ISBN: 0-8247-0536-X
This book is printed on acid-free paper.
Headquarters
Marcel Dekker, Inc.
270 Madison Avenue, New York, NY 10016
tel: 212-696-9000; fax: 212-685-4540
Eastern Hemisphere Distribution
Marcel Dekker AG
Hutgasse 4, Postfach 812, CH-4001 Basel, Switzerland
tel: 41-61-261-8482; fax: 41-61-261-8896
World Wide Web
http://www.dekker.com
The publisher offers discounts on this book when ordered in bulk quantities. For more
information, write to Special Sales/Professional Marketing at the headquarters address
above.
Copyright ? 2001 by Marcel Dekker, Inc. All Rights Reserved.
Neither this book nor any part may be reproduced or transmitted in any form or by any
means, electronic or mechanical, including photocopying, microfilming, and recording,
or by any information storage and retrieval system, without permission in writing from
the publisher.
Current printing (last digit):
10987654321
PRINTED IN THE UNITED STATES OF AMERICA
Preface to the Second Edition
The dairy industry continues to consolidate, with mergers reducing the number
of companies producing dairy products. The number of dairy farms is also de-
creasing, but the remaining farms are larger and the volume of milk they produce
is increasing slowly. The amount and variety of dairy products are also increasing,
and, in fact, new products are regularly introduced into the marketplace.
As the industry continues to evolve, so does dairy microbiology. This sec-
ond edition of Applied Dairy Microbiology reflects that evolution and provides
the reader with the latest available information. There are now 18 chapters, rather
than the 14 found in the first edition. Nearly all chapters that appeared in both
editions have been revised and updated.
Chapter 1, ‘‘Microbiology of the Dairy Animal,’’ contains more informa-
tion on Escherichia coli 0157:H7 and a discussion of bovine spongiform encepha-
lopathy. Chapter 2, ‘‘Raw Milk and Fluid Milk Products,’’ has been rewritten
by new authors and contains much information not found in the first edition.
New bacterial standards for dried milk products appear in Chapter 3, ‘‘Concen-
trated and Dry Milks and Wheys.’’ Chapter 4, ‘‘Frozen Desserts,’’ includes infor-
mation on sherbet, sorbet, and ice cream novelties. Chapter 5, ‘‘Microbiology of
Butter and Related Products,’’ addresses current industrial practices and includes
numerous figures. Chapter 6, ‘‘Starter Cultures and Their Use,’’ discusses isola-
tion and enumeration of lactic acid bacteria.
Chapter 7 of the first edition has evolved into two chapters with new au-
thors: ‘‘Metabolism of Starter Cultures’’ and ‘‘Genetics of Lactic Acid Baceria.’’
iii
iv Preface to the Second Edition
Both chapters deal with their subjects in far greater detail than in the first edition.
Chapter 8 has also been split into two chapters, ‘‘Fermented Milks and Cream’’
(Chapter 9) and ‘‘Probiotics and Prebiotics’’ (Chapter 10).
‘‘Cheese Products,’’ Chapter 11, discusses processed cheese products, and
Chapter 12 covers ‘‘Fermented By-Products.’’ ‘‘Public Health Concerns,’’ Chap-
ter 13, includes information on Creutzfeldt-Jakob disease.
Chapter 14, ‘‘Cleaning and Sanitizing in Milk Production and Processing,’’
is new to this edition of the book. This is followed by ‘‘Control of Microorgan-
isms in Dairy Processing: Dairy Product Safety Systems’’ (Chapter 15). Another
new addition to the book is Chapter 16, ‘‘Regulatory Control of Milk and Milk
Products.’’ Chapter 17, ‘‘Testing Milk and Milk Products,’’ addresses ropy milk
(an old problem that has reappeared) and provides views of a modern dairy testing
laboratory. The final chapter, ‘‘Treatment of Dairy Wastes’’ (Chapter 18) rounds
out the topic.
As was true of the first edition, the present book is intended for use by
advanced undergraduate and graduate students in food/dairy science and food/
dairy microbiology. The book also will be useful to persons in the dairy indus-
try—both those involved in manufacturing products and those doing research.
Furthermore, it should be beneficial to students in veterinary medicine and to
veterinarians whose practice includes dairy animals. Finally, the book will be
helpful to many persons in local, state, and federal regulatory agencies.
Elmer H. Marth
James L. Steele
Preface to the First Edition
Two books on dairy microbiology were published in 1957: Dairy Bacteriology,
4th Edition (B. W. Hammer and F. J. Babel, John Wiley and Sons, New York)
and Dairy Microbiology (E. M. Foster, F. E. Nelson, M. L. Speck, R. N. Doetsch,
and J. C. Olson, Jr., Prentice-Hall, Englewood Cliffs, New Jersey). Since then,
no book on this subject has been published in the United States (although a two-
volume work on dairy microbiology appeared in Europe).
When the two aforementioned books were published, there were numerous
small dairy farms and dairy factories, and they produced a limited number of
products. As time went on, dairy farms evolved into fewer but larger units with
cows that produced more milk than in earlier years. Factories, too, decreased in
number and increased in size and complexity. Furthermore, these factories began
producing a far greater array of products than in the 1950s. All these changes have
had an impact on dairy microbiology as it is currently understood and practiced.
Much of the information in the dairy microbiology books of the 1950s
resulted from research done in dairy industry or closely related departments of
most land grant universities. These departments also trained many of the workers
in the dairy industry. As time went on, when problems occurred in other segments
of the food industry, faculty in dairy industry departments were often consulted.
In some instances, existing faculty responded to the new challenges; in others,
faculty were added to work in various non-dairy segments of the food industry.
Eventually, most dairy industry departments evolved into food science depart-
ments. This led to publication of several books on food microbiology—these
v
vi Preface to the First Edition
books usually contain a chapter or two on dairy microbiology but offer no thor-
ough discussion of the subject.
Although food service departments have replaced most dairy industry de-
partments in land grant universities, research on dairy microbiology has not
stopped. In the 1980s, six centers for dairy research were established at various
U.S. universities—the availability of funds through these centers and through
national and several state promotional organizations served to stimulate research
on dairy foods in general and on dairy microbiology in particular. Industrial re-
search in this field has also expanded, but often the resulting information is propri-
etary.
This book updates and extends information available in earlier texts on
dairy microbiology. In a manner unique to this book, it begins with a discussion
of the microbiology of the milk-producing animal and how this relates to biosyn-
thesis and quality of raw milk. This is followed by a series of chapters dealing
with the microbiology of unfermented (except in a few instances) dairy foods:
raw milk, fluid milk products, dried and concentrated milks and whey, frozen
dairy desserts, and butter and related products. The book then considers fer-
mented dairy foods by devoting two chapters to microorganisms used to manufac-
ture these foods. The first of these describes starter cultures and how they are
used. The second deals with genetics and metabolism of starter bacteria. Fer-
mented dairy foods are discussed in the succeeding two chapters: cultured milks
and creams in one, cheese products in the other. Another unique feature of this
book is the discussion of probiotics in the chapter on cultured milks and creams.
Probiotics refers to the purposeful ingestion of certain bacteria, usually dairy-
related lactic acid bacteria, to improve the health and well-being of humans. Use
of various microorganisms to produce valuable products through fermentation of
whey, the principal by-product of the dairy industry, concludes this part of the
book.
During the last four decades of the twentieth century there have been major
and minor outbreaks of foodborne illness associated with dairy foods. Some of
the outbreaks have been salmonellosis (nonfat dried milk, pasteurized milk,
cheese, ice cream), staphylococcal food poisoning (butter, cheese, chocolate
milk), and listeriosis (pasteurized milk, cheese, chocolate milk). In addition,
pathogens responsible for these and other diseases have occasionally been found
in dairy foods that did not cause illness. These developments have prompted
concerns about public health in the food industry in general and the dairy industry
in particular. Consequently, the largest chapter in this book deals with this impor-
tant subject. The next chapter discusses control of pathogenic and spoilage micro-
organisms in processing dairy foods in which the concept of Hazard Analysis
and Critical Control Points (HACCP) is emphasized.
Various microbiological tests are done to ensure the quality and safety of
dairy foods. Sampling and testing are discussed in the penultimate chapter of the
Preface to the First Edition vii
book. Another unique feature of this book is the last chapter which provides
information on treatment of dairy wastes, processes that are microbiological in
nature.
There is some overlap among chapters in this book. For example, Listeria
monocytogenes, Salmonella, psychrotrophic bacteria, lactic acid bacteria, milk
composition, and bacterial standards for milk and some products are mentioned
in more than one chapter. We could have exercised our prerogative as editors
and eliminated the duplication, but we elected not to do so because: (a) many
persons who use this book will not read it from cover to cover but instead will
read one or two chapters of immediate interest and so the information in each
chapter should be as complete as possible, (b) removing repetitive material, in
most instances, would be detrimental to the flow of thought within a chapter and
hence its readability, and (c) repetition enhances the educational value of the
book—it’s been said that the ‘‘three Rs’’ of learning are repetition, repetition,
and repetition.
This book is intended for use by advanced undergraduate and graduate
students in food/dairy science and food/dairy microbiology. It will also be useful
to persons in the dairy industry—both those producing products and those doing
research. In addition, it should be beneficial to students in veterinary medicine
and to veterinarians whose practice includes dairy animals. Finally, the book will
be helpful to many persons in local, state, and federal regulatory agencies.
Elmer H. Marth
James L. Steele
Contents
Preface to the Second Edition iii
Preface to the First Edition v
Contributors xi
1. Microbiology of the Dairy Animal 1
Paul J. Weimer
2. Raw Milk and Fluid Milk Products 59
Micaela Chadwick Hayes and Kathryn Boor
3. Concentrated and Dry Milks and Wheys 77
Warren S. Clark, Jr.
4. Frozen Desserts 93
Robert T. Marshall
5. Microbiology of Butter and Related Products 127
Jeffrey L. Kornacki, Russell S. Flowers,
and Robert L. Bradley, Jr.
6. Starter Cultures and Their Use 151
Ashraf N. Hassan and Joseph F. Frank
ix
x Contents
7. Metabolism of Starter Cultures 207
Robert W. Hutkins
8. Genetics of Lactic Acid Bacteria 243
Jeffery R. Broadbent
9. Fermented Milks and Cream 301
Vikram V. Mistry
10. Probiotics and Prebiotics 327
Stanley E. Gilliland
11. Cheese Products 345
Mark E. Johnson
12. Fermented By-Products 385
David R. Henning
13. Public Health Concerns 397
Elliot T. Ryser
14. Cleaning and Sanitizing in Milk Production and Processing 547
Bruce R. Cords, George R. Dychdala, and Francis L. Richter
15. Control of Microorganisms in Dairy Processing:
Dairy Product Safety Systems 587
Robert D. Byrne and J. Russell Bishop
16. Regulatory Control of Milk and Dairy Products 613
William W. Coleman
17. Testing of Milk and Milk Products 645
Charles H. White
18. Treatment of Dairy Wastes 681
W. L. Wendorff
Index 705
Contributors
J. Russell Bishop Center for Dairy Research, University of Wisconsin–
Madison, Madison, Wisconsin
Kathryn Boor Department of Food Science, Cornell University, Ithaca, New
York
Robert L. Bradley, Jr. Department of Food Science, University of Wisconsin–
Madison, Madison, Wisconsin
Jeffery R. Broadbent Department of Nutrition and Food Sciences, Utah State
University, Logan, Utah
Robert D. Byrne National Milk Producers Federation, Arlington, Virginia
Warren S. Clark, Jr. American Dairy Products Institute, Chicago, Illinois
William W. Coleman Dairy Consultant and former Director of the Dairy and
Livestock Division of the Minnesota Department of Agriculture, St. Paul, Minne-
sota
Bruce R. Cords Environment, Food Safety, and Public Health, Ecolab, Inc.,
St. Paul, Minnesota
xi
xii Contributors
George R. Dychdala Ecolab Research and Development Center, Ecolab, Inc.,
St. Paul, Minnesota
Russell S. Flowers Silliker Laboratories Group, Inc., Homewood, Illinois
Joseph F. Frank Department of Food Science and Technology, The University
of Georgia, Athens, Georgia
Stanley E. Gilliland Department of Animal Science and Food and Agricultural
Products Center, Oklahoma State University, Stillwater, Oklahoma
Ashraf N. Hassan Department of Dairy Science, Minia University, Minia,
Egypt
Micaela Chadwick Hayes Department of Food Science, Cornell University,
Ithaca, New York
David R. Henning Dairy Science Department, South Dakota State University,
Brookings, South Dakota
Robert W. Hutkins Department of Food Science and Technology, University
of Nebraska, Lincoln, Nebraska
Mark E. Johnson Center for Dairy Research, University of Wisconsin–
Madison, Madison, Wisconsin
Jeffrey L. Kornacki* Silliker Laboratories Group, Inc., Homewood, Illinois
Robert T. Marshall Department of Food Science, University of Missouri, Co-
lumbia, Missouri
Vikram V. Mistry Dairy Science Department, South Dakota State University,
Brookings, South Dakota
Francis L. Richter Ecolab, Inc., St. Paul, Minnesota
Elliot T. Ryser Department of Food Science and Human Nutrition, Michigan
State University, East Lansing, Michigan
* Present affiliation: Center for Food Safety, The University of Georgia, Griffin, Georgia.
Contributors xiii
Paul J. Weimer U.S. Dairy Forage Research Center, Agricultural Research
Service, U.S. Department of Agriculture, and Department of Bacteriology, Uni-
versity of Wisconsin–Madison, Madison, Wisconsin
W. L. Wendorff Department of Food Science, University of Wisconsin–
Madison, Madison, Wisconsin
Charles H. White Department of Food Science and Technology, Mississippi
State University, Mississippi State, Mississippi
1
Microbiology of the Dairy Animal
Paul J. Weimer
U.S. Department of Agriculture and University of Wisconsin–Madison
Madison, Wisconsin
I. INTRODUCTION
Domestication of ruminant animals and their use to produce milk, meat, wool,
and hides represents one of the cornerstone achievements in the history of ag-
riculture. The essential feature of the ruminant animal that has fostered its
utility as a dairy animal is the presence of a large pregastric chamber where
microbial digestion of feed (particularly fibrous feeds not directly digesti-
ble by humans) provides various fermentation products that serve as precur-
sors for efficient and voluminous synthesis of milk. Without this symbiosis
between animal and microbe, the dairy industry would not have developed,
and indeed human culture would be vastly different in its food-gathering
methods.
The dairy animal is a host to a wide variety of microorganisms. Most of
these are microbes in the digestive tract that are essential for fermentative diges-
tion of the animal’s feed. However, a number of other bacteria, fungi, and viruses
can induce a pathogenic state in various organ systems resulting in fatal or nonfa-
tal diseases. This chapter will focus first upon the microbiology of digestion by
the normal flora and its occasional alteration by opportunistic microbes. This will
be followed by a brief overview of the major infectious diseases and their effects
on the animal and on the quantity and quality of milk produced. Most of the
information presented has been obtained from research with cows, but much of
it applies to sheep and goats as well.
1
2 Weimer
II. THE DAIRY ANIMAL
A. Populations and Production
There are nearly three billion domestic ruminants in the world, the most numerous
and economically important of which are cattle, sheep, goats, and buffalo (Table
1). Lactating dairy cattle (not including replacement heifers and dry cows) repre-
sent nearly one-fifth of the world’s domestic cattle population and provide most
of the world’s milk supply. The numbers of sheep and goats actually used for milk
production are difficult to estimate, but these species are of major importance in
providing protein and energy to the human populations of developing countries
and fill niche markets for specialty foods in developed countries. Both sheep and
goats are regarded as superior to cattle in poor-quality grazing and browsing
environments, in part because of more efficient retention of water and nitrogen
(Devendra and Coop, 1982). Several other ruminant animal species (water buf-
falo, yak, camel, reindeer, and even the nonruminant horse) normally used in
some cultures as sources of meat, hides, hair, or draft power are also milked for
human consumption.
Because of their large size and abundant milk production, the Holstein is
the predominant breed of dairy cow in use today. Improvements in animal breed-
ing and genetics have yielded substantially larger animals over the years (Fig.
1) with corresponding increases in feed intake. This factor, combined with a
gradual shift to diets having higher energy contents (i.e., higher proportions of
grain) has resulted in a progressive increase in average milk production per cow,
which in well-bred and well-managed herds may approach 13,600 kg (approxi-
mately 30,000 lb) per lactation.
Dairy cows are usually maintained on a 305-day lactation schedule, after
which the cow is ‘‘dried’’ (by reducing feed and by not milking) for 2 months
before calving to permit full development of the calf and to allow the buildup
of body reserves necessary for the next lactation. After calving, milk production
Table 1 Worldwide Population of Domestic
Ruminants and Worldwide Milk Production, 1998
a
Population Milk production
Species (10
6
head) (10
6
metric tons)
Cattle 1318
Dairy cattle 230 466.3
Sheep 1061 8.2
Goats 700 12.2
Buffalo 162 57.4
a
Source: Food and Agricultural Organization, 1999.
Microbiology of the Dairy Animal 3
Figure 1 The gradual increase in annual milk production in the United States (Panel
A) has been accomplished with a declining number of cows having an increasing average
milk production (Panel B).
4 Weimer
steadily increases over a 6- to 8-week period and then slowly decreases for the
rest of the lactation. Normally, the cow is bred again at 11–12 weeks after calv-
ing, and delivers her next calf some 40 weeks later. Thus, the cow is pregnant
for the bulk of her lactation.
B. Organization of the Digestive Tract
The rumen is the first of the four preintestinal digestive chambers in ruminant
animals and is physically proximate to the second chamber, the reticulum (Fig.
2). Because of their location and their similar function, the physiology and micro-
biology of the rumen and reticulum are usually considered together. At birth, the
ruminant is essentially a monogastric animal having a functional abomasum that
digests a liquid diet (colostrum and milk) high in protein (Van Soest, 1994). As
solids and fiber are gradually introduced into the diet, the other three preintestinal
chambers develop over a period of approximately 7 weeks. The rumen is a large
organ (approximately 10 L in sheep and goats but up to 150 L in high-producing
dairy cows) that together with the reticulum constitute about 85% of the stomach
capacity and contains digesta having 10–12% of the animal’s weight (Bryant,
1970). In the rumen, microbial fermentation converts feed components into a
mixture of volatile fatty acids (VFAs)—acetate, propionate, and butyrate (For
the sake of brevity, these and other organic acids will be referred to in this chapter
as their anionic forms, although they are normally metabolized and transported
across the cell membrane in their protonated (uncharged) form. An exception is
made in the discussion of lactic acidosis (see IV.D.1), where the acid itself is
Figure 2 Schematic representation of the arrangement of the four preintestinal digestive
chambers in the ruminant and illustrating the dominant size of the rumen.
Microbiology of the Dairy Animal 5
responsible for the pathological condition.)—that are absorbed through the rumen
wall for use by the animal as sources of energy and biosynthetic precursors.
Thus, the ruminant animal cannot directly use carbohydrates for energy, and it
is absolutely dependent upon its microflora to, in effect, predigest its food.
By virtue of its large size, the rumen has the function of slowing down the
rate of passage of feed through the organ, which permits microbial digestion of
essentially all of the nonstructural carbohydrate of the feed (starches and sugars)
as well as over half of the more recalcitrant feed fiber (cellulose and hemicellu-
loses) (Van Soest, 1994). Rumen contents, which contain 6–18% dry matter,
are mixed by strong muscular movement and are periodically returned via the
esophagus to the mouth for additional chewing (rumination). Despite this, the
solids have a tendency to stratify, with some maintaining a suspension in the
rumen liquor, some settling to the bottom of the rumen, and some being borne
up by gas bubbles to form a floating mat at the liquid surface. Passage rates vary
with intake, with the rates for solids averaging about twice of that for liquids.
From several published experiments, mean retention times for the rumen liquid
range from 8 to 24 h, whereas that of the particulate phase range from 14 to 52
h (Broderick et al., 1991). The consequence of these long retention times for
solids is that ruminant animals can use fibrous feeds (forages and certain agricul-
tural byproducts) that are not usable by humans and other monogastric animals,
with the ultimate conversion of these feedstuffs to useful products.
In addition to VFAs, other products of the fermentation include microbial
cells and fermentation gases. The microbial cells eventually pass through the
omasum and into the abomasum (the acidic ‘‘true stomach’’), where the microbial
cell protein is hydrolyzed to amino acids that are available for subsequent intesti-
nal absorption. This microbial protein is a major contributor to the protein re-
quirements of the animal, and it acts to counterbalance somewhat the considerable
loss of feed protein that occurs as a result of microbial proteolysis and amino
acid fermentation that occurs in the rumen (see Sec. IV.C.5).
Fermentation gases include primarily carbon dioxide (50–70%) and meth-
ane (30–40%). Rates of gas production immediately after a meal can exceed 30
L/h, and a typical cow may release 500 L of methane per day (Wolin, 1990).
Although some gas is absorbed across the rumen wall and carried by the blood
to the lungs for exhalation, most is eructated through the mouth.
III. MILK
A. Milk Composition
In the United States, milk has a strict legal definition: ‘‘the lacteal secretion,
practically free of colostrum, obtained by complete milking of one or more
healthy cows’’ (Office of the Federal Register, 1995). Parallel definitions are
6 Weimer
provided for milk from goats and sheep (United States Public Health Service,
1993). Because of the central role of milk in the food supply and its ease of
microbial contamination, production and processing of milk used for consump-
tion is subject to tight regulation in most developed countries. In the United
States, most milk is regulated according to the Grade A Pasteurized Milk Ordi-
nance (United States Public Health Service, 1993), a document that sets the stan-
dards for all aspects of milk production and processing. From a microbiological
standpoint, the Pasteurized Milk Ordinance is important primarily in its setting
the standards for acceptable numbers of viable microorganisms in milk before
and after pasteurization. The ordinance sets limits for microbial counts in raw
milk for pasteurization at 1 H11003 10
5
/mL for milk from an individual producer and
3 H11003 10
5
/mL for commingled milk from multiple producers. The ordinance also
establishes the permissible levels of antibiotic residues in milk, which affects the
selection and implementation of antibiotic therapies to control infectious diseases
in dairy animals.
In addition to the direct contamination of milk with pathogens, many micro-
organisms that are themselves not pathogenic can be responsible for altering the
composition of milk after its synthesis. One example of a deleterious effect on
milk is provided by mycotoxins. These compounds are secondary metabolites of
fungi that can produce various toxic effects which can range from acute poisoning
to carcinogenesis. The most widely known mycotoxins are the aflatoxins, which
are produced by Aspergillus flavus, A. parasiticus, and A. nomius. Numerous
structurally distinct aflatoxins have been identified (Fig. 3). The most notorious
of these is aflatoxin B
1
, one of the most potent carcinogens known. Milk and dairy
products may be contaminated by mycotoxins either directly (by contamination of
milk or other dairy products with fungi followed by their growth) or indirectly
(by contamination of animal feed with subsequent passage of the mycotoxin to
milk) (van Egmond, 1989). In either event, contamination is largely dependent
upon environmental conditions that determine the ability of the fungi to grow
and produce toxins.
Two of the more potent aflatoxins, B
1
and B
2
, can be converted in the rumen
to their respective 4-hydroxy derivatives, the somewhat less carcinogenic M
1
and
M
2
(see Fig. 3). The extent of this conversion varies greatly among cows. For
example, Patterson et al. (1980) reported that the M
1
concentration in the milk
of six cows fed approximately 10 μg aflatoxin B
1
/kg feed varied from 0.01 to
0.33 μg/L milk; on average H110112.2% of the ingested B
1
was converted to M
1
.
Applebaum et al. (1982) administered B
1
ruminally to 10 cows at higher doses
(425–770 mg B
1
/kg feed) and detected higher amounts of B
1
in milk (1.1–10.6
μgM
1
/L). Feeding of, or ruminal dosing with, high concentrations of B
1
have
significantly reduced feed intake and milk yield (Mertens, 1979). The effect is
more powerful with impure B
1
than pure B
1
; suggesting the synergistic effects
of other mycotoxins present in the impure preparation. Several other researchers
have noted substantial differences in M
1
concentration among cows at similar or
Microbiology of the Dairy Animal 7
Figure 3 Bioconversion of aflatoxins B
1
and B
2
to M
1
and M
2
, respectively.
different stages of milk production and milk yield and between milkings of the
same cow (Kiermeier et al., 1977; Lafont et al., 1980).
B. Milk Biosynthesis
In evaluating the microbial role in providing the animal with milk precursors, it
is useful briefly to describe the biosynthesis of milk. A more detailed treatment
of the process is provided by Bondi (1983).
Although the mammary gland comprises only 5–7% of the dairy cow’s
body weight, it represents perhaps the animal’s highest concentration of meta-
bolic activity. Careful breeding and advances in nutrition over the years have
resulted in the annual production of milk nutrients from a single cow sufficient
to provide the nutrients required by 50 calves.
Milk is produced in secretory cells clustered in groups known as alveoli.
These cells feed milk through an arborescent duct system that collects milk into
the udder. Production of milk is strongly controlled by endocrine hormones. Fol-
lowing parturition, the cells secrete antibody-rich colostrum for several days until
8 Weimer
milk secretion begins. Continued production of milk is stimulated by suckling
or by milking through the stimulation of several hormones, particularly prolactin.
Nutrients for milk synthesis are provided to the udder through the blood
via a pair of major arteries. The ability of the mammary gland to capture milk
precursors effectively from the arterial blood supply—expressed as a ‘‘per cent
extraction’’ calculated from the difference of precursor concentrations in arterial
and venous blood—is truly impressive (Table 2) when one considers the rapid
flow of arterial blood through the udder, which in dairy cows can approach 20
L/min. Production of 1 L of milk requires approximately 500 L of arterial blood
flow through the udder.
Milk ispredominantly (80–87%)water. The majorcomponents ofmilk solids
are lactose, protein, and fats. The composition of milk varies with feeding regimens,
individual animals, and breed. Marked differences are also noted among different
ruminant species as well, with sheep’s milk having substantially greater content of
protein and fat than the milk of cows or goats (Table 3). Much of the energy re-
quired for biosynthesis of milk in the udder is produced by oxidation of glucose
(30–50%) or acetate (20–30%). In the ruminant animal, glucose is not derived
directly from dietary carbohydrate, but is instead produced by gluconeogenic path-
ways, primarily using propionate, a major product of the ruminal fermentation.
Lactose, a disaccharide of D-glucose and D-galactose linked by an α-1,4-
glycosidic bond, is synthesized by a series of reactions using D-glucose as the
starting substrate. Approximately 60% of the glucose consumed in the mammary
gland is used for lactose synthesis. Lactose concentration in milk is relatively
invariant with diet and stage of lactation, although its concentration declines sub-
stantially in mastitic cows (see Sec. VI.A).
Table 2 Arterial Concentrations of Milk Precursors
and the Efficiency of Their Extraction in the Udder
of Goats
Arterial Extraction
concentration efficiency
Precursor (mg/L) (%)
Blood:
O
2
119 45
Glucose 445 33
Acetate 89 63
Lactate 67 30
Plasma:
3-Hydroxybutyrate 58 57
Triglycerides 219 40
Source: Bondi, 1983.
Microbiology of the Dairy Animal 9
Table 3 Mean Composition of Milk from
Domestic Ruminants
% by weight in milk
Component cow goat sheep
Fat 3.5 4.5 7.4
Protein 2.9 2.9 5.5
Lactose 4.9 4.1 4.8
Ca 0.12 0.13 0.20
P 0.10 0.11 0.16
Source: Bondi, 1983.
Milkfat is a heterogeneous combination of triglycerides with very few
(H110212%) phospholipid or sterols. Triglycerides are composed of glycerol esterified
to three molecules of fatty acids having 4–20 carbon atoms (almost exclusively
even numbered). In all mammalian species, the fatty acids are derived in part from
circulatory lipoproteins produced from dietary or body fat. These lipoproteins are
hydrolyzed at the endothelial capillary wall and are subsequently recombined to
produce milk triglycerides. In ruminant animals, almost half of the fatty acids
are synthesized from acetate produced in the ruminal fermentation and from 3-
hydroxybutyrate produced in the rumen wall from butyrate, another ruminal fer-
mentation product. Milkfat content is subject to variations in diet; because milkfat
is an important determinant of selling price, diets which depress milkfat yield are
avoided even if they provide good milk yields. The Pasteurized Milk Ordinance
stipulates that whole milk in its final packaged form for beverage use shall contain
H113508.25% ‘‘milk solids not fat’’ and H113503.25% fat (United States Public Health
Service, 1993).
Protein in milk is predominantly (82–86%) casein with smaller amounts
of globulins. Milk proteins are synthesized from amino acids extracted from the
arterial blood supply. These amino acids, in turn, are derived from several
sources: synthesis by the animal, dietary protein that escapes the rumen, and
microbial protein produced in the rumen and hydrolyzed to amino acids and pep-
tides by passage through the abomasum (see Sec. IV.C.5).
IV. MICROBIOLOGY OF THE RUMEN
A. Methods
Rumen microbiology is of historical importance in that the rumen was the first
anaerobic habitat whose microbiology was systematically investigated. Many of
the techniques for study of strictly anaerobic microbes were developed in these
10 Weimer
research programs, beginning with the pioneering studies of the research groups
of Robert Hungate and Marvin Bryant in the 1940s. In fact, despite the difficulties
inherent in studying a habitat of limited accessibility and the requirements for
experimental work under strictly anaerobic conditions, the rumen has come to
be regarded as one of the best-understood of all microbial habitats.
Most studies of ruminal microbes have been conducted in batch culture,
usually at fairly high substrate concentrations. This growth mode has been useful
for examining the products and kinetics of digestion by mixed ruminal microflora
(so-called in vitro digestion experiments); for isolating and characterizing pure
cultures; and for examining interactions among microorganisms at different tro-
phic levels (e.g., interspecies H
2
transfer reactions; see Sec. IV.C.4). Studies have
also been carried out in continuous culture in which substrates are fed either
continuously or at defined (e.g., hourly) intervals. This mode of growth is more
useful for some types of studies, because under proper conditions it can simulate
the feeding schedule of the animal.
One type of continuous culture, the chemostat, has been widely used in
growth studies. In this mode of culture, one substrate in the feed medium is
present at a concentration that limits microbial growth. Feeding of the culture
vessel at different volumetric flow rates results in the achievement of a steady
state in which the rate of microbial growth is equal to the dilution rate [that is,
(volumetric flow rate)/(working volume of the culture vessel)]. The chemostat
allows the experimenter to examine the microbial response to growth at subopti-
mal rates; an important consideration because microbes in nature normally grow
at rates well below their maxima (Slater 1988). Appropriate fitting of data to
theoretically derived equations permits determination of fundamental growth pa-
rameters such as affinity constants, true growth yields, and maintenance coeffi-
cients (see Sec. IV.C.5.b). Until recently, chemostat studies were limited to using
soluble substrates, but several new configurations have permitted growth in a
continuous mode on insoluble substrates such as cellulose (Kistner and Kornelius,
1990; Weimer et al., 1991). Culture systems have also been constructed that allow
differential flow rates for solids and liquids, further approximating the conditions
in the rumen (Hoover et al., 1983). However, no laboratory culture method can
fully simulate the complexities of digestion within the rumen itself, because in
vivo digestion involves not only microbial activity but also rumination and masti-
cation, salivary secretions, and recycling of some nutrients.
B. The Ruminal Environment
Much of our understanding of the physiology and microbiology of the rumen
has come from in vitro studies of rumen contents. Early studies with rumen con-
tents used samples recovered from animals at the slaughterhouse, but the microbi-
ology of the rumen under such conditions does not represent that of the living
Microbiology of the Dairy Animal 11
ruminant owing to the practice of withholding food from the animal for at least
24 h before slaughter. More realistic studies of rumen microbiology were facili-
tated by development of procedures to sample the rumen via a stomach tube
or a surgically implanted fistula (Fig. 4). The latter allows recovery of a more
representative grab sample containing both solids and liquor, and it provides a
port for periodic insertion or removal of test materials (e.g., feedstuffs placed in
nylon-mesh bags) for measurement of digestion in situ.
Ruminal studies have revealed that the physical and chemical conditions
within the rumen are fairly constant. Rumen temperature remains within a few
degrees of 39°C as a result of heat production by both animal tissues and the
microflora of the digestive tract. Despite the continuous influx of O
2
into the
rumen through swallowing of feed and water and through diffusion from the
bloodstream via the capillaries feeding the gut epithelial cells, the rumen remains
highly anaerobic, with O
2
concentrations ranging from 0.25 to 3.0 μM (Ellis et
al., 1989). Maintenance of these low concentrations of oxygen appears to result
from the combined effects of facultative anaerobes and strict anaerobes (protozoa
and bacteria). The strict anaerobes can apparently consume substantial amounts
of O
2
in reactions involving H
2
oxidation as long as concentrations of O
2
remain
below 7 μM (Ellis et al., 1989). The rumen is not only anaerobic but also highly
reducing, with an oxidation-reduction potential near H11002400 mV.
Figure 4 A researcher removing a sample of digesta from a ruminally fistulated cow.
12 Weimer
Ruminal pH varies within the range of approximately 5–7 because of op-
posing forces of microbial fermentation to produce acids on the one hand and
their absorptive removal on the other (Table 4). Buffering is provided by the
secretion of bicarbonate-rich saliva, which in high-producing dairy cows may
approximate 150 L/day (Church, 1988). Normally, pH is highest immediately
before feeding; pH values below 5 are usually associated with certain undesirable
conditions (e.g., lactic acidosis; see Sect. V.E.1).
Total concentrations of ruminal VFAs and their molar proportions vary
with diet, but total VFAs are generally near 100 mM, with the molar proportions
of acetate, propionate, and butyrate approximately 68, 20, and 10%, respectively
(Mackie and Bryant, 1994); small amounts of isobutyrate, isovalerate, valerate,
and caproate are also usually present.
C. The Ruminal Microbial Population
The microbial population in the rumen includes numerous species of bacteria,
protozoa, and fungi. There appear to be few differences among cattle, goats, and
sheep with regard to either the digestibility of feeds or the species of microbes
inhabiting the rumen (Baumgardt et al., 1964; Jones et al., 1972). In terms of
sheer numbers of cells, the bacteria far outstrip the eukaryotes, but the latter
group—because of their large cell size—contribute considerably to ruminal mi-
crobial biomass.
1. Bacteria
More than 200 different bacterial species have been isolated from rumen contents
and their properties determined, but only about 24 species are thought to be of
Table 4 Factors Controlling Ruminal pH
Factor Determinants and remarks
pH of feed Near neutrality for fresh herbage, hay and grains
Acid (pH H11021 5) for silages
Acid production Diet composition (maximum rate and extent of digestion)
Feeding schedule (pH highest just before feeding)
Microbial populations (species composition and fermentation
pathways)
Acid absorption across Fermentation product ratios (VFAs absorbed faster than lac-
ruminal wall tate)
Salivation Amount of saliva
Buffer capacity of saliva (concentrations of bicarbonate and
phosphate)
Microbiology of the Dairy Animal 13
major importance in ruminal metabolism (Table 5). Like any natural environ-
ment, the rumen probably contains many other species that have to now resisted
isolation. Moreover, the recent use of phylogenetic criteria (i.e., sequences of
evolutionarily conserved macromolecules such as 16S ribosomal RNAs) in taxon-
omy has altered microbiologists’ concepts of what constitutes a microbial species.
As a result, new species will continue to be described, although the major func-
tional groups of bacteria have probably been identified. The bacterial population
can carry out essentially all of the enzymatic reactions that occur in the rumen
with regard to digestion of feed materials, and bacteria are probably the main
agents of ruminal digestion of carbohydrate and protein in feed. The pathways
for conversion of carbohydrate (the ruminant’s major energy source) to different
fermentation endproducts are shown in Figure 5.
Total populations of bacteria in the rumen are hard to measure with accu-
racy, because a large fraction (perhaps up to 70%) of the cells are attached to
solid surfaces [mostly to feed particles (Hobson and Wallace, 1982; Costerton
et al., 1987), but to a certain degree to the rumen wall as well (Mead and Jones,
1981)]. Thus, bacterial cell counts of 10
7
–10
9
cells/mL, normally determined by
counting unattached cells under the microscope or by plating onto nonselective
culture media, must be regarded as considerable underestimates of the total popu-
lation. The same must be said for the many studies on quantitating individual
species or physiological groups by traditional culture methods. Recent use of
nucleotide probes directed toward 16S rRNAs of specific phylogenetic units (e.g.,
kingdom, species, or strain) has shown great promise for in situ studies of ruminal
microbial ecology (Stahl et al., 1988), and it has been applied successfully to in
vitro studies of ruminal contents (Krause and Russell, 1996) and defined cocul-
tures of ruminal bacteria (Odenyo et al., 1994).
In general, ruminal bacteria are adapted to grow within a fairly nar-
row range of environmental conditions, which is hardly surprising given the
relative constancy of environmental conditions in the rumen. Ruminal bacteria
are mesophilic but are highly stenothermal (i.e., they grow within a narrow
temperature range). Most have growth optima near the mean ruminal temper-
ature of 39°C, and many exhibit poor or no growth at room temperature. Most
ruminal bacteria also have some requirements for vitamins and amino acids
that are present in low concentrations in the ruminal liquor (Bryant, 1970).
Many species also require branched-chain VFAs for growth (Dehority, 1971).
Because environmental conditions are fairly constant and organic growth
substrates are continuously available, few ruminal bacteria have developed
the capability to form resistant morphological forms, such as cysts or spores.
In fact, although various endospore-forming Clostridium species have been
isolated from the rumen, they are rarely abundant, and in some instances may
simply be transients that have little involvement in ruminal metabolism (Varel
et al. 1995).
14
Weimer
Table 5 Physiological Properties of Ruminal Bacteria
Nutritional type Gram Substrates utilized
a
Products formed
b
Additional characteristics
Fibrolytic
Butyrivibrio fibrisolvens H11002
d
C, Cd, Xn, Xd, P For, But, Ac, Lac, EtOH,
CO
2
Clostridium spp.
c
H11001 C, G
2
, Hx For, Ac, But, CO
2
Form endospores
Fibrobacter succinogenes H11002 C, Cd Suc, Ac, For
Lachnospira multiparus H11002 P, G
2
For, Ac, EtOH, Lac, H
2
,
CO
2
Ruminococcus albus H11001 C, Cd, Xn, Xd Ac, EtOH, H
2
, For, CO
2
Ruminococcus flavefaciens H11001 C, Cd, Xn, Xd, P Ac, Suc, H
2
, For, CO
2
Succinivibrio dextrinosolvens H11002 P, Hx Suc, Ac, For
Starch and sugar digesters
Actinobacillus succinogenes H11001 Hx, G
2
, F, Mt, X, A Succ, Ac, Pyr, EtOH Facultative anaerobe
Eubacterium ruminantium H11001 Hx, G
2
, F, MeOH, P, Xd For, Ac, But, Lac
Megasphaera elsdenii H11002 S, Mt, Sc, Gol, Pep For, Ac, Pro, But, H
2
,CO
2
Converts Lac → Pro
Prevotella ruminicola H11002 S, Cd, Hx, Xd, L, F, P, For, Ac, Pro, Suc
Prot
Pseudobutyrvibrio fibrisolvens H11002
d
G
2
, Hx, F, X For, But, Lac, CO
2
Ruminobacter amylophilus H11002 S, Mt Suc, For, Ac Hydrolyzes pectin
Selenomonas ruminantium H11002
d
S, Cd, Hx, X, A, Gol, P, Pro, Ac, But, For, Suc, Lac, A major agent of Suc →
Prot, Xd, Suc H
2
Pro and Lac → Pro
Streptococcus bovis H11001 S, G
2
, Hx, Prot Lac, EtOH, Form, Ac, CO
2
Hydrolyzes pectin
Succinomonas amylolytica H11002 S, G, Mt Suc, Ac, Pro, H
2
Treponema bryantii H11002 Hx, X, A, G
2
, L, Mt For, Ac, Suc
Proteolytic/amino acid fer-
menting
Clostridium aminophilum H11001 Pep, AA Ac, But, BCVFAs, NH
3
,
CO
2
Microbiology
of
the
Dairy
Animal
15
Clostridium sticklandii H11001 Pep, AA Ac, But, BCVFAs, NH3,
CO
2
Peptostreptococcus anaero- H11001 Pep, AA Ac, But, BCVFAs, NH3,
bius CO
2
Hydrogen consumers
Acetitomaculum ruminis H11001 H
2
H11001 CO
2
, Hx Ac Probably not an important
H
2
consumer in the rumen
Desulfovibrio ruminis H11002 H
2
H11001 SO
4
H11005
, EtOH, Lac H
2
S; Ac H11001 H
2
Produces H
2
from EtOH
and Lac in presence of
methanogens
Methanobrevibacter bryantii H11001 H
2
H11001 CO
2
CH4 Autotrophic
Methanosarcina barkeri H11001 H
2
H11001 CO
2
, MeOH CH4 Autotrophic, methylotrophic
Wolinella succinogenes H11002 fumarate H11001 H
2
, formate, or Suc Can also reduce inorganic
H
2
S nitro compounds (e.g.,
NO
3
H11002
)
Other nutritional specialists
Acidaminococcus fermentans H11002
d
Glu, Cit, TAA Ac, But, H
2
Detoxifies TAA
Anaerovibrio lipolytica H11002 TG, Gol, F, Rib Pro, Ac, But, Suc, H
2
,CO
2
Oxalobacter formigenes H11002 Oxalate For, CO
2
Detoxifies oxalate
Succiniclasticum ruminis H11002 Suc Pro, CO
2
Synergistes jonesii H11001 Arg, His, DHP Ac, Pro, H
2
Detoxifies mimosine
Veillonella parvula
e
H11002
d
Lac, Gol Ac, Pro, H
2
,CO
2
a
AA, amino acids; Arg, arginine; Cd, cellodextrins (except where indicated, glucose also fermented); DHP, 2,3- and 3,4-dihydroxypyridinediols; EtOH,
ethanol; F, fructose; For, formate; G, glucose; G
2
, cellobiose; Glu, glutamate; Gol, glycerol; His, histidine; Hx, most common hexose sugars; L, lactose;
Lac, lactate; MeOH, methanol; P, pectin; Pep, peptides; Prot, protein; TG, triglycerides; X, xylose; Xd, xylodextrins; Xn, xylan.
b
Ac, acetate; BCVFAs, branch-chain volatile fatty acids (isobutyrate, isovalerate, 2-methylbutyrate); But, butyrate; EtOH, ethanol; For, formate; Lac, lactate;
Pro, propionate; Suc, succinate.
c
Includes C. cellobioparum, C. chartatabidium, C. lochheadii, C. longisporum, C. polysaccharolyticum. A few of these species also produce ethanol.
d
Stain gram negative but phylogenetically related to gram positive eubacteria.
e
Abundant in ovine rumen but not bovine rumen.
16
Weimer
Figure 5 Generalized pathway of carbohydrate fermentations in the rumen. Fermentation products in dark bor-
dered boxes are maintained in substantial concentrations in the normal rumen. Fermentation products in light
bordered boxes are produced and excreted by some organisms but do not accumulate under normal conditions.
Abbreviations: [2H], pairs of reducing equivalents; ADP and ATP, adenosine di- or triphosphate; GDP and GTP.
guanosine di- and triphosphate; PEP, phosphoenolpyruvate; AcCoA, acetyl coenzyme A. Reactions coded by a
circled letter are restricted to a few species, as follows: A, fibrolytic or amylolytic microbes; B, lactate utilizers,
particularly Selenomonas ruminantium and Megasphaera elsdenii;C,Butyrivibio fibrisolvens;D,Ruminococcus
albus, S. ruminantium, Streptococcus bovis; E, homoacetogenic bacteria (e.g., Acetitomaculum ruminis); F, sulfate-
reducing bacteria; G, methanogenic archaea; H, S. ruminantium and Succiniclasticum ruminis.
Microbiology of the Dairy Animal 17
2. Protozoa
Because of their large size (100 μm or more in length), protozoa are readily
observed microscopically and thus were first described in 1843. Many species of
ruminal protozoa have been identified, primarily based on morphological criteria
(Hungate, 1966). These can be classified into flagellates and ciliates. Flagellates
dominate the ruminal protozoan population of young animals, but they are gradu-
ally displaced by the ciliates with aging. The ciliates contain two main groups:
the relatively simple holotrichs (e.g., Isotricha or Dasytricha) or the structurally
more complex oligotrichs (e.g., Entodinium and Diplodinium). The populations
of protozoa in the rumen vary widely, but they are usually in the range of 10
2
–
10
6
/mL. These densities are much lower than those of the bacteria; however,
because of their large size, the protozoa may in fact represent up to half of the
microbial biomass in the rumen (Van Soest, 1994; Jouany and Ushida, 1999).
All of the ruminal protozoa appear to have a strictly fermentative metabo-
lism. Relative to the bacteria, much less is known regarding the physiology and
biochemistry of the protozoa for two reasons. First, the protozoa are rather diffi-
cult to cultivate in the laboratory (Coleman et al. 1963); ruminal protozoa gener-
ally die within hours of transferring mixed rumen microflora into most laboratory
culture environments. Second, many protozoa in a variety of habitats contain
intracellular or surface-attached bacterial symbionts that engage in syntrophic
interactions with their hosts (Fenchel et al., 1977; Vogels et al., 1980). Thus, even
when ‘‘pure’’ cultures of protozoa (i.e., single protozoal species in the absence of
free-living bacteria) are established and maintained, it is difficult to evaluate the
potential contribution of the associated bacteria to the metabolic activities of the
protozoa. Some continuous culture systems have successfully maintained proto-
zoa by including a floating-mat matrix that allows the protozoa to resist washout
from the vessel at fluid dilution rates similar to those operating in the rumen
(Abe and Kurihara, 1984), and it is likely that ruminal protozoa associate in vivo
with the ruminal mat or the ruminal wall in a similar manner. Populations of
different protozoal species vary among individual animals and within the same
animal fed different diets (Faichney et al., 1997).
Because their relatively large size permits microscopic identification of spe-
cies and behavioral examination, much of our knowledge of these organisms has
come from study of samples withdrawn directly from the rumen itself, particu-
larly for comparisons of faunated animals (i.e., those having a natural protozoal
population) and defaunated animals (i.e., those whose protozoal populations have
been nearly or completely removed, usually by treatment with chemical agents
such as 1,2-dimethyl-5-nitroimidazole or dioctyl sodium sulfosuccinate).
The holotrichs appear to be adapted to growth purely on soluble carbohy-
drates. On the other hand, microscopic observations have revealed that the entodi-
niomorphs can engulf plant particles or can attach to the cut ends of plant fiber and
18 Weimer
can obtain their nutrition from engulfed starches and apparently some structural
polysaccharides as well. Despite the observed associations of protozoa and partic-
ulate feeds, it is widely held that the primary ecological role of the entodinio-
morph protozoa is the grazing of bacteria (Clarke, 1977; Hobson and Wallace,
1982). Using phase-contrast microscopy, these protozoa can be observed rapidly
to ingest free bacteria (i.e., those not attached to plant fiber), and bacterial cell
concentrations are approximately 10-fold higher in rumen samples from defau-
nated than faunated animals. Numerous studies (reviewed by Hobson and Wal-
lace, 1982) have thus far not identified any specific predatory relationships be-
tween particular species of protozoa and bacteria. Protozoal grazing of bacteria
can reduce the availability of microbial protein to ruminants, which is a notion
reflected by lower weight gain in faunated than in defaunated cattle and lambs
when tests were conducted with protein-deficient diets—an effect that disappears
at higher levels of feed protein. On the other hand, protozoa do appear to provide
some benefits to the ruminal microflora (Jouany and Ushida, 1999). By engulfing
starch granules and fermenting them more slowly than do bacteria, and by
converting lactic acid to the weaker propionic acid, protozoa can help attenuate
acidosis and thereby maintain fibrolytic activity of pH-sensitive cellulolytic bac-
teria.
Protozoa are not the only agents that control bacterial numbers; the rumen
maintains substantial populations of bacteriophages (viruses that infect bacteria).
Characterization of phage DNAs from rumen contents by pulsed-field electropho-
resis (Swain et al., 1996) has revealed that individual animals harbor their own
unique populations of phages. Regardless of these differences among host ani-
mals, phage populations (as measured by total phage DNA) follow diurnal popu-
lation cycles related to the populations of the bacterial hosts, with minima and
maxima at approximately 2 h and 10–12 h postfeeding, respectively.
3. Fungi
Orpin (1975) demonstrated that several microorganisms originally thought to be
flagellated protozoa were actually the zoospore stage of anaerobic fungi. These
fungi alternate between a freely motile zoospore stage and a particle-associated
thallus. Fungal populations in rumen contents range from 10
4
to 10
5
thallus-form-
ing units per gram of ruminal fluid (Theodorou et al., 1990). Approximately 24
species of these fungi have now been identified on the basis of morphology and
16S rRNA sequences (Trinci et al., 1994). Much of our understanding of the
metabolic capabilities of the ruminal fungi has been derived from a single species,
Neocallimastix frontalis.
Ruminal fungi are strictly anaerobic and have a catabolism based on fer-
mentation of carbohydrate. All described species can digest cellulose and/or
hemicelluloses via extracellular enzymes that are produced in low titer but have
very high specific activities (Wood et al., 1986). The major products of carbohy-
Microbiology of the Dairy Animal 19
drate fermentation are acetate, formate, and H
2
with lesser amounts of lactate
(primarily the D isomer), CO
2
, and traces of succinate (Borneman et al., 1989).
H
2
production occurs via hydrogenosomes, which are intracellular organelles con-
taining high levels of the enzyme hydrogenase. In pure culture, the amounts of
soluble and gaseous fermentation products essentially equal the amount of carbo-
hydrate consumed (Borneman et al., 1989); suggesting that the yield of fungal
mycelia is very small. This notion is in accord with direct measurements that
indicate the ruminal fungi contribute little to the total microbial biomass in the
rumen (Faichney et al., 1997). However, the ruminal fungi appear to have specific
roles not readily duplicated by bacteria. For example, there is considerable evi-
dence that fungi can attach to and physically disrupt plant tissue (particularly the
more recalcitrant tissues such as sclerenchyma and vascular bundles) during
growth by penetration through cell walls and expansion into the pit fields between
cells (Akin et al., 1989). This physical disruption is thought to make the plant
material more easily broken apart during rumination and thus more available to
bacteria, which are more efficient at digesting the individual plant cell compo-
nents such as cellulose. Fungal populations are highest in animals fed diets high
in fibrous stem materials; perhaps because of the latter’s long ruminal retention
time that coincides with the slow growth rate of the fungi.
D. Microbial Fermentations in the Rumen
1. Structural Carbohydrates
Plant cell walls (the fibrous component of most forages) are composed primarily
of cellulose, hemicellulose, pectin, and lignin. These polymers are differentially
localized into the different layers of the cell wall (Fig. 6). The architecture of
the plant cell wall varies greatly with cell type (Harris, 1990). Some cell types
such as mesophyll and collenchyma are thin walled and essentially unlignified,
and thus are easily digested. Other cell types such as sclerenchyma and xylem
tracheary elements display more complex architectures with clearly distinct struc-
tures. Groups of these cell types are separated from one another by a middle
lamella, which is a highly lignified region that is also rich in pectin. Interior to
the middle lamella is the primary wall, the region where wall growth initiates;
it is composed primarily of xyloglucans and other hemicelluloses as well as
various wall-associated proteins. The secondary wall is laid down later in de-
velopment and is very thick in mature plants. This region, which contains mostly
cellulose with smaller amounts of hemicelluloses and lignin, can be further
differentiated into layers (S1, S2, S3) based on the orientation of the cellulose
microfibrils.
a. Cellulose Cellulose is the major component of forage fiber, comprising
35–50% of dry weight. Individual cellulose molecules are linear polymers of β-
1,4-linked D-glucose molecules. These chainlike molecules are assembled via
20 Weimer
Figure 6 Schematic cross-sectional view of the cell wall of two plant cell types. Abbre-
viations: ML, middle lamella; PW, primary wall; SW, secondary wall; L, lumen, which
in the living cell contains the cytoplasm but is replaced with ruminal fluid during ruminal
digestion. (Left panel) Mesophyll cell, characterized by a thin, essentially unlignified pri-
mary cell wall that is digested rapidly from both the outer and inner (luminal) surface. The
middle lamella is thin and unlignified, and is usually separated from the middle lamellae of
adjacent cells by air spaces. (Right panel) Sclerenchyma cell, characterized by a thin pri-
mary wall and thick, secondary walls consisting primarily of cellulose but also containing
moderate amounts of hemicelluloses and lignin. Adjacent cells are separated by middle
lamellae having a high lignin content. As a result, sclerenchyma cell walls are digested
only from the luminal surface outward, and at a relatively slow rate and incomplete extent.
extensive intrachain and interchain hydrogen bonds to form crystalline microfi-
brils that in turn are bundled into larger cellulose fibers. The packing of cellulose
chains within the microfibrils is so tight that even water cannot penetrate. Cellu-
lose fibers thus have a fairly low ratio of exposed surface to volume. Ruminal
cellulose digestion appears to follow first-order kinetics with respect to cellulose
concentration (i.e., the rate of cellulose digestion is limited by the availability of
cellulose rather than by any inherent property of the cellulolytic microbes them-
selves [Waldo et al., 1972; Van Soest, 1973]).
Although many species of bacteria, fungi, and protozoa have been reported
to digest cellulose in vitro, only three species of bacteria—Fibrobacter (formerly
Bacteroides) succinogenes, Ruminococcus flavefaciens, and R. albus—are
thought to be of major importance in cellulose digestion in the rumen (Dehority,
1993). In pure culture, these three species digest crystalline cellulose as a first-
order process with rate constants of 0.05–0.10 h
H110021
higher than those of any cellu-
lolytic microbes that grow at a similar temperature in nonruminal habitats
(Weimer, 1996). These relatively rapid rates of cellulose digestion derive in part
from the ability of these species to attach directly to the cellulosic substrate (Fig.
7) and digest the cellulose via cell-bound enzymes; this adherence appears to be
a prerequisite to rapid cellulose digestion (Latham et al., 1978; Costerton et al.,
1987; Kudo et al., 1987). The cell-associated cellulolytic enzymes are apparently
organized into supramolecular complexes resembling the cellulosome, an organ-
Microbiology of the Dairy Animal 21
Figure 7 Stereo-optic view of the adherence of the ruminal cellulolytic bacterium Fi-
brobacter succinogenes onto a particle of cellulose. Proper focusing of the eyes or use
of a stereo-optic viewer permits a three-dimensional view of the subject. Bar represents
10 μm.
elle that has been well-characterized in the nonruminal thermophilic bacterium
Clostridium thermocellum (Felix and Ljungdahl, 1993). Although cellulose di-
gestion in the rumen is more rapid than in nonruminal environments, the process
is slow relative to the digestion of nonstructural carbohydrates and proteins. Be-
cause of this, forages, with their high rumen fill and slow digestion, must be
supplemented with more rapidly digested cereal grains to adequately balance
energy and protein requirements for high-producing dairy animals (Van Soest,
1994).
The products of cellulose hydrolysis are cellodextrins (short water-soluble
β-1,4-glucosides of two to eight glucose units) that are subject to fermentation
by both cellulolytic and noncelluloytic species (Russell, 1985). Although the indi-
vidual cellulolytic species can compete directly for cellulose in vitro, it appears
that they show differential ability to adhere to different plant cell types (Latham
et al., 1978) that may indicate separate but overlapping niches in the rumen.
Moreover, it appears that degradation of some plant cell types is delayed by the
slow diffusion on nonmotile fibrolytic bacteria into the plant cell lumen (Wilson
22 Weimer
and Mertens, 1995). These cell types may provide a niche for motile cellulolytic
species such as Butyrivibrio fibrisolvens.
The three major cellulolytic species form different fermentation endprod-
ucts (Hungate, 1966). F. succinogenes produces primarily succinate (an important
precursor of propionate) with lesser amounts of acetate. R. flavefaciens produces
the same acids but with acetate predominating. R. albus produces primarily ace-
tate and ethanol in pure culture, but in the rumen it produces mostly acetate
and H
2
.
Estimation of the relative population sizes of individual cellulolytic species
based on both classic determinative schemes (van Gylswyk, 1970) and probes
to 16S rRNA (Weimer et al. 1999) suggest that R. albus is the most abundant of
the three species, but variations in these populations appear to be more substantial
among animals than within individual animals fed widely different diets (Fig. 8).
Unlike other ruminal bacteria, the ratio of fermentation endproducts formed by
each of the predominant cellulolytic species changes little with growth conditions
(pH or growth rate). It would thus seem that the relative populations of these
three species might contribute to differences in the proportions of acetate and
propionate in the rumen. However, because the three species typically comprise
less than 4% of the bacterial population in the rumen, their direct contribution
to VFA proportions is probably modest.
b. Hemicelluloses Hemicelluloses, a diffuse class of structural carbohy-
drates that may contain any of a number of monomeric units, can comprise up
to one-third of plant cell wall material (Stephen, 1983). Most hemicelluloses
contain a main backbone, usually having β-1,4-glycosyl or β-1,3-glycosyl link-
ages; various types and degrees of branching from the main chain are frequently
observed. Because of the multiplicity of hemicellulose structures present in each
plant species, it is extremely difficult to isolate pure substrates of known structure,
which is a fact that has severely limited the laboratory study of hemicellulose
digestion. Among the most abundant of the hemicelluloses are the xylans (un-
branched β-1,4–linked polymers of xylose) and the arabinoxylans (xylans con-
taining pendant arabinose side chains). The latter are particularly important,
because they are thought to be covalently linked to lignin via cinnamic acid deriv-
atives such as ferulic acid and p-coumaric acid (Hatfield, 1993).
Hemicelluloses are hydrolyzed by enzymes that may be extracellular or
cell-associated depending on the species (Hespell and Whitehead, 1990). The
most active hemicellulose digesters among the ruminal bacterial isolates include
B. fibrisolvens and the cellulolytic species R. flavefaciens, R. albus, and F. succi-
nogenes; the latter can hydrolyze hemicelluloses in vitro but cannot use the hy-
drolytic products for growth (Dehority, 1973).
c. Pectic Materials Pectins are polymers of galacturonic acids, some of
which also contain substantial amounts of neutral sugars (e.g., arabinose, rham-
nose, and galactose). Pectins are more abundant in leaf tissue than in stems, and
Microbiology of the Dairy Animal 23
Figure 8 Relative populations of the cellulolytic bacteria Ruminococcus albus, Rumino-
coccus flavefaciens, and Fibrobacter succinogenes and their sums in the rumens of four
cows fed the same four diets. Diets were based on alfalfa silage (AS) or corn silage (CS)
at two different levels of fiber (24 or 32% neutral detergent fiber, analyzed after α-amylase
treatment). Results are expressed as a fraction of the total bacterial RNA, determined using
oligonucleotide probes on samples collected 3 h after feeding. Note differences in the
scale of the ordinates. (From Weimer et al., 1999; used by permission of the American
Dairy Science Association.)
they are also major components of some byproduct feeds (citrus pulp and fruit
processing waste). Although purified pectins from forages are fairly water solu-
ble, they can be considered to be structural carbohydrates, because they are local-
ized in the plant cell wall, particularly in the middle lamellae between cells.
In many respects, pectins are an ideal substrate for ruminal fermentation.
They are rapidly digested out of both alfalfa leaves and stems (rate constants of
H110110.3 h
H110021
), but unlike starch, pectins do not yield lactic acid as a fermentation
24 Weimer
product (Hatfield and Weimer, 1995). The acetate/propionate ratio resulting from
fermentation of pectins is in the range of 6–12, which is well above those of
most substrates and useful in maintaining milkfat levels in lactating dairy cows.
Production of these acids is accompanied by consumption of the galacturonic
acid moeities of the pectin, thus assisting in the maintenance of ruminal pH.
Several bacterial species have been shown actively to degrade pectin, including
Lachnospira multipara, B. fibrisolvens, Prevotella (formerly Bacteroides) rumi-
nicola, some strains of the genus Ruminococcus. (Gradel and Dehority, 1972),
and some spirochetes (Ziolecki, 1979).
d. Lignin Lignin, the third major component of the forage cell wall, is
a polymer of phenylpropanoid units assembled by a random free radical conden-
sation mechanism during cell wall biosynthesis. Lignin is indigestible under an-
aerobic conditions and constitutes the bulk of the indigestible material leaving
the digestive tract. Moreover, the covalent linkages between lignin (or phenolic
acids) and hemicelluloses reduce the digestibility of these forage components
(Hatfield, 1993). Electron microscopic studies clearly reveal the recalcitrance of
lignified tissues to ruminal digestion (Akin, 1979).
2. Nonstructural Carbohydrates
Nonstructural carbohydrates are those carbohydrates in plant cells that are con-
tained in the cytoplasm or in storage vacuoles. The most abundant of these are
the starches (the linear amylose and the branched amylopectin), which are major
components of cereal grains (e.g., corn) that comprise much of the diet of high-
producing dairy cows.
a. Starch Starches are depolymerized fairly rapidly by extracellular en-
zymes (amylases and pullulanases) that produce maltodextrins (α-1,4-oligomers
of glucose), which are easily converted by other α-glucosidases to glucose and
maltose—substrates utilizable by almost all of the carbohydrate-fermenting mi-
crobes in the rumen (Hungate, 1966). Consequently, starches have the potential
to be completely digestible, although the form of the starch is an important deter-
minant of the rate of digestion. Wheat and barley starch are digested more rapidly
than is that of high-moisture corn, which in turn is digested more rapidly than
are those of dried corn or dried sorghum. The more rapidly digesting starches
have first-order rate constants of digestion of H110110.25 h
H110021
or above.
Several bacterial species are important in starch digestion, including Rumi-
nobacter (formerly Bacteroides) amylophilus, B. fibrisolvens, P. ruminicola, Suc-
cinomonas amylolytica, Succinivibrio dextrinosolvens, and Streptococcus bovis.
The latter species can grow extremely rapidly, particularly on glucose (minimum
doubling time is 13 min), and it is the causative agent of lactic acidosis (see Sec.
V.D.1). As noted above, some protozoa actively engulf starch granules but do
Microbiology of the Dairy Animal 25
not appear to produce lactate, thus sequestering these granules from serving as
substrates for bacterial lactate production.
Even though diets high in grain content are usually preferred for high-
producing cows because of their greater energy density, the presence of an ade-
quate level of fiber in the diet is important for several reasons (Van Soest, 1994).
Fiber promotes the long-term health of the ruminant animal by providing a mod-
est rate of carbohydrate digestion and by stimulating rumination and salivation,
all of which aid in maintaining ruminal pH within a range desirable for balanced
microbial activity. Moreover, fiber in the diet helps the animal avoid milkfat
depression, a syndrome resulting primarily from a relative deficiency in acetic
acid (a precursor of short chain fatty acids in milk triglycerides) and a relative
excess of propionate, which inhibits mobilization of body fat (a precursor of long
chain fatty acids in milk triglycerides).
b. Soluble Sugars and Oligomers Many ruminal carbohydrate-fermenting
bacteria can utilize most of the different monosaccharides that comprise the vari-
ous plant polysaccharides (Hungate, 1966): D-glucose, D-xylose, D-galactose,
L-arabinose, and D- or L-rhamnose. Many can also use at least some oligosac-
charides that are released from the plant cytoplasm by cell wall breakage or that
are produced by enzymatic hydrolysis of plant polysaccharides. The latter in-
clude cellodextrins (Russell, 1985) and xylooligosaccharides (Cotta, 1993) hav-
ing seven or fewer glycosyl residues. Concentrations of soluble sugars and their
oligomers are maintained at very low levels in the rumen; indicating that biopoly-
mer hydrolysis is the rate-limiting step in digestion and that competition for solu-
ble carbohydrates is probably an important determinant of species composition
in the rumen (Russell and Baldwin, 1979a).
In the few cases that have been systematically examined, sugar fermenters
have shown dramatic changes in fermentation product ratios with changes in
growth rate. Both S. bovis (Russell and Hino, 1985) and Selenomonas rumi-
nantium (Melville et al., 1988) carry out mixed acid fermentations at low growth
rates but nearly homolactic fermentations at growth rates near their maxima.
3. Conversion of Fermentation Intermediate Compounds
to Volatile Fatty Acids
Microbial fermentation of both structural and nonstructural polysaccharides pro-
duces a mixture of VFAs (usually acetic with some butyric) and other fermenta-
tion acids (succinic, lactic, and formic) that are further metabolized by other
ruminal microbes. Most of these bacteria require additional growth factors such
as amino acids, peptides, and vitamins. Succinate is decarboxylated to propionate
(see Fig. 5) by several ruminal species, including the metabolically versatile Sele-
nomonas ruminantium and the metabolically specialized Succiniclasticum rum-
inis (van Gylswyk, 1995). Lactate is converted to propionate by several bacterial
26 Weimer
species, particularly S. ruminantium, Megasphaera elsdenii, Veillonella parvula,
Anaerovibrio lipolytica, and some Propionibacterium spp. (Mackie and Heath,
1979). Formate is produced in abundance in the rumen both from carbohydrate
fermentation and from reduction of carbon dioxide. Formate is rapidly turned
over to methane and rarely accumulates (Hungate et al., 1970).
4. H
2
Consumption and Interspecies Hydrogen Transfer
Anaerobic metabolism requires that electrons (reducing equivalents) generated
from biological oxidations be transferred to terminal electron acceptors other than
oxygen. Most anaerobes that ferment carbohydrates dispose of these electrons
by transfer to one or more organic intermediate compounds in the catabolic path-
way such as pyruvate (producing lactate), acetyl coenzyme A and acetaldehyde
(producing ethanol), and carbon dioxide (producing formate) (see Fig. 5). An
alternative electron acceptor is the protons present in all aqueous environments,
resulting in production of hydrogen gas (H
2
). Disposal of electrons as H
2
is partic-
ularly advantageous in that it does not consume carbon-containing intermediate
compounds that may be used as biosynthetic precursors. However, production
of H
2
is thermodynamically unfavorable unless its production is coupled to its
continuous removal by H
2
-consuming reactions. This spatial and temporal cou-
pling of H
2
production with H
2
use, referred to as interspecies H
2
transfer, is one
of the most important processes in the ecology of anaerobic habitats (Oremland,
1988; Wolin, 1990). Interspecies H
2
transfer benefits both the H
2
consumer, which
directly receives its energy source, and the H
2
consumer, which can channel more
of its substrate into the ATP-yielding production of acetate as a fermentation
endproduct (Table 6).
The dominant H
2
-consuming reaction in the rumen is the reduction of car-
bon dioxide to methane gas:
4H
2
H11001 CO
2
→ CH
4
H11001 2H
2
O (1)
This reaction is carried out by a specialized group of organisms, the methanogens.
These organisms are classified with the Archaea, a phylogenetically distinct
group that represents an early evolutionary lineage distinct from both eubacteria
(true bacteria) and eukaryotes (Woese and Olsen 1986). Methanogens are highly
specialized metabolically. Most are restricted in their catabolism to reduction of
carbon dioxide to methane, using H
2
as an electron donor, whereas a few have
the ability to convert one or more simple organic compounds (methanol, methyl-
amine, formate, or acetate) to methane (Oremland, 1988). Methanol may be peri-
odically available in the rumen from deesterification of pectins. Formate, al-
though not a major ruminal fermentation product, is probably produced by carbon
dioxide reduction in amounts sufficient to contribute slightly to ruminal methano-
genesis. Acetate, although abundant in the rumen, does not support growth of
Microbiology of the Dairy Animal 27
Table 6 Fermentation Products from
Cellulose in Ruminococcus albus Monocultures
and R. albus/Methanobreveibacter smithii
Cocultures Illustrating Changes Caused by
Interspecies Transfer of H
2
to the Methanogen
mmol/100 mmol Glucose
equivalents consumed
a
R. albus H11001
Product R. albus alone M. smithii
Ethanol 81 22
Formate 14 0
Acetate 89 151
CO
2
156 98
H
2
140 0
CH
4
075
b
a
Mean values from continuous culture trials conducted
at five different dilution rates.
b
Equivalent to 300 mmol H
2
consumed (at a stoichiome-
try of 4 mol H
2
consumed per mol CH
4
formed).
Source: Pavlostathis et al., 1990.
‘‘aceticlastic’’ methanogens, whose growth rates even under ideal conditions are
well below dilution rates of both liquids and solids in the rumen. Most methano-
gens are also autotrophs; that is, they can obtain all of their cell carbon from
carbon dioxide. Thus, they can produce microbial protein for the ruminant host
without consumption of otherwise useful organic matter.
The energy associated with the reduction of the abundant ruminal carbon
dioxide to methane is sufficient to permit both growth of the methanogens and
thermodynamic displacement or ‘‘pulling’’ of the reduction of protons to H
2
.As
a result, the concentration of H
2
in ruminal fluid is very low—normally near 1
μM with only occasional excursions to approximately 20 μM for a few minutes
postfeeding (Smolenski and Robinson, 1988). Thus, ruminal methanogenesis,
which is viewed unfavorably by nutritionists as a loss of H110118% of the metaboliz-
able energy of the feed, in fact has an important thermodynamic function that
permits an adequate rate and extent of carbohydrate fermentation.
Representatives of another group of bacteria, the carbon dioxide–reducing
homoacetogens, have been isolated from the rumen and appear to be present at
low cell densities. Like the methanogens, these eubacteria can reduce carbon
dioxide with H
2
, but according to the stoichiometry
4H
2
H11001 2CO
2
→ CH
3
COOH H11001 2H
2
O (2)
28 Weimer
The homoacetogens have attracted interest as potential competitors of the metha-
nogens in that they could, in principle, remove fermentatively produced H
2
while
at the same time producing acetic acid, an energy source and biosynthetic precur-
sor that the ruminant is well equipped to use (Mackie and Bryant, 1994). Unfortu-
nately, numerous in vitro studies have shown that the acetogens are ineffective
competitors of the methanogens because of the latter’s superior affinity for low
concentrations of H
2
. The actual role of the acetogens in the rumen is presently
unclear; because this metabolically diverse group is capable of sugar fermentation
and removal of methoxyl groups from some feed constituents, its members may
fill several niches.
A third group of H
2
utilizers, the sulfate-reducing bacteria, can couple the
oxidation of H
2
or certain organic compounds such as lactate to reduction of
sulfate (Odom and Singleton, 1993):
4H
2
H11001 2H
H11001
H11001 SO
4
H11005
→ H
2
S H11001 4H
2
O (3)
Sulfate-reducing bacteria have an affinity for H
2
that even surpasses that of the
methanogens; indeed, sulfate reduction is the dominant means of disposal of ex-
cess electrons in a sulfate-rich environment (e.g., ocean sediments). Sulfate-
reducing bacteria have the unusual capacity to act as H
2
consumers when sulfate
is abundant or as H
2
producers (from lactate) when sulfate is absent (Bryant et
al., 1977). In the latter situation, the sulfate reducers may be maintained in the
rumen by a symbiotic interaction with methanogens wherein the sulfate reducers
oxidize lactate to H
2
, whose concentration is kept low by methanogenic activity.
5. Nitrogen Metabolism in the Rumen
a. Protein Degradation Availability of protein to the ruminant is deter-
mined by the amount of protein in the feed, its loss in the rumen from microbial
fermentation, and the efficiency of microbial protein synthesis that occurs in the
rumen. It is estimated that approximately 35–80% of the protein of most forages
and grains is degraded by ruminal fermentation and is thus not directly available
for intestinal absorption (National Research Council, 1985). Hydrolysis of protein
depends on several factors—particularly solubility, which determines both its
availability to ruminal microbes and its rate of escape from the rumen. The gener-
alized scheme of protein degradation (see Fig. 9) suggests some similarities to
polysaccharide degradations. Proteins are hydrolyzed extracellularly or at the mi-
crobial cell surface to produce soluble oligomers that serve as the actual growth
substrates. Major proteolytic species in the rumen are B. fibrisolvens, S. bovis,
and P. ruminicola. These species also have important roles in carbohydrate fer-
mentation.
The fermentation of amino acids and peptides released from protein hydro-
lysis is carried out by a number of ruminal species. The most active appear to
Microbiology of the Dairy Animal 29
Figure 9 Generalized scheme of protein degradation in the rumen. Both bacteria and
protozoa participate in the process. α-Keto acids may be used intracellularly as anabolic
intermediate compounds, or decarboxylated to VFAs, which are then exported.
be Clostridium aminophilum, C. sticklandii, and Peptostreptococcus anaerobius.
Classic proteolytic species such as P. ruminicola appear to be important in protein
hydrolysis (Wallace et al., 1999), but they are probably less important in amino
acid fermentations, as their rates of ammonia production from amino acids in
vitro are one or two orders of magnitude lower. Both C. sticklandii and P. anaero-
bius are monensin-sensitive, which may explain the protein-sparing effect ob-
served on inclusion of monensin in ruminant diets (Krause and Russell, 1995).
Because the concentrations of peptides and free amino acids in the rumen are very
low, competition for these substrates among both proteolytic and nonproteolytic
microbes is probably intense.
b. Protein Synthesis Whereas the ruminal microflora is responsible for
this extensive loss of feed protein, they also contribute up to half of the nitrogen
requirements of the animal through synthesis of microbial cell protein, which is
hydrolyzed in the abomasum and is subsequently available to the animal (?rskov,
1982). Protein synthesis by ruminal bacteria occurs primarily from ammonia and
organic acids. Indeed, most ruminal bacteria will grow in vitro on ammonia as
the sole nitrogen source, and many species cannot incorporate significant amounts
of amino acids or peptides. Ruminal ammonia is supplied either as a direct prod-
uct of the ruminal degradation of feed proteins or from urea recycled back into
30 Weimer
the rumen by the animal. The organic acids used for protein synthesis are derived
from both protein and carbohydrate fermentation. Availability of these organic
acids is important for adequate carbohydrate nutrition. For example, the predomi-
nant ruminal cellulolytic bacteria require isobutyrate, isovalerate, and 2-methyl-
butyrate as precursors for intracellular synthesis of the branched chain amino
acids valine, leucine, and isoleucine, respectively (Bryant, 1970). This provides
an excellent example of both the interactions among different physiological
groups of ruminal bacteria and the interaction between energy and protein metab-
olism in ruminant nutrition.
Because of their impact on production of microbial protein, quantitative
aspects of microbial cell yield have received considerable attention. The effi-
ciency of microbial growth (growth yield) varies among species and with growth
conditions. Important determinants of growth yield include (a) efficiency of en-
ergy conservation (ATP production per unit substrate consumed), (b) ability to
import and incorporate preformed organic compounds (e.g., amino acids) into cell
material, (c) maintenance energy (the amount of energy that must be expended to
maintain cellular constituents and function), and (d) extent to which cells carry
out other non–growth-related functions such as polysaccharide storage or waste-
ful ‘‘energy spilling’’ (Russell and Cook, 1995). A microbe’s growth rate also
has an impact on cell yield. At low growth rates, yields are depressed somewhat,
because a larger portion of the total energy expenditure is devoted to mainte-
nance.
Carbohydrate-fermenting ruminal bacteria have true growth yields (cell
yields not corrected for maintenance) within the range of 0.1–0.6 g cells/g carbo-
hydrate; in some instances, these yields may be artificially high if the organisms
synthesize storage polysaccharides (Table 7). Cell yields of ruminal bacteria
decline when the pH of the environment decreases below 6 (Russell and Dom-
browski, 1980). Nevertheless, the growth yields of ruminal bacteria are generally
higher than those of anaerobic bacteria native to other anaerobic environments
(Hespell, 1979).
Microbial growth yield is affected by growth rate–induced metabolic shifts
that alter the ATP yield. For example, increased growth rate on sugars in some
species is accompanied by a shift in fermentation products from acetate to lactate
and a reduced ATP yield (because conversion of pyruvate to acetate results in
formation of one unit of ATP, whereas the conversion of pyruvate to lactate does
not) (see Fig. 5). In this instance, the organisms have increased growth rate by
selecting a pathway with an inherently high substrate flux (rate of substrate con-
sumed per unit time) at the sacrifice of some ATP yield. By contrast, interspecies
H
2
transfer reactions increase the ATP yield of the H
2
producers by allowing
more of the organic substrate to be converted to acetate and less to other com-
pounds (e.g., ethanol or lactate) (Wolin, 1990).
Microbiology of the Dairy Animal 31
Table 7 Growth Yields and Maintenance Coefficients for Several Species of
Ruminal Bacteria Grown in Continuous Culture
Bacterium Substrate Yg
a
m
b
Reference
Butyrvibrio fibrisolvens Glucose 0.40 0.049 Russell and Baldwin, 1979b
Megasphaera elsdenii Glucose 0.46 0.187 ″
Prevotella ruminicola Glucose 0.50 0.135 ″
Selenomonas ruminantium Glucose 0.58 0.022 ″
Streptococcus bovis Glucose 0.40 0.150 ″
Fibrobacter succinogenes Cellulose 0.24 0.05 Weimer, 1993
Ruminococcus albus Cellulose 0.11 0.10 Pavlostathis et al., 1988
Cellobiose 0.28 0.04 Thurston et al., 1993
Ruminococcus flavefaciens Cellulose 0.24 0.07 Weimer et al., 1991
a
True growth yield (g cells/g substrate consumed) calculated in the absence of maintenance.
b
Maintenance coefficient (g substrate consumed/g cells/h).
E. Microbial Contributions to Rumen Dysfunction
Under some conditions, the normal ruminal microflora contribute through their
activities to certain metabolic diseases (i.e., diseases that are neither infectious
nor degenerative and that are preventable by proper feeding and management).
1. Lactic Acidosis
Lactic acidosis is an acute acidification of the rumen resulting from the microbial
overproduction of lactic acid (Owens et al., 1998). The condition is often acute
in feedlot-finished beef cattle, but subclinical acidosis is also common in high-
producing dairy cows (Ostergaard and Sorensen, 1998; Owens et al., 1998). fed
diets high in grains, particularly following a switch from diets higher in fiber
content. These concentrates are rich in starches and have a relatively poor buf-
fering capacity. The starches are fermented rapidly to lactic acid, primarily by S.
bovis, a normal rumen inhabitant. At near-neutral pH, S. bovis produces primarily
formic and acetic acids and only small amounts of lactic acid, but during rapid
growth carries out a homolactic fermentation producing the D-isomer. The explo-
sive growth of S. bovis outpaces the activities of ruminal lactate consumers (e.g.,
S. ruminantium, M. elsdenii, as well as some protozoa). As a result, lactic acid
levels may increase from normal values of under 1 mM, to reach 20–300 mM.
Because the acidity of lactic acid is 10-fold greater (pK
a
H11005 3.8) than for the
VFAs—acetic, propionic, and butyric acids—(pK
a
H11005 4.7–4.8), ruminal pH may
drop to 4.5 or below. At high lactic acid concentrations, blood and body tissues
32 Weimer
attempt to restore proper osmolality to the rumen, leading to a systemic dehydra-
tion that may be fatal.
Once acidosis has begun, several factors conspire further to exacerbate the
problem (Russell and Hino, 1985). When pH has declined sufficiently, S. bovis
maintains its homolactic metabolism even as its growth rate decreases. Reduced
pH also inhibits degradation of lactate by S. ruminantium and M. elsdenii and
establishes a ruminal niche for other homolactic fermenters such as the faculta-
tively anaerobic lactobacilli.
Even in nonfatal cases, animal health is severely affected. D-lactic acid is
absorbed into the bloodstream where it is metabolized more slowly than is the
L-isomer. As a result, blood pH decreases and pathologies of other tissues become
important (ulceration of the ruminal wall, liver abscess, and foot disorders)
(Nocek, 1997; Owens et al., 1998). Low ruminal pH also negatively affects milk
production and live weight gain, fiber digestion is inhibited, and feed intake is
reduced (Van Soest, 1994).
2. Foamy Bloat
Foamy (or frothy) bloat is an acute condition resulting from formation of a rigid,
persistent foam mat at the ruminal liquor surface that prevents normal eructive
release of fermentation gases (Clarke and Reid, 1974). It is particularly common
in pastured dairy cattle grazing certain lush feeds, especially some legumes (clo-
vers and alfalfa). Gas accumulation results in substantial distension of the reticu-
lorumen. In severe cases, this distension can interfere with respiratory function
and produce death within an hour of feeding unless strong remedial action (i.e.,
puncture of the ruminal wall) is taken. Even in cases of mild bloat, dairy produc-
tion and animal weight gain may be affected substantially because of reduced
feed intake.
Plant factors that have been suggested as contributing to induction of bloat
include (a) a high content of certain constituents that may contribute to the struc-
ture of the foam mat (soluble proteins, pectin, saponins, or certain classes of
lipids) and (b) a high rate of fermentation (usually related to high concentration
of soluble sugars and an easily digested cell wall). The amount and characteristics
of the plant protein appear to be particularly important. Forages containing high
levels of condensed tannins (e.g., birdsfoot trefoil) do not cause bloat, and feeding
of condensed tannins usually prevents bloat, apparently because of their capacity
to precipitate proteins (Tanner et al., 1995). Animal factors are also involved in
bloating; there is a clear genetic predisposition toward bloat resistance and bloat
sensitivity (Morris et al., 1997). Recent evidence suggests that bloat-resistant
cattle have higher levels of bSP30, a salivary protein of unknown function (Rajan
et al., 1996).
The involvement of microbes in bloat is controversial (Clarke and Reid,
Microbiology of the Dairy Animal 33
1974). Microbes certainly are involved to the extent that the ruminal fermentation
is responsible for production of methane and carbon dioxide gases and the acids
that reduce the ruminal pH and cause release of carbon dioxide from the ruminal
bicarbonate pool. More direct roles of individual species of bacteria and protozoa
have been difficult to establish. However, microbial involvement is suggested by
two lines of evidence: (a) bloat is routinely and effectively inhibited by controlled
release of monensin into the rumen (Cameron and Malmo, 1993) and (b) com-
plete switching of ruminal contents between fistulated cattle having a high or
low susceptibility to bloat results in a change of susceptibility that is maintained
for approximately 24 h before the animal’s natural susceptibility or resistance
reasserts itself (Clarke and Reid, 1974).
3. Polioencephalomalacia
Polioencephalomalacia (PEM), also known as cerebrocortical necrosis, is an
acute toxicosis that causes destruction of tissues of the central nervous system.
It manifests itself in the form of lethargy and sometimes blindness that progress
to muscular tremors and coma, with death following within a few days. PEM
has been attributed to a thiamin deficiency that may result from elevated levels
of thiaminases. More recent data indicate that, in many instances, the condition
results from conversion of ingested sulfates to highly toxic hydrogen sulfide (H
2
S)
by sulfate-reducing bacteria (Gould, 1998) (see Sec. IV.D). Sulfate is not nor-
mally a component of dairy rations, but it can be present in high concentrations
in some groundwaters and surface waters used for watering stock, particularly in
the western United States where the disease was first described and is especially
common.
F. Microbes in the Causation and Mitigation
of Plant Toxicoses
Many wild forages (and a few cultivated ones) contain compounds that have the
potential to poison ruminants (James et al., 1988). In some instances, the toxicosis
occurs as a result of microbial conversion of a nontoxic plant constituent to a
toxic form. Alternatively, microbes may be involved in detoxifying a poisonous
agent in the ingested plant. Specific microoganisms have been identified in three
different toxicoses: grass tetany, oxalate poisoning, and mimosine poisoning.
1. Grass Tetany
Grass tetany is a type of hypomagnesemia observed in ruminant animals grazing
lush pastures, most commonly during periods of cool, cloudy weather in the
spring and autumn. Several clinical forms of the disease have been reported (Lit-
tledike et al., 1983). Symptoms of the most common type include nervous and
34 Weimer
Figure 10 Ruminal metabolism of trans-aconitate, a common component of some for-
ages that is thought to be involved in eliciting grass tetany. The reduced intermediate
tricarballylic acid can chelate Mg and is a potent inhibitor of the enzymatic conversion of
the tricarboxylic acid cycle intermediate cis-aconitate. Some ruminal bacteria can degrade
tricarbyllate to acetate, but only slowly. (From Russell and Forsberg, 1986.)
excited behavior followed within hours or days by strong convulsions that may
lead to coma and death. Several causes of magnesium deficiency have been put
forward, including inhibition of Mg uptake by K and formation of MgNH
4
PO
4
precipitates. Alternative, more feasible explanations revolve around trans-aconi-
tate (TAA) (Russell and Forsberg, 1986). This compound, an isomer of the tricar-
boxylic acid cycle intermediate cis-aconitate, represents up to 7% of the dry
weight of some grasses. Although it is itself a potent chelator of Mg
2H11001
in vitro,
TAA is also reduced by some ruminal microbes (particularly S. ruminantium)to
tricarballylate. This compound is readily absorbed into the bloodstream and acts
as both a strong chelator of Mg
2H11001
and as a structural analog of citrate that inhibits
the enzymatic conversion of citrate to isocitrate, a key reaction sequence of the
oxidative tricarboxylic acid (TCA) cycle (Fig. 10). At least one ruminal bacte-
rium, Acidaminococcus fermentans, can detoxify TAA by stoichimetric conver-
sion to acetate (Cook et al., 1994).
2. Oxalate Poisoning
Oxalate is widely distributed in plants and in some wild forages (e.g., halogeton)
and may comprise several percentage of dry weight. Because oxalate is a potent
chelator of calcium (and to a lesser extent magnesium), ingestion of these forages
can cause hypocalcemia. Oxalate can be metabolized by a dismutation reaction
HOOC-COOH → HCOOH H11001 CO
2
(4)
Microbiology of the Dairy Animal 35
carried out by Oxalobacter formigenes, a nutritionally specialized gram-negative
bacterium unable to use other substrates as energy sources (Allison et al., 1985).
3. Mimosine Poisoning
Mimosine, a nonprotein amino acid, is present in some tropical forages, particu-
larly the shrub Leucaena leucocephale. In the rumen, the pyrridone group of the
compound is released and metabolized to the toxic goiterogen 3,4-dihydroxypyri-
dine. Resistance to mimosine poisoning is dependent on the ruminal bacterium
Synergistes jonesii (Allison et al., 1992). This species has been found in goats
from Hawaii and Indonesia, and it has been successfully transferred to ruminants
in Australia (Jones and Megarrity, 1986) and the United States (Hammond et al.,
1989) where it also confers resistance to mimosine poisoning. In the latter case,
the bacterium was maintained in the rumen over a winter during which Leucaena
was not fed in the diet of the host cattle; maintenance probably resulted from
the bacterium’s ability to compete successfully with the native microflora for
arginine and a few other amino acids that can serve as growth substrates for this
nutritionally specialized bacterium. S. jonesii is unique among ruminal bacteria
in that it exhibits a specific geographical distribution.
G. Potential for Altering the Ruminal Fermentation
and the Composition of Milk
The ruminal symbiosis has developed over eons in response to selective pressures
on both the animal and the ruminal microflora (Van Soest, 1994). The high levels
of production achieved in the animal industry have come in part by the use of
feeding and management strategies that have placed new challenges on the rumi-
nal microflora (e.g., feeding of starches that induce lactic acidosis). Numerous
proposals have been put forward to ‘‘improve’’ the ruminal fermentation. These
proposals have aimed at one or more objectives: (a) increase the rate and extent
of digestion of fiber, (b) improve nitrogen availability (either by decreasing the
rate and extent of degradation of feed protein or by improving microbial protein
synthesis), (c) redirect the microbial fermentation to enhance the amounts or ra-
tios of products that serve as precursors for milk or meat, and (d) detoxify feed
or forage components. The microbial ecological principles associated with such
proposed alterations have been reviewed by Weimer (1998).
Increasing the rate and extent of fiber digestion is complicated by the nature
of the plant cell wall (see Sec. IV.D.1). Introduction of enhanced fibrolytic capa-
bilities by genetic engineering has been touted as a means to improve fiber diges-
tion (Russell and Wilson, 1988). Under normal conditions, cellulose digestion in
the rumen appears to be limited by cellulose accessibility and not by properties
of the microflora (Waldo et al., 1972; Van Soest, 1973). However, under condi-
tions of low pH most fibrolytic species—particularly the cellulolytics—have lim-
36 Weimer
ited activity. Introduction of fibrolytic activities into acid-tolerant but nonfibro-
lytic species may be a viable route to improve fiber digestion as long as the
introduced organism can maintain itself in the rumen both at low pH (when com-
petition for fiber may be minimal) and at more normal pH (when competition
for fiber would be more intense). A second approach to enhancing the ruminal
digestion of fiber involves improvements in plant breeding to produce plant vari-
eties having cell wall structures of improved digestibility (Buxton and Casler,
1993).
Reducing the ruminal degradation of feed protein can be accomplished by
a variety of means, including chemical (formaldehyde) or physical (heat) treat-
ment or incorporation of tannins into the diet (Broderick et al., 1991). Alternative
means of controlling the microbes—either reducing their proteolytic activity or
increasing microbial growth yield—have shown little promise to this point.
Controlling the ratios of fermentation endproducts is already exploited in
the beef industry through the use of monensin and other ionophores. These com-
pounds are more effective against gram-positive than gram-negative bacteria.
Because these groups contain some of the more notable producers of acetate and
propionate, respectively, treatment with monensin has several effects, including
increasing ruminal propionate and decreasing ruminal acetate and the acetate/
propionate ratio. This effect, along with an increase in intake, lead to improved
gluconeogenesis, feed efficiency, and body weight gain in beef animals (summa-
rized by Goodrich et al., 1984). Effects in heifers have been more equivocal,
although monensin does significantly decrease the age at breeding and at calving
(Meinert et al., 1992). The opposite strategy to shift the fermentation balance
toward acetate production may be useful for dairy animals, as the reduction in
ruminal acetate/propionate ratio that occurs in some diets is associated with an
undesirable reduction in milkfat levels (Shaver et al., 1986; Woodford and Mur-
phy, 1988; Klusmeyer et al., 1990).
There is considerable interest in redirecting ruminal H
2
away from produc-
tion of methane and toward acetate (Mackie and Bryant, 1994). Although this
has not been accomplished practically, recent evidence suggests that yeast may
enhance the competitiveness of acetogenic bacteria for H
2
, although this effect
has to this point only been demonstrated in vitro at H
2
concentrations well above
those found in the rumen (Chaucheyras et al., 1995). Yeasts are an example of a
direct-fed microbial agent (or probiotic, a natural strain of microbe that improves
digestive function). Incorporation of some yeasts and fungi into ruminant diets
improves fiber digestion and milk production (Williams et al., 1991; Wohlt et
al., 1991), although the mechanism remains unclear (Martin and Nisbet, 1992).
Bacteria may also be useful as probiotics. For example, it has been shown recently
that lactic acidosis can be avoided in sheep abruptly switched to a grain diet if
the lactate-utilizing bacteria S. ruminantium and M. elsdenii are fed as a probiotic
(Wiryawan and Brooker, 1995). The use of probiotics in the dairy industry is
Microbiology of the Dairy Animal 37
expanding, although they have not assumed the same status as in the poultry
industry, where bacterial probiotics are widely used to prevent colonization of
young chicks with Salmonella infection.
As discussed (see Sec. IV.F.3), implantation of mimosine-degrading bacte-
ria has been proven to confer resistance of ruminant animals to mimosine toxicity.
Once established in an animal, these bacteria apparently can be readily transferred
to other herd members through normal close contact (Quirk et al., 1988). The
probiotic use of other detoxifying organisms holds promise for more productive
utilization of toxigenic forages in ruminant diets.
Several milkfat components that have been implicated in having the ability
to prevent or reduce the incidence of cancer. Two of these components, butyrate
and conjugated linoleic acid, are produced primarily by ruminal bacteria. Butyrate
is produced by many common ruminal bacteria (see Table 5). It is maintained
at concentrations of several millimolar in the rumen and is efficiently absorbed
across the ruminal wall. Among its various metabolic fates is its incorporation
into milkfat, where it accounts for 7.5–13.0 mol% of the fatty acids (Parodi,
1996). Butyric acid has been demonstrated to have a variety of anticarcinogenic
activities (Parodi, 1996), and its production in the colon of humans on high-fiber
diets has been implicated in reducing colon cancer (McIntyre et al., 1993).
Conjugated linoleic acids (CLAs) are a class of isomers of linoleic acid
having conjugated double bonds. CLAs, of which milk fat is the richest natural
source, have been reported to have anticarcinogenic, antiatherogenic, and immu-
nomodulating activities (reviewed by Parodi, 1996). The most abundant CLA
isomer, cis-9, trans-11-octadecandienoic acid, is produced as an intermediate
compound in the hydrogenation of linoleic acid by the ruminal fibrolytic bacte-
rium B. fibrisolvens (Kepler et al., 1966). This synthetic activity is in accord
with the higher levels of milk CLAs observed in pastured cows whose diets are
particularly rich in fiber (Dhiman et al. 1996; Kelley et al., 1998). It appears that
CLAs can also be produced by the gut microflora of monogastric animals, as
normal rats contain higher amounts of CLAs in their tissues than do germ-free
rats (Chin et al., 1994). The higher levels of the linoleic acid substrate that are
present in the rumen, purportedly due to hydrolysis of the ruminal bacteria them-
selves, are thought to explain the unusually high production of CLAs by ruminant
animals (Chin et al., 1994).
H. Fermentations in the Hindgut
Hindgut fermentations received very little attention until development of intesti-
nal cannulae permitted quantitative studies. It was long assumed that the extent
of digestion that occurs in the hindgut is only a small fraction of that of the total
tract. However, the fraction of total tract digestibility that occurs in the hindgut
varies with several factors, particularly feed intake (Tamminga, 1993). In cattle
38 Weimer
fed at high intakes, up to 37% of the total energy digestion can occur in the cecum
and large intestine (Zinn and Owens, 1981). Digestion in the hindgut should be
of greater importance in high-producing ruminants, which in general have both
high levels of feed intake and ruminal pH values sufficiently low to depress fiber
digestion and some other microbial activities in the rumen. The microbiology of
the hindgut fermentation in ruminants has not been extensively explored, but in
many respects probably resembles that of monogastric animals.
V. INFECTIOUS DISEASES OF DAIRY ANIMALS
Dairy animals are subject to numerous infections by different species of patho-
genic microorganisms. All groups of microbes—bacteria, fungi, viruses, proto-
zoa, and even algae—contain species that are pathogenic to dairy animals. The
diseases caused by these organisms are tremendously costly to the dairy producer.
Even if animals survive infection, the producer can suffer severe economic hard-
ship in treatment costs, lost production of milk or calves, and disposal of infected
milk or milk tainted by antibiotic residues. Quantitative data on the effects of
bacterial infections on milk yield and milk composition are now available for
several infectious diseases.
It is beyond the scope of this text to provide more than a general summary
of the more important diseases and their causative agents. A listing of the more
common bacterial diseases is provided in Table 8. For more detail, the reader is
referred to veterinary texts, particularly the recent two-volume treatise of Coetzer
et al. (1994).
A. Mastitis
Mastitis is an inflammation of the mammary gland that can affect virtually any
mammalian species, but it is especially important in dairy animals because of
their large udder sizes, high milk production rates, and extensive handling of
teats. Mastitis remains the most costly disease of the dairy animal (DeGraves
and Fetrow, 1993). Economic losses are well over $2 billion annually in the
United States alone. Most of the economic losses associated with the disease
result from the decrease in milk output and in the discard of milk from infected
animals. When the costs associated with additional labor, veterinary fees, and
therapeutic agents are added, the total represents 10–11% of the productive ca-
pacity of the dairy cattle industry.
Mastitis is classified as clinical or subclinical based on its severity, cause,
and the characteristics of the exudate fluid; additional subclassifications can also
be made (dePreez and Giesecke, 1994). Clinical mastitis is accompanied by mac-
roscopic signs of disease in the animal (e.g., fever, swelling of the udders) and
Microbiology of the Dairy Animal 39
Table 8 Major Bacterial Diseases of Cattle
Disease Causative agent
Anthrax Bacillus anthracis
Botulism Clostridium botulinum
Bovine tuberculosis Mycobacterium bovis
Brucellosis Brucella abortus
Clostridial enterotoxemia Clostridium perfringens types B, C, and D
Fusobacterium infections Fusobacterium necrophorum
Gas gangrene Clostridium chauvoei, C. novyi, C. septicum
Genital campylobacteriosis Camplyobacter sp.
Haemophilus somnus complex Haemophilus somnus
Leptospirosis Leptospira pomona
Listeriosis Listeria monocytogenes
Mastitis Many agents (See Table 9)
Paratuberculosis Mycobacterium paratuberculosis
Salmonellosis Salmonella serovars
Tetanus Clostridium tetani
in the milk. Clinical mastitis appears to cause similar reductions in yield in high-
and low-yielding herds (Firat, 1993).
Subclinical mastitis can only be detected by laboratory methods, and is
most commonly revealed by routine microscopic counts of somatic cells (H110224 H11003
10
5
cells/mL, usually leukocytes) in the milk (Auldist and Hubble, 1998). If mas-
titis is caused by infection, the causative agent can be observed and often identi-
fied at the same time. Even subclinical mastitis is usually associated with a de-
crease in milk volume. In a recent review of the literature, Hortet and Seegers
(1998) have calculated that each doubling of somatic cell count above 5 H11003 10
4
cells/mL reduces milk yield by 0.4 kg/day in primiparous cows and 0.6 kg/day
in multiparous cows.
Mastitis may have any of several causes, chief among which are bacterial
infections. Although the udder is constantly exposed to potential pathogens, de-
velopment of mastitis requires both that the agent be sufficiently numerous and
virulent and that the host be susceptible to infection. Susceptibility is a complex
function of the animal and management practices, including milking technique.
From an epidemiological standpoint, mastitis is regarded as contagious if it is
transmitted from infected animals (i.e., almost exclusively by the milking pro-
cess) or environmental if the pathogen’s reservoir and the source of infection is
the animal’s environment. Numerous species of bacteria have been implicated
in causing mastitis (Table 9), but the importance of individual species has
changed with changes in dairy practice (Fox and Gay, 1993). Streptococcus aga-
40 Weimer
Table 9 Causative Agents of Bovine Mastitis
Common agents:
Staphylococcus aureus
Streptococcus spp. (especially S. agalactiae, S. dysgalactiae, S. uberis)
Coliform bacteria (especially Escherichia coli, Citrobacter freundii, Enterobacter
spp., and Klebsiella spp.)
Actinomyces pyogenes
Less common agents:
Listeria monocytogenes
Pseudomonas aeruginosa
Mycoplasma bovis
Corynebacterium bovis and C. diphtheriae
Nocardia spp. (especially N. asteroides)
Coagulase-negative Staphylococcus spp. (many species)
Bacillus cereus
Brucella abortus
Clostridium perfringens
Coxiella burnetii
Leptospira spp.
Mycobacterium bovis
Serratia marcesens
Prototheca zopfii (alga)
Source: duPreez and Giesecke, 1994.
lactiae was once the most common causative agent, but it has been displaced
over the past few decades by Staphylococcus aureus. Several genera of the family
Mollicutes (bacteria having very simple genomes and lacking a cell wall), includ-
ing Mycoplasma spp., appear to have a growing involvement as causative agents
of mastitis, as does Listeria monocytogenes.
Mastitic infection can occur via the blood or by trauma to the udder, but
it far more commonly occurs via the streak canal of the teat. Although the arrange-
ment of cells and folding of tissues within the teat provide considerable defense
against invading pathogens, this defense weakens in cows with age or under
conditions of high production. Infection, regardless of route, results in a suite of
host responses. Among these are phagocytosis by polymorphonuclear neutrophils
(Craven and Williams, 1985), production of antibodies which resist bacterial ad-
herence to epithelial cells, and neutralization of toxins.
Infectious mastitis results in changes, which are often dramatic, in milk
composition (du Preez and Giesecke, 1994; Hortet and Seegers, 1998). Fat con-
tent is reduced to below 3%, chloride is increased 1.5-fold, and lactose decreases
substantially (often by 5-fold or more), because the pathogen uses this substrate
Microbiology of the Dairy Animal 41
for growth. Total protein content may show only slight changes, but the amount
of casein may be reduced at the expense of protein from antibodies, somatic cells,
and bacterial cells. In addition to its nutritional inferiority, mastitic milk is visu-
ally and organoleptically unappealing because of the presence of microbial poly-
mers, the release of free fatty acids (as a result of lipase activity), and a reduced
lactose and increased chloride content.
S. aureus, now the most common agent of clinical mastitis, is a gram-
positive nonmotile coccus that grows in characteristic aggregates resembling
bunches of grapes. The virulence of S. aureus appears to result from a variety
of characteristics, including production of extracellular polysaccharide (EPS)
capsule, ability to involute into the epithelial cells, production of exotoxins (e.g.,
leukocidin and coagulase), and causation of tissue necrosis. Chronic mastitic in-
fections are often characterized by bacterial growth in the form of adherent colo-
nies embedded within a large EPS matrix (Brown et al., 1988). Most S. aureus
isolates that have been recovered from mastitic milk show a characteristic ‘‘dif-
fuse colony morphology’’ resulting from the constitutive or inducible production
of the EPS capsule (Baselga et al., 1994). The specific EPS is normally deter-
mined by direct serotyping of capsular antigens. Although the EPS is apparently
involved in adhesion of bacterial cells to ducts and alveoli in the mammary gland,
it is not yet clear if the EPS is involved in the initial adhesion event or more
firmly attaches the bacteria in place following initial adhesion of the cells to the
mammary tissue. Regardless, these matrices provide the bacteria with resistance
to antibiotic treatment (because of inaccessibility) and phagocytosis (because of
the substantial size of the cellular complex).
Much has been written regarding the potential increase in mastitis that may
arise from treatment of cows with bovine somatotropin (BST). Although BST
treatments undoubtedly increase the prevalence of mastitis, there is considerable
evidence (reviewed by Burton et al., 1994) that this effect is not the result of a
reduced immunological capacity to resist infection, but instead is caused by extra
stress placed on udders from increased milk volume. Thus, the enhanced levels
of mastitis are similar to those observed in cows geared to high production by
any of a number of feeding and management strategies regardless of exogenous
BST supplementation.
B. Tuberculosis
Tuberculosis is a contagious, chronic disease resulting from infection by species
of the genus Mycobacterium. Tuberculosis has been one of the most pervasive
and destructive diseases of both humans and animals throughout all of recorded
history, and Robert Koch’s isolation in 1882 of M. tuberculosis (the main
causative agent in humans) is one the greatest achievements of clinical microbi-
ology.
42 Weimer
Bovine tuberculosis is caused by M. bovis, an organism with an unusually
wide host range that includes not only cattle but humans and other primates along
with many domestic animals (e.g., dogs, cats, pigs, and goats) (O’Reilly and
Daborn, 1995). Reservoirs of tuberculosis are also maintained in many wild ani-
mals, including bison (Bison bison) and elk (Cervus elaphus) in North America;
badgers (Meles meles) in England; and opposum (Trichosurus velpecula) in New
Zealand. These wild species represent a potential source of infection of domesti-
cated ruminant animals, or they more commonly provide sufficient exposure to
elicit positive tuberculin tests that complicate the undertaking of prophylactic
measures to control the disease. In most nonbovine species, the infection is not
self-maintaining; even in sheep and goats, the disease is rare.
M. bovis infections of humans through the drinking of milk from infected
dairy cows was a serious public health problem early in the 20th century, and
this spearheaded the impetus for compulsory disinfection of the U.S. public milk
supply by pasteurization (Myers and Steele, 1969). These and other advances in
sanitation, along with aggressive culling of infected animals, has largely con-
trolled bovine tuberculosis in many parts of the world, but it remains an im-
pending threat to dairy producers.
Bovine tuberculosis is normally spread among herds as a result of the intro-
duction of infected cattle into noninfected herds. Infections are generally spread
among animals by inhalation of aerosol microdroplets (2–5 μm diameter; small
enough to reach the lung alveoli) released by infected animals when sneezing
and coughing; however, transmission is also thought to be possible via feces and
various body fluids that may contain the bacilli. The spread of the disease within
a herd is largely governed by the susceptibility of its cows, which in turn depends
on management conditions (e.g., stock density, the overall health of the herd,
and control measures adopted by the producer) and by the relative number of
young stock. Control measures are complicated by the generally chronic, subclin-
ical nature of the disease. In most cases, the lesions are small in size and number
and clinical signs are often not readily apparent. In clinical forms of the disease,
the lymph nodes are the most common target, with the lungs being less often
affected. Other organs are affected only rarely, and usually as a result of spread
through the bloodstream; included among these are infections of the udder (dis-
cussed earlier as a form of mastitis). The pathogenesis of the disease has been
recently reviewed by Neill et al. (1994).
As a genus, the mycobacteria are straight or slightly curved rods that lack
motility and the ability to form endospores. Because of their high content of
lipids, the cells do not stain readily by the Gram staining method, although elec-
tron microscopy reveals that the cell walls are clearly gram-positive. The lipids
are responsible for the characteristic property of acid fastness (i.e., resistance to
decolorization by an acid-alcohol mixture following initial staining by heated
carbol fuchsin), a characteristic sufficiently rare among bacteria as to constitute
Microbiology of the Dairy Animal 43
Table 10 Phenotypic Characteristics Differentiating Mycobacterium bovis from
M. tuberculosis
Characteristic M. bovis M. tuberculosis
Primary host Cattle Human
Colony morphology Moist, smooth, flat Dry, wrinkled
Colony development H11350 3 weeks 10–14 days
Nitrate reduction Negative Positive
Niacin production Negative Positive
Glycerol Inhibits growth Stimulates growth
Pyrazinamide Resistant Sensitive
Thiophene-2-carboxylic acid hydrazide Sensitive Resistant
strong preliminary evidence for a mycobacterial infection. The lipids are also
responsible for the considerable resistance of the mycobacteria toward chemical
agents, and this property is used to advantage in the isolation of mycobacteria
from clinical samples. Tissues are ground in a saline solution and pretreated for
30 min or less with 1 M of NaOH or 2% HCl before neutralization, centrifugation
(to concentrate the cells), and plating onto solid media.
The mycobacteria are notoriously slow growers in culture media, including
the preferred rich diagnostic media such as Lo¨wenstein-Jensen, Ogawa, Dubos,
or Middlebrook 7H10 medium. Even in these media, growth is often not detected
before 3 or 4 weeks of incubation at 37°C. Clinical and veterinary microbiologists
should recognize that, in addition to host specificity, M. bovis and M. tuberculosis
display several physiological differences (Table 10). The difficulty of culturing
these organisms has led to attempts to develop alternate diagnostic tests, and
evidence suggests that enzyme-linked immunosorbent assays (ELISAs), when
used in combination with standard tuberculin tests, improve the diagnosis of in-
fection (Gaborick et al., 1996).
Elimination of tuberculosis in infected herds is usually accomplished by
either immediate slaughter of infected animals or by gradual isolation of infected
animals until all of the remaining cattle are free of tuberculosis.
C. Paratuberculosis
Paratuberculosis (Johne’s disease) is a chronic and infectious disease of the intes-
tinal tract caused by Mycobacterium paratuberculosis (Huchzermeyer et al.,
1994). The disease affects both domestic and wild ruminants, and it causes a
severe diarrhea and debilitating weight loss. Infection normally occurs either con-
genitally or via ingestion by young animals of feces from infected animals. Older
animals may largely resist infection, because mycobacteria do not survive well
44 Weimer
in the fully developed rumen. In infected animals, the incubation period varies
enormously, but clinical signs of the disease apparently require multiple expo-
sures and are not normally manifested for 3–5 years. Even in totally infected
herds, however, only a small percentage of the animals may display clinical signs,
whereas the remaining, subclinically infected animals may or may not be actively
shedding the agent in their feces. Subclinical infections result in approximately
a 4% reduction in milk yields without significant changes in fat or protein content
(Nordlund et al., 1996).
As a result of the low percentage of clinical cases in infected herds, the
mortality rate within the herd is fairly low (Blood et al., 1989). The long incuba-
tion period and subclinical nature of the disease makes antibiotic therapy diffi-
cult and fairly ineffective in clinical cases. Vaccination is effective only in con-
junction with a strong emphasis on animal hygiene, and must be used only in
tuberculosis-free herds, because the vaccine interferes with serological or allergic
tests. In humans, M. paratuberculosis is thought to cause Crohn’s disease.
M. paratuberculosis is a short, thin, gram-positive, acid-fast rod connected
by intercellular filaments that give the organism an aggregated appearance under
microscopic observation. Like the mycobacterial agents of bovine tuberculosis,
M. paratuberculosis grows extremely slowly, even in the preferred Herrold’s egg
yolk medium, and requires exogenous mycobactin (a class of lipid-soluble cell
wall components) for growth. Because of this slow growth, successful isolation
of the bacterium requires that feces or intestinal tissue be macerated and exposed
briefly to chemical agents (e.g., NaOH or various disinfectants) to eliminate other
bacterial contaminants.
D. Brucella Infections
Bacteria of the genus Brucella include several infectious disease agents, including
Brucella abortus, which causes bovine brucellosis (contagious abortion) in cattle,
bison, and other bovines; B. ovis, which causes epididimitis and orchitis in sheep;
and B. melitensis, which causes abortion and orchitis in sheep and goats. B.
abortus can also be transmitted to humans, in whom it causes undulant fever;
this debilitating and often misdiagnosed disease (Latter, 1984) most often afflicts
workers having extensive contact with cattle, but it has been reported in some
cases to result from contamination of unpasteurized dairy products from infected
animals (Bishop et al., 1994).
Members of the genus Brucella are gram-negative, nonmotile, nonsporulat-
ing cells having a coccus or coccobacillus morphology. They are fairly fastidious
in their growth requirements; most require for growth complex media containing
serum and an atmosphere enriched to 5–10% carbon dioxide. One distinguishing
feature of B. abortus is its use of erythritol, a four-carbon sugar alcohol, as an
Microbiology of the Dairy Animal 45
energy source. This substrate is abundant in the uterus of pregnant cows, stimulat-
ing the localization of the organism at that site.
Because the disease is often subclinical in nature, an extensive battery of
tests is often employed to detect Brucella infections (Bishop et al., 1994). These
include direct culture of the agent, detection of specific antibodies, and detection
of allergic responses to the agent. Various inocula are used for direct culture,
particularly uterine discharge, colostrum, or milk (from live animals); supramam-
mary lymph nodes (from slaughtered animals); and lung, stomach, and liver (from
aborted fetuses and full-term calves). The simplest test is the milk ring test in
which killed Brucella cells are added to a fresh milk sample. If the milk is in-
fected, a bluish ring will form around the cream line as the cream rises. Other
tests involve the reaction of serum antibodies with antigens stained with Rose
Bengal, the reaction of milkfat antibodies with stained B. abortus cells, or the
complement fixation test, which is regarded as the most definitive of the antibody
tests (Huber and Nicoletti, 1986). Recent application of the polymerase chain
reaction to amplify species-specific repetitive DNA sequences shows promise for
identifying infected animals and tracing outbreaks (Tcherneva et al., 1996).
Removal of infected stock is used to control outbreaks, but this strategy is
complicated by the latency of the disease (Ter Huurne et al., 1993). Vaccination
with avirulent strains of B. abortus is somewhat effective in controlling infection,
particularly in heifers (Nicroletti, 1984; Al-Khalaf et al., 1992). Such vaccination
enhances resistance to the disease but does not provide absolute immunity.
E. Enteropathogenic Escherichia coli
Several serotypes of E. coli, particularly O157:H7, cause severe intestinal illnesses
in humans that can include bloody diarrhea and hemolytic uremic syndrome, and
they are responsible for an estimated 400,000 infections and 250 deaths annually
in the United States (Armstrong et al., 1996). E. coli O157:H7 has an unusually
low infectious dose (as few as 10 cells), and it owes its potent virulence to a
combination of its ability to invade gut mucosa, an outer membrane containing a
lipid A endotoxin, and its production of a Shiga-like protein exotoxin (Bettleheim,
1996). E. coli infections usually result from consuming contaminated, inadequately
prepared foods (e.g., undercooked meat, fruit juices, and vegetables).
Cattle are considered a major reservoir of E. coli O157:H7 (Bettleheim,
1996). The bacteria proliferate primarily in the hindgut and are shed in the feces
where they may remain viable for months (Wang et al., 1996). Because of this,
numerous quantitative studies have examined the prevalence of E. coli O157:H7
in cattle herds. Early work suggested that E. coli O157:H7 was fairly uncommon
in dairy cows. A survey of 1131 dairy cattle and 659 calves in Ontario, Canada,
for Shiga-like toxin-producing strains of E. coli (Wilson et al., 1992) revealed
46 Weimer
that H1101110% of all cows and 25% of all calves were infected; in some herds, the
infection rates were 60 and 100%, respectively. However, few of the 206
verotoxin-producing strains were serovars that had been isolated from humans,
and none were serovar O157:H7. In contrast, although 5 of 60 dairy herds in
Washington state had cows with fecal O157:H7 present, overall prevalence (only
10 of 3570 cows) was low (Hancock et al., 1994). More recent work, using more
sensitive methods based on immunomagnetic beads (Chapman et al., 1994), re-
veals that O157:H7 is much more prevalent than previously suspected and may
exceed 30% in dairy herds (Chapman et al., 1997; Mechie et al., 1997). Differ-
ences in O157:H7 strains both among and within herds have been noted at the
genetic level using restriction endonuclease digestion profiles (Faith et al., 1996).
Because E. coli O157:H7 can successfully colonize human gut epithelia
only if the bacteria can survive transit through the acidic gastric stomach, and
because acid resistance is inducible, the preinfection environment may have a
major role in the pathogenicity of E. coli O157:H7. There is strong evidence that
diets high in concentrates, which promote low pH and high concentrations of
volatile fatty acids in the bovine colon, result in fecal shedding of strain O157:
H7 and other acid-resistant strains in their most virulent (i.e., acid-resistant) state
(reviewed by Russell et al., 2000). Diez-Gonzalez et al. (1997) observed that
feces from grain-fed animals contained higher densities of acid-resistant E. coli,
and that these numbers decreased on a switch to a hay diet. Moreover, a recent
study with beef cattle that naturally shed strain O157:H7 indicates that dietary
management (particularly reducing the amount of grain feeding) can greatly re-
duce the prevalence of O157:H7 shedding (Keen et al., 1999).
F. Viral Diseases
Most of the major classes of viruses contain strains that are pathogenic to dairy
animals (Table 11). The bovine leukemia virus is the most serious in the United
States, where 10–30% of dairy herds may be infected. In tropical countries, rin-
derpest and hoof-and-mouth disease are probably the most serious viral infections
of cattle. Unlike many bacterial infections of ruminant animals that can also be
transmitted to humans, most viruses that infect ruminant animals have narrower
host specificities and do not normally infect humans. Exceptions include the fol-
lowing: some of the Orthomyxoviridiae (influenza viruses) and Flaviviridae,
which cause mild influenza-like diseases, and the parainfluenza type 3 virus,
which causes a pneumonia-like condition. The more serious exceptions include
the Bunyarviridae, causative agents of Rift Valley fever and Crimean-Congo
hemorrhagic fever. The former is, in humans, a mild influenza with various and
occasionally fatal complications, whereas the latter is a serious disease with a
mortality rate in humans of approximately 30% (Swanepol, 1994).
Microbiology of the Dairy Animal 47
Table 11 Viral Agents of Disease in Cattle
Viral family Disease
Adenoviridae Adenovirus infection
a
Bunyaviridae Crimean-Congo hemorrhagic fever
Rift Valley fever
Coronaviridae Coronavirus infection
Flaviviridae Weselbron disease
Louping-ill
Herpesviridae Bovine herpes mammilitis
Malignant catarrhal fever
Pseudorabies
Paramyxoviridae Bovine respiratory syncytial virus
a
Parainfluenza type 3 (shipping fever)
a
Rinderpest
Parvoviridae Bovine parvovirus infection
Picornaviridae Bovine rhinovirus infection
Foot-and-mouth disease
Retroviridae Bovine leucosis
a
Also affects goats, as do caprine arthritis-encephalitis and peste de petits
ruminants.
Source: Adapted from Coetzer et al., 1994.
The lack of response of viruses to antibiotics makes treatment of viral dis-
eases particularly problematic, although progress is being made toward the devel-
opment of new vaccines (e.g., for Rift Valley fever [Morril et al., 1997]) and
new antiviral compounds (e.g., polyoxometalates effective against respiratory
syncytial virus [Barnard et al., 1997]). Regardless of these efforts, dairy producers
should continue to maintain both animal hygiene and good management tech-
niques to ward off viral infections.
Viral infections have variable effects on milk production. Bovine diarrhea
virus has been reported to have severe economic impact in dairy herds both
through lower milk yield and more severe disease in calves (Moerman et al.,
1994). Bovine respiratory syncytial virus has no significant effect on milk produc-
tion (Van der Poel et al., 1993). Bovine leukemia virus has been reported in one
case to decrease milk yield and in another to increase yield (Rulka et al., 1993).
Dairy cattle having a genetic potential for high milk production have a greater
tendency toward infection with bovine leukemia virus, which probably explains
why cows having subclinical infections with this virus sometimes produce more
milk (albeit with lower milkfat content) than do uninfected animals in the same
herd (Wu et al., 1989).
48 Weimer
G. Bovine Spongiform Encephalopathy
Bovine spongiform encephalopathy (BSE), commonly known as ‘‘mad cow dis-
ease,’’ is a transmissible slow-acting fatal neurodegenerative disease whose
symptoms include abnormal gait, nervousness, and ataxia. The disease was first
identified in Britain in 1987 (Wells et al., 1987), and by mid-1998 the number
of confirmed cases in that country had reached 173,915 (Patterson and Painter,
1999). Epidemiological studies suggest that approximately 903,000 cattle were
infected between 1974 and 1995; apparently from consuming offal mixed into
the feed following a change in processing methods by renderers. Most infected
animals were beef cattle that had been slaughtered before demonstration of symp-
toms, and it is suspected that approximately 446,000 infected animals entered
the human food chain. BSE was also widely distributed in dairy cows, and it is
thought to have infected 59% of British dairy herds. The epidemic has dissipated
after changes in feeding practices and the forced destruction of hundreds of thou-
sands of infected animals; however, infected cattle have recently been identified
in several other European countries.
Evidence has accumulated that BSE and other transmissible spongiform
encephalopathies (TSEs), which have been identified in many domestic and wild
mammalian species, are caused by prions, an abnormal form of PrP, a cell surface
glycoprotein (Prusiner, 1997). The abnormal form, designated PrP
Sc
, can convert
PrP to additional PrP
Sc
. Because PrP
Sc
is resistant to proteases, it accumulates to
concentrations that cause degeneration of the brain and reticuloendothelial tissues
by a yet unknown mechanism. There is evidence that (a) BSE may have arisen
from scrapie, a TSE of sheep and goats and (b) BSE may have been transferred
in several cases to humans, resulting in a variant Creutzfeldt-Jakob disease (re-
viewed in Patterson and Painter, 1999).
REFERENCES
Abe M, Kurihara Y. Long-term cultivation of certain rumen protozoa in a continuous
fermentation system supplemented with sponge materials. J Appl Bacteriol 56:201–
213, 1984.
Akin DE. Microscopic evaluation of forage digestion by rumen microorganisms—a re-
view. J Anim Sci 48:701–710, 1979.
Akin DE, Lyon CE, Windham WR, Rigsby LL. Physical degradation of lignified stem
tissues by ruminal fungi. Appl Environ Microbiol 55:611–616, 1989.
Al-Khalaf SAS, Mohamad BT, Nicoletti P. Control of brucellosis in Kuwait by vaccination
of cattle, sheep and goats with Brucella abortus strain 19 or Brucella melitensis
strain Rev1. Trop Anim Health Prod 24:45–49, 1992.
Allison MJ, Dawson KA, Mayberry WR, Foss JG. Oxalobacter formigenes gen. nov.,
Microbiology of the Dairy Animal 49
sp. nov.: oxalate-degrading anaerobes that inhabit the gastrointestinal tract. Arch
Microbiol 141:1–7, 1985.
Allison, MJ, Mayberry WR, McSweeney CS, Stahl DA. Synergistes jonesii, gen. nov.,
sp. nov.: a rumen bacterium that degrades toxic pyridinediols. Syst Appl Microbiol
15:522–529, 1992.
Applebaum RS, Brackett RE, Wiseman DW, Marth EH. Response of dairy cows to dietary
aflatoxin: feed intake and yield, toxin content, and quality of milk of cows treated
with pure and impure aflatoxin. J Dairy Sci 65:1503–1508, 1982.
Armstrong GL, Hollinsworth J, Morris JG Jr. Emerging foodborne pathogens: Escherichia
coli O157:H7 as a model of entry of a new pathogen into the food supply of the
developed world. Epidemiol Rev 18:29–51, 1996.
Auldist MJ, Hubble IE. Effect of mastitis on raw milk and dairy products. Aust J Dairy
Technol 53:28–36, 1998.
Barnard DL, Hill CL, Gage T, Matheson JE, Huffman JH, Sidwell RW, Otto MI, Schinazi
RF. Potent inhibition of respiratory syncytial virus by polyoxometalates of several
classes. Antivir Res 34:27–37, 1997.
Baselga R, Albizu I, Amorena B. Stapylococcus aureus and slime as virulence factors in
ruminant mastitis. A review. Vet Microbiol 39:195–204, 1994.
Baumgardt BR, Byer WJ, Jumah HF, Krueger CR. Digestibility in the steer, goat, and
artificial rumen as measures of forage nutritive value. J Dairy Sci 47:160–164,
1964.
Bettleheim, KA. Enterohaemorrhagic Escherichia coli: a new problem, an old group of
organisms. Aust Vet J 73:20–26, 1996.
Bishop GC, Bosman PP, Herr S. Bovine brucellosis, In: Coetzer JAW, Thomson GR,
Tustin RC, eds. Infectious Diseases of Livestock, with Special Reference to South-
ern Africa. Cape Town, South Africa: Oxford University Press, 1994, pp 1056–
1066.
Blood DC, Radostits OM, Henderson JA. Diseases Caused by Bacteria. Vol IV. Veterinary
Medicine. 7th ed. London: Baillie′re, Tindall, and Cox, 1989.
Bondi A. Animal Nutrition. London: J Wiley, 1983, pp 437–475.
Borneman WS, Akin DE, Ljungdahl LG. Fermentation products and plant cell wall de-
grading enzymes produced by monocentric and polycentric anaerobic rumen fungi.
Appl Environ Microbiol 55:1066–1073, 1989.
Broderick GA, Wallace RJ, ?rskov ER. Control of the rate and extent of protein degrada-
tion, In: Physiological Aspects of Digestion and Metabolism in Ruminants: Pro-
ceedings of the Seventh International Symposium on Ruminant Physiology. New
York: Academic Press, 1991, pp 541–592.
Brown MRW, Allison DG, Gilbert P. Resistance of bacterial biofilms to antibiotics: a
growth-rate related effect? J Antimicrob Chemother 22:777–783, 1988.
Bryant MP. Normal flora—rumen bacteria. Am J. Clin Nutr 23:1440–1450, 1970.
Bryant MP, Campbell LL, Reddy CA, Crabill MR. Growth of Desulfovibrio in lactate
and ethanol media low in sulfate in association with H
2
-utilizing methanogenic bac-
teria. Appl Environ Microbiol 33:1162–1169, 1977.
Burton JL, McBride BW, Block E, Glimm DR, Kennelly JJ. A review of bovine growth
hormone. Can J Anim Sci 74:167–201, 1994.
50 Weimer
Buxton DR, Casler MD. Environmental and genetic effects on cell wall composition and
digestibility. In: Jung HG, Buxton DR, Hatfield RD, Ralph J, eds. Forage Cell Wall
Structure and Digestibility. Madison, WI: American Society for Agronomy-Crop
Science Society of America-Soil Science Society of America, 1993, pp 685–
714.
Cameron R, Malmo J. A survey of the efficacy of sustained-release monensin capsules
in the control of bloat in dairy cattle. Aust Vet J 70:1–4, 1993.
Chapman PA, Wright DJ, Siddons DA. A comparison of immunomagnetic separation and
direct culture for the isolation of verotoxin-producing Escherichia coli from bovine
faeces. J Med Microbiol 40:424–427, 1994.
Chapman PA, Siddons CA, Cerdan Malo AT, Harkin MA. A 1-year study of Escherichia
coli in cattle, sheep, pigs and poultry, Epidemiol Infect 119:245–250, 1997.
Chaucheyras F, Fonty G, Bertin G, Gouet P. In vitro H
2
utilization by a ruminal acetogenic
bacterium alone or in association with an archaea methanogen is stimulated by a
probiotic strain of Saccharomyces cerevesiae. Appl Environ Microbiol 61:3466–
3467, 1995.
Chin SF, Storkson JM, Liu W, Albright KJ, Pariza MW. Conjugated linoleic acid (9,11-
and 10,12-octadecadienoic acid) is produced in conventional but not germ-free rats
fed linoleic acid. J Nutr 124:694–701, 1994.
Church DC, ed. The Ruminant Animal. Englewood Cliffs, NJ: Prentice-Hall, 1988, p 564.
Clarke RTG. Protozoa in the rumen ecosystem, In: Clarke RTG, Bauchop T, eds. Micro-
bial Ecology of the Gut. New York: Academic Press, 1977, pp 251–275.
Clarke RTG, Reid CSW. Foamy bloat of cattle: a review. J Dairy Sci 57:753–785, 1974.
Coetzer JAW, Thomson GR, Tustin RC, eds. Infectious Diseases of Livestock, with Spe-
cial Reference to Southern Africa. Cape Town, South Africa: Oxford University
Press, 1994.
Coleman GS. The growth and metabolism of rumen ciliate protozoa, In: Dubos R, Kessler
A, eds. Symbiotic Associations. 13th Symposium of the Society of General Micro-
biologists. Cambridge, UK: Cambridge Univ. Press, 1963, pp 298–324.
Cook GM, Rainey FA, Chen G, Stackebrandt E, Russell JB. Emendation of the description
of Acidaminococcus fermentans,atrans-aconitate and citrate-oxidizing bacterium.
Int J Syst Bacteriol 44:576–578, 1994.
Costerton JW, Cheng, K-J., Geesey GG, Ladd TI, Nickel DC, Dasgupta M, Marrie TJ.
Bacterial biofilms in nature and disease. Ann Rev Microbiol 41:435–464, 1987.
Cotta MA. Utilization of xylooligosaccharides by selected ruminal bacteria. Appl Environ
Microbiol 59:3557–3563, 1993.
Craven N, Williams MR. Defences of the bovine mammary gland against infection and
prospects for their enhancement. Vet Immunol Immunopathol 10:71–127, 1985.
DeGraves FJ, Fetrow J. Economics of mastitis and mastitis control. Vet Clin North Am
Food Animal Pract 9:421–434, 1993.
Dehority BA. Carbon dioxide requirement of various species of rumen bacteria. J Bacteriol
105:70–76, 1971.
Dehority BA. Hemicellulose degradation by rumen bacteria. Fed Proc 32:1819–1825,
1973.
Dehority BA. Microbial ecology of cell wall degradation. In: Jung HG, Buxton DR, Hat-
field RD, Ralph J, eds. Forage Cell Wall Structure and Digestibility. Madison, WI:
Microbiology of the Dairy Animal 51
American Society for Agronomy-Crop Science Society of America-Soil Science
Society of America, 1993, pp 425–454.
Devendra C, Coop IE. Ecology and distribution. In: Coop IE, ed. World Animal Science.
C. Production-System Approach. Vol 1, Sheep and Goat Production. Amsterdam:
Elsevier, 1982, p 8.
Dhiman TR, Anand GR, Satter LD, Pariza M. Conjugated linoleic acid content of milk
from cows fed different diets. J Dairy Sci 79(Suppl 1):137, 1996.
Diez-Gonzalez F, Russell JB. Grain feeding and the dissemination of acid-resistant Esche-
richia coli from cattle. Science 281:1666–1668, 1998.
duPreez JH, Giesecke WH. Mastitis. In: Coetzer JAW, Thomson GR, Tustin RC, eds.
Infectious Diseases of Livestock, with Special Reference to Southern Africa. Cape
Town, South Africa: Oxford University Press, 1994, pp 1564–1595.
Ellis JE, Williams AG, Lloyd D. Oxygen consumption by ruminal microorganisms: proto-
zoal and bacterial contributions. Appl Environ Microbiol 55:2583–2587, 1989.
Faichney G, Poncet C, Lassalas J, Jouany P, Millet L, Dore J, Brownlee AG. Effect of
concentrate in a hay diet on the contribution of anaerobic fungi, protozoa and bacte-
ria to nitrogen in rumen and duodenal digesta in sheep. Anim Feed Sci Technol
64:193–213, 1997.
Faith NG, Shere JA, Brosch R, Arnold KW, Ansay SE, Lee MS, Luchansky JB, Kaspar
CW. Prevalence and clonal nature of Escherichia coli O157:H7 on dairy farms in
Wisconsin. Appl Environ Microbiol 62:1519–1525, 1996.
Felix CR, Ljungdahl LG. The cellulosome: the exocellular organelle of Clostridium. Ann
Rev Microbiol 47:791–819, 1993.
Fenchel T, Perry T, Thane A. Anaerobiosis and symbiosis with bacteria in free-living
ciliates. J Protozool 24:154–163, 1977.
Firat MZ. An investigation into the effects of clinical mastitis on milk yield in dairy cows.
Livestock Prod Sci 36:311–321, 1993.
Food and Agricultural Organization. Production Yearbook, Vol. 52. FAO Statistics Series
No. 112, Rome, Italy: Food and Agricultural Organization, United Nations, 1999,
pp 186–216.
Fox LK, Gay JM. Contagious mastitis. Vet Clin North Am Food Animal Pract 9:475–
488, 1993.
Gaborick CM, Salman MD, Ellis RP, Triantis J. Evaluation of a five antigen ELISA for
diagnosis of tuberculosis in cattle and Cervidae. J Am Vet Med Assoc 209:962–
966, 1996.
Goodrich RD, Garrett JE, Gast DR, Kirick MA, Larson DA, Meiscke JC. Influence of
monensin on the performance of cattle. J Anim Sci 58:1484–1498, 1984.
Gould DH. Polioencephalomalacia. J Anim Sci 76:309–314, 1998.
Gradel CM, Dehority BA. Fermentation of isolated pectin and pectin from intact forages
by pure cultures of rumen bacteria. Appl Microbiol 23:332–340, 1972.
Guettler MV, Rumler D, Jain MK. Actinobacillus succinogenes sp. nov., a novel succinic
acid producing strain from the bovine rumen. Int J Syst Bacteriol 49:207–216, 1999.
Hammond AC, Allison MJ, Williams MJ, Prine GM, Bates DB. Prevention of leucaena
toxicosis of cattle in Florida by ruminal inoculation with 3-hydroxy-4-(1H)-pyri-
done–degrading bacteria. Am J Vet Res 50:2176–2180, 1989.
Hancock DD, Besser TE, Kinsel ML, Tarr PI, Rice DH, Paros MG. The prevalence of
52 Weimer
Escherichia coli O157:H7 in dairy and beef cattle in Washington State. Epidemiol
Infect 113:199–207, 1994.
Harris PJ. Plant cell wall structure and development, In: Akin DE, Ljungdahl LG, Wilson
JR, Harris PJ, eds. Microbial and Plant Opportunities to Improve Lignocellulose
Utilization in Ruminants. New York: Elsevier, 1990, pp 71–90.
Hatfield, RD. Cell wall polysaccharide interactions and degradability. In: Jung HG, Buxton
DR, Hatfield RD, Ralph J, eds. Forage Cell Wall Structure and Digestibility. Madi-
son, WI: American Society for Agronomy-Crop Science Society of America-Soil
Science Society of America, 1993, pp 285–314.
Hatfield RD, Weimer PJ. Degradation characteristics of isolated and in situ cell wall lu-
cerne pectic polysaccharides by mixed ruminal microbes. J Sci Food Agric 69:185–
196, 1995.
Hespell RB. Efficiency of growth by ruminal bacteria. Fed Proc 38:2707–2712, 1979.
Hespell RB, Whitehead TR. Physiology and genetics of xylan degradation by gastrointesti-
nal tract bacteria. J Dairy Sci 73:3013–3022, 1990.
Ho YW, Abdullah N. The role of rumen fungi in fiber digestion: a review. Asian Austr
J Anim Sci 12:104–112, 1999.
Hobson PN, Wallace RJ. Microbial ecology and activities in the rumen: part I. CRC Crit
Rev Microbiol 9:165–225, 1982.
Hoover WH, Kincaid CR, Varga GA, Thayne WV, Junkins LL Jr. Effects of solids and
liquid flows on fermentation in continuous cultures. IV. pH and dilution rate. J
Anim Sci 58:692–699, 1983.
Hortet P, Seegers H. Calculated milk production losses associated with elevated somatic
cell counts in dairy cows: review and critical discussion. Vet Res (Paris) 29:497–
510, 1998.
Huber JD, Nicoletti P. Comparison of the results of card, Rivanol, complement-fixation,
and milk ring tests with the isolation rate of Brucella abortus from cattle. Am J
Vet Res 47:1529–1531, 1986.
Huchzermeyer HFAK, Bru¨ckner GK, Bastianello SS. Paratuberculosis. In: Coetzer JAW,
Thomson GR, Tustin RC, eds. Infectious Diseases of Livestock, with Special Refer-
ence to Southern Africa. Cape Town, South Africa: Oxford University Press, 1994,
pp 1445–1457.
Hungate RE. The Rumen and Its Microbes. New York: Academic Press, 1966.
Hungate RE, Smith W, Bauchop T, Yu I, Rabinowitz JC. Formate as an intermediate in
the rumen fermentation. J Bacteriol 102:389–397, 1970.
James LF, Ralphs MH, Nielsen DB. The Ecology and Economic Impact of Poisonous
Plants on Livestock Production. Boulder, CO: Westview Press, 1988.
Jones GM, Larsen RR, Javed AH, Donefer E, Gaudreau JM. Voluntary intake and nutrient
digestion of forages by goats and sheep. J Anim Sci 34:830–838, 1972.
Jones RJ, Megarrity RG. Successful transfer of DHP-degrading bacteria from Hawaiian
goats to Australian ruminants to overcome the toxicity of Leucaena. Aust Vet J
63:259–262, 1986.
Jouany JP, Ushida I. The role of protozoa in feed digestion: a review. Asian Austr J Anim
Sci 12:113–128, 1999.
Keen JE, Urlich GA, Elder RO. Effect of hay- and grain-based diets on the fecal shedding
of naturally-acquired enterohemorrhagic E. coli (EHEC) O157:H7 in beef feedlot
Microbiology of the Dairy Animal 53
cattle. Abstr 86, 80th Conference of Research Workers in Animal Diseases, Chi-
cago, 1999.
Kelly ML, Kolver ES,Bauman DE, Van Amburgh ME, Muller LD. Effect of intake of
pasture on concentrations of conjugated linoleic acid in milk of lactating cows. J
Dairy Sci 81:1630–1636, 1998.
Kepler CR, Hirons KP, McNeill JJ, Tove SB. Intermediates and products in the biohydro-
genation of linoleic acid by Butyrivibrio fibrisolvens. J Biol Chem 241:1350–1354,
1966.
Kiermeier F, Weiss G, Behringer G, Miller M, Ranfft K. Presence and content of aflatoxin
M
1
in milk supplied to a dairy. Z Lebens Unters Forsch 163:71–74, 1977.
Kistner A, Kornelius JH. A small-scale, three-vessel, continuous culture system for quanti-
tative studies of plant fibre degradation by anaerobic bacteria. J Microbiol Methods
12:173–182, 1990.
Klusmeyer TH, Cameron MR, McCoy GC, Clark JH. Effects of feed processing and fre-
quency of feeding on ruminal fermentation, milk production, and milk composition.
J Dairy Sci 73:3538–3543, 1990.
Krause DO, Russell JB. An rRNA approach for assessing the role of obligate amino acid-
fermenting bacteria in ruminal amino acid deamination. Appl Environ Microbiol
62:815–821, 1996.
Kudo H, Cheng K-J, Costerton JW. Electron microscopic study of the methylcellulose-
mediated detachment of cellulolytic rumen bacteria from cellulose fibers. Can J
Microbiol 33:267–272, 1987.
Lafont P, Lafont J, Mousset J, Frayssinet C. Etude de la contamination du lait de vache
lors de l’ingestion de faibles quantite′s d’aflatoxine. Ann Nutr Alim 34:699–708,
1980.
Latham MJ, Brooker BE, Pettipher GL, Harris PJ. Adhesion of Bacteroides succinogenes
in pure culture and in the presence of Ruminococcus flavefaciens to cell walls in
leaves of perennial ryegrass (Lolium perenne). Appl Environ Microbiol 35:1166–
1173, 1978.
Latter M. On having brucellosis. In: Freed DLJ, ed. Health Hazards of Milk. London:
Baillie′re Tindall, 1984, pp xvi–xvii.
Littledike ET, Steudemann JA, Wilkinson SR, Horst RL. Grass tetany syndrome. In: Fon-
tenot JP, Bunce GE, Webb KE Jr, Allen VG, eds. Role of Magnesium in Animal
Nutrition. Blacksburg, VA: Virginia Polytechnic Institute and State University,
1983, pp 1–49.
Mackie RI, Bryant MP. Acetogenesis and the rumen: syntrophic relationships. In: Drake
HL, ed. Acetogenesis. New York: Chapman and Hall, 1994, pp 331–364.
Mackie RI, Heath S. Enumeration and isolation of lactate-utilizing bacteria from the rumen
of sheep. Appl Environ Microbiol 38:416–421, 1979.
Martin SA, Nisbet DJ. Effect of direct-fed microbials on rumen microbial fermentation.
J Dairy Sci 75:1736–1744, 1992.
McIntyre A, Gibson PR, Young GP. Butyrate production from dietary fibre and protection
against large bowel cancer in a rat model. Gut 34:386–391, 1993.
Mead L, Jones GA. Isolation and presumptive identification of adherent epithelial bacteria
(‘‘epimural’’ bacteria) from the ovine rumen wall. Appl Environ Microbiol 41:
1020–1028, 1981.
54 Weimer
Mechie SC, Chapman PA, Siddons SA. A fifteen month study of Escherichia coli O157:
H7 in a dairy herd. Epidemiol Infect 118:17–25, 1997.
Meinert RA, Yang, C-MJ, Heinrichs AJ, Varga GA. Effect of monensin on growth, repro-
ductive performance, and estimated body composition in Holstein heifers. J Dairy
Sci 75:257–261, 1992.
Melville SB, Michel TA, Macy JM. Regulation of carbon flow in Selenomonas rumi-
nantium grown in glucose-limited continuous culture. J Bacteriol 170:5305–5311,
1988.
Mertens DR. Biological effects of mycotoxins upon rumen function and lactating dairy
cows. Proceedings of the Symposium on Interaction of Mycotoxins in Animal Pro-
duction. Washington, DC: National Academy of Sciences, 1979.
Moerman A, Straver PJ, DeJong MCM, Quak J, Baanvinger T, Van Oirschot JT. Clinical
consequences of a bovine virus diarrhoea virus infection in a dairy herd: a longitudi-
nal study. Vet Q 16:115–119, 1994.
Morril JC, Mebus CA, Peters CJ. Safety and efficacy of a mutagen-attenuated Rift Valley
fever virus vaccine in cattle. Am J Vet Res 58:1104–1109, 1997.
Morris CA, Cullen NG, Geertsma HG. Genetic studies of bloat susceptibility in cattle.
Proc NZ Soc Anim Prod 57:19–21, 1997.
Myers JA, Steele JH. Bovine Tuberculosis Control in Man and Animals. St. Louis, MO:
Warren H. Green, 1969.
National Research Council. Ruminant Nitrogen Usage. Washington, DC: National Acad-
emy Press, 1985.
Neill SD, Pollock JM, Bryson DB, Hanna J. Pathogenesis of Mycobacterium bovis infec-
tion in cattle. Vet Microbiol 40:41–52, 1994.
Nicoletti P. Vaccination of cattle with Brucella abortus strain 19 administered by differing
routes and doses. Vaccine 2:133–135, 1984.
Nocek JE. Bovine acidosis: implications of laminitis. J Dairy Sci 80:1005–1028,
1997.
Nordlund KV, Goodger WJ, Pelletier J, Collins MT. Association between subclinical para-
tuberculosis and milk production, milk components, and somatic cell counts in dairy
herds. J Am Vet Med Assoc 208:1872–1876, 1996.
Odenyo AA, Mackie RI, Stahl DA, White BA. The use of 16S rRNA-targeted oligonucleo-
tide probes to study competition between ruminal fibrolytic bacteria: pure culture
studies with cellulose and alkaline peroxide-treated wheat straw. Appl Environ Mi-
crobiol 60:3697–3703, 1994.
Odom JM, Singleton R Jr, eds. Sulfate-Reducing Bacteria: Current Perspectives. New
York: Springer-Verlag, 1993.
Office of the Federal Register. Code of Federal Regulations, Title 21, Section 131.110.
Washington, DC: National Archives and Records Administration, 1995.
O’Reilly LM, Daborn CJ. The epidemiology of Mycobacterium bovis infection in animals
and man. Tubercle Lung Dis 76(Suppl 1):1–46, 1995.
Oremland RS. Biogeochemistry of methanogenic bacteria, In: Zehnder AJB, ed. Biology
of Anaerobic Microorganisms. New York: J Wiley, 1988, pp 641–705.
Orpin CG. Studies on the rumen flagellate, Neocallimastix frontalis. J Gen Microbiol 91:
249–262, 1975.
?rskov, ER. Protein Nutrition in Ruminants. New York: Academic Press, 1982.
Microbiology of the Dairy Animal 55
Ostergaard S, Sorensen JT. A review of the feeding-health-production complex in a dairy
herd. Prev Vet Med 36:109–129, 1998.
Owens FN, Secrist DS, Hill WJ, Gill DR. Acidosis in cattle: a review. J Anim Sci 76:
275–286, 1998.
Patterson DSP, Glancy EM, Roberts BA. The carryover of aflatoxin M
1
into the milk of
cows fed rations containing a low concentration of aflatoxin B
1
. Food Cosmet Tox-
icol 18:35–37, 1980.
Patterson WJ, Painter MJ. Bovine spongiform encephalopathy and new variant Creutz-
feldt-Jakob disease: an overview. Comm Dis Pub Health 2:5–13, 1999.
Parodi PW. Milk fat components: possible chemopreventive agents for cancer and other
diseases. Aust J Dairy Technol 51:24–32, 1996.
Pavlostathis SG, Miller TL, Wolin MJ. Kinetics of insoluble cellulose fermentation by
continuous cultures of Ruminococcus albus. Appl Environ Microbiol 54:2660–
2663, 1988.
Pavlostathis SG, Miller TL, Wolin MJ. Cellulose fermentation by continuous cultures of
Ruminococcus albus and Methanobrevibacter smithii. Appl Microbiol Biotechnol
33:109–116, 1990.
Prusiner SB. Prion diseases and the BSE crisis. Science 278:245–251, 1997.
Quirk MF, Bushell JJ, Jones RJ, Megarrity RG, Butler KL. Liveweight gains on leucaena
and native grass after dosing cattle with rumen bacteria capable of degrading DHP,
a ruminal metabolite from leucaena. J Agric Sci 111:165–170, 1988.
Rajan GH, Morris CA, Carruthers VR, Wilkins RJ, Wheeler TT. The relative abundance
of a salivary protein, bSP30, is correlated with susceptibility to bloat in cattle herds
selected for high or low bloat susceptibility. Anim Genetics 27:407–414, 1996.
Rulka J, Dacko J, Kozaczynska B, Reichert M, Kimentowski S. Milk production in cows
infected with enzootic bovine leukemia virus evaluated on the basis of ELISA and
AGAD tests. Med Weteynaryjna 49:408–411, 1993.
Russell JB. Fermentation of cellodextrins by cellulolytic and noncellulolytic rumen bacte-
ria. Appl Environ Microbiol 49:572–576, 1985.
Russell JB, Baldwin RL. Comparison of substrate affinities among several rumen bacteria:
a possible determinant of rumen bacterial competition. Appl Environ Microbiol 37:
531–536, 1979a.
Russell JB, Baldwin RL. Comparison of maintenance energy expenditures and growth
yields among several rumen bacteria grown in continuous culture. Appl Environ
Microbiol 37:537–543, 1979b.
Russell JB, Cook GM. Energetics of bacterial growth: balance of anabolic and catabolic
reactions. Microbiol Rev 59:48–62, 1995.
Russell JB, Dombrowski DB. Effect of pH on the efficiency of growth by pure cultures
of rumen bacteria in continuous culture. Appl Environ Microbiol 39:604–610,
1980.
Russell JB, Forsberg N. Production of tricarballylic acid by rumen microorganisms and
its potential toxicity in ruminant tissue metabolism. Br J Nutr 56:153–162, 1986.
Russell JB, Hino T. Regulation of lactate production in Streptococcus bovis: a spiraling
effect that contributes to rumen acidosis. J Dairy Sci 68:1712–1721, 1985.
Russell JB, Wilson DB. Potential opportunities and problems for genetically engineered
rumen organisms. J Nutr 118:271–279, 1988.
56 Weimer
Russell JB, Diez-Gonzalez F, Jarvis GN. Potential effect of cattle diets on the transmission
of pathogenic Escherichia coli to humans. Microbes Infect 2:45–53, 2000.
Shaver, RD, Nytes AJ, Satter LD, Jorgensen NA. Influence of amount of feed intake and
forage physical form on digestion and passage of prebloom alfalfa hay in dairy
cows. J Dairy Sci 69:1545–1559, 1986.
Slater JH. Microbial populations and community dynamics. In: Lynch JM, Hobbie JE,
eds., Microorganisms in Action: Concepts and Applications in Microbial Ecology.
2nd ed. Oxford, UK: Blackwell, 1988, pp 51–74.
Smolenski WJ, Robinson JA. In situ rumen hydrogen concentrations in steers fed eight
times daily, measured using a mercury reduction detector. FEMS Microbial Ecol
53:95–100, 1988.
Stahl DA, Flesher B, Mansfield HR, Montgomery L. Use of phylogenetically-based hy-
bridization probes for studies of ruminal microbial ecology. Appl Environ Micro-
biol 54:1079–1084, 1988.
Stephen AM. Other plant polysaccharides, In: Aspinall, GO, ed. The Polysaccharides. Vol
2. New York: Academic Press, 1983, pp 97–193.
Swain RA, Nolan JV, Klieve, AV. Natural variability and diurnal fluctuations within
the bacteriophage population of the rumen. Appl Environ Microbiol 62:994–997,
1996.
Swanepol R. Crimean-Congo haemorrhagic fever, In: Coetzer JAW, Thomson GR, Tustin
RC, eds. Infectious Diseases of Livestock, with Special Reference to Southern Af-
rica. Cape Town, South Africa: Oxford University Press, 1994, pp 722–729.
Tamminga S. Influence of feeding management on ruminant fiber digestibility. In: Jung
HG, Buxton DR, Hatfield RD, Ralph J, eds. Forage Cell Wall Structure and Digest-
ibility. Madison, WI: American Society for Agronomy-Crop Science Society of
America-Soil Science Society of America, 1993, pp 571–602.
Tanner GJ, Moate PJ, Davis LH, Laby RH, Yuguang L, and Larkin PJ. Proanthocyanidins
(condensed tannins) destabilise plant protein foams in a dose dependent manner.
Aust J Agric Res 46:1101–1109, 1995.
Tcherneva E., Rijpens N, Naydensky C, Herman L. Repetitive element sequence based
polymerase chain reaction for typing of Brucella strains. Vet Microbiol 51:169–
178, 1996.
Ter Huurne AAHM, Deijer M, Dijkerman NA. The latency of Brucella abortus causes
a problem in brucellosis control: a review. Tidjsch v Diergeneesk 118:679–683,
1993.
Theodorou MK, Gill M, King-Spooner C, Beever DB. Enumeration of anaerobic chytrido-
mycetes as thallus-forming units: quantification of fibrolytic fungal populations
from the digestive tract ecosystem. Appl Environ Microbiol 56:1073–1078, 1990.
Thurston B, Dawson KA, Strobel HJ. Cellobiose versus glucose utilization by the ruminal
bacterium Ruminococcus albus. Appl Environ Microbiol 59:2631–2637, 1993.
Trinci APJ, Davies DR, Gull K, Lawrence MI, Nielsen BB, Rickers A, Theodorou MK.
Anaerobic fungi in herbivorous animals. Mycol Res 98:129–152, 1994.
United States Public Health Service. Grade A Pasteurized Milk Ordinance. Publication
No. 229, Washington, DC: Public Health Service, Food and Drug Administration,
U.S. Department of Health and Human Services, 1993.
Van der Poel WHM, Mourits MCM, Nielsen M, Frankena K, Van Oirschot JT, Schukken
Microbiology of the Dairy Animal 57
YH. Bovine respiratory syncytial virus reinfections and decreased milk yield in
dairy cattle. Vet Q 17:77–81, 1993.
van Egmond HP, ed. Mycotoxins in Dairy Products. London: Elsevier Applied Science,
1989.
van Gylswyk NO. The effect of supplementing a low-protein hay on the cellulolytic bacte-
ria in the rumen of sheep and on the digestibility of cellulose and hemicellulose.
J Agric Sci (Cambridge) 74:169–180, 1970.
van Gylswyk NO. Succiniclasticum ruminis, gen. nov., sp. nov., a ruminal bacterium con-
verting succinate to propionate as the sole energy-yielding mechanism. Int J Syst
Bacteriol 45:297–300, 1995.
van Gylswyk NO. Pseudobutyrivibrio ruminis, gen. nov., sp. nov., a butyrate-producing
bacterium from the the rumen that closely resembles Butyrivibrio fibrisolvens in
phenotype. Int J Syst Bacteriol 46:559–563, 1996.
Van Soest PJ. The uniformity and nutritive availability of cellulose. Fed Proc 32:1804–
1810, 1973.
Van Soest PJ. Nutritional Ecology of the Ruminant. 2nd ed. Ithaca, NY: Cornell University
Press, 1994.
Varel VH, Yen JT, Kreikemeier KK. Addition of cellulolytic clostridia to the bovine ru-
men and pig intestinal tract. Appl Environ Microbiol 61:1116–1119, 1995.
Vogels GD, Hoppe WF, Stumm CK Association of methanogenic bacteria with rumen
ciliates. Appl Environ Microbiol 40:608–612, 1980.
Waldo DE, Smith LW, Cox EL. Models of cellulose disappearance from the rumen. J
Dairy Sci 55:125–129, 1972.
Wallace RJ, Atasoglu C, Newbold CJ. Role of peptides in rumen microbial metabolism:
a review. Asian Austr J Anim Sci 12:139–147, 1999.
Wang G, Zhao T, Doyle MP. Fate of enterohemorrhagic Escherichia coli O157:H7 in
bovine feces. Appl Environ Microbiol 62:2567–2570, 1996.
Weimer PJ. Effect of dilution rate and pH on the ruminal cellulotytic bacterium Fibro-
bacter succinogenes S85 in cellulose-fed continuous culture. Arch Microbiol 160:
288–294, 1993.
Weimer PJ. Why don’t ruminal bacteria digest cellulose faster? J Dairy Sci 79:1496–
1502, 1996.
Weimer PJ, Shi Y, Odt CL. A segmented gas/liquid delivery system for continuous culture
of microorganisms on insoluble substrates and its use for growth of Ruminococcus
flavefaciens on cellulose. Appl Microbiol Biotechnol 36:178–183, 1991.
Weimer PJ, Waghorn GC, Odt CL, Mertens DR. Effect of diet on populations of three
species of ruminal cellulolytic bacteria in lactating dairy cows. J Dairy Sci 82:122–
134, 1999.
Wells GAH, Scott AC, Johnson CT, Gunning RF, Hancock RD, Jeffrey M. A novel pro-
gressive spongiform encephalopathy in cattle. Vet Rec 121:419–420,
1987.
Williams PEV, Tait CAG, Innes GM, Newbold CJ. Effects of the inclusion of culture
(Saccharomyces cerevesiae plus growth medium) in the diet of dairy cows on milk
yield and forage degradation and fermentation patterns in the rumen of steers. J
Anim Sci 69:3016–3026, 1991.
Wilson JB, McEwen SA, Clarke RC, Leslie KE, Wilson RA, Waltner-Toews D, Gyles
58 Weimer
CL. Distribution and characteristics of verocytotoxigenic Escherichia coli isolated
from Ontario dairy cattle. Epidemiol Infect 108:423–439, 1992.
Wilson JR, Mertens DR. Cell wall accessibility and cell structure limitations to microbial
digestion of forage. Crop Sci 35:251–259, 1995.
Wiryawan KG, Brooker JD. Probiotic control of lactate accumulation in acutely grain-
fed sheep. Aust J Agric Res 46:1555–1568, 1995.
Woese CR, and Olsen GJ. Archaebacterial phylogeny: perspectives on the urkingdoms.
Syst Appl Microbiol 7:161–177, 1986.
Wohlt JE, Finkelstein AD, Chung CH. Yeast culture to improve intake, nutrient digestibil-
ity, and performance by dairy cattle during early lactation. J Dairy Sci 74:1395–
1400, 1991.
Wolin MJ. Rumen fermentation: biochemical interactions between populations of the mi-
crobial community. In: Akin DE, Ljungdahl LG, Wilson JR, Harris PJ, eds. Micro-
bial and Plant Opportunities to Improve Lignocellulose Utilization in Ruminants.
New York: Elsevier, 1990, pp 237–251.
Wood TM, Wilson CA, McCrae SI, Joblin KN. A highly active extracellular cellulase
from the anaerobic rumen fungus Neocallimastix frontalis. FEMS Microbiol Lett
34:37–40, 1986.
Woodford ST, Murphy MR. Effect of physical form on chewing activity, dry matter intake,
and rumen function of diary cows in early lactation. J Dairy Sci 71:674–686, 1988.
Wu MC, Shanks RD, Lewin HA. Milk and fat production in dairy cattle influenced by
advanced subclinical bovine leukemia virus infection. Proc Natl Acad Sci USA 86:
993–996, 1989.
Zinn RA, Owens FN. Influence of level of feed intake on nitrogen metabolism in steers
fed high concentrate rations. Am Soc Anim Sci Abstr, 1981, p 448.
Ziolecki A. Isolation and characterization of large treponemes from the bovine rumen.
Appl Environ Microbiol 37:131–135, 1979.
2
Raw Milk and Fluid Milk Products
Micaela Chadwick Hayes and Kathryn Boor
Cornell University
Ithaca, New York
I. INTRODUCTION
The microbiology of fluid milk impacts on production and consumption of dairy
products in several different ways. Numerous types of bacteria can degrade milk
components, creating negative sensory attributes, decreasing processed product
shelf life and adversely affecting cultured dairy product yield. Since numerous
pathogens are sometimes associated with milk and other dairy products, the mi-
crobiology of milk has implications for human health as well. This chapter will
discuss various types of microorganisms that have been associated with raw milk
and fluid milk products; microbiological techniques with which the microflora
of milk samples can be assessed; various routes through which bacteria can con-
taminate raw milk; implications of microbial contamination for the quality of
raw and processed milk; problems posed by heat-stable enzymes secreted by
contaminating bacteria; and techniques for reducing and controlling bacterial
numbers in raw and pasteurized milk.
II. MICROFLORA OF RAW MILK
Designed to provide complete nutrition for growing calves, bovine milk also
provides a highly suitable growth medium for a variety of microorganisms. The
abundance of carbohydrates, proteins, and fats combined with the neutral pH
supports and encourages a microbial ecology that can be both diverse and highly
variable. One can find numerous different organisms in raw milk, including
psychrotrophs, which can grow at 7°C or less, irrespective of their optimum
59
60 Hayes and Boor
Table 1 Human Microbial Pathogens Associated with Milk and Milk Products
Organism Disease
Enterobacteriaceae
Escherichia coli, including O157:H7
?
Gastroenteritis, hemolytic ure-
mic syndrome
Salmonella Gastroenteritis, typhoid fever
Yersinia enterocolitica (psychrotrophic) Gastroenteritis
Other gram-negative bacteria
Aeromonas hydrophila (psychrotrophic) Gastroenteritis
Brucella spp. Brucellosis (Bang’s disease)
Campylobacter jejuni Gastroenteritis
Pseudomonas aeruginosa Gastroenteritis
Gram-positive spore formers
Bacillus cereus (some strains are psychrotrophic) Gastroenteritis
Bacillus anthracis Anthrax
Clostridium perfringens Gastroenteritis
Clostridium botulinum (type E is psychrotrophic) Botulism
Gram-positive cocci
Staphylococcus aureus Emetic intoxication
Streptococcus agalactiae Sore throat
Streptococcus pyogenes Scarlet fever/sore throat
Streptococcus zooepidemicus Pharyngitis, nephritic sequelae
Miscellaneous gram-positive bacteria
Corynebacterium spp. Diphtheria
Listeria monocytogenes (psychrotrophic) Listeriosis
Mycobacterium bovis Tuberculosis
Mycobacterium tuberculosis Tuberculosis
Mycobacterium paratuberculosis Johne’s disease (ruminants)
Rickettsia
Coxiella burnetii Q fever
Viruses
Enterovirus, including polioviruses, rotaviruses, Enteric infection
Coxsackie viruses
FMD virus Foot-and-mouth disease
Hepatitis virus Infectious hepatitis
Fungi
Molds Mycotoxicoses
Protozoa
Entamoeba histolytica Amebiasis
Giardia lamblia Giardiasis
Toxoplasma gondii Toxoplasmosis
Source: Adapted from Boor, 1997, and Johnson et al., 1990.
Raw Milk and Fluid Milk Products 61
growth temperature; coliforms and other gram-negative bacteria, which can be
associated with unsanitary production and processing practices; thermoduric bac-
teria, which can survive pasteurization conditions; spore formers, which produce
the heat- and dessication-resistant structures known as spores; pathogens that
cause mastitis, which can be shed into the milk by infected udders; and various
yeasts and molds (Bramley and McKinnon, 1990; Gilmour and Rowe, 1990). As
indicated in Table 1, a variety of microbes with human pathogenic potential,
including Listeria monocytogenes, Salmonella spp., Staphylococcus aureus and
Mycobacterium tuberculosis, can sometimes be found in raw milk (Bramley and
McKinnon, 1990; Flowers et al., 1992; Johnson et al., 1990).
Psychrotrophic bacteria belonging to numerous genera have been isolated
from milk, including Pseudomonas, Enterobacter, Flavobacterium, Klebsiella,
Aeromonas, Acinetobacter, Alcaligenes, and Achromobacter. Certain genera of
bacteria isolated from milk are both psychrotrophic and thermoduric, including
gram-positive Bacillus, Clostridium, Microbacterium, Micrococcus, and Coryne-
bacterium (Cousin, 1982; Suhren, 1989). Coliforms, which are defined as aerobic
and facultatively anaerobic, asporogenous, gram-negative rods that ferment lac-
tose with acid and gas production within 48 h at 32 or 35°C, include the genera
Escherichia, Enterobacter, Citrobacter, and Klebsiella (Christen et al., 1992; Jay,
2000; Gilmour and Rowe, 1990). Aerobic gram-negative rods commonly found
in milk include Pseudomonas fluorescens, P. putida, P. fragi, P. putrefaciens,
and less frequently P. aeruginosa (Gilmour and Rowe, 1990).
Thermoduric bacteria belonging to numerous genera have also been isolated
from milk, including Microbacterium, Micrococcus,andAlcaligenes.Thespore-
forming genera most relevant to milk and dairy products are Bacillus and Clostrid-
ium. Bacillus spp. have been implicated in spoilage of raw and pasteurized milk;
ultrahigh temperature (UHT), concentrated and canned milk products; and ‘‘bitty’’
cream and sweet curdling of pasteurized milk. Clostridium spp. have been impli-
cated in the rancid spoilage and ‘‘late blowing’’ of numerous cheeses (Gilmour
and Rowe, 1990). Species of Streptococcus, Lactobacillus,andCorynebacterium
also show some heat resistance, with less than 1% of a given population surviving
a heat treatment of 63°C for 30 min (Bramley and McKinnon, 1990). Pathogens
that cause mastitis include Streptococcus uberis, S. dysgalactiae, S. agalactiae,
Staphylococcus aureus, coagulase-negative staphylococci, P. aeruginosa, Myco-
plasma bovis, Corynebacterium bovis, and coliforms (Bramley and Dodd, 1984).
III. BACTERIAL CONTAMINATION
A. Raw Milk Contamination
Sources of bacterial contamination of raw milk can be divided into three general
categories: environment, udder, and milking equipment. Environmental sources,
62 Hayes and Boor
which include water, soil, vegetation, and bedding material, vary in the numbers
and types of organisms that can be introduced into raw milk. In general, contami-
nation with psychrotrophic microflora has been associated with bedding material,
untreated water, soil, and vegetation; coliform contamination with soil; and spore
formers with bedding material (Cousin, 1982; Suhren, 1989). Poor premilking
udder hygiene that fails adequately to clean dirty udders can result in the introduc-
tion of vegetation, soil, and bedding material and their associated microorganisms
into the milk. Thorough cleaning and drying of the udder immediately before
milking lowers total bacterial numbers as well as coliform and Staphylococcus
spp. counts and decreases milk sediment (Galton et al., 1984; Pankey, 1989).
Bacterial contamination from within the udder is frequently a result of mastitis,
an inflammation of the udder that can result in high levels of bacteria being shed
into the milk. (see Chapter 1) Currently, E. coli, Staph. aureus, other staphylo-
cocci, S. dysgalactiae, and other streptococci are the most prevalent pathogens
among dairy herds (Barkema et al., 1998; Sargeant et al., 1998; Waage et al.,
1999). Since cows infected with S. uberis can shed up to 10
7
cfu/mL (Leigh,
1999) and cows infected with E. coli can shed up to 10
8
cfu/mL (Van Werven
et al., 1997), one infected cow can influence total bacterial numbers in an entire
bulk tank of milk. Since Staph. aureus is shed in relatively low numbers, typically
less than 10,000 cfu/mL (Sears et al., 1990), S. uberis and S. dysgalactiae are
often responsible for large increases in the total bacterial count of raw milk
(Bramley et al., 1984). Although the microflora of a healthy udder can be shed
into the raw milk, these organisms do not typically cause significant increases
in the bulk tank total bacterial count.
Common contamination sources associated with milking equipment in-
clude milking machines, milk pipelines, bulk tanks, and transport tankers. Inef-
fective cleaning can leave milk residue throughout these various machines which
can provide an excellent environment for microbial growth (see Chapter 14).
Bacteria multiply within these residues and contaminate milk passing through
the equipment.
B. Postpasteurization Contamination
Postpasteurization bacterial contamination provides a serious obstacle to main-
taining and extending fluid milk product shelf life. Two major sources contribute
to postpasteurization contamination: equipment milk residues and aerosols. Inef-
fective cleaning procedures of the interior of processing equipment create milk
residues which can allow bacteria to multiply and contaminate subsequent milk
flow (see Chapter 14). Filler nozzles, carton-forming mandrels, and pasteurizers
have all been pinpointed as sources of postpasteurization contamination (Gruetz-
macher and Bradley, 1999; Ralyea et al., 1998). Bacterial biofilms, which are
difficult to remove with clean-in-place (CIP) procedures, can also form within
Raw Milk and Fluid Milk Products 63
processing equipment and provide a constant source of contamination for both
raw and pasteurized milk (Austin and Bergeron, 1995).
Unenclosed milk contact surfaces provide a route for microbial aerosols to
contaminate pasteurized milk (Kang and Frank, 1989). During cleaning or opera-
tion, airborne yeast, molds, bacteria, and spores can land on a milk contact surface
and thus enter the milk flow. An unenclosed filling unit (e.g., a federal-style filler)
can allow exposure of the pasteurized milk to airborne bacteria, which can result
in levels of postpasteurization contamination higher than those of milk packaged
in a self-enclosed system (Douglas et al., 2000).
IV. MICROBIAL ANALYSIS OF RAW MILK
Characterization of the microbial population in raw milk (see Chapter 17) is of
particular interest to dairy farmers and processors for several reasons. As in-
dicated in Table 2, the U.S. Food and Drug Administration (FDA) guidelines
detailed in the Pasteurized Milk Ordinance (PMO) require that total bacterial
numbers of an individual producer’s milk not exceed 100,000 cfu/mL before
commingling with other producer milk; following pasteurization, total bacterial
numbers are not to exceed 20,000 cfu/mL (U.S. Public Health Service, 1995).
Therefore, the total bacterial count (TBC) of raw and pasteurized milk is deter-
mined to ensure that products meet FDA regulations. In addition, many proces-
sors and cooperatives have established price incentives or premium payments
for raw milk with a low TBC. Thus, farmers and processors desire information
about the TBC to determine premium allocations. The TBC is also of interest in
Table 2 Bacteriological Standards for Raw and Pasteurized Milk as Defined by the
Pasteurized Milk Ordinance
Product Test Standard
Grade A raw milk and milk Total bacterial count H11349 100,000 cfu/mL before
products commingling
H11349300,000 cfu/mL after com-
mingling
Grade A pasteurized milk and Total bacterial count H1134920,000 cfu/mL
milk products
Coliform count H1134910 cfu/mL
Grade A aseptically processed Total bacterial count No growth by standard plate
milk and milk products count or other comparable
method
Source: U.S. Public Health Service, 1995.
64 Hayes and Boor
terms of milk quality and safety. Excessively high bacterial counts can over-
whelm the bacterial thermal destruction capacity of a pasteurizer, resulting in
pasteurized milk with high bacterial numbers that may be unsafe to consume and
that may have reduced quality and shelf life. High bacterial counts in raw milk
can also suggest the presence of bacterially produced enzymes that may adversely
affect the quality of any fluid milk and processed product made from the raw
milk.
For reasons noted above, analytical tests are routinely done to characterize
the microbial population of raw milk samples. The TBC is typically determined
by the standard plate count (SPC) or the Petrifilm (3M Company, St. Paul, MN)
aerobic count (PAC). The SPC measures all bacteria able to form colonies on
standard methods agar within 48 h under aerobic conditions at 32°C, whereas
the PAC measures all bacteria able to form colonies on a nutrient medium embed-
ded in a plastic film within 48 h at 32°C (Houghtby et al., 1992). Several alterna-
tive, but less commonly applied, techniques for estimating total bacterial numbers
exist, including plate loop count, pectin gel plate count, spiral plate count, hy-
drophobic grid membrane filter most probable number count, and impedance/
conductance method (Houghtby et al., 1992).
A notable new rapid method known as Bactoscan (Foss Food Technology
Corp., Eden Prarie, MN) utilizes fluorescent staining to count individual bacterial
cells. In this technique, somatic cells, fat globules, and casein particles are chemi-
cally degraded and then separated from bacterial cells by centrifugation in a sac-
charose-glycerol gradient. Bacterial cells are then stained with acridine orange
and channeled beneath the objective of an epifluorescence microscope. As they
pass under the objective, the bacteria are irradiated with filtered blue light, which
causes red light pulses to be emitted from live bacteria. A photodetector fitted
to the objective detects these pulses, which are then counted as individual bacte-
rial cells (IBCs) (Rodriguez-Otero et al., 1993). Differences in acridine orange
intercalation into cell DNA cause dead cells to emit green light, whereas live
cells emit red light, thus ensuring that Bactoscan only counts live bacteria (Sharpe
and Peterkin, 1988). Calibration of the Bactoscan apparatus using reference stan-
dards allows IBC/mL values to be translated into colony-forming units per milli-
liter values. This calibration step facilitates comparison of Bactoscan results with
other TBC techniques. The Bactoscan method is unique in that it counts individ-
ual bacterial cells rather than the colony-forming units measured by most other
tests, leading to values of IBCs per milliliter which may be significantly higher
than corresponding colony-forming units per milliliter values, particularly in the
presence of organisms such as many Streptococcus spp. and Staphylococcus spp.
that form, for example, clusters, chains, duplets, or triplets. Although widely
applied in Europe to analyze raw milk quality, the Bactoscan method is not cur-
rently approved for regulatory use in the United States.
Although information provided by the TBC is useful for determining pre-
Raw Milk and Fluid Milk Products 65
mium allocations and for satisfying PMO regulations, it is of less utility for identi-
fying specific sources of high bacterial counts or for assessing risks to milk qual-
ity posed by a particular bacterial population. Selective and/or differential tests
that detect and quantify a specific type or group of bacteria can prove to be more
useful. By doing tests that distinguish among microbial groups, one can identify
the dominant organism(s) in a given bacterial population. The identity of domi-
nant organism(s) can often suggest a possible contamination source or route and
thus aid in focusing future contamination prevention efforts. The identity of domi-
nant organism(s) can also help assess bacterial threat(s) to milk quality and safety.
Many spore formers and thermoduric organisms, which can survive pasteuriza-
tion, can also grow in the processed product and diminish product quality and
shelf life. Psychrotrophs, which grow under refrigeration conditions, can multi-
ply while raw milk awaits pasteurization, creating off-odors and off-flavors and
chemically degrading milk components. Many heat-stable enzymes produced by
psychrotrophs can also survive pasteurization and degrade the finished product,
decreasing the shelf life of fluid milk products and adversely affecting yield of
cultured products (Cousin, 1982). Individual selective tests can also prove to be
useful for monitoring elimination of a specific contamination source. For exam-
ple, a selective test that detects S. agalactiae could be employed to gauge the
effectiveness of an S. agalactiae eradication program.
Numerous selective and differential tests can be used to determine the pres-
ence or absence of specific types of bacteria in raw milk. The laboratory pasteur-
ized count (LPC), in which milk samples are heated to 62.8°C for 30 min before
plating onto standard methods agar, estimates the number of thermoduric bacteria
that could survive a batch pasteurization-type process (Frank et al., 1992; Mur-
phy, 1997). The preliminary incubation count (PIC), in which milk samples are
held at 12.8°C for 18 h before doing an SPC, gauges the number of bacteria
capable of growth at cooler temperatures. A significant increase in the SPC after
preliminary incubation is considered to be indicative of unsanitary production
practices. The coliform count, in which samples are plated on the selective and
differential medium Violet Red Bile Agar and incubated for 24 h at 32°C, esti-
mates the number of coliform organisms present (Christen et al., 1992). The
presence of these organisms can also indicate unsanitary production and pro-
cessing practices. The selective and differential Edwards Medium can be used
to isolate streptococci, which can be indicative of mastitis in the herd (Atlas,
1993). To meet other specific diagnostic objectives, procedures have been estab-
lished to detect and quantify thermophilic organisms, proteolytic organisms, li-
polytic organisms, lactic acid bacteria, enterococci, aerobic bacterial spores, and
yeast and molds (Frank et al., 1992).
Characterization of the bacterial population present in raw milk must al-
ways consider the limitation inherent in any analytical technique: No one test can
detect all bacteria. Even nonselective tests designed to determine total bacterial
66 Hayes and Boor
numbers cannot detect fastidious organisms that require additional nutrients,
slow-growing organisms that require more time to form visible colonies, or poor
competitors that require selective media to ensure sufficient nutrient access. Fur-
thermore, correlations are so low among results obtained from standard plate
count, rapid psychrotrophic count, preliminary incubation count, aerobic spore
count, and laboratory pasteurized count analyses from the same raw milk sample
that one result cannot be used to estimate multiple different test results (Boor et
al., 1998). Ultimately, no one test gives a complete picture of the microbial popu-
lation; the picture must be pieced together using results from multiple different
tests. Since doing all possible tests is neither economically nor logistically feasi-
ble, microbial analysis must involve deciding which tests will provide the most
useful information about the microbial population of the particular product being
examined. Additional information on the testing of milk and milk products can
be found in Chapter 17.
V. EFFECTS OF MICROBIAL CONTAMINATION
ON MILK QUALITY
A. Vegetative Growth
The presence and growth of bacteria in milk affects milk quality. Chemical com-
ponents of milk can be degraded by bacterial metabolism and various enzymes
secreted by bacteria. Products of these degradation reactions can have undesirable
effects on milk structure, smell, and taste. Lactose present in milk is readily
fermented by lactic acid bacteria, resulting in sour flavor notes and, if the pH of
milk drops below 4.6, precipitation of casein proteins (Bylund, 1995; Jay, 2000).
Fermentative metabolism of lactose by a variety of bacteria can also produce
numerous volatile compounds, including acetic and butyric acids, carbon dioxide
and hydrogen gas, and various alcohols that can adversely affect milk odor and
flavor. Proteins are also subject to degradation by bacteria and their secreted
enzymes. Digestion of proteins by extracellular proteases can create bitter-tasting
peptides; cause curdling and clotting of the milk; result in production of ammonia
and hydrogen sulfide; and ultimately cause gelation of the milk. Lecithinases
hydrolyze lecithin molecules present in fat globule membranes, causing globule
aggregation that results in flocking and lumping. Lipase, which breaks down
triglycerides, creates short chain fatty acids that give milk a rancid smell and
taste. Phospholipases hydrolyze phospholipids present in fat globule membranes
making interior lipids more susceptible to lipase attack (Bylund 1995; Cousin,
1982). Growth of molds, yeasts, coliforms, Pseudomonas spp., Actinomyces spp.,
and Lactococcus lactis ssp. lactis biovar. maltigenes can give milk musty, fruity,
cowlike, fishy, earthy, or malty odors, respectively.
Raw Milk and Fluid Milk Products 67
B. Spore-Forming Bacteria
Most microorganisms present in raw milk are destroyed by exposure to time and
temperature combinations currently in use for milk pasteurization. Minimizing
the time between production and pasteurization and maintaining low storage tem-
peratures will help control enzymatic degradation of raw milk through growth
of heat-sensitive organisms. However, some spores and thermoduric organisms
can survive pasteurization and affect the quality of fluid milk and other processed
dairy products. Thermoduric organisms, such as some species of Streptococcus
and Lactobacillus, and spore-forming organisms, such as Bacillus, can multiply
within pasteurized milk products resulting in off-flavors and protein and lipid
degradation. Psychrotrophic spore formers present a particularly difficult chal-
lenge, as they can survive pasteurization, germinate, and multiply in refrigerated
conditions under which milk is stored (Boor et al., 1998; Douglas, 2000; Ralyea,
1998).
C. Heat-stable Enzymes
Numerous organisms commonly found in raw milk produce degradative enzymes
that remain functional following heat treatment. Once these enzymes have been
secreted, they have the potential to degrade both raw and processed milk compo-
nents. Furthermore, refrigeration conditions under which raw milk is stored se-
lects for growth of psychrotrophs, many of which produce heat-stable enzymes.
These psychrotrophs can grow and secrete heat-stable enzymes while milk awaits
processing. Following heat treatment, these enzymes can continue to degrade
milk in the absence of viable bacterial cells. A variety of psychrotrophic organ-
isms, including P. fluorescens, P. putida, P. fragi, P. putrefaciens, Acinetobacter
spp., Achromobacter spp., Flavobacterium spp., Aeromonas spp., and Serratia
marcescens produce heat-stable extracellular proteases (Mottar, 1989). Many
psychrotrophs, including P. fluorescens, P. fragi, P. putrefaciens, Achromobacter
spp., Alcaligenes viscolactis, Acinetobacter spp., and Serratia marcescens, pro-
duce heat-stable extracellular lipases (Mottar, 1989). Among these organisms,
Pseudomonas spp. are commonly isolated from raw milk, frequently comprising
50% of the psychrotrophic flora (Suhren, 1989).
D. Mastitis
Mastitis directly impacts milk quality by raising the total bacterial number of
raw milk through shedding from the infected udder. An indirect effect of mastitis
can also have significant implications for milk quality. Whereas healthy udders
typically shed low numbers of somatic cells, mastitic udders frequently shed 10
6
68 Hayes and Boor
somatic cells/mL. This increased somatic cell count (SCC) can impact the quality
of fluid milk and other dairy products. Ma et al. (2000) found that high SCC
pasteurized milk (849,000 cells/mL) experienced rates of lipolysis and casein
hydrolysis three and two times faster than those of low SCC pasteurized milk
(45,000 cells/mL), respectively. Sensory defects, such as rancid, oxidized, and
fruity aroma; salty, rancid, bitter and astringent taste; and bitter and lingering
aftertaste, were detected in high SCC pasteurized milk after 21 days at 5°C. Stan-
dard plate counts, coliform counts, and psychrotrophic bacterial counts remained
below 100,000 cfu/mL for both high and low SCC milk, suggesting that these
effects were likely to be independent of contaminating bacteria. The SCC also
affects cheese making with high SCC milk resulting in reduced curd firmness,
decreased cheese yield, increased fat and casein loss in the whey, and sensory
defects (Munro et al., 1984; Politis and Ng-Kwai-Hang, 1988a, 1988b).
VI. CONTROL OF MICROORGANISMS IN MILK
A. Refrigeration
Ideally, microbial contamination of raw milk and milk products should be ad-
dressed primarily through preventive measures on the farm and throughout pro-
cessing. However, far too many contamination sources exist to prevent entry of
all bacteria. Therefore, milk handling and processing strategies are designed to
reduce and control bacterial numbers in processed products to protect milk quality
and milk safety. The first of these measures involves efficient cooling of milk
to 4°C immediately following milking. Reduced temperatures inhibit growth of
mesophils and thermophils and reduce the activity of degradative enzymes. Mod-
ern dairy farms use refrigerated bulk storage tanks which maintain milk at 4°C
or below. As bulk tank milk pick-up typically occurs daily or every other day,
product from multiple milkings is frequently mixed and stored in the same tank.
To prevent fresh, warm milk from the most recent milking from raising the tem-
perature of milk already present in the bulk tank, many farms employ pretank
cooling systems to reduce product temperature before addition to the tank.
B. Heat Treatment
Heat treatment plays a critical role in controlling bacterial numbers in processed
milk products. The three basic approaches to heat treatment of raw milk, pasteur-
ization, ultrapasteurization and UHT, differ primarily in their underlying purpose.
Pasteurization aims to eliminate the non–spore-forming pathogen most resistant
to thermal destruction, currently recognized as being Coxiella burnetii, and con-
currently reduce nonpathogenic bacterial numbers in milk. Ultrapasteurization
Raw Milk and Fluid Milk Products 69
adds the additional goal of increasing product shelf life through further reduction
in total bacterial numbers. UHT processing aims to achieve microbial sterility to
create a shelf-stable fluid milk product.
The PMO lists seven time and temperature combinations (Table 3) which
are acceptable for milk pasteurization; these temperatures increase by 3°Cifthe
milk product contains added sweeteners or greater than 10% fat. Two particular
time and temperature combinations have become standard in the United States:
low-temperature long-time (LTLT) and high-temperature short-time (HTST). In
LTLT, or ‘‘vat,’’ pasteurization, which is commonly used for milk intended for
manufactured products such as cheese and yogurt, milk is held at a minimum of
63°C for 30 min. In HTST pasteurization, which in the United States is currently
most commonly used for fluid milk products, milk is held at a minimum of 72°C
for 15 s. In ultrapasteurization, milk is held at a minimum of 138°C for at least
2 s, and in UHT processing, milk is held at 140–150°C for a few seconds (Bylund,
1995; U.S. Public Health Service, 1995). UHT processing involves the additional
step of aseptic packaging in which heat-treated milk is cooled and packaged di-
rectly into sterilized containers under aseptic conditions. Typical shelf lives for
heat-treated fluid milk are 14–21 days for HTST; 40–60 days for ultrapasteurized
Table 3 Minimum
Pasteurization Time and
Temperature Combinations as
Defined by the Pasteurized
Milk Ordinance
Temperature,
°C(°F) Time
63 (145)
a
30 min
72 (161)
a
15 s
89 (191) 1.0 s
90 (194) 0.5 s
94 (201) 0.1 s
96 (204) 0.05 s
100 (212) 0.01 s
a
If the fat content of the milk product
is 10% or more, or if it contains
added sweeteners, the specified tem-
perature shall be increased by 3°C
(5°F).
Source: U.S. Public Health Service,
1995.
70 Hayes and Boor
(Boor and Nakimbugwe, 1998); and up to 6 months for UHT (Dunkley and Ste-
venson, 1987). Whereas HTST and ultrapasteurized products require refrigeration
at 4°C or less during storage, UHT products can be stored at 25°C.
Currently, both direct and indirect methods are used to bring raw milk to
pasteurization temperatures (Bylund, 1995). Direct heating strategies, which are
most commonly used for UHT and ultrapasteurization, involve injecting raw milk
with hot culinary steam until the desired temperature has been achieved. Con-
trolled pressure changes during cooling ensure that the amount of water vapor
that was injected into the milk is equal to the amount of water that evaporates
from the milk during cooling, thus preventing dilution or concentration of the
milk. Indirect heating strategies, which are most commonly used for LTLT and
HTST pasteurization, utilize a heating fluid which is separated from milk by a
physical barrier; typically a stainless steel pipe, plate, or vat. The two fluids flow
side-by-side and either gain or lose heat via conduction through the metal barrier
and convection within the fluids.
The effectiveness of heat treatment depends on three main factors: tempera-
ture to which milk is raised, length of time milk is held at the temperature, and
resistance of microorganisms in milk to thermal destruction. Two graphical repre-
sentations describe the interaction between these variables. The thermal death rate
curve, also known as the survivor curve, plots time versus number of surviving
organisms at a given temperature. The reciprocal slope of this curve, also known
as the D value, indicates the length of time required to kill 90% of the microbial
population at that specific temperature (Potter and Hotchkiss, 1995; Jay, 2000).
Destruction of 90% of the microbial population is known as a one-log reduction.
Thermal death time curves plot time versus temperature for a given number of
organisms killed. The negative slope of this curve, known as the z value, indicates
the degrees Fahrenheit needed for a 1 log cycle reduction in the thermal destruc-
tion curve (Potter and Hotchkiss, 1995; Jay 2000).
Resistance of microorganisms to thermal destruction depends on several
factors, including product water activity, product pH, quantities of protein and
colloidal particles present, number and physiological status of organisms in the
total population, and the presence of heat-stable antibiotics or inhibitory com-
pounds in the product (Jay, 2000). Water activity, which is a measure of unbound
water present in a solution, is determined primarily by concentrations of sugars,
fats, and salts in milk and heavily influences microbial resistance to thermal de-
struction. The higher the water activity of the product, the lower the heat resis-
tance of organisms present in the product. This is likely to be the result of the
increased rate of heat-induced protein coagulation caused by the presence of wa-
ter. The effect of pH on thermal destruction characteristics depends on the partic-
ular bacterium, as organisms are most resistant at their optimum growth pH. In
general, the optimum growth pH of most organisms, about 7, coincides with the
pH of raw milk, suggesting that pH generally does not contribute to thermal
Raw Milk and Fluid Milk Products 71
destruction of organisms in raw milk. The presence of protein and colloidal parti-
cles has a protective effect on bacteria, increasing their heat resistance by serving
as a thermal buffer. Larger numbers of organisms similarly result in increased
bacterial resistance to thermal destruction. The individual bacteria in a species
are no more or less heat resistant; rather large numbers of bacteria present in
milk act as a thermal buffer, raising the time necessary for all bacteria to reach
the appropriate destructive temperature. Stationary phase cells tend to be more
resistant to thermal destruction than logarithmic phase cells. The presence of
heat-stable antibiotics or inhibitory compounds typically reduces resistance to
thermal destruction.
C. Centrifugation
Two techniques known as clarification and Bactofugation (e.g., Westfalia Separa-
tor, Inc., Northvale, NJ) rely on the greater relative densities of bacterial cells
and of other foreign particles to separate milk from contaminants. Centrifugation
of milk causes denser bacteria, dirt particles, somatic cells, animal hairs, and
bacterial spores to migrate outward, whereas lighter fat globules and casein mi-
celles migrate inward. Appropriately designed outlet nozzles allow for separation
of milk from contaminant sludge. Clarification is primarily designed to remove
dirt particles, somatic cells, and animal hairs, whereas Bactofugation is specially
designed to remove bacterial spores from milk (Spreer, 1998). Using high-force
centrifugation, the spore load of raw milk can be reduced by greater than 99%
(Olesen, 1989; Torres-Anjel and Hedrick, 1971).
D. Filtration
Microfiltration and ultrafiltration utilize the larger relative size of bacterial cells
to separate out microbial contaminants. Filters with very small pores allow milk
components to pass through while blocking bacteria, thus separating contami-
nants (Olesen, 1989). Typically rated in terms of pore diameter, microfiltration
filters range from 0.2 to 5.0 μm. Using microfiltration, lactose, minerals, and
small proteins pass through into the permeate, whereas fat, very large proteins,
and bacteria are retained. Typically rated in terms of the largest molecular weight
molecule that can pass through the pores, ultrafiltration filters range from 10
3
to
10
5
D. Using ultrafiltration, minerals and lactose pass through into the permeate,
whereas proteins, fats, and bacteria are retained (Smith, 2000).
Although filtration can not remove all microorganisms, it can achieve a
99.99% reduction of the total bacterial count and a 99.95% reduction in the total
spore count while allowing 5–6% of the solids in the bulk liquid to flow through
into the permeate (Eckner and Zottola, 1991; Olesen, 1989). Effective bacterial
retention appears to be determined primarily by the type and manufacturer of the
72 Hayes and Boor
filter and the design and configuration of the filtration unit; the morphology of
contaminating microbes does not appear to affect bacterial retention (Eckner and
Zottola, 1991). Although the fat level does not affect bacterial retention, milk
with higher fat percentages causes membrane fouling, making this technique most
useful for treating skim milk.
E. Additional Microbial Control Methods
Several less commonly utilized techniques exist for controlling microbial growth
in milk. Addition of carbon dioxide to milk at 10–30 mm/L inhibits growth of
the common spoilage organism P. fluorescens (Muir, 1996). This technique has
been reported to extend the shelf life of refrigerated milk by several days. The
use of the natural antibiotic nisin to inhibit gram-positive bacterial growth in
milk has also been explored (Muir, 1996). Addition of nisin to milk intended for
clotted cream and processed cheese is currently approved in the United Kingdom.
Addition of lactic acid starter cultures to raw milk has been shown to inhibit
growth of psychrotrophs (Muir, 1996). Although the lactic acid bacteria do not
multiply at refrigeration temperatures, their metabolism results in a pH decrease
to below 6 and possible organoleptic changes.
VII. MICROBIOLOGY OF FLUID MILK PRODUCTS
A. Flavored Milks
The microbiology of flavored milk differs from that of unflavored milk in that
conventionally pasteurized chocolate milk typically spoils faster than convention-
ally pasteurized unflavored milk. Douglas et al. (2000) found that after 14 days
at 6°C, chocolate milk samples had higher standard plate counts and higher
psychrotrophic plate counts than unflavored milk samples from the same raw
milk batch (P H11021 .001). Further experiments indicated that the chocolate powder,
and not the additional sucrose, contributed to the increased bacterial growth. The
chocolate powder did not introduce additional microbes into the milk. Rather
microbes already present in the raw milk grew faster owing to the presence of the
chocolate powder. Rosenow and Marth, (1987) in comparing growth of Listeria
monocytogenes in skim, whole, and chocolate milk and in whipping cream also
found that chocolate milk consistently produced the highest bacterial numbers
by a factor of 10 or more.
B. Unflavored Milks
A wide variety of unflavored fluid milk products exist, including skim (H11021 0.5%
fat), 1% fat, 2% fat, and whole milk; low-lactose (H11021 30% normal milk) and low-
Raw Milk and Fluid Milk Products 73
sodium (H11021100 mg/L) milk; and half-and-half (10.5–18.0% fat), light cream (18–
30% fat), light whipping cream (30–36% fat), and heavy cream (H11022 36% fat) (US
Public Health Service, 1995). Studies indicate that the microbiology of many of
these products is quite similar. Brown et al. (1984) compared the shelf lives of
skim (0.1% fat), semiskim (1.6% fat), and whole (3.8% fat) milk at 4 and 7°C
and with and without Pseudomonas contamination and found no difference in
the rate at which samples reached 10
7
cfu/mL. Similary, Rosenow and Marth
(1987) found no difference in the growth rate of L. monocytogenes in skim and
whole milk and in whipping cream. The genera of spoilage bacteria found in
pasteurized heavy cream and their lipolytic and proteolytic activities are compara-
ble to the genera found in pasteurized milk, suggesting that fat standardization
has little impact on the microbiology of the resulting cream and milk (Phillips
et al. 1981).
Although the microbiology of various fluid milk products is similar, spoil-
age from nonmicrobial factors may vary from product to product. Recent data
suggest that UHT-processed skim and whole milk behave differently during their
respective shelf lives. Lo′pez-Fandin?o et al. (1993) found increased activity of
both native and bacterially produced proteases in UHT-processed skim milk as
compared to UHT-processed whole milk.
VIII. SUMMARY
Bacterial types and numbers present in raw milk are influenced by the health of
the lactating cow, udder preparation practices, adequacy of equipment cleaning
and sanitizing regimens, milk-cooling practices, and the length of time the milk
is held before pasteurization. Residual bacterial populations in processed products
are determined by initial numbers and types of bacteria in raw milk, time and
temperature combination used to process milk, and care taken to prevent recon-
tamination of the pasteurized product. Measures taken to protect raw and pasteur-
ized products from contamination with bacteria contribute to final product quality
and shelf life extension.
REFERENCES
Atlas RM. Handbook of Microbiological Media. Parks LC, ed. Boca Raton, FL: CRC
Press, 1993.
Austin JW, Bergeron G. Development of bacterial biofilms in dairy processing lines. J
Dairy Res 62:509–519, 1995.
Barkema HW, Schukken YH, Lam TJGM, Beiboer ML, Wilmink H, Benedictus G, Brand
A. Incidence of clinical mastitis in dairy herds grouped in three categories by bulk
milk somatic cell counts. J. Dairy Sci 81:411–419, 1998.
74 Hayes and Boor
Boor KJ. Pathogenic microorganisms of concern to the dairy industry. Dairy Food Environ
Sanit 17:714–717, 1997.
Boor KJ, Nakimbugwe DN. Quality and stability of 2%-fat ultrapasteurized fluid milk
products. Dairy Food Environ Sanit 18:78–82, 1998.
Boor KJ, Brown DP, Murphy SC, Kozlowski SM, Bandler DK. Microbiological and chem-
ical quality of raw milk in New York State. J Dairy Sci 81:1743–1748, 1998.
Bramley AJ, Dodd FH. Reviews of the progress of dairy science: mastitis control—prog-
ress and prospects. J Dairy Res 51:481–512, 1984.
Bramley AJ, McKinnon CH. The microbiology of raw milk. In: Robinson RK, ed. Dairy
Microbiology. Vol 1. The Microbiology of Milk. 2nd ed. London: Elsevier, 1990,
pp 163–208.
Bramley AJ, McKinnon CH, Staker RT, Simpkin DL. The effect of udder infection on
the bacterial flora of the bulk tank milk of ten dairy herds. J Appl Bacteriol 57:
317–323, 1984.
Brown JV, Ranjith HMP, Prentice GA. Comparative shelf-lives of skimmed, semi-
skimmed and whole milks. J Soc Dairy Technol 37:132–135, 1987.
Bylund G. Dairy Processing Handbook. Teknotext AB, ed. Lund, Sweden: Tetra Pak Pro-
cessing Systems AB, 1995.
Christen GL, Davidson PM, McAllister JS, Roth LA. Coliform and other indicator bacte-
ria. In: Marshall RT, ed. Standard Methods for the Examination of Dairy Products.
16th ed. Washington, DC: American Public Health Association, 1992, pp 247–269.
Cousin MA. Presence and activity of psychrotrophic microorganisms in milk and dairy
products: a review. J Food Prot 45:172–207, 1982.
Douglas SA, Gray MJ, Crandall AD, Boor KJ. Characterization of chocolate milk spoilage
patterns. J Food Prot 63:516–521, 2000.
Dunkley WL, Stevenson KE. Ultra-high temperature processing and aseptic packaging of
dairy products. J Dairy Sci 70:2192–2202, 1987.
Eckner KF, Zottola EA. Potential for the low-temperature pasteurization of dairy fluids
using membrane processing. J Food Prot 54:793–797, 1991.
Flowers RS, Andrews W, Donnelly CW, Koenig E. Pathogens in milk and milk products.
In: Marshall RT, ed. Standard Methods for the Examination of Dairy Products. 16th
ed. Washington, DC: American Public Health Association, 1992, pp 103–212.
Frank JF, Christen GL, Bullerman LB. Tests for groups of microorganisms. In: Marshall
RT, ed. Standard Methods for the Examination of Dairy Products. 16th ed. Wash-
ington, DC: American Public Health Association, 1992, pp 271–286.
Galton DM, Petersson LG, Merrill WG, Bandler DK, Shuster DE. Effects of premilking
udder preparation on bacterial population, sediment, and iodine residue in milk. J
Dairy Sci 67:2580–2589, 1984.
Gilmour A, Rowe MT. Micro-organisms associated with milk. In: Robinson RK, ed. Dairy
Microbiology. Vol 1. The Microbiology of Milk. 2nd ed. London: Elsevier Applied
Science, 1990, pp 37–75.
Gruetzmacher TJ, Bradley RL, Jr. Identification and control of processing variables that
affect the quality and safety of fluid milk. J Food Prot 62:625–631, 1999.
Houghtby GA, Maturin LJ, Koenig EK. Microbiological count methods. In: Marshall RT,
ed. Standard Methods for the Examination of Dairy Products. 16th ed. Washington,
DC: American Public Health Association, 1992, pp 213–246.
Raw Milk and Fluid Milk Products 75
Jay JM. Modern Food Microbiology. 6th ed. Gaithersburg, MD: Aspen, 2000.
Johnson EA, Nelson JH, Johnson M. Microbiological safety of cheese made from heat-
treated milk, Part II. Microbiology. J Food Prot 53:519–540, 1990.
Kang Y, Frank JF. Biological aerosols: a review of airborne contamination and its mea-
surement in dairy processing plants. J Food Prot 52:512–524, 1989.
Leigh JA. Streptococcus uberis: a permanent barrier to the control of bovine mastitis?
Vet J 157:225–238, 1999.
Lo′pez-Fandin?o R, Olano A, Corzo N, Ramos M. Proteolysis during storage of UHT milk:
differences between whole and skim milk. J Dairy Res 60:339–347, 1993.
Ma Y, Ryan C, Barbano DM, Galton DM, Rudan MA, Boor KJ. Effects of somatic cell
count on quality and shelf-life of pasteurized fluid milk. J Dairy Sci 83:264–274,
2000.
Mottar JF. Effect on the quality of dairy products. In: McKellar RC, ed. Enzymes of
Psychrotrophs in Raw Food. Boca Raton, FL: CRC Press, pp 227–243, 1989.
Muir DD. The shelf-life of dairy products: 1. Factors influencing raw milk and fresh prod-
ucts. J Soc Dairy Technol 49:24–32, 1996.
Munro GL, Grieve PA, Kitchen BJ. Effects of mastitis on milk yield, milk composition,
processing properties and yield and quality of milk products. Aust J Dairy Technol
39:7–16, 1984.
Murphy S. Raw milk bacteria tests: standard plate count, laboratory pasteurization count,
preliminary incubation count and coliform count—What do they mean for your farm?
Syracuse, NY: National Mastitis Council Regional Meeting Proceedings, 1997.
Olesen N, Jensen F. Microfiltration. The influence of operation parameters on the process.
Milchwissenschaft. 44:476–479, 1989.
Pankey JW. Premilking udder hygiene. J Dairy Sci 72:1308–1312, 1989.
Phillips JD, Griffiths MW, Muir DD. Growth and associated enzymatic activity of spoilage
bacteria in pasteurized double cream. J Soc Dairy Technol 34:113–118, 1981.
Politis I, Ng-Kwai-Hang KF. Effects of somatic cell counts and milk composition on
cheese composition and coagulating properties of milk. J Dairy Sci 71:1711–1719,
1988a.
Politis I, Ng-Kwai-Hang KF. Association between somatic cell counts of milk and cheese
yielding capacity. J Dairy Sci 71:1720–1717, 1988b.
Potter NN, Hotchkiss JH. Food Science. 5th ed. New York: Chapman & Hall, 1995.
Ralyea RD, Wiedmann M, Boor KJ. Bacterial tracking in a dairy production system using
phenotypic and ribotyping methods. J Food Prot 61:1336–1340, 1998.
Rodriguez-Otero JL, Hermida M, Cepeda A, Franco C. Total bacterial count in raw milk
using the BactoScan 8000. J AOAC Int 76:838–841, 1993.
Rosenow EM, Marth EH. Growth of Listeria monocytogenes in skim, whole, and chocolate
milk, and in whipping cream during incubation at 4, 8, 13, 21 and 35°C. J Food
Prot 50:452–459, 1987.
Sargeant JM, Scott HM, Leslie KE, Ireland MJ, Bahiri A. Clinical mastitis in dairy cattle
in Ontario: frequency of occurrence and bacteriological isolates. Can Vet J 39:33–
38, 1998.
Sears PM, Smith BS, English PB, Herer PS, Gonzalez RN. Shedding pattern of Staphylo-
coccus aureus from bovine intramammary infections. J Dairy Sci 73:2785–2789,
1990.
76 Hayes and Boor
Sharpe AN, Peterkin PI. Membrane Filter Food Microbiology. New York: J Wiley, 1988.
Smith K. Mechanics of membrane processes, Part 2. A focus on the dairy industry. Dairy
Pipeline, Wisconsin Center for Dairy Research, 12:6–7, 2000.
Spreer E. Milk and Dairy Product Technology. New York: Marcel Dekker, 1998.
Suhren G. Producer microorganisms. In: McKellar RC, ed. Enzymes of Psychrotrophs in
Raw Food. Boca Raton, FL: CRC Press, 1989, pp 3–34.
Torres-Anjel MJ, Hedrick TI. Spore removal by centrifugation and its effects of ultra-
high temperature commercial sterilization of milk. J Dairy Sci 54:326–330, 1971.
United States Public Health Service. Grade A Pasteurized Milk Ordinance. Publication
No. 229, Food and Drug Administration, Washington DC: 1995.
Van Werven T, Noordhuizen-Stassen EN, Daemen AJJM, Schukken YH, Brand A, Bur-
venich C. Preinfection in vitro chemotaxis, phagocytosis, oxidative burst, and ex-
pression of CD11/CD18 receptors and their predictive capacity on the outcome of
mastitis induced in dairy cows with Escherichia coli. J Dairy Sci 80:67–74, 1997.
Waage S, Mork T, Roros A, Aasland D, Hunshamar A, Odegaard SA. Bacteria associated
with clinical mastitis in dairy heifers. J Dairy Sci 82:712–719, 1999.
3
Concentrated and Dry Milks and Wheys
Warren S. Clark, Jr.
American Dairy Products Institute
Chicago, Illinois
I. INTRODUCTION
Fluid milk and whey are perishable dairy products that require proper cooling
and handling to maintain their freshness and quality. However, milk and whey
solids may be preserved for future use by various methods, the most common
of which is concentration by removing water, using either heat or membrane
methodology, followed by drying. Dairy products commonly manufactured
through the use of one or more of these processes are evaporated milks, con-
densed and sweetened condensed milks, dry milks, condensed whey products,
and dry whey products. Emphasis in this chapter is given to the major products
and similarities are made to other closely related products.
All evaporated milks and most condensed, sweetened condensed, and dry
milk products are manufactured using grade A raw milk (U.S. Public Health
Service, 1997). In some areas of the United States, condensed and dry whey
products also are made entirely from raw milk meeting grade A requirements.
Overall, however, a lesser quantity of condensed and dry whey products is manu-
factured using grade A milk. In those instances, milk that meets U.S. Department
of Agriculture (USDA) requirements (U.S. Department of Agriculture, 1972) is
used. Current estimates (D. R. Spomer, personal communication, 2000) are that
3% of the U.S. milk supply is non–grade A and that approximately 5% of domes-
tic manufactured dairy products (condensed and dry milks, condensed and dry
wheys, cheese, and butter) are made from milk meeting USDA requirements. All
milk and whey used to manufacture concentrated and dry milk and whey products
are pasteurized (see Chapter 2).
77
78 Clark
II. CONDENSED MILK
Bulk condensed milk may be manufactured using either whole or skim milk.
Typically, milk is pasteurized and then concentrated by heat in an evaporator
until the product contains 40–45% total solids. Following concentration, the
product may be dried or distributed for use as a concentrated milk. A detailed
processing scheme for condensed milk is shown in Fig. 1. Most condensed whole
milk is used as an ingredient in chocolate/confectionery, bakery, or dairy (frozen
dessert) industries; condensed skim milk not subsequently dried is used primarily
within the dairy industry (American Dairy Products Institute, 1999a). These prod-
ucts are not commercially sterile and, when intended for shipment as an ingredi-
ent, they immediately are cooled and continuously held at temperatures below
7°C (45°F). Microorganisms surviving the heat treatments usually are thermodu-
ric or thermophilic types. Under proper handling and storage conditions, these
organisms grow slowly, if at all, and are not expected to create keeping quality
Figure 1 Processing scheme for condensed milk.
Concentrated and Dry Milks and Wheys 79
problems. If spoilage occurs, it usually is attributed to postheating contamination.
Psychrotrophic bacteria, yeasts, or molds may cause spoilage if product is held
for unusually long periods or under improper storage conditions.
III. SWEETENED CONDENSED BULK AND CANNED MILK
The primary difference between condensed and sweetened condensed milks is
addition of sugar. Sweetened condensed milk is preserved by addition of sugar,
which reduces water activity to a point inhibitory to most microorganisms. The
increased milk solids content also decreases the water activity. The sugar-in-
water concentration of sweetened condensed milk is called the sugar ratio, which
is calculated as follows:
% Sugar in condensed milk
100 H11002 Total milk solids in condensed milk
H11003 100 H11005 Sugar ratio
Like condensed milk, sweetened condensed milk may be as whole milk or
skim milk and be used either in bulk or consumer (canned) form. Most sweetened
condensed milk is whole and is used in bulk in bakery and confectionery indus-
tries. With modern processing, storage, and handling practices, spoilage seldom
is encountered. If the bulk product is improperly handled or held for extended
periods before use, surface growth of yeasts or molds may occur. These micro-
organisms are the most common cause of spoilage of sweetened condensed milks.
Their presence is indicative of unsanitary postpasteurization conditions. The con-
sumer (canned) product has been thermally processed and is commercially sterile
(see Sec. IV).
IV. EVAPORATED MILKS
A. History
Evaporated milk, like other processed canned foods, originated with the experi-
ments of the French scientist Nicholas Appert (Clark, 2000a). Appert, whose
work on food preservation began in 1795, was the first person to evaporate milk
by boiling it in an open container and then preserving it by heating the product
in a sealed container. Fifty years later, another French scientist, Louis Pasteur,
laid the scientific foundation for heat preservation through demonstrations that
food spoilage could be caused by bacteria and other microorganisms.
Patents dealing with preservation of milk after evaporation in a vacuum
were granted to Gail Borden by the United States and England in 1856. These
80 Clark
patents applied to concentrating milk without addition of sugar. In 1884, U.S.
patent number 308,421 was issued for ‘‘an apparatus for preserving milk’’ and,
in 1885, the first commercial evaporated milk plant in the world was opened
in a converted wool factory in Highland, IL, where ‘‘evaporated cream’’ was
manufactured and sold (Clark, 2000a).
B. Products and Processing
Evaporated milk is a canned whole milk concentrate to which a specified quantity
of vitamin D has been added and to which vitamin A may be added. It conforms
to the U.S. Food and Drug Administration (FDA) Standard of Identity 21 CFR
131.130 (U.S. Department of Health and Human Services, 1999a), having a mini-
mum of 6.5% milkfat, 16.5% milk solids-not-fat, 23% total milk solids, and 25
IU vitamin D per fluid ounce. Related evaporated milk products are evaporated
skim milk, evaporated low-fat milk, evaporated filled milk, and evaporated goat’s
milk. Evaporated skim milk contains not less than 20% of total milk solids, not
more than 0.5% milkfat, with added vitamins of 25 IU vitamin D and 125 IU
vitamin A per fluid ounce. Typical compositions for other evaporated milk prod-
ucts are as follows:
Evaporated low-fat milk: 2% milk fat, 18% nonfat milk solids, vitamins
A and D added
Evaporated filled milk: 6% vegetable fat, 17.5% nonfat milk solids, vita-
mins A and D added
Evaporated goat’s milk: not less than 7% milkfat and 15% nonfat milk
solids, vitamin D added
A typical processing scheme for evaporated milk (Fig. 2) begins with high-
quality, fresh whole milk to which vitamins, emulsifiers, and stabilizers are
added. The product is then pasteurized, concentrated under reduced pressure in
an evaporator, homogenized, cooled, and standardized to the composition desired
in the final product. After cans are filled and sealed, they are sterilized in a three-
phase continuous system consisting of preheater, retort, and cooler and then la-
beled and packed for shipment. In the United States, evaporated milk is packed
in 5–, 12–, and 97–fl oz lead-free cans. In 1999, production of evaporated milk
and related products (evaporated skim milk, evaporated low-fat milk, and evapo-
rated filled milk) was slightly more than 477 million pounds (American Dairy
Products Institute, 2000).
Evaporated milk processing is covered by FDA regulations dealing with
thermally processed low-acid foods packaged in hermetically sealed containers
(U.S. Department of Health and Human Services, 1999b). Therefore, manufactur-
ers of evaporated milk and related products must comply with stringent pro-
Concentrated and Dry Milks and Wheys 81
Figure 2 Processing scheme for evaporated milk.
cessing regulations, including establishment and filing of scheduled processes
with the FDA and maintenance of strict processing records.
C. Microbiology
Because of the heat processes and packaging used to manufacture evaporated
milks, the product is commercially sterile. This means that the product is free of
all microorganisms of public health significance and does not show microbial
82 Clark
defects during its intended shelf life under normal conditions of handling, storage,
and distribution. Whereas vegetative cells do not survive evaporated milk pro-
cessing, and absolute sterility is obtained in most cans, small numbers of non-
pathogenic spores occasionally may survive the heat treatment and, depending
on the microorganism and its previous growth and heat exposure, subsequently
may germinate (Curran and Evans, 1945). Kalogridou-Vassiliadou (1992) studied
40 strains of bacilli implicated in causing flat sour spoilage in evaporated milk.
The microorganisms were identified as Bacillus stearothermophilus (five strains),
B. licheniformis (10 strains), B. coagulans (15 strains), B. macerans (five strains),
and B. subtilis (five strains). Species of the genus Bacillus (i.e., cereus, coagulans,
megatherium, stearothermophilus, and subtilis) earlier were implicated in evapo-
rated milk spoilage (Foster et al., 1957; Hammer and Babel, 1957). Langeveld
et al. (1996), in studies of B. cereus naturally present in raw milk, reported no
evidence that this organism would cause intoxication in healthy adult humans at
levels less than 10
5
/mL. Beard et al. (1999) and Wandling et al. (1999) studied the
effects various concentrations of the bacteriocin nisin had on thermal resistance of
Bacillus spores in dairy products. They reported that although addition of nisin
lowered decimal reduction times (D values) for spores of B. cereus, B. stearother-
mophilus, and B. licheniformis, it apparently required specific nutrients to sensi-
tize spores to heat. Medium composition, exposure time, and pH also had an
effect on the heat sensitivity. Classic studies (Curran and Evans, 1945; Theophi-
lus and Hammer, 1938) on the microbiology of evaporated milk have contributed
significantly to the knowledge of the microbiology of this product.
Under current continuous processing conditions wherein heat treatments
of 117–121°C (242–250°F) for 10–15 min are common, and batch retorting is
uncommon, spoilage of evaporated milk is unlikely to be encountered. Specific
methods for microbiological examination of evaporated milk are contained in
Standard Methods for the Examination of Dairy Products (Marshall, 1992).
V. DRY MILKS
A. History
Development of the dry milk industry stems from the days of Marco Polo in the
13th century. It is reported that Marco Polo encountered sun-dried milk on his
journeys through Mongolia and that, from this beginning, dry milk products
evolved (Clark, 2000b). Through early pioneering scientists, such as Appert and
Borden, the basic methods were developed for the emergence of processes for
drying milk products. Ekenberg and Merrill have been acknowledged as develop-
ers of the first commercial roller- and spray-process drying systems, respectively,
in the United States (Beardslee, 1948). Since initial development of commercial
Concentrated and Dry Milks and Wheys 83
drying systems, significant technological advances have been made, resulting in
the manufacture of a variety of dry milk products.
B. Products and Processing
The primary dry milk products manufactured domestically are nonfat dry milk,
dry whole milk, and dry buttermilk. Nonfat dry milk is the product resulting from
removal of fat and water from milk. It contains lactose, milk proteins, and milk
minerals in the same relative proportions as the fresh milk from which it is made.
Nonfat dry milk contains not more than 5% by weight of moisture. The fat content
is not more than 1.5% by weight unless otherwise indicated. Dry whole milk is
the product resulting from removal of water from milk and contains not less than
26% milkfat and not more than 4% moisture. Dry whole milks with milkfat con-
tents of 26.0 and 28.5% are most commonly produced. Dry buttermilk is the
product resulting from removal of water from liquid buttermilk derived from
manufacture of butter. It contains not less than 4.5% milkfat and not more than
5% moisture.
Steps in a typical dry milk processing operation include (a) receipt of fresh,
high-quality milk delivered in refrigerated, stainless-steel bulk tankers; (b) clari-
fication, and, if nonfat dry milk is to be manufactured, (c) separation. The milkfat
removed usually is churned into butter. If dry whole milk is to be manufactured,
the separation step is omitted but may be replaced by a standardization procedure.
Pasteurization by a continuous high-temperature short-time (HTST) process,
whereby every particle of milk is subjected to a heat treatment of at least 72°C
(161°F) for 15 s is accomplished next. Holding the pasteurized milk at an elevated
temperature for an extended period (85°C [185°F] for 20–30 min) is used in the
manufacture of high-heat nonfat dry milk, which commonly is used as an ingredi-
ent in bakery or meat products. Following concentration of milk by removing
water in an evaporator until a milk solids content of at least 40% is reached, the
product enters the dryer for final moisture removal.
Commercial U.S. drying processes are of two types: spray and roller
(drum). Currently, the latter is used to a limited extent and primarily for prod-
uct intended for other than human consumption. Two basic configurations of
spray dryers are in use: horizontal (box) and vertical (tower). In both, the pas-
teurized and concentrated milk is directed under pressure to a spray nozzle
(horizontal dryer) or to either a spray nozzle or an atomizer (vertical dryer)
where the dispersed liquid then comes into contact with a current of filtered,
heated air. The droplets of milk are dried almost immediately and fall to the
bottom of the fully enclosed stainless steel drying chamber. The dry milk product
is continuously removed from the drying chamber, transported through a cooling
and collecting system, and finally conveyed into a hopper for packaging, usually
84 Clark
Figure 3 Processing scheme for dry milk.
in 50-lb bags or in tote bins. Figure 3 reflects a typical processing scheme for
dry milk.
In processing nonfat dry milk, various heat treatments may be applied to
give the finished dry milk product desirable functional characteristics. Three heat-
treatment classifications, based on the use of the whey protein nitrogen test, are
of practical importance in indicating the suitability of spray-process nonfat dry
milk for specific purposes (American Dairy Products Institute, 1990). Instant-
type dry milks are processed by special methods that result in products with
improved solubility. Instant nonfat dry milk is defined by its solubility index
value (American Dairy Products Institute, 1990).
Concentrated and Dry Milks and Wheys 85
The American Dairy Products Institute (1999a) publishes annual census
figures that reflect markets of end use for dry milk products, which may be refer-
enced for further information about quantities of dry milks processed and their
use. In 1998, U.S. production of nonfat dry milk was 1.1 billion pounds, dry
whole milk production was 139 million pounds, and dry buttermilk production
was 49 million pounds (American Dairy Products Institute, 1999a).
C. Standards
Industry microbiological standards for dry milk products are established by the
American Dairy Products Institute. In addition, government standards for these
products also have been generated by the USDA and the FDA (U.S. Public Health
Service, 1995). Table 1 shows these standards by source, product, and, as applica-
ble, grade.
D. Microbiology
Relatively few species of bacteria have been reported as naturally occurring in
dry milks. Hammer and Babel (1957) and Foster et al. (1957), in earlier texts
covering the microbiology of dry milk products, summarized literature reports
indicating microorganisms of the genera Streptococcus, Micrococcus, Bacillus,
Clostridium, and Sarcina as comprising the primary microflora of dry milks.
Rodriquez and Barrett (1986), based on a study of the microbial population and
growth in reconstituted dry milk, confirmed the occurrence of viable cells of the
genera Bacillus and Micrococcus in nonfat and dry whole milks.
Since initiation of the requirement that all milk be pasteurized before dry-
ing, current heat treatments used to process dry milks destroy all microorganisms
of public health significance. Relatively low numbers of microorganisms survive
processing, and those heat-resistant organisms (both spore-forming and non–
spore-forming types) rarely, if ever, are responsible for finished product deteriora-
tion. Because the drying process is accomplished in a completely closed system,
postprocessing contamination also is rare. When such occurs, it usually is from
an airborne source. Because of low moisture levels in dry milks, those viable
organisms that may be present are unable to grow and decrease in number during
storage. Specific methods for microbiological examination of dry milks are con-
tained in Standard Methods for the Examination of Dairy Products (Marshall,
1992).
Spray-dried milks have been implicated in outbreaks of staphylococcal
food poisoning (Anderson and Stone, 1955; Armijo et al., 1957). In both in-
stances, illness were caused by a preformed enterotoxin that was not inactivated
by the drying process. Miller et al. (1972), in a study of the effect of spray drying
on survival of Salmonella and Escherichia coli, reported that heat treatments
86
Clark
Table 1 Microbiological Standards for Condensed and Dry Milk Products
a
American Dairy Products United States Department of Food and Drug Administration
Product Institute standards
b
Agriculture standards
b
(grade A) standards
Condensed milk None None Bacterial estimate: 30,000/g
Coliform: 10/g
Nonfat dry milk
Extra grade SPC: 10,000/g SPC: 10,000/g Bacterial estimate: 30,000/g
Coliform: 10/g Coliform: 10/g Coliform: 10/g
Standard grade SPC: 75,000/g SPC: 75,000/g
Coliform: 10/g Coliform: 10/g
Dry whole milk
Extra grade SPC: 10,000/g SPC: 10,000/g None
Coliform: 10/g Coliform: 10/g
Standard grade SPC: 50,000/g SPC: 50,000/g
Coliform: 10/g Coliform: 10/g
Dry Buttermilk
Extra grade SPC: 20,000/g SPC: 20,000/g Bacterial estimate: 30,000/g
Coliform: 10/g Coliform: 10/g Coliform: 10/g
Standard grade SPC: 75,000/g SPC: 75,000/g
Coliform: 10/g Coliform: 10/g
DMC, direct microscopic clump count; SPC, standard plate count.
a
All counts expressed as ‘‘not more than.’’
b
DMC may not exceed 100 million/g for ADPI- and USDA-graded nonfat dry milk and dry whole milk.
Concentrated and Dry Milks and Wheys 87
typically associated with spray drying could not be counted on to supplant ade-
quate pasteurization and postdrying sanitary procedures. Bradshaw et al. (1987),
in studies of the thermal resistance of disease-associated Salmonella Typhimu-
rium in milk, reported the organism did not survive pasteurization.
Doyle et al. (1985) studied survival of Listeria monocytogenes during man-
ufacture and storage of nonfat dry milk. Concentrated (30% solids) and unconcen-
trated skim milks were inoculated with 10
5
–10
6
L. monocytogenes/mL. They
reported reductions of 1.0–1.5 log
10
L. monocytogenes/g occurred during the
spray drying process and that the organism progressively died during storage.
The inoculated milks were not pasteurized before drying. Bradshaw et al. (1985)
and Donnelly et al. (1987) reported that L. monocytogenes did not survive in
milk during pasteurization. Earlier studies (Nichols, 1939; Higginbottom, 1944)
also reported on destruction of microorganisms during drying and the fate of
surviving organisms during storage.
VI. DRY WHEY PRODUCTS
A. History
Although spray and roller processes have been used to dry whey for many years,
development of a whey processing industry in the United States did not fully
materialize until organization of the Whey Products Institute in 1971 (Clark,
1991). At that time, development of product identity and quality standards was
undertaken as a guide to production of uniformly high-quality whey products.
In 1981, the FDA accepted industry-recommended common and usual names for
a variety of whey products and affirmed the generally recognized as safe (GRAS)
status of these products and their method of manufacture (U.S. Department of
Health and Human Services, 1981). Technological changes associated with whey
processing are dynamic. In no area of the modern dairy industry have changes of
a technical nature been as innovative and rapid as in the whey products segment.
Important applications to whey processing include the use of selective membrane
techniques that allow various whey constituents to be separated into protein-,
carbohydrate-, or mineral-rich streams, which then may be further processed and
made available in concentrated functional forms. Significant further develop-
ments, reflecting continuing changes, are anticipated in this area.
B. Products and Processing
The primary whey products currently manufactured in the United States are con-
centrated and dry whey and the modified whey products, including reduced-lac-
tose whey, reduced-minerals whey, and whey protein concentrate. Other modified
whey products manufactured in smaller quantities include lactalbumin (minimum
88 Clark
protein content 80%) and whey protein isolate (minimum protein content 90%).
Lactose, the carbohydrate of milk, also is being produced in large quantities as
a coproduct with the manufacture of modified wheys. Table 2 defines the com-
monly known whey products currently being manufactured.
A typical processing scheme for manufacture of dry whey is shown in
Figure 4. Some whey-drying operations receive only condensed whey for pro-
cessing; others receive condensed and fresh fluid whey. The solids concentration
of transported condensed whey and the time-temperature conditions of its ship-
ment determine how the product is processed before entering the drying system.
Currently, the USDA requires all condensed whey containing less than 40% sol-
ids to be pasteurized or repasteurized in the processing plant where it is to be
dried. The process of drying is similar to that used to manufacture dry milks,
and some processing plants may dry both products interchangeably.
Processing operations to manufacture modified whey products include re-
verse osmosis, ultrafiltration, and electrodialysis procedures, some of which may
be proprietary in nature. For more information on these processes, various pub-
lished texts (Sienkiewicz and Riedel, 1990; Gillies, 1974) may be consulted.
The American Dairy Products Institute (1999b) publishes data annually that
reflect production and utilization trends for whey products. In 1998, nearly 2.2
billion pounds of whey solids were processed in the United States as follows:
1.2 billion pounds of dry whey; 109 million pounds (solids) as condensed whey;
105 million pounds of reduced-lactose and reduced-minerals whey; 285 million
pounds of whey protein concentrate; and 454 million pounds of lactose.
Table 2 Composition of Whey Products
Major parameters (%)
a
Name of product Protein Fat Ash Lactose Moisture
Whey
b
10–15 0.2–2.0 7–14 61–75 1–8
Concentrated whey
b
10–15 0.2–2.0 7–14 61–75 1–8
Dry or dried whey
b
10–15 0.2–2.0 7–14 61–75 1–8
Reduced-lactose whey
b
16–24 0.2–4.0 11–27 60 max 1–6
Reduced-minerals whey
b
10–24 0.2–4.0 7 max 85 max 1–6
Whey protein concentrate
b
25 min 0.2–10.0 2–15 60 max 1–6
Whey protein isolate
c
90 min N/A 6 max 6 max 6 max
Dairy product solids
c
10 max N/A 27 max 59 min 6 max
Lactose
b
N/A N/A 0.3 98 min 4–6
a
On dry product basis.
b
FDA affirmation of direct food substances as generally recognized as safe.
c
FDA concurrence with ADPI notification of generally recognized as safe status.
Concentrated and Dry Milks and Wheys 89
Figure 4 Processing scheme for manufacture of dry whey.
C. Standards
As for dry milk products, industry microbiological standards for whey products
have been established by the American Dairy Products Institute, the USDA, and
the FDA. Table 3 shows current microbiological standards for whey products.
D. Microbiology
As drying processes for whey are essentially the same as those for milk, the
discussion of dry milk microbiology also applies to dry whey. Microbiological
methods to assay the quality of whey products are contained in Standard Methods
for the Examination of Dairy Products (Marshall, 1992). Cultural or direct micro-
90 Clark
Table 3 Microbiological Standards for Whey Products
a
American Dairy United States
Products Department of
Institute Agriculture Food and Drug Administration
Product standards standards (grade A) standards
b
Condensed whey None None Bacterial estimate: 30,000/g
Coliform: 10/g
Dry whey SPC: 30,000/g SPC: 30,000/g Bacterial estimate: 30,000/g
Coliform: 10/g Coliform: 10/g Coliform: 10/g
SPC, standard plate count.
a
All counts expressed as ‘‘not more than.’’
b
Includes grade A dry whey and dry whey products.
scopic (DMC) procedures may be used. If using the latter, it must be understood
that most whey processed is derived from cheese manufactured using bacterial
cultures; thus, large numbers of viable lactic organisms are present in fresh whey.
Except for the more heat-resistant strains of lactic bacteria, these organisms are
not expected to survive pasteurization and are not detected by cultural techniques.
However, when freshly dried whey is examined by direct microscopic techniques,
cells of nonviable bacteria often stain. Therefore, results of DMC techniques used
to assess the quality of dry whey must be interpreted with care.
Merin (1986), in a study of the microfiltration of whey using 1.2-μm pore
size membranes, reported that membranes reduced bacterial counts by one to
three times and that increased fat content in the feed stream governed the de-
crease. Fat trapped on the membrane formed a barrier to microorganism penetra-
tion into the permeate.
REFERENCES
American Dairy Products Institute. Standards for grades of dry milks including methods
of analysis. Chicago, 1990, as revised.
American Dairy Products Institute. Dry milk products. Utilization and production trends,
1998. Chicago, 1999a.
American Dairy Products Institute. Whey products. Utilization and production trends,
1998. Chicago, 1999b.
American Dairy Products Institute. Evaporated milk production. Chicago, 2000.
Anderson PHR, Stone DM. Staphylococcus food poisoning associated with spray-dried
milk. J Hyg 53:387, 1955.
Armijo R, Henderson DA, Timothee R, Robinson HB. Food poisoning outbreaks associ-
Concentrated and Dry Milks and Wheys 91
ated with spray-dried milk. An epidemiologic study. Am J Public Health 47:1093,
1957.
Beard, BM, Sheldon, BW, Foegeding, PM Thermal resistance of bacterial spores in milk-
based beverages supplemented with nisin. J Food Prot 62:484, 1999.
Beardslee CE. Dry milks. The Story of an Industry. Chicago: American Dry Milk Institute,
1948.
Bradshaw JG, Peeler JT, Corwin JJ, Hunt JM, Tierney JT, Larkin EP, Twedt RM. Thermal
resistance of Listeria monocytogenes in milk. J Food Prot 48:743, 1985.
Bradshaw JG, Peeler JT, Corwin JJ, Barnett JE, Twedt RM. Thermal resistance of disease
associated Salmonella typhimurium in milk. J Food Prot 50:95, 1987.
Clark WS Jr. Whey processing: history and development. In: Hui YH, ed. Encyclopedia
of Food Science and Technology. New York: Wiley, 1991, pp 2845–2847.
Clark WS Jr. Evaporated milk. In: Francis, FJ, ed. Wiley Encyclopedia of Food Science
and Technology. 2nd ed. New York: Wiley, 2000a, pp 661–662.
Clark WS Jr. Dry milk. In Francis, FJ, ed. Wiley Encyclopedia of Food Science and Tech-
nology. 2nd ed. New York: Wiley, 2000b, pp 540–542.
Curran HR, Evans FR. Heat inactivation inducing germination in the spores of the ther-
motolerant and thermophilic aerobic bacteria. J Bacteriol 49:335, 1945.
Donnelly CW, Briggs EH, Donnelly LS. Comparison of heat resistance of Listeria mono-
cytogenes in milk as determined by two methods. J Food Prot 50:14, 1987.
Doyle MP, Meske LM, Marth EH. Survival of Listeria monocytogenes during the manu-
facture and storage of nonfat dry milk. J Food Prot 48:740, 1985.
Foster EM, Nelson FE, Speck ML, Doetsch RN, Olson JC Jr. Dairy Microbiology. Engle-
wood Cliffs, NJ: Prentice-Hall, 1957.
Gillies MT. Whey Processing and Utilization. Park Ridge, NJ: Noyes Data, 1974.
Hammer BW, Babel FJ. Dairy Bacteriology. 4th ed. New York: Wiley, 1957.
Higginbottom C. Bacteriological studies of roller-dried milk powders, roller-dried butter-
milk and of roller- and spray-dried whey. J Dairy Res 13:308, 1944.
Kalogridou-Vassiliadou D. Biochemical activities of Bacillus species isolated from flat
sour evaporated milk. J Dairy Sci 75:2681, 1992.
Langeveld LPM, van Spronsen WA, van Beresteijn ECH, Notermans SHW. Consumption
by healthy adults of pasteurized milk with a high concentration of Bacillus cereus:
a double blind study. J Food Prot 59:723, 1996.
Marshall RT, ed. Standard Methods for the Examination of Dairy Products. 16th ed. Wash-
ington, DC: American Public Health Association, 1992.
Merin U. Bacteriological aspects of microfiltration of cheese whey. J Dairy Sci 69:326,
1986.
Miller DL, Goepfert JM, Amundson CH. Survival of salmonellae and Escherichia coli
during the spray drying of various food products. J Food Sci 37:828, 1972.
Nichols AA. Bacteriological studies of spray-dried milk powder. J Dairy Res 10:202,
1939.
Rodriquez MH, Barrett EL. Changes in microbial population and growth of Bacillus cereus
during storage of reconstituted dry milk. J Food Prot 49:680, 1986.
Sienkiewicz T, Riedel CL. Whey and Whey Utilization. 2nd ed. Gelsenkirchen-Buer, Ger-
many: Verlag Th. Mann, 1990.
Theophilus DR, Hammer BW. Influence of growth temperature on the thermal resistance
92 Clark
of some bacteria from evaporated milk. IA. Agr Exp Sta Res Bull No. 244,
1938.
U.S. Department of Agriculture, Agricultural Marketing Service. Milk for manufacturing
purposes and its production and processing; requirements recommended for adop-
tion by state regulatory agencies. Federal Register 37:7046, 1972, as amended by
FR 50:34726, 1985, and FR 58:86, 1993, and FR 61:48120, 1996. Washington,
DC: U.S. Government Printing Office.
U.S. Department of Health and Human Services, Food and Drug Administration. Code
of Federal Regulations. Part 184. Direct food substances affirmed as generally rec-
ognized as safe. Federal Register 46:44439, 1981, as amended by FR 47:7410, 1982,
and FR 54:24899, 1989. Washington, DC: U.S. Government Printing Office, 1999a.
U.S. Department of Health and Human Services, Food and Drug Administration. Code of
Federal Regulations. Part 131. Milk and cream. Washington, DC: U.S. Government
Printing Office, 1999b, pp 275–276.
U.S. Department of Health and Human Services, Food and Drug Administration. Code
of Federal Regulations. Part 113. Thermally processed low-acid foods packaged in
hermetically sealed containers. Washington, DC: U.S. Government Printing Office,
1999c, pp 216–242.
U.S. Public Health Service. Grade A Condensed and Dry Milk Ordinance. Supplement 1
to the Grade A Pasteurized Milk Ordinance, 1995 Recommendations. Washington,
DC: U.S. Department of Health and Human Services, Public Health Service, Food
and Drug Administration, 1995.
U.S. Public Health Service. Grade A Pasteurized Milk Ordinance. Publication No. 229.
Washington, DC: U.S. Department of Health and Human Services, Public Health
Service, Food and Drug Administration, 1997.
Wandling LR, Sheldon BW, Foegeding PM Nisin in milk sensitizes Bacillus spores to
heat and prevents recovery of survivors. J Food Prot 62:492, 1999.
4
Frozen Desserts
Robert T. Marshall
University of Missouri
Columbia, Missouri
I. INTRODUCTION
The temperatures at which ice cream is produced, stored, and served are below
freezing, and microbial growth is of no concern. Because the viability of many
microorganisms is preserved by freezing, this treatment is not expected to be
lethal for microorganisms. Freezing and frozen storage are detrimental to some
microorganisms, and these effects are discussed later in this chapter. Although
ice cream itself does not suffer direct microbial spoilage, several ingredients of
ice cream are susceptible to spoilage, because they are held at temperatures suit-
able for microbial growth.
A major concern of the ice cream industry is the potential for frozen des-
serts to be carriers of pathogenic microorganisms and of microbial toxins. Sources
of disease producers and methods of protecting consumers from them are impor-
tant topics for discussion in this chapter.
Some frozen desserts, particularly frozen yogurt, depend on microbial
growth to produce typical flavor and textural characteristics. Some of the bacteria
used in yogurt fermentation are thought to provide health benefits and are called
probiotics. The beans used to produce vanilla and chocolate flavors are fermented
by microorganisms under controlled conditions.
This chapter describes and defines frozen desserts, considers their major
ingredients and the potential contribution of those ingredients to the microflora
of the finished product, describes processing of mixes, and explores the freezing,
storage, distribution, and serving of frozen desserts. Finally, regulations and qual-
ity assurance are discussed.
93
94 Marshall
II. ENVIRONMENTAL SOURCES OF CONTAMINANTS
Outbreaks of foodborne disease from pasteurized dairy foods in the 1970–1985
period prompted the U.S. Food and Drug Administration (FDA) to launch the
Dairy Product Safety Initiative in 1985. A part of this program was microbiologi-
cal surveillance of finished products for pathogenic bacteria. Potential pathogens
were isolated from samples collected in 70 (6.9%) of 1016 plants surveyed during
the second year of the program. Among the isolates were Yersinia enterocolitica
(3.2%), Listeria spp. (2.9%), and miscellaneous isolates of Salmonella, Aeromo-
nas hydrophila, and other pathogenic species (0.8%). Positive test results were
associated with postpasteurization contamination (U.S. Food and Drug Adminis-
tration, 1987).
Klausner and Donnelly (1991) surveyed 34 dairy processing plants in Ver-
mont, focusing on floors and other nonproduct surfaces. Y. enterocolitica and
other strains of Yersinia were isolated from 10.5 and 2.5% of the sites, respec-
tively. The incidence of Listeria innocua (16.1%) was high compared with that
of L. monocytogenes (1.4%). Pathogens were significantly more likely to be found
in wet than in dry areas (P H11021 .05). This points to the importance of depriving
microorganisms of water. Although sanitizing floor mats and foot baths are de-
signed to reduce the incidence of transmission of bacteria by personnel, data from
the study by Klausner and Donnelly indicate these devices may be sources of
bacteria if they are not properly cleaned and refreshed with sanitizer.
A survey for listeriae in frozen milk product plants in California by Walker
et al. (1991) revealed an incidence of 12% among 922 samples. Among the 39
plants sampled, L. monocytogenes and L. innocua were the single species recov-
ered in 5 and 13 plants, respectively, and both species were recovered from 9
plants. No listeriae were isolated from 12 plants. A single species dominated at
any particular site. Although floor drains have been major sources of Listeria in
dairy plants, no isolates were made from drains in nine plants where they were
present in other selected sites. The investigators suggested that increased aware-
ness of high risks of drain-associated Listeria may have directed much attention
to them even though other areas in the plant were neglected. Workers in Finland
(Miettinen et al., 1999) monitored production environment, equipment, and ice
cream from one plant during 1990–1997. Using pulsed-field gel electrophoresis,
they identified 12 different endonuclease digestion patterns among the 41 isolates
of L. monocytogenes. One strain persisted for 7 years. Samples became negative
after the facility was modified structurally and cleaning and disinfection practices
were improved.
Whereas confidential reports from industry laboratories indicate that it is
not unusual to find listeriae in environmental samples, it is unusual to find them
in finished product. The rationale for this is that hygienic practices common to
the frozen desserts industry are effective in preventing transfer of pathogens from
Frozen Desserts 95
the environment to pasteurized product. FDA enforcement reports for the years
1997–1999 record six recalls of ice cream and frozen yogurt products because
of potential contamination with L. monocytogenes (FDA Enforcement Reports,
http://www.fda.gov/bbs/topicws/ENFORCE/ENF00498.HTML). In contrast,
there were 14 recalls of cheeses and cheese products because of contamination
with L. monocytogenes. During the same time, there were recalls of frozen des-
serts for the reasons cited and of the following numbers, respectively: undeclared
or unspecified nut ingredient, 16; undeclared color additive, 7; undeclared egg
ingredient, 6; undeclared wheat or corn flour, 5; environmental contaminants
(metal, calcium chloride, and ammonia), 4.
Recent studies of microbiological quality of frozen desserts have revealed
varying numbers of undesirable bacteria. For example, Nichols and de Louvois
(1995) reported that the microbiological quality of commercially produced ice
cream in the United Kingdom has been generally good with the occasional out-
breaks related to ice cream usually caused by Salmonella Enteritidis from raw
eggs in noncommercial ice cream. However, nearly one-third of 46 samples of
ice cream from markets in Ankara, Turkey, failed to meet Turkish standards of
quality, and fecal coliforms were found in 15% of them (Kocak et al., 1998).
Masud (1989) found that among 50 samples of commercial ice cream in the
Pakistani market, 72% had total viable counts of more than 10
6
/g and 66% had
coliform counts between 10
2
and 10
3
/g. Of 122 samples of vanilla ice cream
manufactured by eight firms in Caracas, Venezuela, 43 and 77% failed to comply
with international standards proposed for the aerobic plate count and Enterobac-
teriaceae count, respectively (de Tamsut and Garcia, 1989).
III. COMPOSITION AND CHARACTERISTICS
Ice cream is a frozen foam. The continuous phase is a viscous syrup that makes
up 18–20% of the volume at 0°C. The suspended phase consists of tiny air cells,
ice crystals, fat globules, and colloidal substances (principally casein and stabiliz-
ing gums). These components occupy about 45, 25, 5, and 3% of the volume,
respectively, when the overrun is 90%. Microorganisms are also suspended in
the continuous phase. Their viability is mainly affected by the pH, osmotic pres-
sure, and their abilities to withstand high concentrations of salts plus the physical
forces of ice crystals.
Freezing results in concentration of dissolved substances in the syrup. Sub-
stances detrimental to microorganisms include acids, salts, and, for some bacteria,
sugars. In general, the order of survival of microorganisms in frozen desserts,
ranked from highest to lowest survivability, is (a) bacterial spores, (b) spores of
molds and yeasts, (c) gram-positive bacteria, (d) vegetative cells of molds and
yeasts, and (e) gram-negative bacteria. Microbial toxins are resistant to freezing.
96 Marshall
Ice cream contains from approximately 34 to 44% total solids. The most
abundant component is carbohydrates, especially sugars. A typical full-fat for-
mula may include 12% sucrose and 6% lactose as well as approximately 2%
glucose and maltose from corn sweeteners. (These monosaccharides and disac-
charides are listed as sugars in current nutritional labeling practice.) Additionally,
such a formula includes approximately 4% higher saccharides from hydrolyzed
corn starch. These carbohydrates lower the freezing point of the mix to about
H110023°C (26.6°F). The characteristic mix also contains approximately 1% ash,
which is made up of minerals, especially calcium, magnesium, and phosphorus.
As ice is frozen out of the continuous phase, dissolved substances become
increasingly concentrated, and the freezing point of this phase decreases. As the
amount of available water decreases, pH also decreases, especially in the highly
acidic products, frozen yogurt, sherbet, and sorbet, and osmotic pressure and
viscosity increase. If heat is steadily and continuously removed, the cryohydric
point of the least-soluble substance is reached ultimately. At this temperature,
this substance starts to precipitate, and latent heat of fusion is released. Therefore,
the rate of decline in temperature is slowed until that substance is precipitated.
There is a large number of substances in ice cream that may precipitate; therefore,
during freezing, rates of temperature decline are not expected to be constant once
eutectic points begin to be reached.
An unstable rate of decrease in temperature of ice cream being frozen is
not expected to be a factor in survival of microorganisms, but formation of crys-
tals and increasing concentrations of salts are likely to be detrimental. Salts tend
to destabilize proteins and lipoproteins, and renaturation of them on thawing does
not always occur. This is especially important for permeases that are located on
the exterior of the cell. Sugars, however, may protect microorganisms from injury
by freezing. Luyet (1962) suggested that microorganisms that best survive freez-
ing are those that are able to dehydrate themselves most rapidly. Such cells are
able to reduce the number of intracellular ice crystals that form, crystals that may
puncture the cytoplasmic membrane.
Others have shown that cold-shock proteins are produced by some bacteria
and that these have a protective effect against freezing. The temperature that
stimulated production of the proteins varied with the bacterium: 4°C with psych-
rotrophic Pseudomonas fluorescens KUIN-1 (Obata et al., 1998); 10°C with
Lactococcus lactis ssp. cremoris (Broadbent and Lin, 1999) and with Salmonella
Enteritidis (Jeffreys et al., 1998); 20°C with Streptococcus thermophilus
CNRZ302 (100-fold increase in survival after four freeze-thaw cycles compared
to mid–exponential phase cells grown at 42°C) (Wouters et al., 1999); 25°C with
Lactobacillus acidophilus (Lorca, 1998).
L. monocytogenes, which is notably resistant to cold temperatures, contains
an unusually high proportion of branched chain fatty acids (H1102285%). Furthermore,
Frozen Desserts 97
cells grown at 6°C contained about one-third more total lipid than did those grown
at 30°C. Ratios of neutral lipids to phospholipids and of anteiso-15 to anteiso-17
fatty acids were considerably higher in the cells grown at the lower temperature
(Mastronicolis, 1998).
Enzymes of bacteria able to grow in the cold have a relatively high turnover
number and catalytic efficiency, but they suffer high thermosensitiviy. Their
highly flexible structure enables them to undergo conformational changes during
catalysis. The weak interactions involved in protein stability are either reduced
in number or modified to provide this high flexibility (Feller and Gerday, 1997;
Gerday et al., 1997). These characteristics make the enzymes more susceptible
to heat denaturation, which is one of the reasons that psychrotrophic bacteria are
readily destroyed by pasteurization.
The quantity of milk fat in ice cream ranges from less than 0.5% to more
than 16%. Milk fat is an insulator in that it slows the rate of heat transfer through
the frozen foam. Air cells, which may constitute up to one-half of the volume
of ice cream, are also insulators. Both fat globules and air cells restrict growth
of ice crystals. In so doing they reduce the amount of damage done to microbial
cells by extracellular ice.
Colloidal substances that associate with water through hydration reduce
the amount of water to be frozen, thus reducing the size and number of extracellu-
lar ice crystals. It is expected, therefore, that chances of survival of microorgan-
isms are enhanced as increasing concentrations of colloidal substances are in-
cluded and free water content is decreased in ice cream mixes. Furthermore,
freezing causes cells to dehydrate, thus decreasing the amount of available water
to form intracellular ice. Gases dissolved in the cytoplasm are lost. These events
cause the viscosity of cellular matter to increase, thus slowing molecular interac-
tions.
In frozen yogurt, the concentration of lactic acid is expected to vary from
0.1 to 0.2% of the total weight of the mix. As a percentage of the weight of the
unfrozen aqueous phase at the temperature of storage of ice cream, H1100220°C, lactic
acid may constitute 1–2%. Depending on the buffering capacity of the mix con-
stituents, the pH in the microenvironment of the microbial cells of the ice cream
may be detrimental to viability of the cells.
IV. INGREDIENTS
A. Milk and Milk Products
Raw milk and cream are likely to contain the following pathogens sporadically
but consistently when milk is assembled from numerous farms to a single large
facility: Campylobacter jejuni (and other campylobacteria), Salmonella Dublin
98 Marshall
(and other salmonellae), Escherichia coli (at times including pathogenic strains),
and L. monocytogenes. Animals used for food production are infrequent carriers
of these bacterial pathogens and a few others.
Ryser and Marth (1991) summarized results of tests of raw milk in the
United States, Canada, and Europe, finding 3.1, 2.7, and 4.1%, respectively, of
the samples contaminated with L. monocytogenes. However, numbers commonly
found in raw milk are seldom more than 10/mL. Sources of Listeria in raw milk
include infected mammary glands, poorly fermented silage, and soil. This bacte-
rium is generally considered to be transmitted by nonzoonotic means (Kozak et
al., 1995).
Raw fluid milk and cream spoil relatively rapidly. In general, raw milk is
delivered from producing farms to processors within 40–72 h of production and
is not permitted to be held for more than 72 h in the receiving dairy before
processing. Most manufacturers process raw milk much sooner than the maximal
time the system permits. It is important to do so to minimize risks of spoilage by
psychrotrophic bacteria, especially members of the genus Pseudomonas. These
bacteria are prolific producers of hydrolytic enzymes, including proteinases
(Mayerhofer et al., 1973), lipases (Christen and Marshall, 1983), phospholipases
(Fox et al., 1976), and glycosidases (Marin and Marshall, 1983). Many of the
proteinases, phospholipases, and lipases retain their activity after pasteurization.
Some can be inactivated at the relatively low temperatures of 40–60°C (Marshall
and Marstiller, 1981; Christen and Marshall, 1985).
Concentrated milks, commonly known as condensed milk and condensed
skim milk, are widely used as ice cream ingredients. Concentrated milk products
are almost always pasteurized before or during the concentration operation.
Therefore, the incidence of microbial pathogens in these products is practically
nil, and they have the microbiological keeping quality of pasteurized milk. Con-
centrated whey has similar characteristics. Bulk sweetened condensed milk and
skim milk are prepared with sufficient sugar (approximately 42%) to prevent
outgrowth of most spoilage bacteria. Furthermore, the evaporative process by
which they are concentrated uses heat sufficient to destroy most vegetative forms
of microorganisms. Therefore, they can be shipped and stored for limited periods
without refrigeration.
Dry dairy ingredients include nonfat dry milk, dry buttermilk, dry whey,
and whey protein concentrate. Processing commonly involves pasteurization,
concentration, and drying. The heat of these processes kills most of the vegetative
microorganisms; therefore, viable bacteria recoverable from them usually are
mostly spore formers. Major advantages to the use of dried dairy ingredients are
their storability and low weight per unit of solids. The latter factor reduces the
cost of transportation, whereas the former provides maximal flexibility in use
and helps balance supply with demand.
Frozen Desserts 99
B. Sweeteners
1. Crystalline and Granular Sweeteners and Bulking Agents
Sucrose, dextrose, and fructose are available in both crystalline and syrup forms.
Few microorganisms are contained in crystalline sweeteners. Maltodextrins,
polydextrose, and corn syrup solids are available in granular form. Some of
these materials may carry viable microorganisms, usually yeasts. Bottler’s stan-
dards for 10-g samples of granulated sugars are less than 200 mesophils, 10
yeasts, and 10 molds (National Soft Drink Association, 1975).
2. Syrups
In addition to sucrose, dextrose, and fructose, corn sweeteners are available as
syrups. Because syrups contain water and provide energy, they may support
growth of osmophilic fungi. These microorganisms, usually being highly aerobic,
grow on surfaces. They can be killed by exposure to ultraviolet light and their
growth can be inhibited by sealing full containers in which they are packed. This
is not practicable when the container is a tank into which air must be admitted
to displace syrup as it is drawn out during use. For them to flow steadily, syrups
must be kept warm in pipelines that are used to transfer the sweetener to the
batching tank for making mixes. Therefore, it is critical that the concentration
of solids in the syrup be so high as to inhibit growth of the most osmophilic
yeasts that might be contained. The usual solids concentration of these syrups is
71–82%, making the water activity (a
w
) approximately 0.80. Syrups with a high
dextrose equivalent (DE) are significantly more microbiologically stable than
those with a low DE; for example, 62 DE versus 36 DE. The sugar concentration,
measured in Brix, ranges from 67 to 86°, depending on the sweetener. Smaller
sugar molecules exert greater osmotic pressure than larger ones given the same
weight concentration. Therefore, concentrations of glucose, fructose, sucrose, and
maltose necessary to limit microbial growth are lower than for corn syrups, which
contain polymers of glucose that are products of incomplete hydrolysis of starch.
High-fructose corn syrups of 42 and 55% have a
w
values of 0.75 and 0.68, respec-
tively (L. True, personal communication, 1997).
Osmotolerant yeasts can grow at a
w
of less than 0.85. Even syrups with an
a
w
as low as 0.65 have been found to support growth of osmophilic yeasts (Troller,
1979). Most of these are in the genus Zygosaccharomyces (Walker and Ayres,
1970). Other genera of yeasts reportedly found are Candida, Pichia, Schizosac-
charomyces, and Torula.
Condensate formation in syrup storage tanks raises the a
w
and gives fungi
opportunities to grow. Condensate accumulation can be prevented by forcing
filtered and ultraviolet-treated air over the surface of the syrup.
100 Marshall
In the preparation of corn syrups, the steps of steeping, wet milling, wash-
ing, purifying, and drying have a potential effect on microbial growth and sur-
vival. During steeping, corn is soaked in water at 45–50°C for 48 h at a pH of
approximately 4 (Whistler and Paschall, 1967). During this period, the mixture
is susceptible to growth of microorganisms that produce alcohols and butyric
acid. A common microbial inhibitor added during steeping is sulfur dioxide (0.1–
0.2%).
Typical manufacturer’s maximal standards for microorganisms in syrups
follow: aerobic plate count, 100/g; yeasts, 20/g; molds 20/g; E. coli, none in 30
g; and Salmonella, none in 100 g.
C. Honey
Honey is sometimes used in frozen desserts in the dual role of sweetener and
flavoring agent. A typical concentration of honey in honey-flavored ice cream is
9%. Yeasts are likely contaminants of honey, because flowers from which the
nectar is derived are the habitat of yeasts. Several species of Zygosaccharomyces
have been isolated from defect-free and fermented honeys (Walker and Ayres,
1970). Because of its high hygroscopicity and viscosity, unprotected honey tends
to develop areas (gradients) in which the a
w
is high enough to permit yeast growth.
D. Flavorings
Pure synthetic or natural flavorings vary widely in content of microorganisms.
Flavorings that are heat sensitive cannot be given a lethal heat treatment. Those
that are low in viscosity and contain no suspended matter can be filter-sterilized.
Some are naturally antagonistic to microbial growth, especially those that have
an alcohol base. Most are used in such small quantities that their contribution to
the bacterial load is insignificant. Most are added after pasteurization, making it
critical that they contain no pathogens.
1. Extracts
Alcohol is used to extract flavorful substances, such as vanilla, that are used to
add flavor to frozen desserts. Pure vanilla is required to contain at least 35%
ethanol to be labeled vanilla extract. This concentration of alcohol is sufficient to
dehydrate and destroy most vegetative microbial cells. Other extractants include
ethylene and propylene glycols.
2. Chocolate
Cacao beans are fermented before being ground and pressed to separate some of
the cocoa butter from the cocoa. Grinding alone produces chocolate liquor,
Frozen Desserts 101
whereas pressing and grinding yields cocoa and cocoa butter. The latter contains
only minor flavor notes, whereas the chocolate flavor is carried in the cocoa.
Cocoa powders contain from 10 to 24% cocoa butter (fat) unless they have been
extracted with a solvent. The microflora of uncontaminated cocoa and chocolate
liquor consists nearly exclusively of bacterial spores and numbers are usually
less than 100/g.
E. Fruits
Fruit ice creams represent approximately 15% of the total market.
1. Fresh and Frozen
Frozen fruits, especially berries, have been widely used in the frozen desserts
industry for many years. Freezing tends to disrupt the structure and destroy the
turgidity of fruits. On thawing, fruits become soft, juices escape from the cells,
and color fades.
Because of the relatively low pH of fruits, the microflora of fresh and frozen
fruits is dominated by yeasts, including the genera Saccharomyces and Crypto-
coccus, and by molds, including species of Alternaria, Aspergillus, Botrytis, Fu-
sarium, Geotrichum, Mucor, Penicillium, and Rhizopus. Small numbers of soil-
borne bacteria are present also, including species of Bacillus, Pseudomonas, and
Achromobacter. These bacteria do not compete well with the fungi in the pH
range common to fruits. However, some lactic acid bacteria as well as species
of Acetobacter, Gluconobacter, and Zymomonas may develop in the acidic envi-
ronment of the fruit processing plant.
A principal source of pathogens in fresh and frozen fruits is persons who
pick and handle them. Insects also may contaminate fruits. Peeling, washing, and
blanching are processes that lower numbers of microorganisms on raw fruits. A
major recall of frozen strawberries was initiated in March 1997 when they were
associated with an outbreak of hepatitis A in Michigan. The recall was extended
to frozen strawberry fruit bars and to strawberry ice cream containing the same
pack of berries that originated in California (FDA Enforcement Reports, 1997).
Freezing kills some microorganisms on fruits but is not a dependable lethal
process. Furthermore, it is not feasible from a quality viewpoint to blanch most
fruits (except peaches) to destroy microorganisms. However, bactericidal chemi-
cals, such as hypochlorite, may be added to wash water to reduce numbers of
microorganisms on surfaces. Antioxidant dips are frequently applied to minimize
browning. These include ascorbic acid, sulfur dioxide, and sugar syrup. Sulfur
dioxide has some antimicrobial effect, and syrups may kill organisms that are
susceptible to high osmotic pressures.
102 Marshall
2. Processed
With the advent of highly effective heating and aseptic packaging processes,
mostly aseptically processed fruits are used. In general, steam under pressure is
not needed to destroy the microflora of fruits, because they are acidic, and heating
at 100°C or less is adequate. The more acidic the fruit, the lower the heat treat-
ment required to preserve it. Among the fruits often used in frozen desserts,
peaches and apricots fall within the ‘‘acid foods’’ range of pH 3.7–4.5, whereas
berries have a pH less than 3.7, placing them in the ‘‘high-acid foods’’ group.
Fruits that are aseptically processed can be stored at room temperature for
several months with no microbial spoilage. Processors frequently use swept-sur-
face heat exchangers that heat the mixture of fruit, sugar, acid, and stabilizer to
88–121°C, depending on the fruit. After holding the mixture for approximately
3 min at the maximal temperature, it is cooled to approximately 27°C and pumped
directly to an aseptic filling machine. It is filled into sterile containers that are
usually made of laminated polyethylene and foil.
In an alternative processing system (Fig. 1), fruit is pumped through coils
that heat, hold, and cool the product. The coils cause the fruit to mix well in the
Figure 1 Aseptic processing system for fruits. (Courtesy of Lyons Magnus,
Fresno, CA.)
Frozen Desserts 103
tubes so that scrapers are not needed; therefore, little damage is done to the integ-
rity of the fruit. Yet, microbial cells are efficiently and effectively destroyed.
Processing in open kettles permits heating to a maximum of a few degrees
above 100°C (sugar in the fruit raises the boiling point) and extends needed hold-
ing time to at least 20 min. Volatile substances are able to escape the fruit, chang-
ing the flavor, and color usually darkens. Shelf life is often short, and refrigeration
is needed to preserve the product.
Typical microbial specifications for fruit flavorings follow:
Yeast and
Process APC/g mold/g Coliforms/g
Cool fill 5000 100 10
Hot fill 1000 100 H110211
Aseptic pack 100 10 H110211
APC, aerobic plate count
3. Candied
Sugar is added to fruits before they are added to ice cream. The usual fruit to
sugar ratio ranges from 2:1 to as high as 9:1. Candied and glace′ed fruits have
sugar concentrations high enough to lower the a
w
below the level that permits
microbial growth. Candying is accomplished by treating fruits with syrups having
progressively higher sugar concentrations to prevent the exterior from becoming
tough or leathery while the interior remains soft. Following impregnation with
sugar, the fruit is washed to prevent crystallization of sugar on the surface and
is then dried. To make glace′ed fruit, candied fruit may be dipped into syrup and
dried again.
F. Nuts
Nuts carry with them from the fields a wide array of microorganisms, many of
which have their origin in soil. Some are contaminated with excreta from animals,
birds, and insects. Various treatments are given nuts and nut meats in separating
the nut meats from the shells. Most of these treatments lower microbial numbers
in the nut meats. For example, sorting of lightweight pieces from the heavier
nuts removes much of the dust that carries microorganisms. Flotation in water
is used with pistachios to remove immature fruits and with pecans to remove
fragments of shells. Blanching in hot water loosens pellicles from almonds and
peanuts, and some nuts are salted in a brine solution. Treatments with water can
remove microorganisms, but they can also elevate a
w
, and reuse of water results
104 Marshall
in increasing populations of microorganisms that can be spread to other nuts.
Therefore, frequent changes of water are needed.
Low a
w
is the major limiting factor in preservation of nut meats; therefore,
drying is required to prevent mold growth if harvested nuts are not sufficiently
dry. Moisture content of tree nuts normally ranges from 3.8 to 6.7%. Thus, the
a
w
is usually less than 0.70 and microbial growth does not occur (Beuchat, 1978).
Microorganisms usually die during storage. High temperatures and a
w
just below
the level sufficient for growth are factors that increase death rates of microorgan-
isms (King and Shade, 1986).
Because of the wide variety of nuts, the different environments they come
from, and the several treatments given them, types and numbers of microorgan-
isms present on nuts vary widely. Counts range upward to several thousand per
gram, and insect-damaged nuts carry more microorganisms than undamaged ones
(King et al., 1970). Nuts harvested from orchards where farm animals have been
kept have an increased likelihood of contamination with E. coli. However, neither
tree nuts nor ground nuts are considered to be likely vehicles of pathogenic micro-
organisms. Treatments with propylene oxide, permitted on tree nuts but not on
peanuts, destroys most of the residual microflora (Beuchat, 1973; USHEW,
1978). Roasting, a treatment given peanuts and some other nuts, destroys vegeta-
tive cells of microbes.
Mycotoxins, especially aflatoxins, are of concern because of the chance of
mold growth on nuts that contain high amounts of moisture. Nut meats removed
from refrigeration can have condensate form on them, especially when placed in
areas of high humidity. If these nuts are not used soon and are stored at favorable
temperatures, molds are likely to grow on them.
G. Confections and Bakery Products
Confections and baked goods are low in bacterial numbers and seldom carry
pathogenic bacteria. Methods of preparation and very low a
w
greatly limit survival
and growth of microorganisms. However, these ingredients are usually added
after freezing so that any contaminants they carry are given no positively lethal
treatment.
H. Eggs and Egg Products
The ice cream industry uses egg yolks primarily for their flavor in the manufac-
ture of French vanilla ice cream (also known as frozen custard; 1.4% egg yolk
solids required) and in parfaits. Egg yolk is used also as a source of emulsifying
and stabilizing agents, because egg yolk contains a high amount of lecithin. Sor-
bets usually contain 2.5–3% egg white. Pasteurized egg yolk is commercially
available in three forms, liquid, frozen, and dried, that are useful in manufacture
Frozen Desserts 105
of frozen desserts. Egg white is available in dry and frozen forms. It is also
possible to break and separate yolks from albumen of fresh shell eggs; however,
this is usually feasible and economical only in production of small batches of
ice cream.
Addition of 10% sucrose to egg yolks is effective in preventing gelation
that occurs during storage of frozen yolks. Gelation of frozen plain yolk occurs
most rapidly at approximately H1100218°C. Sugar is usually added to both the liquid
and frozen forms. Salt also prevents gelation of egg yolk and is effective at ap-
proximately 2% concentration, but the salty flavor is undesirable in frozen des-
serts, making the sugar form the product of choice if frozen yolks are used.
The interiors of shell eggs (eggs in the shell) are usually sterile (with the
possible exception of harboring certain salmonellae) at the time of laying (Brooks
and Taylor, 1955; Morris, 1989). However, the shells of eggs become contami-
nated with several thousand to millions of bacteria during laying, collection, and
processing.
Normally, 10–20 days pass between the time an egg is contaminated and
the time when there is a significant increase in bacterial numbers inside the egg.
One reason is that little iron is available at the shell membranes and in the albu-
men, and most bacteria require iron for growth. Glycoproteins of the membrane
fibers bind iron tightly. Ovotransferrin, a protein of the albumen (white), also
chelates iron. Certain species of Pseudomonas produce an iron chelate, pyover-
dine, that has been claimed to scavenge iron from ovotransferrin (Board and
Tranter, 1995). Thus, they are able to overcome one of the major barriers to
growth in egg albumen. Chemotaxis played a role in movement of Pseudomonas
putida and Salmonella Enteritidis toward yolk surfaces (Lock et al., 1992). The
chemical attractant was not identified.
Additional hurdles that microbes face in the albumen of the shell egg in-
volve binding of biotin by avidin (Chignell et al., 1975) and of riboflavin by
ovoflavoprotein (Clagett, 1971). Bacteria that require either or both of these vita-
mins would, therefore, be inhibited in albumen of the egg. Furthermore, the
highly alkaline (pH 9.5) albumen contains lysozyme, an enzyme that can lyse
the cell membrane of certain gram-positive bacteria. Once a bacterium has
reached the yolk of the egg, inhibitors are of no effect and nutrients abound, so
growth can proceed rapidly.
Fresh eggs are seldom used in ice cream except in small operations. Be-
cause of the relatively high risk of the presence of salmonellae on and in fresh
eggs, it is important that egg breaking be done in a room separate from the freez-
ing and filling rooms. Furthermore, all eggs must be pasteurized if they are added
to a frozen dessert after the mix is pasteurized. The FDA reported three recalls
of liquid whole eggs for contamination with salmonella bacteria in the 1997–
1999 enforcement reports (FDA Enforcement Reports, 1997, 1998, 1999).
Micrococci are nearly always present on freshly laid eggs, but spoilage of
106 Marshall
shell eggs is nearly always caused by gram-negative rods, especially species of
Pseudomonas and Proteus (Board and Tranter, 1995).
Samples of unpasteurized liquid egg from commercial egg breakers have
been reported to range in aerobic plate count from 10
3
to 10
6
/g (Froning et al.,
1992). Although the number of salmonellae in unpasteurized liquid eggs is usu-
ally less than one per gram, the risk that these organisms may be present is sig-
nificant. Recently, the incidence of contamination of eggs with S. enteritidis
through transovarian infection has caused considerable concern. S. enterica sero-
var Enteritidis, commonly known as S. Enteritidis, has adapted to survive in the
hen’s internal organs from which it is occasionally deposited into the contents
of an egg. A conservative estimate of the average incidence of infection across
the United States is 1:20,000 eggs (American Egg Board, 1999). Foodborne ill-
nesses from S. Enteritidis have been on the decline in the United States since
1995.
Most manufacturers use pasteurized egg products, including liquid whole
egg, frozen sugar egg yolk, or dried egg yolk. Approved pasteurization standards
for egg products produce 6–8 log
10
reductions in numbers of Salmonella (Speck
and Tarver, 1967; Shafi et al., 1970). All pasteurized egg products should meet
the following microbiological limits: aerobic plate count, less than 10,000/g; coli-
form count, less than 10/g; yeast and mold count, less than 10/g; and salmonellae,
negative in 25 g.
Freezing reduces numbers of viable microorganisms in egg products (Win-
ter and Wilkin, 1947). Although most species of bacteria survive freezing in some
numbers, the major survivors of both pasteurization and freezing are Bacillus,
Micrococcus, and Enterococcus (Wrinkle et al., 1950; Froning et al., 1992). Sal-
monella Oranienburg survived storage in frozen yolk (Cotterill and Glauret,
1972).
I. Coloring Materials
Coloring materials are often added to frozen dessert mixes after pasteurization;
therefore, it is important that colorants be free of pathogens and low in total
numbers of microorganisms. The following are typical microbiological specifica-
tions for food, drug, and cosmetic (FD&C) dry powders, blends, granulars, and
FD&C lakes and lake blends: aerobic plate count less than 1000/g; coliforms,
less than 10/g; yeasts and molds, less than 100/g; E. coli or Salmonella, negative
in 25 g. Most firms do not test each batch for microbial counts but are willing
to arrange for batch certification by an independent laboratory.
Colors and lakes provide very limited nutrients for growth of microorgan-
isms, and, when sold in the liquid form, they contain low concentrations of benzo-
ates as preservatives. When purchased in the powder or granular form, the water
and containers used in hydrating them should be practically sterile. The water
Frozen Desserts 107
should be free of sources of nitrogen and energy that might enable microorgan-
isms to grow. When rehydrated colorants are to be kept for several weeks, it is
advisable to store them refrigerated.
J. Spices
Spices can carry widely varying numbers and types of microorganisms. Spore
formers are especially prone to be present and to survive over long periods.
Spices, like nuts, can be treated with ethylene oxide to reduce the microbial load.
Furthermore, spices can be irradiated to kill microorganisms.
Cinnamon contains cinnaminic acid, a microbial inhibitor. However, dilu-
tion of cinnamon with ice cream mix greatly reduces this antimicrobial effect.
V. FROZEN YOGURT
A. Composition and Properties
Consumers often choose to eat frozen yogurt because they expect that it will
contain less lactose than ice cream containing a similar amount of fat, and because
they expect some benefit from the viable bacteria contained in the yogurt. There-
fore, it is important to consider how much lactose is fermented to lactic acid
during preparation of the mix, how many viable cells reside in the product, and
how much galactosidic (lactase) activity those cells retain.
Frozen yogurt has a composition similar to low-fat ice cream. However,
there is no Standard of Identity for frozen yogurt. The labeling regulations based
on content of milkfat are the same as for ice cream. The unique characteristic
of frozen yogurt is that it contains cultures of Streptococcus thermophilus and
Lactobacillus delbrueckii ssp. bulgaricus. The shorter name, L. bulgaricus is usu-
ally used for the latter bacterium.
These two bacteria are typically grown together in skim milk fortified with
1–4% added nonfat milk solids. Therefore, the nonfat milk contains about 6.5%
lactose, and about 1.2% of it is converted to lactic acid during fermentation. This
fortified skim milk is heated to approximately 85°C for 5 min and cooled before
inoculation. Temperature of incubation is high, approximately 42°C, so genera-
tion time and, consequently, incubation time are short. From 10 to 20% of the
finished and cooled yogurt is added to the processed and aged base mix at the
time flavoring and coloring agents are added. Freezing follows.
It is also possible to add the yogurt culture to the base mix, which is then
incubated until the titratable acidity, expressed as lactic acid, reaches approxi-
mately 0.30%. However, this process involves cooling the mix after pasteuriza-
tion to the incubation temperature, then completing the cooling of the full batch,
and holding it to permit aging. Therefore, time of production is longer and the
108 Marshall
capacity of the fermentation tank must be larger than with the previously de-
scribed method.
The product is frozen in the same way as ice cream, and the overrun is
typically in the range of 70–100%. Freezing kills many of the streptococci and
lactobacilli of the yogurt culture. Sheu and Marshall (1993) observed that num-
bers of viable L. bulgaricus of two strains decreased approximately 45 and 90%
during the continuous freezing of a simulated frozen yogurt mix. Viable cell
numbers decreased approximately 5% more during storage at H1100220°C for 2 weeks
after freezing. However, when the same two cultures were entrapped in beads
(average diameter H1102118 μm) of calcium alginate gel, viable counts were approxi-
mately 45% higher than those of the nonentrapped cultures (Fig. 2). Cells of the
strain of L. bulgaricus that were most susceptible to freeze damage were much
larger than those of the smaller strain, suggesting that stresses of freezing are
more damaging to large than to small cells.
Researchers have shown that exopolysaccharide (capsules) on bacteria ren-
ders cells comparatively resistant to thermal and physical shock (Robinson,
1981). Hong (1995) isolated three nonencapsulated mutants of S. thermophilus
Figure 2 Numbers of survivors among Lactobacillus delbrueckii ssp. bulgaricus en-
robed in calcium alginate. (From Sheu and Marshall, 1993.)
Frozen Desserts 109
and compared them with the encapsulated parental strain for abilities to withstand
freezing under a variety of conditions. The parent and mutant strains did not
respond differently when frozen without agitation. However, freezing to H110027°C
with agitation in a batch freezer and hardening to H1100229°C resulted in survival of
28% of the encapsulated and only 17% of the nonencapsulated strains (Fig. 3).
Early log phase cells were more sensitive to freezing than late log phase or sta-
tionary phase cells. Cell viability after batch freezing was unaffected by (a) cul-
ture growth temperatures between 40 and 45°C, (b) fat content between 5 and
14%, or (c) neutralization of the acid produced by the cells during growth in
skim milk. S. thermophilus survived significantly better in reduced-fat ice cream
frozen in a continuous freezer to 50% overrun than in the same mix frozen to
100% overrun. The added agitation and scraping of the freezer barrel walls
needed to attain higher overrun may have been responsible for the lowered rate
of survival. Additional oxygen whipped into the mix might have increased cell-
ular exposure to free radicals and thus increased the death rate. However, no
significant difference was found between numbers of survivors when the gas
Figure 3 Numbers of survivors among encapsulated and nonencapsulated strains of
Streptococcus thermophilus subjected to freezing in nonfat ice cream mix by a batch
freezer. (From Hong, 1995.)
110 Marshall
whipped into the ice cream was nitrogen or air. Storage of the frozen ice
cream at H1100223 or H1100229°C resulted in significantly more survivors than storage at
H1100217°C.
B. Probiotic Nature
Although it was 1908 when Eli Metchnikoff suggested that certain bacteria in
the human intestine could prolong the life of persons who consumed them in
their foods, only recently have food microbiologists coined the term probiotic
and have selected specific bacteria to add to foods as dietary adjuncts. The infer-
ence of the word probiotic is that a microorganism confers a positive effect on
a biological entity, most importantly on human life. Most bacteria thought to
have a probiotic effect are part of the natural microflora of the human intestine.
Many of them are also useful as starter bacteria in food fermentations. Prebiotic
is a term coined to describe substances needed to support the growth of probiotic
microorganisms.
Benefits to consumers of fermented dairy foods and of those to which di-
etary adjunct bacteria are added include the following: (a) improved nutritional
qualities (synthesized vitamins and enzymes as well as hydrolyzed proteins), (b)
competitive exclusion of infective bacteria, (c) production of antibacterial sub-
stances (Shahani et al., 1977), (d) enhanced antibody production, (e) moderated
response to endotoxin, and (f) anticarcinogenic activity.
Humans influence the nature of the intestinal microflora in several ways.
Salivary, gastric, and intestinal secretions, bile, and mucus provide selective envi-
ronmental factors. The stomach is strongly acidic, but pH increases as food moves
to the distal end of the large intestine. Intestinal motility moves both food and
microorganisms along the gastrointestinal tract, expelling billions of bacteria
daily. Oxidation reduction potential is also a selective force. In general, the
greater the distance intestinal contents travel from the stomach, the higher their
microbial numbers.
Fermented dairy foods usually contain viable cells of the bacteria used as
starter. Commonly used starter cultures contain lactococci, streptococci, lactoba-
cilli, or leuconostocs. Some species of these genera have been shown to affect
consumers favorably.
Frozen yogurt is the most popular dessert made from fermented milk. Most
manufacturers produce frozen yogurt by adding 10–20% of plain yogurt to a
pasteurized low-fat ice cream mix. Flavoring is then added just before the mix
is frozen. Assuming 5 H11003 10
8
/g of viable S. thermophilus and L. bulgaricus in
the plain yogurt and addition of 20% yogurt to the mix, the number of yogurt
bacteria in the mix before freezing would be 10
8
/g. If freezing were to kill 50%
of the yogurt bacteria, the viable number remaining would be 5 H11003 10
7
/g. This
large number of viable cells may provide benefit to consumers. Lopez et al.
Frozen Desserts 111
(1997) stored three batches of commercial frozen yogurt at H1100223°C for over 1
year. The numbers of lactic acid bacteria, which exceeded 10
7
/g initially, de-
creased only slightly during the storage period. A strong correlation (r
2
H11005 0.62)
existed in 11 brands of frozen yogurt between β-galactosidase activity and num-
bers of lactic acid bacteria (Schmidt et al., 1997).
Additionally, frozen desserts can be used as carriers of dietary adjuncts.
Modler et al. (1990) used ice cream as a carrier for three species of bifidobacteria.
At the end of 70 days of storage at H1100217°C, viable counts of these bacteria had
decreased only 10%. Bifidobacteria have been receiving major attention as poten-
tial dietary adjuncts. These anaerobic, nonmotile, nonsporing, gram-positive, bi-
furcated (y-form) or curved rods produce acetic acid and L(H11001) -lactic acid as
they ferment sugars. They comprise nearly 100% of the microflora in the stools
of healthy breast-fed infants but only 30% to 40% of stool flora of formula-fed
infants (Jao et al., 1978). As humans age, the percentage of bifidobacteria in
stools decreases to low values. Their growth can be stimulated by oligosaccha-
rides (Gyorgy et al., 1974), including β-linked N-acetylglucosaminides (Zilliken
et al., 1955), glycoproteins (Bezkorovainy et al., 1979), and cysteine-containing
peptides of kappa-casein (Poch and Bezkorovainy, 1991). Therefore, some foods
are being supplemented with such ‘‘prebiotic’’ substances with the intention of
enhancing growth of bifidobacteria in the human intestine.
Hekmut and McMahon (1992) fermented a representative ice cream mix
with L. acidophilus and Bifidobacterium bifidum and then froze it in a batch
freezer. Counts of L. acidophilus dropped from 1.5 H11003 10
8
/g immediately after
freezing to 4 H11003 10
6
/g after 17 weeks, whereas those of B. bifidum dropped from
2.5 H11003 10
8
/g to 1 H11003 10
7
/g during the same period. Coincidentally, β-galactosidase
activity dropped by about 25%. Freezing caused a loss in viable cell numbers of
0.7–0.8 log
10
in ice cream inoculated with four strains of probiotic bacteria
(L. reuteri, L. acidophilus, L. rhamnosus, and B. bifidum). However, during 1
year of frozen storage, counts did not drop significantly and all remained above
10
6
/g (Hagen and Narvhus, 1999). Incorporation of glycerol in the ice cream did
not improve survival. In another study (Ravula and Shah, 1998), 10 strains of
S. thermophilus and 7 of L. bulgaricus along with probiotic bacteria (13 strains
of L. acidophilus and 11 strains of bifidobacteria) were screened for abilities to
survive freezing at H1100218°C when the pH was 4.5 or 4.0 and sucrose levels were
8 and 16%. Counts of the yogurt bacteria decreased about 1 log
10
during the first
3–5 weeks and then remained fairly constant. However, probiotic strains varied
widely in response, with some losing up to 6 log
10
cycles in numbers of recover-
able cells.
Another popular dietary adjunct that may be added to frozen desserts is L.
acidophilus. Certain strains of this bacterium were reported to assimilate choles-
terol in a laboratory medium (Gilliland et al., 1984) as well as to lower serum
cholesterol in rats (Grunewald, 1982). It is important that bacteria added to foods
112 Marshall
for probiotic effects be able to survive the effects of low pH and bile and to
attach to and grow in a niche of the intestinal tract.
Each of the lactose-fermenting bacteria is a potential carrier of β-galactosi-
dase. If these bacteria survive through the stomach and resist lysis by bile acids
and enzymes, they may be permeated by lactose molecules. Intercellular β-galac-
tosidase can then hydrolyze lactose to glucose and galactose so it can be absorbed
through the human intestinal cell wall. Thus, symptoms of lactose malabsorption,
a common malady among persons of Asian and African descent, can be reduced
or eliminated.
VI. SHERBETS, SORBETS, AND ICES
Whereas sherbets contain 2–5% total milk solids, neither sorbets nor ices contain
milk solids. All three product groups are high in sweetener; contain fruits, fruit
juices, or fruit flavoring; and are generally acidic. Sherbet mix of typical composi-
tion can be made by adding one part of ice cream mix to four parts of water ice
mix. Because sherbet contains milk solids, it must be pasteurized. A product
called yogurt sherbet is defined in the California Food and Agricultural Code as
having an acidity of 0.6% calculated as lactic acid and a yogurt content of not
less than 40%.
Water ices typically contain 20–30% sugar, 0.35–0.5% citric acid, fruit
flavoring, gum stabilizer, and water. Sorbet is a frozen fruit product that can be
considered to be an ‘‘upscale’’ version of Italian ice (water ice). White tablecloth
restaurants often serve it as an intermezzo between the appetizer and the main
course. There is no federal standard for the product. It usually contains 30–50%
fruit or fruit juice, 30% sugar, 2.6% egg white solids and pectin, modified cellu-
lose, and/or gum stabilizer. At least one company has produced a chocolate sor-
bet. Overrun is 20% or less. Because it is expected to contain no milk ingredient,
persons who suffer allergies to components of milk consider it to be safe to eat.
However, since it is usually made in equipment used also to make ice cream,
there is a risk that traces of milk proteins may enter a sorbet. This happened in
Rochester, MN, when a 3-year old boy consumed 4–6 oz of lemon sorbet (Lao-
prasert et al., 1998). The quantity of protein ingested was only 120–180 μg, but
symptoms of itching throat, facial angioderma, and vomiting were experienced
within 20 min of consumption.
Water ices and sorbets may not be required to be pasteurized. Their very
low pH restricts growth of microorganisms to yeasts and molds. Further-
more, mixes are commonly prepared immediately before freezing, thus limiting
the potential for microbial growth. They remain susceptible to contamination
from ingredients, equipment, personnel, and the environment. Acid-tolerant
Frozen Desserts 113
bacteria, especially spores, can survive in them but will have little opportunity
to grow.
VII. FROZEN NOVELTIES
In the United States, frozen novelties consist of frozen ices (26%), ice cream
sandwiches (16%), ice cream bars (12%), fruit or juice bars (10%), fudge bars
(9%), ice cream cones (9%), and numerous other forms of single-serve frozen
items. They differ from related products in multiserve containers primarily in the
ways they are frozen, formed, and packaged. Some, particularly frozen ices, are
frozen quiescently in refrigerated molds. Their maximum expansion in volume
(overrun) is 10%. Others, especially ice cream bars on sticks, are first soft-frozen
with air incorporated and then hardened in molds or are extruded in very stiffly
frozen form onto conveyors that carry them through hardening tunnels. Ice cream
may be extruded into the space between two cookies to form ice cream sand-
wiches. Many of the ice cream and frozen yogurt bars on-a-stick are dipped in
chocolate or fruit-flavored coatings.
With novelty items the main microbiological considerations relate to clean-
liness of equipment with which the novelties are formed or packaged. The typical
plant runs continuously for many hours, and molds of the forming equipment
are subjected to alternate cold and warm temperatures. Although there is little
opportunity for microbial growth, contaminants from the environment are not
likely to be killed during operation. This makes it important to maintain a high
degree of sanitation within the area of freezing, forming, and packaging of novel-
ties. It is highly important that airborne contaminants not be produced from dust
or mists wherever novelties are exposed to open air (not enclosed by equipment
or packages). Dry floor operations are recommended to avoid splash and creation
of aerosols. Goff and Slade (1990) used a pilot scale wind tunnel, operated at
H1100216 to H1100218°C, to demonstrate that L. monocytogenes could be transferred to
frozen unpackaged ice cream via contaminated cold air.
VIII. PROCESSING MIXES
The most important process in any dairy plant is pasteurization, because safety
of the product depends on successful performance of this lethal heat treatment.
Standards set for time and temperature of heating ice cream mixes (Table 1) are
adequate to kill vegetative forms of pathogenic microorganisms that may be
found in frozen dessert mixes. Residual spores of pathogenic bacteria are not
114 Marshall
Table 1 Minimal Times and
Temperatures Required for
Pasteurization of Frozen Dessert Mixes
Temperature,
Method °C(°F) Time
LTLT 69 (155) 30 min
HTST 80 (175) 25 s
83 (180) 15 s
LTLT, low temperature, long time, or batch (vat)
method; HTST, high temperature, short time, or
continuous method.
considered to be dangerous, because they are unable to germinate and grow under
conditions of storage of either the mix or frozen product.
Pathogens introduced into ice cream mixes by ingredients, equipment, per-
sonnel, or the environment are killed by pasteurization, but recontamination may
occur in subsequent operations. The potential for amplification of the effects of
pathogens increases as sizes of dairy processing facilities increase. This is true
because large plants serve large numbers of consumers over a wide trade territory.
Controls are provided on continuous pasteurizers to ensure that minimal
temperatures are maintained until mix reaches the end of the holding tube. Also,
pasteurizers are required to be designed and operated to provide minimal times
of holding mixes at the minimal temperature. However, research by Goff and
Davidson (1992) revealed that mix viscosity is a major variable that can affect
time of holding a mix in a pasteurizer. They found that laminar flow characteris-
tics are likely to exist in holding tubes of high-temperature, short time (HTST)
pasteurizers when ingredients cause viscosities to become unusually high. Gener-
alized Reynolds numbers, which are measures of turbulence in flowing liquids,
ranged from 100 to 1700 in holding tubes of sizes common to the dairy industry.
Laminar flow is likely to exist when Reynolds numbers are less than 2100 (Denn,
1980). In true laminar flow, mix that is at the tube wall flows one-half as fast as
that in the center of the tube, whereas, in true turbulent flow, mixing is so thor-
ough that particles travel at the same average rate in any cross section of the
pipe. Because of the high potential for laminar flow of ice cream mixes in pasteur-
izer holding tubes, special considerations should be given to their design.
The method approved in 3A Sanitary Standard No. 603-06 (3A Sanitary
Standards Committee, 1992) provides that, for most pasteurizers, the pumping
rate is experimentally determined by timing the filling of a can of known volume
and referencing this to a table of tube diameters and holding times of 15 and
25 s. Furthermore, holding time is confirmed by pumping water through the tube
Frozen Desserts 115
and detecting the time taken for an injected salt solution to pass conductivity
sensors at each end of the holding tube. Whereas this method of testing provides
reliable times for passage of products with the viscosity of milk, it is unlikely
to be satisfactory for ice cream mixes that vary widely in viscosity. To overcome
this problem, one approach is to design holding tubes to provide twice the holding
time that would be applicable during turbulent flow. The 3A accepted practices
provide that fully developed laminar flow is assumed when the desired holding
tube length is calculated. This may result in more heated flavor than is desirable
in the product. An alternative approach is to design pasteurizers with characteris-
tics that ensure turbulent flow.
IX. FREEZING AND FROZEN STORAGE
In the freezing of ice cream, cold mix is admitted to a freezing chamber and
subjected to whipping in the presence of air while the ice crystals that form on
the wall of the freezing cylinder are scraped from the wall. Temperature drops
rapidly and ice forms quickly in continuous freezers, but the process takes several
minutes in batch freezers. These conditions place severe stresses on microorgan-
isms in the mix. Factors that affect survival of microorganisms during freezing
and frozen storage include the type and physiological condition of the cells, com-
position of the food, treatment of the food before freezing, rate and method of
freezing, and the temperature, time, and conditions of storage. Ice crystals that
form outside the cells reduce the amount of free water in which solute can be
dissolved. Those that form inside cells have the potential to puncture cell mem-
branes. Mazur (1966) concluded that viabilities of microorganisms subjected to
subzero temperatures are affected primarily by solute concentration and intracel-
lular freezing. Water that freezes in the cell is free water, and this water forms ice
crystals. Bound water remains unfrozen. As crystals form, the cytoplasm becomes
more concentrated and viscous. Electrolytes and acids are concentrated. Colloidal
constituents may be precipitated and proteins denatured. Intracellular ice is
thought to be more harmful to microorganisms than extracellular ice. However,
Ray and Speck (1973) concluded that, during freezing, formation of extracellular
ice was the principal cause of bacterial death and that cells in the stationary phase
of growth resist freezing better than those in the logarithmic phase.
The result is that many microorganisms die. Generally, gram-negative rods
and the vegetative cells of yeasts and molds are more easily killed than gram-
positive bacteria, and bacterial and fungal spores are largely unaffected by sub-
zero temperatures (Georgala and Hurst, 1963). Encapsulated bacteria survive
freezing better than do the same strains that have lost the ability to express cap-
sules because of mutations. The number of strains of encapsulated yogurt bacteria
is limited, and it is important that yogurt bacteria survive freezing so they can
116 Marshall
deliver β-galactosidase to the human intestine of persons who are deficient in
that enzyme and cannot, therefore, digest amounts of lactose they may ingest.
During frozen storage at H1100220°C, the rate of death of yogurt bacteria in frozen
yogurt was observed to be quite low. Ingram (1951) summarized the following
effects of freezing on selected microorganisms: (a) many species experience an
abrupt loss in viability on freezing and (b) cells left viable after freezing die
slowly during frozen storage, with the death rate being highest when temperature
approaches the melting point of the food and lowest at H1100220°C and below.
X. SERVING FROZEN DESSERTS
All of the care in selecting and protecting ingredients, in cleaning and sanitizing
equipment, in pasteurizing in a properly constructed and operated heat exchanger,
and in packaging ice cream aseptically in containers that are practically sterile
can be for naught if the product is contaminated with pathogens during serving.
Gould et al. (1948), in a survey of ice cream stores, found 11 of 20 hand-
packed samples had coliform counts of more than 10/g, whereas only 2 of 14
factory-packed samples from the same stores had this high number of coliforms.
Ice cream scoops and dippers as well as the hands of the store workers are likely
sources of contaminants in dipped ice cream. Water should be kept flowing in
dipper wells to ensure that bacterial growth is prevented in water used to warm
and cleanse dippers and scoops.
Persons who are ill or infected should not dispense frozen desserts. All
workers should wear clean clothing and hair restraints and should wash their
hands before working in dispensing operations and every time there is a chance
of their hands becoming contaminated.
XI. REGULATORY CONTROLS AND INDUSTRY
STANDARDS
There is no federal standard for counts of bacteria in frozen desserts in the United
States. However, most states enforce standards for coliform bacteria at less than
or equal to 10/g and for standard plate count at 50,000/g. One state enforces a
maximum standard plate count of 20,000/g. Approximately 14 states permit coli-
form counts of up to 20/g for bulky flavored ice creams. These are products to
which large amounts of flavorings, fruits, and nuts are added. Because many of
these items are added after freezing, the chances of contamination with coliform
bacteria is considerably greater than with plain ice creams. With the recent knowl-
edge that microbial environmental contaminants include Listeria, it is prudent
for manufacturers to consider the presence of coliform bacteria in ice cream as
Frozen Desserts 117
indicative of unsanitary practices and to increase the intensity of hygienic activi-
ties when coliform bacteria are found in finished products.
Coliform bacteria belong to the larger group of gram-negative asporogen-
ous facultatively anaerobic glucose-fermenting bacteria of the family Enterobac-
teriaceae, all of which are killed by pasteurization of ice cream mixes. Testing
for this group of bacteria, rather than for the coliform group only, increases the
sensitivity of the test for postpasteurization contamination. The modification of
the coliform test is simple: instead of lactose, 1% glucose is added to the Violet
Red Bile Agar used to plate the sample. Appearance of typical colonies arising
from plating of 1 g of sample is indicative of postpasteurization contamination
and the possible entrance of pathogenic bacteria into the product. Therefore, the
cause of the problem should be determined and corrected.
The FDA has tested finished ice cream products for pathogens, principally
L. monocytogenes, and numerous recalls have ensued when samples have been
positive (Anonymous, 1986a, 1986b, 1986c, 1986d, 1994). The U.S. Code of
Federal Regulations, Title 21, Part 7.40 (21 CFR 7.40) provides recall policies,
procedures, and industry responsibilities.
Recall is a voluntary act of manufacturers and distributors who seek to
protect the health and welfare of consumers from products that may present a
risk of injury or gross deception or are otherwise defective. Recall is an alternative
to FDA-initiated court action to remove violative, distributed products. Recalls
are assigned classes I, II, or III depending on the relative degree of health hazard
with the greatest risk associated with class I recalls. The FDA may request a
recall when a distributed product presents a risk of illness and the manufacturer
or distributor has not initiated a recall. A recalling firm is expected to conduct
checks of the effectiveness of the recall action.
A survey of 530 samples of ice cream mix (85), ice cream (394), and ice
cream novelties (51) by Health and Welfare Canada revealed only two samples
that contained L. monocytogenes (Farber et al., 1989). Furthermore, the WHO
Working Group (1988) reported the incidence of L. monocytogenes in ice cream
as varying from 0 to 5.5% with very low numbers (1–15 cfu/g) usually being
observed.
The heat resistance of L. monocytogenes is higher than that of many vegeta-
tive bacteria (Doyle et al., 1987). Its heat resistance can be enhanced in milk and
cream in which it is contained in white blood cells (leukocytes). As an agent of
bovine mastitis (Gitter et al., 1980), L. monocytogenes is phagocytized by leuko-
cytes of the mammary gland. If numbers of phagocytized L. monocytogenes are
sufficiently high, the pathogen may survive minimal conditions of high-tempera-
ture, short-time pasteurization of milk (Garayzabel et al., 1985; Doyle et al.,
1987). However, the incidence of mastitis caused by L. monocytogenes is quite
low. Furthermore, leukocytes and, consequently, phagocytized bacteria are
mostly removed by clarification and separation during the preparation of cream
118 Marshall
for the manufacture of ice cream. No evidence has been forthcoming that these
bacteria survive pasteurization of ice cream mix.
L. monocytogenes appears to survive well the freezing and frozen storage
of ice cream (Golden et al., 1988; Palumbo and Williams, 1991; Dean and Zot-
tola, 1996). Dean and Zottola (1996) inoculated ice cream mixes with an 18-h-
old culture of L. monocytogenes V7, froze the mix to H110025toH110026°C, and stored
samples at H1100218°C for up to 3 months. One set of mixes contained 14 mg/L (535
IU/g) of the bacteriocin nisin (Nisaplin) and another set contained no nisin.
Counts of L. monocytogenes decreased insignificantly in samples without nisin;
however, counts decreased to near zero in the samples that contained nisin. Nisin
was slightly less effective in ice cream containing 10% milkfat than in samples
containing 3% milkfat. Jung et al. (1992) observed lowered nisin activities in
high-fat–containing milk products.
L. monocytogenes is a gram-positive, non–spore-forming short rod that is
motile with peritrichous flagella. This ubiquitous psychrotroph (Donnelly and
Briggs, 1986; Rosenow and Marth, 1987) is pathogenic to humans and animals.
Most persons who have contracted listeriosis have been pregnant women, neo-
nates, or immunocompromised adults (Gray and Killinger, 1966; Seeliger, 1986).
An outbreak of gastrointestinal infections caused by S. Enteritidis in ice
cream was observed beginning in September 1994. After a case-control study
implicated a national brand of ice cream, much of the product was recalled by
the manufacturer. Gastroenteritis developed in an estimated 224,000 persons
(Hennessey et al., 1996), but fewer than 600 cases were reported to public health
departments (Anonymous, 1996). The attack rate was estimated at 6.6% among
consumers of the affected products. Salmonella was isolated from 8 of 266 ice
cream products (3%) but not from environmental samples. The source of the
pathogens was believed to be transport trucks used to haul both nonpasteurized
liquid eggs and pasteurized ice cream mix. The mix was not repasteurized at the
plant to which it was delivered in the tank trucks for freezing. The lesson learned
was that repasteurization should be done when a mix is given any opportunity
to be contaminated after pasteurization and especially when it is moved from
one location to another in reusable containers. Such reusable containers should
be dedicated to transport of mix only.
XII. MICROBIOLOGICAL METHODS
Tests for microbiological quality and safety of frozen desserts and their ingredi-
ents are described in Standard Methods for the Examination of Dairy Products
(Marshall, 1993), the Compendium of Methods for the Microbiological Examina-
tion of Foods (Vanderzant and Splittstoesser, 1992), and the Official Methods of
Analysis (Cuniff, 1999). Tests most relied on to reflect overall microbiological
Frozen Desserts 119
quality have been the standard plate count (aerobic plate count) and the coliform
count. Petrifilm (3M Health Care, St. Paul, MN) methods of performing each of
these counts are given official status in standard methods and can be substituted
for the plating methods. Furthermore, the spiral plating method for determination
of the total aerobic plate count is an officially recognized method in standard
methods.
Methods for enumeration of microorganisms are classified in Standard
Methods for the Examination of Dairy Products (SMEDP) and in the official
methods manual of AOAC International. Classification is based on three criteria:
(a) research that thoroughly evaluates the method, (b) collaborative testing in
qualified laboratories, and (c) demonstration of applicability based on extensive
use. The AOAC decides whether these qualifications have been met and awards
a method first action status when it has been thoroughly evaluated and collabora-
tively tested; final action status is assigned when those methods have been proven
in extensive use. The SMEDP classification terminology for these methods is A2
and A1, respectively. Recently, two additional classifications have been added.
Class A3 applies to methods approved after meeting criteria set by the United
States Conference on Interstate Milk Shipments for milk produced and shipped
under provisions of the U.S. Pasteurized Milk Ordinance. Class A4 apples to
methods granted Performance Tested status after evaluation by AOAC Interna-
tional Research Institute (Wehr, 2001).
As given in Standard Methods for the Examination of Dairy Products (Mar-
shall, 1993), the agar method for enumerating coliform bacteria in ice cream
products calls for making a 1:2 or 1:10 dilution and distributing 10 mL of this
dilution equally into three Petri dishes to which is added Violet Red Bile Lactose
Agar. Matushek et al. (1992) showed that dilution of ice cream produced more
accurate results than did direct plating. The major reason for inaccuracies with
the direct plating method was atypical colonies produced with the directly plated
samples. Non–lactose-fermenting bacteria can ferment sugar contained in plating
media to which ice cream or frozen desserts are added, producing false-positive
tests. The lower the dilution of the sample, the greater the concentration of sugar
in the medium and the greater the chance for false-positive results (red colonies
arise when acid is produced from fermentable sugar in the medium). Confirmation
of suspect colonies as coliforms can be done by incubation in brilliant green bile
lactose broth in which coliform bacteria produce gas when incubated at 32°C. False-
negative results can occur when ingredients of frozen desserts inhibit growth. Inac-
curacies may occur when excess product on a plate causes overcrowding (more
than approximately 150 colonies), resulting in colonies that are less than 0.5 mm
in diameter. Finally, pipeting undiluted sample cannot be done with precision be-
cause of the high and variable viscosities of frozen dessert mixes.
The official procedure (Marshall, 1993) for enumerating coliform bacteria
with the Petrifilm method calls for making a 2:3 dilution of ice cream and plating
120 Marshall
0.5 mL of this dilution onto one or each of three prehydrated coliform count
plates. Experiments by Matushek et al. (1992) demonstrated that the Petrifilm
coliform count method was highly satisfactory with higher confirmation rates
(94–100%) than any of the other methods tested.
Freezing of desserts produces dead, injured, and fully viable cells. Many
factors interact to determine the fate of microorganisms on freezing. The common
practice used to differentiate injured from uninjured cells is to plate a sample on
an inhibitory medium such as Violet Red Bile Agar (VRBA) (used to enumerate
coliform bacteria) as well as a productive but nonselective medium such as Tryp-
ticase Soy Agar. The injured cells among the survivors of freezing will grow on
the nonselective medium but not on the selective agar, whereas noninjured cells
will grow on both. This principle has been used in the Modified VRBA procedure
of SMEDP in which the sample is plated in 10 mL of Tryptic Soy Agar (TSA).
After solidification, the base medium is overlaid with an equal amount of double-
strength VRB agar. The remainder of the test is unchanged from the VRBA
procedure. The bile salts, neutral red, and crystal violet in the double-strength
VRB agar diffuse into the TSA providing the needed inhibition of noncoliform
bacteria.
Testing of 353 environmental samples taken at four ice cream and six liquid
milk plants by Cotton and White (1990) failed to show a relationship between
standard plate count, coliform count, or psychrotrophic bacteria count and the
presence of L. monocytogenes, but high counts by these methods were associated
with the presence of Yersinia enterocolitica (P H11021 .01).
New tests for small numbers of pathogens in frozen desserts are being made
possible by technological developments. For example, E. coli 0157:H7 was re-
covered and identified within 10 h at concentrations as low as 1 cfu/g of ice
cream (Gooding and Choudary, 1997). Samples were enriched in Tryptic Soy
Broth for 4 h, captured by immunomagnetic separation, amplified by polymerase
chain reaction of parts of the verotoxin genes (SLT-I and SLT-II), and detected
by agarose gel electrophoresis.
XIII. SUMMARY
Ice cream and other frozen desserts are protected from spoilage by very low
temperatures of preparation and storage; however, major ingredients used to make
these products are prone to spoilage and several ingredients are added after the
last lethal process, pasteurization, has been completed. Therefore, microorgan-
isms are of considerable importance to the frozen desserts industry. Pathogens
of greatest importance are L. monocytogenes and S. Enteritidis. The most threat-
ening spoilage bacteria are psychrotrophs in the refrigerated dairy products and
yeasts and molds in fruits and nuts. Dry ingredients and flavoring and colors are
likely to contribute bacterial spores, but they seldom are of concern because of
Frozen Desserts 121
their low numbers and their inability to germinate and grow in the frozen prod-
ucts.
Ice cream is a relatively safe product, but failure to pasteurize it and to
prevent environmental contamination can render it unsafe, especially to infants
and immunocompromised adults.
REFERENCES
Anonymous. Food Chem News 28(19):31, 1986a.
Anonymous. Food Chem News 28(24):11, 1986b.
Anonymous. Food Chem News 28(27):17, 1986c.
Anonymous. Food Chem News 28(35):25, 1986d.
Anonymous. Food Chem News 36(33):34, 1994.
Anonymous. How safe is our food? Lessons from an outbreak of salmonellosis (editorial).
N Engl J Med 334:1324, 1996.
Anonymous. Food Safety. In: Eggcyclopedia. Park Ridge, IL: American Egg Board, 1999,
Chap. 3.
Beuchat LR. Escherichia coli on pecans: survival under various storage conditions and
disinfection with propylene oxide. J Food Sci 38:1036, 1973.
Beuchat LR. Relationship of water activity to moisture content in tree nuts. J Food Sci
43:754, 1978.
Bezkorovainy A, Grohlich D, Nichols JH. Isolation of a glycopolypeptide fraction with
Lactobacillus bifidus subspecies pennsylvanicus growth-promoting activity from
human milk casein. Am J Clin Nutr 32:1428, 1979.
Board RG, Tranter HS. The microbiology of eggs. In: Stadelman WJ, Cotterill OJ, eds.
Egg Science and Technology. 4th ed. Binghamton, NY: Haworth, 1995.
Broadbent JR, Lin C. Effect of heat shock or cold shock treatment on the resistance of
Lactococcus lactis to freezing and lyophilization. Western Dairy Center, Logan,
UT. Academic Press, 1999.
Brooks J, Taylor DI. Eggs and egg products. G. B. Dep Sci Ind Res Board, Spec Rep
Food Invest. 60, 1955.
Chignell CF, Starkweather DK, Sinha BK. A spin label study of egg white avidin. J Biol
Chem 250:5622, 1975.
Christen GL, Marshall RT. Effect of histidine on thermostability of lipase and protease
of Pseudomonas fluorescens 27. J Dairy Sci 68:594, 1985.
Clagett CO. Genetic control of the riboflavin carrier protein. Fed Proc Fed Am Soc Exp
Biol 30:127, 1971.
Cotterill OJ, Glauert J. Destruction of Salmonella oranienburg in egg yolk fractions; emul-
sion stabilizing power, viscosity and electrophoretic patterns. Poult Sci 48:251,
1972.
Cotton LN, White CH. Predictive tests for the presence of environmental pathogens. J
Dairy Sci 73:(Suppl 1):260, 1990.
Cunniff PA ed. Official Methods of Analysis. Gaithersburg, MD: AOAC International,
1996.
122 Marshall
Dean JP, Zottola EA. Use of nisin in ice cream and effect on survival of Listeria monocyto-
genes. J Food Prot 59:476, 1996.
Denn MM. Process Fluid Mechanics. Englewood Cliffs, NJ: Prentice-Hall, 1980.
De Tamsut LS, Garcia CE. Microbiological quality of vanilla ice cream manufactured in
Caracas, Venezuela. Arch Latinoam Nutr 39:46, 1989.
Donnelly CW, Briggs EH. Psychrotrophic growth and thermal inactivation of Listeria
monocytogenes as a function of milk composition. J Food Prot 49:994, 1996.
Doyle MP, Glass KA, Beery GT, Garcia GA, Pollard DJ, Schultz RD. Survival of Listeria
monocytogenes in milk during high temperature short-time pasteurization. Appl En-
viron Microbiol 53:1433, 1987.
Farber JM, Sanders GW, Johnston MA. A survey of various foods for the presence of
Listeria species. J Food Prot 52:456, 1989.
Feller G, Gerday C. Psychrophilic enzymes: molecular basis of cold adaptation. Cell Mol
Life Sci 53:830, 1997.
Fox CW, Chrisope GL, Marshall RT. Incidence and identification of phospholipase C–
producing bacteria in fresh and spoiled raw milk. J Dairy Sci 59:2024, 1976.
Froning G, Izat A, Riley G, Magwire H. Eggs and egg products. In: Vanderzant C, Split-
tstoesser DF, eds. Compendium of Methods for the Microbiological Examination
of Foods. 3rd ed. Washington, DC: American Public Health Association, 1992.
Garayzabel JFF, Rodrigues LD, Boland JAV, Canulo JLB, Fernandez GS. Listeria mono-
cytogenes dans let lait pasteurise. Can J Microbiol 32:149, 1985.
Georgala DL, Hurst A. The survival of food poisoning bacteria in frozen foods. J Appl
Bacteriol 26:346, 1963.
Gerday C, Aittaleb M, Arpigny JL, Baise E, Chessa JP, Garsoux G, Petrescu G, Petrescu
I, Feller G. Psychrophilic enzymes: a thermodynamic challenge. Biochim Biophys
Acta 1342:119, 1997.
Gilliland SE, Nelson CR, Maxwell C. Assimilation of cholesterol by Lactobacillus acido-
philus. Appl Environ Microbiol 49:377, 1985.
Gitter M, Bradley R, Blampied PH. Listeria monocytogenes infection in bovine mastitis.
Vet Rec 107:390, 1980.
Goff HD, Davidson VJ. Flow characteristics and holding time calculations of ice cream
mixes in HTST holding tubes. J Food Prot 55:34, 1992.
Goff HD, Slade PJ. Transmission of Listeria sp. through a cold air tunnel. Dairy Food
Environ Sanit 10:340, 1990.
Gooding CM, Choudary PV. Rapid and sensitive immunomagnetic separation-polymerase
chain reaction method for the detection of Escherichia coil 0157:H7 in raw milk
and ice cream. J Dairy Res 64:87, 1997.
Gould IA, Larsen PB, Doetsch RN, Potter FE. Maintaining quality in ice cream. Ice Cream
Field 52:80, 1948.
Gray ML. Epidemiological aspects of listeriosis. Am J Public Health 35:554, 1963.
Gray ML, Killinger AH. Listeria monocytogenes and listeric infections. Bacteriol Rev 30:
309, 1966.
Grunewald KK. Serum cholesterol levels in rats fed skim milk fermented by L. acido-
philus. J Food Sci 47:2078, 1982.
Gyorgy P, Jeanloz RW, von Nicolai H, Zilliken F. Undialyzable growth factors for Lacto-
bacillus bifidus var pennsylvanicus. Eur J Biochem 43:29, 1974.
Frozen Desserts 123
Hagen M, Narvhus JA. Production of ice cream containing probiotic bacteria. Milchwis-
senschaft 54:265, 1999.
Hekmut S, McMahon DJ. Survival of Lactobacillus acidophilus and Bifidobacterium bi-
fidum in ice cream for use as a probiotic food. J Dairy Sci 75:1415, 1992.
Hennessy TW, Hedberg CW, Slutsker L, White KE, Besser-Wiek JM, Moen ME, Feldman
J, Coleman WW, Edmondson LM, MacDonald KL, Osterholm MT, Investigation
Team. A national outbreak of Salmonella enteritidis infections from ice cream. N
Engl J Med 334:1281, 1996.
Hong SH. Enhancing survival of lactic acid bacteria in ice cream by natural encapsulation
and gene transfer. PhD dissertation, University of Missouri, Columbia, MO, 1995.
Ingram M. The effect of cold on microorganisms in relation to food. Proc Soc Appl Bacte-
riol 14:243, 1951.
Jao YC, Mikolajcik EM, Hansen PMT. Growth of Bifidobacterium bifidum var pennsyl-
vanicus in laboratory media supplemented with sugars and spent broth from Esche-
richia coli. J. Food Sci 43:1257, 1978.
Jeffreys AG, Hak KM, Steffan RJ, Foster JW, Bej AK. Growth, survival and characteriza-
tion of cspA in Salmonella enteritidis following cold shock. Curr Microbiol 36:39,
1998.
Jung DS, Bodyfelt FW, Daeschel MA. Influence of fat and emulsifiers on the efficacy of
nisin in inhibiting Listeria monocytogenes in fluid milk. J Dairy Sci 75:387, 1992.
King AD Jr, Miller MJ, Eldridge LC. Almond harvesting, processing and microbial flora.
Appl Microbiol 20:208, 1970.
King AD Jr, Shade JE. Influence of almond harvesting, processing and storage on fungal
population and flora. J Food Sci 51:202, 1986.
Klausner RB, Donnelly CW. Environmental sources of Listeria and Yersinia in Vermont
dairy plants. J Food Prot 54:607, 1991.
Kocak C, Akan M, Yardimci H. Bacteriological quality of ice cream marketed in Ankura.
Veteriner-Fakultesi-Dergisi, Ankara University 45:1, 131, 1998.
Kozak J, Balmer T, Byrne R, Fisher K. Prevalence of Listeria monocytogenes in Foods:
‘‘Incidence in Dairy Products.’’ International Dairy Foods Association, Washing-
ton, DC. Presented at the International Food Safety Conference, Listeria, The State
of the Science, Rome, Italy, June 29–30, 1995.
Laoprasert N, Wallen ND, Jones RT, Hefle SL, Taylor SL, Yunginger JW. Anaphylaxis
in a milk-allergic child following ingestion of lemon sorbet containing trace quanti-
ties of milk. J Food Prot 61:1522, 1998.
Lock JL, Dolman J, Board RG. Observations on the mode of bacterial infection of hen’s
eggs. FEMS Microbiol Lett 100:701, 1992.
Lopez MC, Medina LM, Jordano R. Survival of lactic acid bacteria in frozen yogurt. J
Food Sci 63:706, 1997.
Lorca GL. Temperature adaptation and cryotolerance in Lactobacillus acidophilus. Bio-
technol Lett 20:847, 1998.
Luyet B. Recent developments in cryobiology and their significance in the study of freez-
ing and freeze-drying of bacteria. In: Proceedings Low Temperature Microbiology.
Camden, NJ: Campbell Soup Co., 1962, p 63.
Marin A, Marshall RT. Production of glycosidases by psychrotrophic bacteria. J Food Sci
48:570, 1983.
124 Marshall
Marshall RT, ed. Standard Methods for the Examination of Dairy Products. 16th ed. Wash-
ington, DC: American Public Health Association, 1993.
Marshall RT, Marstiller J. Unique response to heat of extracellular protease of Pseudomo-
nas fluorescens M5. J Dairy Sci 64:1545, 1983.
Mastronicolis SK. Influence of cold shock on the fatty acid composition of different lipid
classes of the food-borne pathogen Listeria monocytogenes. Food Microbiol 15:
299, 1998.
Masud T. Microbiological quality and public health significance of ice cream. J Pak Med
Assoc 39:102, 1989.
Matushek MG, Curiale MS, McAllister JS, Fox TL. Comparison of various plating proce-
dures for the detection and enumeration of coliforms in ice cream and ice milk. J
Food Prot 55:113, 1992.
Mazur P. Physical and chemical basis of injury in single-celled microorganisms subjected
to freezing and thawing. In: Meryman HT, ed. Cryobiology. New York: Academic
Press, 1966.
Mayerhofer HJ, Marshall RT, White CH, Lu M. Characterization of a heat-stable protease
of Pseudomonas fluorescens P26. Appl Microbiol 25:44, 1973.
Metchnikoff E. The Prolongation of Life. New York: GP Putnam and Sons, 1908.
Miettinen MK, Bjorkroth KJ, Korkeala HJ. Characterization of Listeria monocytogenes
from an ice cream plant by pulsed-field gel electrophoresis. Int J Food Microbiol
46:187, 1999.
Modler HW, McKellar RC, Goff HD, Mackie DA. Using ice cream as a mechanism to
incorporate bifidobacteria and fructoligosaccharides into the human diet. Cultured
Dairy Prod J 25(3):4, 1990.
Morris GK. Salmonella enteritidis and eggs: Assessment of risk. Poultry Sci (Suppl 1):
1000, 1989.
National Soft Drink Association. Quality Specifications and Test Procedures for Bottlers’ Granu-
lated and Liquid Sugar. Washington, DC: National Soft Drink Association, 1975.
Nichols G, de Louvois J. The microbiological quality of ice cream and other edible ices
PHLS Microbiol Dig 12:11, 1995.
Obata H, Ishigaki H, Kawahara H, Yamade K. Purification of a novel cold-regulated pro-
tein from an ice-nucleating bacterium, Pseudomonas fluorescens KUIN. Biosci Bio-
technol Biochem 62:2091, 1998.
Poch M, Bezkorovainy A. Bovine milk k-casein digest is a growth enhancer for the genus
Bifidobacterium. J Dairy Sci 71:3214, 1991.
Ravula RR, Shah NP. Viability of probiotic bacteria in fermented frozen dairy desserts.
Food Australia 50:3, 1998.
Ray B, Speck ML. Freeze injury in bacteria. In: King JK, Faulkner WR eds. Critical
Reviews in Clinical Laboratory Science. Cleveland, OH: CRC Press, 1973, p 161.
Robinson DK. Yogurt manufacture—some considerations of quality. Dairy Indus Int 46:
31, 1981.
Rosenow EM, Marth EH. Growth of Listeria monocytogenes in skim, whole and chocolate
milk, and in whipping cream during incubation at 4, 8, 13, 21, and 35°C. J Food
Prot 50:452, 1987.
Ryser ET, Marth EH. Listeria, Listeriosis and Food Safety. New York: Marcel Dekker,
1991.
Frozen Desserts 125
Schmidt KA, Kim J, Jeon IJ. Composition and concentration of beta-galactosidase of com-
mercial frozen yogurt. J Food Qual 20:349, 1997.
Seeliger HPR. Diagnosis and treatment of listeriosis. In: Listeriosis. Joint WHO/ROI Con-
sultation on Prevention and Control. Berlin, December 10–12, 1986.
Shafi R, Cotterill OJ, Nichols ML. Microbial flora of commercially pasteurized egg prod-
ucts. Poultry Sci 49:578, 1970.
Shahani KM, Vakil JR, Kilara A. Natural antibiotic activity of Lactobacillus acidophilus
and bulgaricus. II. Isolation of acidophilin from L. acidophilus. Cult Dairy Prod J
12(12):8, 1977.
Sheu J-S, Marshall RT. Improving survival of culture bacteria in frozen desserts by
microentrapment. J Dairy Sci 76:1902, 1993.
Speck ML, Tarver FR. Microbiological populations in blended eggs before and after com-
mercial pasteurization. Poultry Sci 46:1321, 1967.
3ASanitary Standards Committee. 3A Accepted Practices for the Sanitary Construction,
Installation, Testing and Operation of High-temperature Short-time and Higher-
heat Short-time Pasteurizer Systems. Revised, Number 603-06. McLean, VA: 3A
Sanitary Standards Committee, 1992.
Troller JA. Food spoilage by microorganisms tolerating low a
w
environments. Food Tech-
nol 33:72, 1979.
U.S. Food and Drug Administration. FDA dairy product safety initiatives. Second year
status report. Washington, DC: Milk Safety Branch, Center for Food Safety and
Applied Nutrition, 1987.
USHEW. Propylene oxide. 21 CFR 193.380. Public Health Service, Food and Drug Administra-
tion. Washington, DC: U.S. Department of Health, Education, and Welfare, 1978.
Vanderzant C, Splittstoesser DF, eds. Compendium of Methods for the Microbiological
Examination of Foods. 3rd ed. Washington, DC: American Public Health Associa-
tion, 1992.
Walker HW, Ayers JC. Yeasts as spoilage organisms. In: Rose AH, Harrison JS, eds. The
Yeasts. Vol 3. Yeast Technology. New York: Academic Press, 1970.
Walker RL, Jensen LH, Kinde H, Alexander AV, Owens LS. Environmental survey for Listeria
species in frozen milk product plants in California. J Food Prot 54:178, 1991.
Wehr, HM, ed. Standard Methods for the Examination of Dairy Products. 17th ed. Wash-
ington, DC: American Public Health Association, 2001.
Whistler RL, Paschall EF. Starch: Chemistry and Technology. Vol II. New York: Aca-
demic Press, 1967.
WHO Working Group. Foodborne listeriosis. Bulletin of the WHO 66(4):421, 1988.
Winter AR, Wilkin M. Holding, freezing and storage of liquid egg products to control
bacteria. Food Freezing 2(4):338, 1947.
Wouters JA, Rombouts FM, de Vos WM, Kuipers OP, Abee T. Cold shock proteins and
low-temperature response of Streptococcus thermophilus CNRZ302. Appl Environ
Microbiol 65:4436, 1999.
Wrinkle C, Weiser HH, Winter AR. Bacterial flora of frozen egg products. Food Res 15:
91, 1950.
Zilliken F, Rose CS, Braun GA, Gyorgy P. Preparation of alkyl N-acetyl-α- and β-D-
glucosaminides and their microbiological activity for Lactobacillus bifidus var.
penn. Arch Biochem 54:392, 1955.
5
Microbiology of Butter
and Related Products
Jeffrey L. Kornacki* and Russell S. Flowers
Silliker Laboratories Group, Inc.
Homewood, Illinois
Robert L. Bradley, Jr.
University of Wisconsin–Madison
Madison, Wisconsin
I. INTRODUCTION AND DEFINITIONS
A. Volumes of Butter and Brief History
Worldwide consumption of butter and milkfat products is estimated at 2,420,000
tons in 1993 for countries where data are available (Table 1). In 1998, the United
States produced 1082H1100310
6
lb of butter with none being purchased by the govern-
ment as surplus (IDFA, 1999). Butter was one of the first dairy products manufac-
tured by humans and has been traded internationally since the 14th century (An-
derson, 1986; Varnam and Sutherland, 1994). All butter manufacture relies on
cream as a starting material. From ancient times through the latter part of the
1800s, cream was obtained from milk by gravity separation. In the 1850s, cream-
eries began producing butter on a small scale. Large-scale manufacture only be-
came possible after development of the mechanical cream separator in 1877 (Var-
nam and Sutherland, 1994).
B. Composition and Types of Butter
Butter is a water-in-oil emulsion, wherein milkfat forms the continuous phase.
This is in contrast to cream, which is an emulsion of milkfat globules suspended
in an aqueous phase. Thus, an emulsion phase inversion occurs during manufac-
*Present affiliation: Center for Food Safety, The University of Georgia, Griffin, Georgia.
127
128 Kornacki et al.
Table 1 Total Consumption of
Butter and Milkfat Products (1993)
Country 1000 tons
Austria 33.8
Australia 58.3
Belgium 70.0
Canada 84.776
Switzerland 37.5
Germany 555.9
Denmark 21.5
Estonia 8.91
Spain 9.0
Finland 27.0
France 389.8
United Kingdom 205
Hungary 9.7
India 58.51
Iceland 0.589
Italy 98
Japan 92
Netherlands 50.4
Norway 9.7
New Zealand 31.9
Sweden 19.9
United States 533
South Africa 14.748
Total 2420
Source: Bulletin of IDF No. 301, 1995.
ture of butter. This happens in churning of cream, and, as a result, milkfat is
concentrated in the product. Butter contains 80% milkfat (typically 80–81%),
17% moisture, 1% carbohydrates and protein, and 1.2–1.5% sodium chloride
(with no salt, the milkfat increases to 82–83%). The pH of sweet cream butter
(unfermented) is about 6.4–6.5. Many countries allow sodium chloride and lactic
cultures as the only nonmilk additives in butter (Milner, 1995). Some countries
allow neutralization of cream and addition of natural coloring agents to adjust for
seasonal variation in colorant in the cream (e.g., annato, carotene, and turmeric).
There are two kinds of butter: sweet cream, which may or may not be
salted, and ripened-cream butter. In ripened cream butter, citrate in cream is fer-
mented by certain lactic acid bacteria to produce acetoin and diacetyl; the latter
imparts a characteristic flavor to the product. Ripened-cream butters are more
Microbiology of Butter and Related Products 129
popular in Europe, whereas unripened or sweet-cream butter is preferred in the
United States, Ireland, England, Australia, and New Zealand (Adams and Moss,
1995).
When whey produced during cheese making is passed through a separator,
the result is whey cream. Whey cream is processed into butter, usually as a blend
with sweet cream. Butter from a H1134920% whey cream and sweet cream blend
may be indistinguishable from that made from 100% sweet cream. Butter is also
manufactured from neutralized or nonneutralized whey cream, usually as a blend
with sweet cream.
II. MANUFACTURE OF BUTTER
Review of Figs. 1–12 will give the reader an understanding of the complete
butter-making process, both continuous and batch methods. The manufacture of
butter (Fig. 12) is uniquely characterized by the following three processes:
1. Concentration of the fat phase of milk. This is done by separation or
standardization of milk which results in cream.
2. Crystallization of the fat phase. Large numbers of small solid fat crys-
tals in globular form are required, with each globule surrounded by
liquid fat. Although pasteurization of cream yields a fully liquefied
Figure 1 Continuous butter churn. (1) Churning cylinder containing beaters to break
emulsion. (2) Separation section where buttermilk is drained. (3) Squeeze-drying section
where initial working begins and where salt is added as a slurry. (4) Second working
section where uniform moisture and salt dispersion occur and texture is finalized. (Cour-
tesy of Dairy Processing Handbook. Tetra Pak Processing Systems AB, Lund, Sweden.)
130 Kornacki et al.
Figure 2 Control panel display. Control and monitoring of the churning process is
affected at this point. A flow diagram through the churning process is shown. Figures
2–9 illustrate modern, high-speed, sanitary production of butter.
Figure 3 Butter is delivered from the turret end of the continuous churn into a covered
silo.
Microbiology of Butter and Related Products 131
Figure 4 Butter is discharged into the covered silo.
Figure 5 Butter in covered silo moving to a rotary positive displacement pump by
augers.
132 Kornacki et al.
Figure 6 Distribution of butter to packaging machinery through a manifold.
Figure 7 Infrared light sensor (arrow) monitors level of butter in hopper and signals
computer which controls off/on of delivery pump and an air-operated valve.
Microbiology of Butter and Related Products 133
Figure 8 Wrapping of 1-lb prints of butter.
Figure 9 Filling of butter cups on a Form-Fill-Seal machine (Hooper Engineering, Sara-
sota, FL).
134 Kornacki et al.
Figure 10 A batch churn with controls. A few batch churns continue to operate in the
United States.
milkfat, cooling and tempering for at least 4 h at approximately 10°C
is necessary to develop an extensive network of stable fat crystals sur-
rounded by liquid milkfat. In making ripened-cream butter, addition
of lactic acid bacteria to pasteurized cream cooled to 16°C is followed
by incubation until a pH near 5 is attained. Cooling to 3–5°C stops
the fermentation followed by warming to 10°C immediately before
churning. This technique controls the fermentation while allowing for
liquid fat on the globule exterior.
3. Phase separation and formation of a plasticized water-in-oil emulsion.
Churning breaks the oil-in-water (o/w) emulsion and results in a plas-
tic, water-in-oil (w/o) emulsion. The phase inversion occurs in both
batch and continuous churns. During churning, vigorous agitation is
used to disrupt the membrane on each milkfat globule. When the emul-
sion breaks, milkfat globules have formed pea-sized granules. Contin-
ued aggregation of fat globules forms a continuous matrix at an optimal
temperature. The optimal temperature is dependent on triglyceride
composition and season of the year; for example, 10°C summer and
11°C winter (Brunner, 1976). Churning is inefficient with homoge-
nized cream or if the milkfat is too liquid or solid (too warm or too
Microbiology of Butter and Related Products 135
Figure 11 Interior view of a batch churn showing vanes on outer edge, inspection win-
dow, and center tube which can have chilled water circulated through it to control product
temperature. Butter is removed by one of two ways: (a) manually with metal scoops or
(b) by dumping the butter into a boat (hopper) positioned beneath the churn. The boat is
then wheeled to the packaging area.
cold, respectively). The proper blend of liquid fat surrounding solid
fat is necessary. The optimum temperature for continuous churning
is from research conducted on batch churns to minimize fat losses.
Continuous churn operations require similar cream conditions to those
for batch churns to control fat losses to buttermilk. Using batch churns,
researchers found cream must ‘‘break’’ or aggregate into pea-sized
granules in 45 min to minimize fat losses in buttermilk. These same
principles of operation have been used in developing butter manufac-
turing techniques with the continuous churn. Cream is pasteurized at
a minimum temperature of 85°C and held for at least 15 s at that tem-
perature. Research proved that high-temperature pasteurization was
necessary to allow for frozen (H1100230°C) storage of butter for 2 years
as with Commodity Credit Corporation (CCC) purchases of surplus
product. Lipase native to milk, in particular, may reactivate with lesser
thermal treatment resulting in spoilage of butter by hydrolytic ran-
cidity.
136 Kornacki et al.
Figure 12 Production of butter.
Microbiology of Butter and Related Products 137
Working of butter accomplishes two purposes: first, even distribution of
moisture and salt in tiny droplets, and second, to allow for fat crystal growth to
increase spreadability and to minimize brittleness of the product. After churning
and working, butter is salted. Salting is done near the end of working in a continu-
ous churn and at moisture standardization in a batch churn to prevent loss of salt.
Packaging occurs after salting and may be done directly into retail portions or
in bulk containers (25 and 31 kg are common) (Varnam and Sutherland, 1994).
National intervention boards in the European Economic Community stipulate a
storage temperature of H1100215°C; however, a lower temperature is frequently used,
particularly for unsalted butter. A temperature of H1100230°C was effective for storing
butter in excess of 1 year (Varnam and Sutherland, 1994). Stored frozen butter
is later thawed and microfixed and then packaged into retail containers. Microfix-
ing is a mechanical process that reestablishes the physical structure of butter lost
as a result of freezing. Butter from different manufacturers may be blended to-
gether during repackaging. Without microfixing, butter will have texture prob-
lems (lack of spreadability) and may show moisture leakage.
Thus, butter manufacture involves partial or complete separation of cream
from raw milk, pasteurization, possible fermentation by added lactic acid bacteria
(when ripened-cream butter is manufactured), churning, working, salting, pack-
aging, storage, and perhaps later repackaging (see Fig. 12). All of these activities
impact on the microflora of the final product.
III. MICROBIOLOGICAL CONSIDERATIONS IN BUTTER
The microbiology of butter reflects the microflora present in pasteurized cream
from which it is made, water added at the time of salting butter, sanitary condi-
tions of process equipment, manufacturing environment, and conditions under
which the product is stored. Intrinsic properties of butter, for example, a
w
, pH,
salt content, uniformity of moisture distribution and droplet size, all impact mi-
crobiological stability.
A. Cream
The main source of microorganisms in butter made under excellent sanitary con-
ditions is cream. Raw milk may be contaminated with a wide variety of patho-
genic and spoilage microorganisms. The microflora of raw milk is related to that
found in and on the cow’s udder, milk-handling equipment, and storage condi-
tions (Jay, 2000). Proper handling, pasteurization, and storage conditions should
result in a predominantly gram-positive microflora in milk. Psychrotrophic Bacil-
lus spp. (United States and Europe) and Clostridium spp. (Europe) have been
found in 25–35% and 8% of raw milk samples, respectively (Jay, 2000; IDF/FIL,
138 Kornacki et al.
1994). These organisms survive pasteurization of cream. A review of pathogenic
microorganisms in raw milk was prepared by the International Dairy Federation
(IDF/FIL, 1994). (Also see Chapters 1 and 13.)
B. Importance of Pasteurization
The Code of Federal Regulations (21 CFR 58.334) stipulates that pasteurization
of cream for butter manufacture will be at or above 85°C for 15 s. This thermal
treatment minimizes reactivation of lipase native to milk. Further, after 2 years
of frozen storage at H1100230°C, resultant butter will still have a score of 92 or grade
A. Moreover, there are further benefits to this process. Many microorganisms are
inactivated. However, there is a lack of research data to show destruction of
enzymes from psychrotrophic bacteria during this thermal exposure. Because fin-
ished butter is stable during frozen storage, it is thought that all enzymes were
destroyed. Pasteurization of cream from raw milk is designed to eliminate vegeta-
tive microbial pathogens and reduce numbers of potential spoilage organisms.
In the United States, cream must contain not less than 18% fat. However, heat-
resistant microbes and spores of Bacillus and Clostridium will survive. Tempera-
tures between 95 and 112°C are commonly used to inactivate them (Schweizer,
1986). Cream is also heated to inactivate lipases (which cause hydrolytic rancidity
in butter), reduce intensity of undesirable flavors by vacuum treatment (e.g., from
feed ingredients), activate sulfydryl compounds (which can reduce autooxidation
of butter), and liquefy milkfat for subsequent efficient churning (Schweizer,
1986).
C. Ripening
Many people in western and northern Europe and a few in the United States
prefer the flavor of butter manufactured from microbiologically ripened cream
(Pesonen, 1986). Traditionally, pasteurized cream is adjusted to 21°C and inocu-
lated with lactic cultures composed of pure or mixed strains of Lactococcus lactis
subsp. lactis, Lc. lactis subsp. cremoris, Leuconostoc mesenteroides subsp. crem-
oris, and Lc. lactis subsp. lactis biovar diacetylactis. Ripening occurs for 4–6 h
until a pH of about 5 is achieved, and then cream is cooled to stop the fermenta-
tion. In this process, spoilage microorganisms are controlled primarily through
the bacteriostatic effect of lactic acid produced by the starter culture.
D. NIZO Method
The NIZO method (Kimenai, 1986) for producing a cultured butter is allowed
in several countries and is used by many dairies in western Europe. In the NIZO
method, starter culture is not added to cream, but instead, a mixture of diacetyl-
Microbiology of Butter and Related Products 139
rich permeate and starter cultures is worked into butter. Fermentation of partly
delactosed whey or other suitable media containing milk components by lactic
acid bacteria (i.e., Lactobacillus helveticus) continues for 2 days at 37°C, and
then the medium is ultrafiltered to remove proteins and bacteria and to further
concentrate the medium (Kimenai, 1986). During ultrafiltration, macromole-
cules are removed and concentrated in the retentate, whereas low molecular
weight solutes pass through into the permeate stream. The pH of butter made
with the permeate from this process is more easily adjusted in the desired
range of 4.8–5.3. This permeate can be stored at 4°C for more than 4 months
under proper conditions. Advantages cited for this process are numerous (Ki-
menai, 1986).
Homofermentative lactic acid bacteria such as Lc. lactis subsp. lactis and
Lc. lactis subsp. cremoris are used to produce lactic acid from lactose in dairy
products. However, flavor production requires addition of a heterofermentative
organism such as L. mesenteroides subsp. cremoris or Lc. lactis subsp. lactis
biovar diacetylactis to produce diacetyl (Jay, 2000). Diacetyl, in addition to im-
parting flavor, inhibits gram-negative bacteria and fungi (Jay, 2000).
E. Churning and Working
The bacterial load of buttermilk is typically greater than that of cream or butter
(Milner, 1995). When culture-ripened cream is used to manufacture butter, most
starter culture organisms are retained in buttermilk; however, some remain in
butter. In several studies, butter made from cultured cream retained 0.5–2.0% of
the culture organisms present in cream (Hammer and Babel, 1957). Olsen et al.
(1988) found numbers of Listeria monocytogenes were 6.7–15.0 times higher in
pasteurized but subsequently inoculated creams than in butter manufactured from
the same cream. In an earlier study (Minor and Marth, 1972), Staphylococcus
aureus behaved similarly. These organisms are gram positive, and it is unclear
how other microorganisms with different cell wall and membrane structures dis-
tribute themselves between cream and butter. Diacetyl content of milkfat in-
creases during churning; agitation during churning favors oxidative processes
needed for diacetyl production (Foster et al., 1957). The pH of salted butter can
prohibit formation of diacetyl (Foster et al., 1957).
F. Moisture Distribution During Churning and Working
From 10 to 18 billion droplets of water are dispersed in 1 g of the water-in-oil
emulsion that is butter (Hammer and Babel, 1957). Given the low microbial load
expected in pasteurized sweet cream (less than 20,000 cfu/mL) (Jay, 2000), most
of the droplets are sterile. This depends on size and degree of dispersion of drop-
140 Kornacki et al.
lets and the microbial level in cream (Hammer and Babel, 1957). The diameter
of water droplets in conventionally made butter has been reported at H110211toH1102230
μm (Brunner, 1976).
The number of water droplets greater than 30 μm in diameter is inversely
proportional to the time of working during conventional (batch churn) butter
manufacture (Hammer and Babel, 1957). A consequence of uneven distribution
of droplets containing microorganisms is a high degree of nonhomogeneity
regarding microbial distribution in butter. Inadequate working of the butter in
batch churns results in poor dispersion of water droplets and promotes microbial
spoilage (Hammer and Babel, 1957; Foster et al., 1957). Further, this defect can
be observed on a trier in the form of moisture droplets. The defect is called
‘‘leaky’’ butter and results in a reduced score. This implies that availability of
nutrients or inhibitor is limited by the fine dispersion of water droplets (Foster
et al., 1957). Droplet size ideally is less than 10 μm (Varnum and Sutherland,
1994).
G. Washing and Salting
Butter granules may be washed to remove excess buttermilk (Foster et al., 1957);
however, this is not often done today. Salt added to butter inhibits microbial
growth. However, salt must be distributed evenly in the moisture phase of butter
effectively to inhibit microbial growth in water droplets. Insufficient working
results in a nonhomogeneous distribution of salt in the water droplets (Hammer
and Babel, 1957; Milner, 1995). Salt creates an osmotic gradient between salt
granules and buttermilk during working. This tends to cause aggregation of water
droplets and can lead to free moisture (‘‘leaky’’ butter) and a color defect called
‘‘mottling.’’ Adequate working and use of finely ground salt or salt flour can
minimize this defect (Varnam and Sutherland, 1994).
The use of brine to salt butter is restricted to products with less than 1%
salt, because the brine cannot contain more than 26% salt (w/w). Mostly, slurries
of salt in saturated brine solutions containing up to 70% w/w sodium chloride
are used. Salt granules used to produce a slurry should be less than 50 μmin
diameter. Salt in the slurry should also be of high chemical purity, with insignifi-
cant levels of lead (H110211 ppm), iron (H1102110 ppm), and copper (H110212 ppm) (Varnam
and Sutherland, 1994).
The microbiological quality of water used for washing or for brines is criti-
cal to production of a safe and stable product. Water with less than 100 cfu/mL
total aerobic count when plates are incubated at 22°C and less than 10 cfu/mL
total aerobic count when plates are incubated at 37°C has been deemed to be
acceptable (Murphy, 1990). Formerly, wash water was chilled and chlorinated
at 10 ppm 2 h before use to control microflora. Little if any butter washing is
done today.
Microbiology of Butter and Related Products 141
Listeria survive in a saturated brine solution held at 4°C for 132 days
(Mitscherlich and Marth, 1984). Thus, brines used to salt butter must be free of
Listeria. Water is frequently contaminated with pseudomonads, and consequently
care must be taken to insure water and brines used are free of these bacteria. The
most common form of spoilage in butter occurs with species of Pseudomonas
(Jay 2000; Milner, 1995). Addition of salt to butter lowers the freezing point so
that psychrotrophic microorganisms present may be able to grow at less than
0°C. Some psychrotrophic organisms multiply in salted butter stored as low as
H110026°C (Hammer and Babel, 1957).
Distribution of salt in the moisture phase of butter has less impact on growth
of yeasts and molds on the surface of butter as compared to bacteria (Hammer
and Babel, 1957). Humid conditions appear to have a greater impact on mold
growth than does the material on which they grow. Bacterial spoilage may occur
in areas of butter with low salt in large droplets of moisture (poor working).
Varnam and Sutherland (1994), Kimenai (1986), and Munro (1986) have
provided more detailed descriptions of continuous butter manufacturing pro-
cesses.
H. Packaging
In batch operations, butter is loaded directly from the churn into hoppers and
wheeled to packaging machines. Handling butter this way exposes it to air, work-
ers, plant environment, and ambient temperatures that may accelerate spoilage.
Control of the microbiological quality of air in the packaging room is therefore
important. HEPA (High Efficiency Particulate Arrester) quality air with the fil-
tration after temperature modification is desired. Practices that result in standing
water on the floor or residual and spilled product facilitate growth of environmen-
tal contaminants. Practices that aerosolize contaminants often produce unaccept-
able levels of microbiological contamination in the air. Thus, maintaining dry
conditions in the plant is preferred. Numerous approaches can be taken to monitor
microbiological air quality, which include sedimentation, impaction on solid sur-
faces, impingement in liquids, centrifugation, and filtration (Hickey et al., 1992).
Air quality is particularly important in butter produced from continuous-type
churns that may incorporate up to 5% air into the product (if a vacuum deaerator
is not used) (Varnam and Sutherland, 1994). Most whipped butter does not have
processing room air incorporated but instead uses purified compressed nitrogen
gas. Gases used must be of acceptable microbiological quality.
Personnel hygiene is critical at this point of butter manufacture, because
contaminants from hands, mouth, nasal passages, and clothing may be transmitted
to butter during packaging. Few continuous churns are arranged to discharge
product directly into the receiving hopper of packaging machinery (Varnam and
Sutherland, 1994). However, to ensure uninterrupted operation, it is common to
142 Kornacki et al.
transfer butter to a butter boat (open) or covered silo. Covered silos minimize
the risk of further contamination from the plant environment. Screw augers in
the bottom of the boat or silo move butter to the suction side of a rotary positive
displacement pump which moves butter from the boat or silo to packaging equip-
ment. Direct packaging into consumer-size containers is preferable over bulk
packaging, because such butter must be reworked and repackaged before sale.
Such reworking increases the risk of contamination and subsequent spoilage of
butter (Milner, 1995).
Cardboard boxes lined with vegetable parchment, parchment aluminum foil
laminate, or a variety of plastic films are typically used for bulk packaging of
butter (Varnam and Sutherland, 1994). Polyethylene is the preferred material
based on its physical properties (low density, high impact, cost effectiveness,
absence of copper, and near sterile condition). Parchment, which supports mold
growth under humid conditions, is still frequently used (Varnam and Sutherland,
1994). Retail butter packs are typically wrapped in parchment, waxed parchment,
or foil/parchment laminate and overwrapped with a cardboard container. Odors
in storage refrigerators will permeate and ultraviolet rays from light will penetrate
parchment wraps more rapidly than other wrappers and result in oxidized flavor.
Individual butter packs, for example, continentals, cups, and chips, used in restau-
rants and food service are made at the time of packaging by appropriate high-
speed equipment.
I. Pathogen Survival and Growth in Butter
Research conducted using the following pathogenic microorganisms has shown
their growth in butter products: L. monocytogenes in butter at 4 and 13°C (made
from inoculated cream) (Olsen et al., 1988), S. aureus in lightly salted (1% w/
w) whey cream butter at 25 and 30°C (Halpin-Dohnalek and Marth, 1989b),
and inoculated whipped butter at 25°C (Halpin-Dohnalek and Marth, 1989a).
L. innocua (not a pathogen but frequently associated with L. monocytogenes in
environmental samples) was found in butter by Massa et al. (1990).
J. Food Poisoning Outbreaks
The incidence of documented food poisoning associated with butter is low. This is
partially attributed to widespread use of pasteurization at elevated temperatures.
Postpasteurization environmental contamination of cream or butter represents the
greatest risk to butter contamination and spoilage. Several outbreaks of staphylo-
coccal intoxication related to butter have been reported in the United States (Cen-
ters for Disease Control, 1970, 1974, 1977). In one instance, gastrointestinal ill-
ness developed in 24 customers and employees of a department store restaurant
and was traced to whipped butter manufactured from whey cream (Centers for
Microbiology of Butter and Related Products 143
Disease Control, 1970). The same butter used to manufacture the implicated
whipped product also resulted in one case of gastroenteritis. This butter contained
10 ng of staphylococcal enterotoxin A/g. In 1977, more than 100 customers of
pancake houses in the Midwest became ill after consumption of whipped butter
(Centers for Disease Control, 1977).
K. Spoilage
The two principal types of microbial spoilage of butter are surface taint and hy-
drolytic rancidity (Jay, 2000). Both conditions can be caused by growth of Pseu-
domonas spp. Some Pseudomonas spp. are psychrotrophic (Kornacki and Gabis,
1990) and produce proteases and lipases which may survive pasteurization
(Cousin, 1982) and which hydrolyse protein and fat, respectively. P. putrifaciens
can grow on butter surfaces at 4 to 7°C and produce a putrid odor within 7–10
days (Jay, 2000). This odor may result from liberation of certain organic acids,
especially isovaleric acid (Jay, 2000).
Rancidity, the second most common spoilage defect, is caused by both
microbial and nonmicrobial lipases, which degrade milkfat to free fatty acids. P.
fragi and sometimes P. fluorescens are associated with this defect (Jay, 2000).
Mold growth on butter also can cause hydrolytic rancidity for the same reasons
(Irbe, 1993). Molds that can cause this defect in butter include some in the genera
Rhizopus, Geotrichum, Penicillium, and Cladosporium (Irbe, 1993). Less com-
mon spoilage defects include malty flavor, skunk-like odor, and black discolor-
ation. These defects are caused by Lc. lactis var. maltigenes, P. mephitica, and
P. nigrifaciens, respectively. Other microbially induced color changes may result
from surface growth of various fungi that produce colored spores (Jay, 2000).
Heat-resistant proteases and lipases produced by pseudomonads that may grow
during storage of raw milk or cream may result in spoilage of butter after manu-
facture even though spoilage organisms may have been destroyed by pasteuriza-
tion.
L. Sources of Environmental Contamination
The necessity for milk, cream, and wash water to be of high microbial quality
and the importance of pasteurization to public health have been described. Yeasts
and molds are particularly resistant to dry conditions when compared to bacteria.
Unlike bacteria, many of these fungi can grow at water activities (a
w
) below 0.84.
A few can grow below an a
w
of 0.65 (Troller and Christian, 1978). A study was
reported in which molds would not grow on butter held at or below 70% humidity
(Hammer and Babel, 1957). Therefore, to prevent growth of osmotolerant yeasts
and molds, a humidity of 60% or less should be maintained in the processing
environment.
144 Kornacki et al.
Ineffective sanitation of processing equipment could result in product con-
tamination from equipment such as piping, pumps, silos, or other equipment
(Hammer and Babel, 1957). In our experience, the backplate of older positive
displacement pumps (e.g., from pasteurized cream storage tanks) may be ne-
glected during sanitation and become a microbial growth niche, which in turn
provides an inoculum to the product stream. Stress cracks in double-walled, insu-
lated tanks can also provide a source of product contamination when the insulat-
ing material between walls becomes wet. Further, published data validating effec-
tive cleaning and sanitation on continuous churns through use of microbiological
swabs are lacking.
Personal hygiene of employees working with butter is also important. Cross
contamination from hands, mouths, nasal passages, and clothing must be pre-
cluded (Hammer and Babel, 1957). Handling butter in restaurants may also result
in cross contamination of a product; for example, when 1-lb prints are divided
with knives used for cutting meat or when whipped butter is scooped with im-
properly sanitized equipment (Halpin-Dohnalek and Marth, 1989a).
IV. MICROBIOLOGICAL CONTROL OF BUTTER
A. Factors Limiting Microbial Growth in Butter
A variety of extrinsic (e.g., temperature) and intrinsic (e.g., salt in the moisture
phase) factors combine to control the microflora of butter. Most important among
these are (a) fine and uniform dispersion of moisture phase, (b) addition and
uniform dispersion of salt, (c) low-temperature storage, and (d) use of lactic cul-
tures (in ripened cream butter) (Hammer and Babel, 1957; Olsen et al., 1988).
Microbial growth is proportional to availability of nutrients and related to size
of water droplets in butter (Verrips, 1989). Thus, the smaller and more uniform
the droplets, the lower the potential for microbial growth. Salt must also be dis-
tributed evenly in the moisture phase of the product effectively to inhibit micro-
bial growth in contaminated water droplets. The approximate salinity of moisture
in butter with 1.5% salt is 9%; this will inhibit growth of many bacteria. However,
working may not result in a homogeneous distribution of salt in the water droplets
(Milner, 1995; Hammer and Babel, 1957). Data suggest that dispersion of water
droplets, salt, and bacteria in butter made by continuous churns may be more
uniform than in butter made with batch churns. Aerobic plate counts revealed a
steady decrease in microbial contaminants in butter made in continuous churns
compared with counts obtained on butter made from batch churns (O’Toole,
1978). Salt-free droplets were found in freshly worked salted butter made with
a batch churn (Hammer and Babel, 1957). Technological developments that allow
for uniform dispersion of moisture, salt, and bacteria enhance both safety and
shelf-life of butter.
Microbiology of Butter and Related Products 145
Storage of salted butter at freezing temperatures is not adequate to guaran-
tee complete cessation of microbial growth because of the depressed freezing
point in the moisture phase of the product resulting from elevated salt content
and presence of other dissolved solutes. However, freezing is an effective means
of storage for unsalted butter. O’Toole (1978) provided data that suggested that
the lowest temperature limit for microbial metabolic activity in salted butter was
H110029°C. As a result of sensory evaluation, the flavor of butter held at H110026°C was
marginally less after 12 weeks; however, butter stored 8 weeks at 4 or 10°C
dropped about one point in flavor score (O’Toole, 1978).
Some countries allow the use of potassium sorbate and sodium benzoate
as preservatives in butter. However, countries such as the United States, United
Kingdom, France, and Luxembourg prohibit preservatives in butter. Addition of
0.1% potassium sorbate inhibited growth of coliforms and molds in naturally
contaminated butter (Kaul et al., 1979). The inhibitory effect was enhanced when
2% salt was added along with 0.1% potassium sorbate. This inhibition occurred
in all samples stored 4 weeks at H1100218 and 5°C.
Caution should be exercised in selection of any additives blended into but-
ter products for flavor (e.g., honey, garlic, chopped herbs, and fruits), because
they may contribute additional enzymes and microflora to the product. For exam-
ple, unpasteurized honey added to butter will cause hydrolytic rancidity within
2 weeks because of lipase in the honey. Butter colorants that have not been mis-
handled have rarely contributed to the microflora of cream or butter (Foster et
al., 1957).
B. Quality Assurance
Any quality assurance program should incorporate maintenance and documenta-
tion of good manufacturing practices (GMPs) and hazard analysis critical control
points (HACCP).
C. Hazard Analysis Critical Control Points (HACCP)
An obvious critical control point for butter manufacturers is pasteurization or
repasteurization of cream received at the manufacturing site. Control of the mi-
croflora in the manufacturing environment is also critical. Each plant must evalu-
ate its individual process and develop its own risk assessment and HACCP plan
(Smittle, 1992). An environment sampling protocol should be aimed at monitor-
ing for L. monocytogenes, S. aureus, and Salmonella. Recalls of butter because
of L. monocytogenes contamination were reported as recently as 1994 (Ryser,
1999). Faust and Gabis (1988) have recommended areas of food plant environ-
ments that can be targeted for sampling for pathogens. Discovery of Salmonella
or Listeria in the environment requires immediate corrective action with docu-
146 Kornacki et al.
mentation of the success of that action. Irbe (1993) has recommended that manu-
facturers of whipped butter develop in-plant guidelines for aerobic plate count
and S. aureus at critical control points of manufacture. Finished products must
be free of Salmonella, and L. monocytogenes and should be free of Escherichia
coli (Irbe, 1993).
Testing for these organisms can be done to validate success of the manufac-
turer’s HACCP program. All testing of pathogens must be done away from the
manufacturing site. Most in-plant laboratories are not equipped with the needed
accessories to prevent spread of pathogens to the plant environment. Manufactur-
ers should also test for lipolytic and psychrotrophic spoilage organisms in the
finished product and develop a three-class attribute sampling plan (Smittle, 1992).
These data can be used to establish goals and measure success based on principles
of continuous quality improvement (Crosby, 1984). Sanitation of equipment used
to manufacture product should be assessed regularly by testing environmental
swabs for selected microbes.
The authors of this chapter recommend that pasteurized cream for butter
manufacture has H113495000 cfu/g (APC) with H110212 coliforms/g. Finished butter
should contain H113495000 cfu/g (APC), H110212 coliforms/g, no staphylococcal entero-
toxins, no Salmonella in 375 g, no L. monocytogenes in 25 g, and H1102110 yeasts
and molds/g.
V. MICROBIOLOGY OF RELATED PRODUCTS
A. Definitions
Margarine, like butter, contains approximately 80–81% fat, 15% moisture, 0.6%
protein, 0.4% carbohydrate, and 2.5% ash (Irbe, 1993). In margarine, edible fats,
oils, or mixtures of these with partially hydrogenated vegetable oils or rendered
animal carcass fats are substituted for milkfat (Code of Federal Regulations,
1994). Eighty percent fat in butter and margarine is considered too high by many
individuals concerned about their diets (Varnam and Sutherland, 1994). Conse-
quently, numerous spreads have been manufactured with lower fat contents. In
many countries, there are no legal standards or definitions for these low-fat
spreads. However, a working categorization has been made based on fat content
(Varnam and Sutherland, 1994). Full-fat spreads are described as those with fat
contents of 72–80%; reduced-fat spreads have 50–60% fat; low-fat spreads have
39–41% fat, and very low-fat spreads have less than 30% fat. Vegetable fats,
mixtures of vegetable fat and milkfat, and milkfat alone have been used to de-
velop these spreads (Varnam and Sutherland, 1994). Another trend has been pro-
duction of spreads in which fat has been replaced in part or completely by a
variety of substances such as Neutrifat, Simplesse, and Stellar (Varnam and Suth-
erland, 1994). Olestra a sucrose polyester with fatty acids, was recently (1996)
Microbiology of Butter and Related Products 147
approved by the U.S. Food and Drug Administration (FDA) as a substitute for
conventional fats and may appear in products in the future.
B. Dairy Spreads: Manufacture and Microbiological
Considerations
Low-fat spreads are also water in oil emulsions but contain more moisture than
butter. Consequently, there is increased likelihood of microbial growth in these
products unless preservatives are added. The use of preservatives is allowed in
some countries but not in others. Because of combining ingredients at 45°C, in
an emulsifying unit, growth of thermoduric organisms (e.g., Enterococcus fae-
cium, E. faecalis) and thermophils may occur. Higher fat dairy spreads are typi-
Figure 13 Manufacturing flow diagram for margarine-type products.
148 Kornacki et al.
cally made using a swept-surface heat exchanger and texturizer where the aque-
ous blend of ingredients is mixed in the correct ratio with oil-soluble ingredients.
Crystallization of fat during working is critical to obtain desired consistency
and spreadability in the finished product. Rapid supercooling to H1100210° to H1100220°C
under high sheer conditions in the scraped surface heat exchanger initiates and
maintains crystallization and disperses moisture within the fat matrix (Varnam
and Sutherland, 1994). Control of cross contamination during packaging is more
critical than in butter manufacture because of the higher potential for microbial
growth in spreads.
Microorganisms that cause spoilage in butter have been implicated in mar-
garine spoilage. However, vegetable fats are typically more resistant to lipolytic
breakdown than is milkfat (Varnam and Sutherland, 1994). Yarrowia lipolytica,
Bacillus polymyxa, and E. faecium are spoilage organisms of concern in low-fat
spreads (Varnam and Sutherland, 1994; Lanciotti et al., 1992). Lanciotti et al.
(1992) showed that L. monocytogenes and Yersinia enterocolitica can grow in
‘‘light’’ butter at 4 and 20°C. A class I recall of 60% butter, 40% margarine
product occurred in 1992 (FDA Enforcement Report, 1992). More detailed de-
scriptions of margarines, spreads, and industrial milkfat products can be found
in the report by Varnam and Sutherland (1994). An outline of margarine and
spread manufacture is shown in Fig. 13.
VI. CONCLUSION
The safety record of butter has improved considerably since the advent of cream
pasteurization and improvements in churn design, sanitation, and water quality.
However, rigorous adherence to GMPs with appropriate environmental sampling
and HACCP are necessary to ensure the safety and prolong the shelf-life of butter
and spreads.
REFERENCES
Adams MR, Moss MO. The microbiology of food preservation. In: Food Microbiology.
Cambridge, UK: The Royal Society of Chemistry, 1995, pp 55–102.
Anderson RF. Introduction, Continuous Butter Manufacture. International Dairy Federa-
tion Bulletin No. 204. Brussels: International Dairy Federation, 1986, p 2.
Brunner JR. Characteristics of edible fluids of animal origin: milk. In: Fennema OR, ed.
Principles of Food Science. New York: Marcel Dekker, 1976, pp 619–658.
Centers for Disease Control. Staphylococcal food poisoning traced to butter—Alabama.
Morbid Mortal Weekly Rep 19:271, 1970.
Centers for Disease Control. Probable staphylococcal enterotoxin contamination of com-
Microbiology of Butter and Related Products 149
monly produced milk shake mixes—Maryland, New Jersey, Pennsylvania, West
Virginia. Morbid Mortal Wkly Rep 23:155–156, 1974.
Centers for Disease Control. Presumed staphylococcal food poisoning associated with
whipped butter. Morbid Mortal Wkly Rep 19:271, 1977.
Code of Federal Regulations. 21 CFR 116.110. Washington, DC: Food and Drug Adminis-
tration, 1994.
Code of Federal Regulations. 21 CFR 58.334. Washington, DC: Food and Drug Adminis-
tration, 1998.
Cousin M. Presence and activity of psychrotrophic microorganisms in milk and dairy
products: a review. J Food Prot 45:172–207, 1982.
Crosby PB. Quality Without Tears. New York: McGraw-Hill, 1984.
Faust RE, Gabis DA. Controlling microbial growth in food processing environments. Food
Technol 42(12):81–82, 89, 1988.
Foster EM, Nelson FE, Speck ML, Doetsch RN, Olson JC Jr. Microbiology of Cream
and Butter. Dairy Microbiology. Englewood Cliffs, NJ: Prentice-Hall, 1957.
Halpin-Dohnalek MI, Marth EH. Fate of Staphylococcus aureus in whipped butter. J Food
Prot 52:863–866, 1989a.
Halpin-Dohnalek MI, Marth EH. Fate of Staphylococcus aureus in whey, whey cream,
and whey cream butter. J Dairy Sci 72:3149–3155, 1989b.
Hammer BW, Babel FJ. Dairy Bacteriology. 4th ed. New York: Chapman & Hall, 1957,
pp 442–509.
Hickey PJ, Beckelheimer CE, Parrow T. Microbiological tests for equipment, containers,
water and air. In: Marshall RT, ed. Standard Methods for the Examination of Dairy
Products. 16th ed. Washington, DC: American Public Health Association, 1992,
pp 397–412.
IDF/FIL. The Significance of Pathogenic Microorganisms in Raw Milk. Brussels: Interna-
tional Dairy Federation. 1994.
IDF/FIL. Consumption Statistics of Milk and Milk Products 1993. Bulletin No. 301. Brus-
sels: International Dairy Federation. 1995.
IDFA. Milk Facts, 1999 edition. International Dairy Foods Assn., Washington, DC.
Irbe RJ. Microbiology of reduced-fat foods. Science for the food industry of the 21st
century. In: Yalpani M, ed. Biotechnology, Supercritical Fluids and Other Ad-
vanced Technologies for Low Calorie, Healthy, Food Alternatives. Mount Prospect,
IL: ATL Press, 1993, pp 359–382.
Jay JM. Modern Food Microbiology. 6th ed. New York: Chapman & Hall, 2000.
Kaul J, Singh J, Kuila RK. Effect of potassium sorbate on the microbial quality of butter.
J Food Prot 42:656–657, 1979.
Kimenai MP. Cream crystallization, Section III-NIZO method. In: Continuous Butter
Manufacture. Bulletin No. 204. Brussels: International Dairy Federation, 1986, pp
11–15.
Kornacki JL, Gabis DA. Microorganisms and refrigeration temperatures. Dairy, Food En-
viron Sanit 10:192–195, 1990.
Lanciotti R, Massa S, Guerzoni M, Di Fabio G. Light butter: natural microbial population
and potential growth of Listeria monocytogenes and Yersinia enterocolitica. Lett
Appl Microbiol 15:256–258, 1992.
Massa S, Cesaroni D, Poda G, Trovatelli LD. The incidence of Listeria spp. in soft cheeses,
150 Kornacki et al.
butter and raw milk in the province of Bologna. J Appl Bacteriol 68:153–156,
1996.
Milner J. Butter and low-fat dairy spreads. In: LFRA Microbiology Handbook. Leather-
head, Surrey, UK: Leatherhead Food RA, 1995, pp B-1–B-15.
Minor TE, Marth EH. Staphylococcus aureus and enterotoxin A in cream and butter. J
Dairy Sci 55:1410–1414, 1972.
Mitscherlich E, Marth EH. Microbial Survival in the Environment: Bacteria and Rickett-
siae Important in Human and Animal Health. New York: Springer-Verlag, 1984.
Munro DS. Alternative processes. In: Continuous Butter Manufacture. Bulletin No. 204.
Brussels: International Dairy Federation, 1986, p. 17–19.
Murphy MF. Microbiology of butter. In: Robinson RK, ed. Dairy Microbiology. Vol 2.
The Microbiology of Milk Products. London: Elsevier, 1990, pp 109–130.
Olsen JA, Yousef AE, Marth EH. Growth and survival of Listeria monocytogenes during
making and storage of butter. Milchwissenschaft 43:487–489, 1988.
O’Toole DK. Effect of storage temperature on microbial growth in continuously made
butter. Aust J Dairy Technol 33:85–87, 1978.
Pesonen H. Cream crystallization, Section II—Ripened Cream. In: Continuous Butter
Manufacture. Bulletin No. 204. Brussels: International Dairy Federation, 1986, pp
12–13.
Ryser, ET. Incidence and behavior of Listeria monocytogenes in unfermented dairy prod-
ucts. In: Ryser ET, Marth EH eds. Listeria, Listeriosis and Food Safety. 2nd ed.
Marcel Dekker, New York, 1999, pp 359–409.
Schweizer M. Heat treatment. In: Continuous Butter Manufacture. Bulletin No. 204. Brus-
sels: International Dairy Federation, 1986, p 10.
Smittle RB. Foods, quality control. In: Encyclopedia of Microbiology. Vol 2. New York:
Academic Press, 1992, pp 219–229.
Troller JA, Christian JHB. Water Activity and Food. New York: Academic Press, 1978.
Varnam AH, Sutherland JP. Butter, margarine and spreads. In: Milk and Milk Products.
New York: Chapman & Hall, 1994, pp 223–274.
Verrips CT. Growth of microorganisms in compartmentalized products. In: Gould GW, ed.
Mechanisms of Action of Food Preservation Procedures. London: Elsevier Applied
Science, 1989, pp 363–399.
6
Starter Cultures and Their Use
Ashraf N. Hassan
Minia University
Minia, Egypt
Joseph F. Frank
The University of Georgia
Athens, Georgia
I. INTRODUCTION
Modern dairy microbiology began with the study of the natural acidification pro-
cess that occurs when milk, cheese whey, or buttermilk (from cultured butter
manufacture) are held for a time. These acidified products had long been used
as inocula to produce cheese, butter, and cultured milks, but the resulting fermen-
tations were undependable and of uneven quality. Pasteur, in 1857, was the first
to demonstrate that the lactic fermentation was of microbial origin; disputing the
accepted theory of the time that chemical degradation of sugar to lactic acid
resulted in spontaneous generation of microorganisms (Brock, 1961). It was not
until 1878 that Lister isolated pure cultures of the lactic acid bacteria responsible
for milk acidification (Brock, 1961). In the 1880s, Conn in the United States,
Storch in Denmark, and Weigmann in Germany demonstrated the advantages of
using selected lactic acid bacteria to culture cream for butter manufacture (Knud-
son, 1931; Cogan, 1996). Commercial production and the use of starter cultures
grew rapidly and was widespread at the beginning of the 20th century. The advan-
tages of using starter cultures to initiate fermentation were convincing. Before
the use of commercial starter cultures, Cheddar cheese took 6–7 h to produce,
and much of the product was of too poor a quality to be sold (Conn, 1895). Slow
fermentation was also a public health threat, because milk for cheese manufacture
was not pasteurized. Currently, most cultured dairy products are produced using
151
152 Hassan and Frank
commercial starter cultures that have been selected for a variety of desirable
properties in addition to rapid acid production. These may include flavor produc-
tion, lack of associated off-flavors, bacteriophage tolerance, ability to produce
flavor during cheese ripening, salt tolerance, polysaccharide production, bacterio-
cin production, and heat sensitivity.
A starter culture is any active microbial preparation intentionally added
during product manufacture to initiate desirable changes. These microbial prepa-
rations can consist of lactic acid bacteria, propionibacteria, surface-ripening bac-
teria, yeasts, and molds. Starter cultures have a multifunctional role in dairy fer-
mentations. Their ability to produce acid rapidly aids in separation of curd from
whey during cheese manufacture, modifies texture of cheeses and cultured milks,
and enhances preservation. Production of low molecular weight compounds such
as diacetyl contributes to flavor and aroma. Gas production can cause eye forma-
tion in cheese. Development of flavor and changes in texture during ripening of
cheeses is associated with enzymes originating from bacterial and fungal cultures,
depending on the cheese variety.
Lactic starter cultures may consist of single strains used alone or in combi-
nations or undefined mixtures of strains (mixed-strain cultures). Cultures can also
be either mesophilic (optimal growth at approximately 26°C) or thermophilic
(optimal growth at approximately 42°C) (Cogan, 1996). Mesophilic mixed-strain
starter cultures can be grouped by composition: O (or N) cultures consist of lacto-
cocci that do not ferment citrate; B (or L) cultures contain Leuconostoc spp. and
lactococci that do not ferment citrate; D cultures contain both citrate-fermenting
and citrate-nonfermenting lactococci but no Leuconostoc spp; BD cultures con-
tain Leuconostoc spp. as well as lactococci found in D cultures (Lodics and
Steenson, 1993). The type of mixed strain culture used for a specific cheese vari-
ety depends primarily on the amount of gas production (if any) that is desired.
Thermophilic starter cultures consist of a mixture of Streptococcus thermophilus
and Lactobacillus sp., usually either Lb. helveticus, Lb. delbrueckii subsp. bulgar-
icus,orLb. delbrueckii subsp. lactis. These cultures are used to produce Italian
and Swiss cheese varieties and yogurt.
This chapter discusses characteristics of lactic acid bacteria and other mi-
croorganisms found in dairy starter cultures; their interactions, preparation, and
activity measurement; inhibitors of their activity; microbial inhibitors that they
produce; and their genetic modifications.
II. STARTER CULTURE MICROORGANISMS
A. General Characteristics of Lactic Acid Bacteria
All dairy fermentations use lactic acid bacteria for acidification and flavor produc-
tion. Although lactic acid bacteria are genetically diverse, common characteristics
of this group include being gram-positive, non–spore forming, nonpigmented,
Starter Cultures and Their Use 153
and unable to produce iron-containing porphyrin compounds (catalase and cyto-
chrome); growing anaerobically but being aerotolerant; and obligately fermenting
sugar with lactic acid as a major endproduct. Lactic acid bacteria tend to be
nutritionally fastidious, often requiring specific amino acids, B vitamins, and
other growth factors, whereas being unable to use complex carbohydrates.
1. Taxonomy
There are currently 11 genera of lactic acid bacteria, of which four—Lactobacil-
lus, Streptococcus, Lactococcus, and Leuconostoc—are commonly found in
dairy starter cultures. A fifth genus, Enterococcus, is occasionally found in
mixed-strain (undefined) starter cultures. Important phenotypic taxonomic crite-
ria include morphological appearance (rod or coccus), fermentation endproducts
(homofermentative or heterofermentative), carbohydrate fermentation, growth
temperature range, optical configuration of lactic acid produced, and salt toler-
ance (Axelsson, 1993). rRNA sequences are used accurately to determine phylo-
genetic relationships among bacteria. This and other genetic methods have led
to reorganization of some genera of lactic acid bacteria (e.g., reclassification of
lactic streptococci to Lactococcus spp.).
2. Natural Habitat
Lactic acid bacteria are generally associated with nutrient-rich habitats containing
simple sugars. These include raw milk, meat, fruits, and vegetables. They grow
with yeast in wine, beer, and bread fermentations. In nature, they are found in
the dairy farm environment and in decomposing vegetation, including silage.
Some species colonize animal organs, including the mouth, intestine, and vagina.
They are also part of the normal microflora of the streak canal of the mammary
gland. Lactic acid bacteria isolated from natural habitats are often physiologically
distinct from their starter culture variants. For example, lactococci isolated from
plants ferment lactose slowly, if at all (Chassy and Murphy, 1993).
B. Characteristics of Starter Culture Genera and Species
1. Lactococcus
Lactococci (formerly group N streptococci) are the major mesophilic microorgan-
isms used for acid production in dairy fermentations. Although five species are
recognized, only one, Lc. lactis, is of significance in dairy fermentations. Lc.
lactis cells are cocci that usually occur in chains, although single and paired cells
are also found. They are homofermentative; when grown in milk, more than 95%
of their endproduct is lactic acid (of the L isomer). Lactococci grow at 10°C but
not at 45°C. They are weakly proteolytic and can use milk proteins. They hy-
drolyse milk casein by extracellular proteinase PrtP. However, all their peptidases
154 Hassan and Frank
seem to be intracellular (Law and Haandrikman, 1997). There are two subspecies,
Lc. lactis subsp. lactis and Lc. lactis subsp. cremoris. Differential characteristics
for these subspecies are presented in Table 1. Lc. lactis subsp. lactis is more heat
and salt tolerant than Lc. lactis subsp. cremoris. A variant of Lc. lactis (Lc. lactis
subsp. lactis var. diacetylactis) converts citrate to diacetyl, carbon dioxide, and
other compounds. Some lactococci produce exopolysaccharide (Cerning, 1990).
These variants are used to produce Scandinavian cultured milks having a ropy
texture (viilli, taettamilk, and langmjolk). Another variant of Lc. lactis produces
malty off-flavor caused by aldehyde production from amino acids (Morgan,
1976).
2. Streptococcus
The only Streptococcus sp. useful in dairy fermentation is S. thermophilus. This
microorganism is genetically similar to oral streptococci (S. salivarius) but can
still be considered a separate species (Axelsson, 1993). S. thermophilus is differ-
entiated from other streptococci (and lactococci) by its heat resistance, ability to
grow at 52°C, and ability to ferment only a limited number of carbohydrates
(Axelsson, 1993). Most dairy products subjected to high temperatures during
fermentation (H1102240°C) are acidified by the combined growth of S. thermophilus
and Lactobacillus spp. S. thermophilus has limited proteolytic ability, although
it possesses many types of proteolytic enzymes.
3. Leuconostoc
Leuconostoc spp. are distinguished from other lactic acid bacteria by being meso-
philic heterofermentative cocci. They do not hydrolyze arginine and require vari-
Table 1 Differentiation of Lactococci Used in Starter
Cultures
Lactococcus lactis subsp.
Characteristic lactis cremoris
Acid from
Lactose H11001H11001
Galactose H11001H11001
Maltose H11001H11002
Ribose H11001H11002
Growth in 4% salt H11001H11002
Arginine hydrolysis H11001H11002
Source: Schleifer et al., 1985.
Starter Cultures and Their Use 155
ous B vitamins for growth. Leuconostoc spp. used in the dairy industry produce
diacetyl, carbon dioxide, and acetoin from citrate. Some also produce exopolysac-
charide (dextran) from sucrose. Only two species of Leuconostoc are associated
with dairy starter cultures, Leuc. mesenteroides subsp. cremoris (previously,
Leuc. citrovorum) and Leuc. lactis. These are differentiated by their ability to
ferment various carbohydrates. Leuconostoc spp. grow poorly in milk; probably
because they are adapted to growth on vegetables and roots (Vedamuthu, 1994)
and therefore lack sufficient proteolytic ability to grow in milk. Leuc. mesentero-
ides subsp. cremoris does not produce sufficient acidity in milk to coagulate it,
but Leuc. lactis may (Thunell, 1995). In starter cultures, Leuconostoc spp. are
combined with lactococci when production of diacetyl and carbon dioxide is
desired in addition to acidification. When used in cultured milk starters, they
convert excess acetaldehyde to diacetyl, thus reducing undesirable ‘‘green’’ fla-
vor (Lindsay et al., 1965). Leuconostoc spp. do not grow well in high-phosphate
phage-inhibitory media (Vedamuthu, 1994).
4. Lactobacillus
The Lactobacillus genus consists of a genetically and physiologically diverse
group of rod-shaped lactic acid bacteria. The genus can be divided into three
groups based on fermentation endproducts. Species in each of these groups can be
found in dairy starter cultures, as listed in Table 2. Homofermentative lactobacilli
exclusively ferment hexose sugars to lactic acid by the Embden-Meyerhof path-
way. They do not ferment pentose sugars or gluconate. These are the lactobacilli
(Lb. delbrueckii subsp. bulgaricus, Lb. delbrueckii subsp. lactis, and Lb. helveti-
cus) commonly found in starter cultures. They grow at higher temperatures
(H1102245°C) than lactobacilli in the other groups and are thermoduric. Another mem-
ber of this group, Lb. acidophilus, is not a starter culture organism, but it is added
to dairy foods for its nutritional benefits.
Facultatively heterofermentative lactobacilli ferment hexose sugars either
only to lactic acid or to lactic acid, acetic acid, ethanol, and formic acid when
glucose is limited. Pentose sugars are fermented to lactic and acetic acid via the
phosphoketolase pathway. This group includes Lb. casei, which is not usually
found in starter cultures but is associated with beneficial secondary fermentation
during cheese ripening.
Obligately heterofermentative lactobacilli ferment hexose sugars to lactic
acid, acetic acid (or ethanol), and carbon dioxide using the phosphoketolase path-
way. Pentose sugars are also fermented using this pathway. These lactobacilli
can cause undesirable flavor and gas formation during ripening of cheese. They
produce proteinases, endopeptidases, aminopeptidases, dipeptidases, tripepti-
dases, and proline-specific peptidases (Law and Haandrikman, 1997). One spe-
cies, Lb. kefir, is associated with kefir cultures.
156
Hassan
and
Frank
Table 2 Characteristics of Lactobacillus spp. Associated with Dairy Products
Growth Fermentation of
Lactic acid Mole
Species Products at 15°Cat45°C isomer %GH11001C Glu Gal Lac Mal Suc Rib
Homofermentative
L. delbrueckii Yogurt, koumiss, H11002H11001 D49–51H11001H11002H11001H11002H11002H11002
subsp. bulgaricus kefir, Italian
and Swiss
cheeses
subsp. lactis Hard cheese H11002H11001 D49–51H11001 d
a
H11001H11001H11001H11002
L. acidophilus Acidophilus milk, H11002H11001 DL 34–37 H11001H11001H11001H11001H11001H11002
laban
L. helveticus Yogurt, Swiss H11002H11001 DL 38–40 H11001H11001H11001 d H11002H11002
cheese
Facultatively hetero-
fermentative
L. casei subsp. casei Hard cheese H11001H11002 L45–47H11001H11001d H11001H11001H11001
Obligately heterofer-
mentative
L. kefir Kefir H11001H11002 DL 41–42 H11001H11002H11001H11001H11002H11001
a
Some strains are positive.
Source: Cogan, 1996.
Starter Cultures and Their Use 157
Lactobacilli are the most acid tolerant of the lactic acid bacteria, preferring
to initiate growth at acidic pH (5.5–6.2) and lowering the pH of milk to below
4.0. Lactobacilli are slow to grow in milk in pure culture. For this reason, they
are generally used in combination with S. thermophilus.
5. Propionibacteria
Propionibacterium spp. are non–spore-forming, pleomorphic, gram-positive rods
that produce large amounts of propionic and acetic acid and carbon dioxide from
sugars and lactic acid. They are anaerobic to aerotolerant mesophils. They are
not considered to belong to the lactic acid bacteria, but are closely related to
coryneform bacteria in the Actinomycetaceae group. Four species of Propioni-
bacterium are found in cheese (Table 3), but P. freudenreichii subsp. freudenrei-
chii and P. freudenreichii subsp. shermanii are most often used in cheese manu-
facture (Lyon and Glatz, 1995). Although Propionibacterium spp. are found in
raw milk, they may be present in insufficient numbers to produce an adequate
fermentation, so they are often added along with the lactic culture when cheese
with eyes is made.
Propionibacteria can use both inorganic and organic nitrogen sources, and
their requirements for amino acids vary. Most strains require biotin. Cultures for
cheese manufacture are grown on complex media, including hydrolyzed protein
and yeast extract with lactic acid as a carbon source (Glatz, 1992).
Propionibacteria grow on lactic acid produced during cheese fermentation.
Lactate is oxidized to pyruvate, which then is either converted to acetate and
carbon dioxide or propionate. Carbon dioxide forms the large eyes found in Swiss
and similar types of cheese, and other metabolic products, including amino acids
and fatty acids, contribute to flavor of these cheeses.
Table 3 Differentiation of Propionibacterium spp. Associated with Dairy Products
Characteristic Pr. freudenreichii Pr. jensenii Pr. thoenii Pr. acidipropionici
Acid from
Sucrose H11002H11001H11001H11001
Maltose H11002H11001H11001H11001
Mannitol H11002H11001H11002H11001
Rhamnose H11002H11002H11002H11001
Nitrate reduction H11002H11002H11002H11001
β-hemolysis H11002H11002H11001H11002
Colony color Cream Cream Red-brown Cream to orange-
yellow
Source: Cummins and Johnson, 1984.
158 Hassan and Frank
6. Brevibacterium
Brevibacterium cells are aerobic, gram-positive, pleomorphic rods that grow on
the surface of surface-ripened varieties of cheese. The species most often isolated
from these cheeses is B. linens. B. linens produces a yellow-orange carotenoid
pigment that colors the surface of the cheese. Color formation is enhanced by
exposure to light. Older cultures are primarily coccoid, but slender rods are pro-
duced in exponential growth. B. linens does not use lactose or citrate but can
grow on the lactate produced during cheese manufacture. It also grows best at
neutral pH, so it does not grow well on the cheese surface until lactic acid is
neutralized or metabolized by yeasts or micrococci. Surface-ripened cheeses are
surface salted, and B. linens, like yeasts and micrococci, grows well at high salt
concentrations. B. linens is highly proteolytic with the ability to degrade whey
proteins and casein (Fringa et al., 1993; Holtz and Kunz, 1994). The ability of
B. linens to degrade amino acids to ammonia and methionine to methanethiol is
partially responsible for production of strong flavors and odors during surface
ripening of cheese. Other volatile compounds produced by B. linens that contrib-
ute to the typical flavor of surface-ripened cheese include butyric acid, caproic
acid, phenylmethanol, dimethyldisulfide, and dimethyltrisulfide (Jollivet et al.,
1992). B. linens grows well in media containing hydrolyzed protein, glucose,
yeast extract, potassium phosphate, and magnesium sulfate (Haysahi et al., 1990).
7. Enterococci
The genus Enterococcus includes the Lancefield group D (fecal) streptococci,
Streptococcus faecalis and S. faecium,asEnt. faecalis and Ent. faecium. Since
reestablishing the genus in 1984, 9 species has been transferred from the genus
Streptococcus and 10 new species have been added (Stiles and Holzapfel, 1997;
Klein et al., 1998). They are gram-positive, catalase-negative cocci, produce L(H11001)
lactic acid homofermentatively from glucose, and also derive energy from degrada-
tion of amino acids. They have a phosphoenolpyruvate phosphotransferase (PEP-
PTS) system for uptake of lactose and other carbohydrates, including gluconate.
Enterococci are used as food safety indicators and have a possible involve-
ment in foodborne illness. Enterococci are also used as starter cultures in some
southern European cheeses. In addition, they are commercially available as pro-
biotics for prevention and treatment of intestinal disorders. Among enterococci
only Ent. faecalis and Ent. faecium are important as probiotics. They are readily
differentiated by fermentation of arabinose and sorbitol and by their growth tem-
peratures (Klein et al., 1998).
8. Bifidobacteria
The genus Bifidobacterium is in the family Actinomycetaceae. Bifidobacteria pro-
duce lactic and acetic acids in the ratio of 2:3. They have the enzyme fructose-
Starter Cultures and Their Use 159
6-phosphate phosphoketolase which is lacking in lactic acid bacteria. Also, the
high GH11001C content of their DNA (55–57 mol%) and their phylogenetic relat-
edness place them in the actinomyces subdivision of gram-positive bacteria. The
29 species exhibit major morphological differences (Stiles and Holzapfel, 1997).
The taxonomy and nomenclature of Bifidobacterium is still evolving, and many
probiotic cultures now in use do not have the appropriate species designation.
Since biochemical reactions are not always useful to classify strains isolated
from dairy products, only polyphasic taxomony, which is a combination of phe-
notypic and genomic traits, is able to differentiate species (Kien et al., 1998).
The natural habitat of bifidobacteria is the intestinal tract. They can also be found
in sewage, vaginal microflora, and dental caries. The most important species of
Bifidobacterium for probiotic application are B. longum, B. bifidum, and B. ani-
malis.
The different enzymatic capabilities of bifidobacteria strains make it diffi-
cult to select a single medium for all species (Marshall and Tamime, 1997). Tech-
nological selection criteria for bifidobacteria strains to be used as probiotic micro-
organisms include capability of growing to high cell density in inexpensive
media, robust to culture concentration, and the capability of being harvested,
frozen or freeze dried with cryoprotection. In addition, the culture must retain its
viability and properties throughout the shelf life of the product. Medicoscientific
criteria for selection include gastric transit tolerance, small intestinal transit toler-
ance, bile salt tolerance, limenal growth and persistence, epithelial adhesion, epi-
thelial growth and persistence, coaggregation ability, and antimicrobial produc-
tion and susceptibility (Charteris et al., 1998).
Bifidobacteria grow poorly in milk; possibly because of the lack of small
peptides and free amino acids. Some strains exhibit better growth when milk is
supplemented with casein hydrolysate or yeast extract. Strains reported to grow
well in milk may be stimulated by naturally occurring growth factors such as
specific casein derivatives or oligosaccharides (Marshall and Tamime, 1997).
Because of the possible role of bifidobacteria in stabilizing the digestive
system of humans, much attention has recently been given to incorporation of
this species into dairy products. In yogurt, they are usually used in combination
with normal yogurt bacteria because of their slow acid production. However,
postproduction acidification and the possibility that they are inhibited by antimi-
crobial compounds produced by Lb. delbrueckii subsp. bulgaricus could pose
problems for their survival. Although many bifidobacteria are acid sensitive,
some strains survive at pH values as low as 4. Variations in survival are affected
by storage temperature, the initial number of bacteria, storage time, and strain
tested. In cheese, bifidobacteria persist in moderately high numbers in spite of
adverse salt content and storage temperature. Generally, bifidobacteria strains
exhibit diverse responses to adverse conditions, so appropriate strain selection is
very important.
160 Hassan and Frank
9. Penicillium
Penicillium spp. are molds in the class Hyphomycetes in the division Deuteromy-
cota. Molds in this class produce conidia directly on mycelium or on conidio-
phores. The conidiophores of Penicillium spp. arise erect from the hyphae and
branch near the tip to produce a brush-like ending (Beneke and Stevenson, 1987).
Two groups of Penicillium spp. are used in cheese manufacture, the white mold
(P. camemberti Thom, formerly two species, P. caseicolum and P. camemberti),
which grows on the surface of Camembert, Brie, and similar varieties; and the
blue mold (P. roqueforti, formerly P. roqueforti var. roqueforti), which grows
in the interior of blue-veined cheeses such as Roquefort, Gorgonzola, and Stilton.
P. camemberti is closely related to P. commune, a common cheese contaminant
that produces various toxins (Frisvad and Filtenborg, 1989), whereas P. camem-
berti produces only one mycotoxin, cyclopiazonic acid. P. roqueforti is closely
related to P. carneum (formerly P. roqueforti var. carneum), a producer of the
mycotoxin patulin, and P. paneum (formerly P. roqueforti var. carneum), a pro-
ducer of patulin and the mycotoxin botryodiploidin (Boysen et al., 1996).
P. camemberti and P. roqueforti are lipolytic and proteolytic. Both produce
methyl ketones and free fatty acids, but the much higher levels produced by P.
roqueforti give blue cheeses their distinctive flavor and aroma (Kinsella and
Hwang, 1976; Jollivet et al., 1993). P. camemberti contributes to the flavor of
Camembert and Brie cheeses by producing a complex mixture of compounds,
the major ones being 2-heptanone, 2-heptanol, 8-nonen-2-one, 1-octen-3-ol, 2-
nonanol, phenol, butanoic acid, and methyl cinnamate (Moines et al., 1975).
C. Enumeration of Dairy Starter Cultures
Many complex media are available to cultivate different genera of lactic acid
bacteria. However, only a few of them are considered to be selective. Table 4
lists media commonly used to enumerate dairy starter bacteria.
Different means are used to develop selective media which are based on
biochemical characteristics (oxygen sensitivity, antibiotic resistance, acid produc-
tion, fermentation patterns), and bioproducts of the enumerated species. The same
medium can be used to enumerate selectively a particular species by changing
the incubation temperature (M17 at 37°C for S. thermophilus and 25°C for Lacto-
coccus) or by changing the pH (MRS at 5.5 for selective enumeration of Lb.
delbrueckii ssp. bulgaricus). Some ingredients are added to inhibit growth of other
species. For example, sodium azide makes Elliker agar more selective for lactic
acid bacteria. Also, media used to enumerate bifidobacteria are characterized by
the presence of substrates, which lowers the redox potential (cysteine, cystine,
ascorbic acid), antibiotic, and/or a single carbon source to inhibit lactic acid bac-
teria. Vacomysin is added to a Leuconostoc medium to inhibit Lactococcus and
Starter Cultures and Their Use 161
Table 4 Media Used for Enumeration of Dairy Starter Cultures
Microorganism Media References
Lactic acid bacteria Elliker (lactic) agar Elliker et al., 1956
S. thermophilus 1. M17 1. Terzaghi and Sandine,
1975
2. S. thermophilus agar 2. Dave and Shah, 1996
Lb. delbrueckii subsp. bul- MRS (pH 5.5) DeMan et al., 1960
garicus
Lb. acidophilus 1. MRS-salicin agar 1. Hull and Roberts, 1984
2. MRS-sorbitol agar 2. Hull and Roberts, 1984
Bifidobacteria 1. BL-OG 1. Lim et al., 1995
2. Bif 2. Pacher and Kniefel,
1996
Leuconostoc ssp. LUSM Benkerroum et al., 1993
Yeasts and molds OGY Mossel et al., 1970
Enterococci Citrate azide agar Reinbold et al., 1953
Lactococci M17 Terzaghi and Sandine,
1975
Propionibacteria 1. Sodium lactate agar 1. Vedamuthu and Rein-
bold, 1967
2. Emmental juice-like 2. Savat-Brunaud et al.,
agar 1997
3. Modified YEL 3. Savat-Brunaud et al.,
1997
Differentiate between rods Yogurt lactic agar Matalan and Sandine,
and cocci in yogurt 1986
starter
Differentiate between ho- HHD McDonald et al., 1987
mo- and heterfermenta-
tives
Differentiate between Lb. TPPPYPB Ghoddusi and Robinson,
acidophilus, Bifido- 1996
bacterium spp., S. ther-
mophilus and Lb. del-
brueckii subsp.
bulgaricus
Differentiate between Lac- Differential agar Reddy et al., 1972
tococcus lactis subsp.
162 Hassan and Frank
some Lactobacillus spp. On the other hand, nonselective media are required to
enumerate injured cells; for example, lactobacilli that survive milk pasteurization
used for cheese manufacture. Many different media were also developed to assist
differentiation of species or subspecies. Differentiation is usually based on colony
morphology, which is affected by the interaction between bacteria and medium.
D. Desirable Properties of Lactic Cultures
Properties desired of lactic cultures for industrial use may differ from those found
in typical wild-type microorganisms. For example, most dairy fermentations re-
quire rapid acid production and the lack of off-flavor production, whereas wild-
type organisms are often slow acid producers and produce such off-flavors as
fruity, bitter, and malty. Buchenhu¨skes (1993) summarized selection criteria for
lactic acid bacteria to be used for food fermentations. These include (1) lack of
pathogenic or toxic activity (e.g., production of biogenic amines), (2) ability to
produce desired changes, (3) ability to dominate competitive microflora, (4) ease
of propagation, (5) ease of preservation, and (6) stability of desirable properties
during culturing and storage. Specific properties desired in a dairy starter culture
depend on the product being produced.
1. Cheddar Cheese
The four main selective criteria for Cheddar cheese cultures are rapid acid produc-
tion, bacteriophage resistance (see Sec. V), salt sensitivity, and ripening activity
(Strauss, 1997). Rapid acid production should occur at a steady rate throughout
curd making. This ensures suppression of undesirable microflora, timely cheese
manufacture, and the presence of sufficient ripening enzymes from starter micro-
organisms. Rapid lactose fermentation in lactococci is associated with the pres-
ence of a phosphoenol pyruvate-dependent phosphotransferase system (see
Chap. 7 for discussion of acid production).
In Cheddar manufacture, salt is added after most of the desired acidity has
developed. However, some acid-producing activity is still needed after salting to
ensure that all lactose is metabolized. Residual lactose can serve as a substrate
for salt-tolerant organisms such as heterofermentative lactobacilli that produce
gas and undesirable flavors (Olson, 1990). Growth of starter microflora after salt
addition also produces a low oxidation-reduction potential that has a beneficial
impact on flavor development and inhibits some spoilage microorganims.
Ripening activity is related to production of proteases and other enzymes.
These enzymes must be produced in sufficient quantity to develop the typical
Cheddar flavor without off-flavors. Peptidase activity is more important than
proteinase activity. In fact, starter culture proteinases are associated with de-
velopment of a bitter flavor (Visser et al., 1983). Cheese made using 45–75%
proteinase-negative cells developed less bitter flavor than cheese made using
Starter Cultures and Their Use 163
proteinase-positive cultures (Mills and Thomas, 1980). However, proteinase-
negative strains cannot use proteins, so their growth in milk is limited. Starter
culture peptidases hydrolyze peptides (including those with bitter flavor) pro-
duced by the action of rennet, and, in combination with other microbial enzymes,
produce a chemical environment conducive to development of the typical Ched-
dar flavor. Starter cultures for Cheddar cheese can include strains that specifically
enhance ripening but take little or no part in initial acid production (Trepanier
et al., 1991). (See Chapter 7 for additional information on starter culture protease
systems.)
2. Mozzarella Cheese
Cultures for mozzarella cheese manufacture are combinations of S. thermophilus
and either Lb. delbrueckii subsp. bulgaricus or Lb. helveticus. American-style
mozzarella is manufactured for use as a food ingredient, especially on pizza. The
starter culture contributes to functional properties related to this use, such as
stretchability and heat-induced browning. The typical starter culture for American
mozzarella manufacture has a 1:5 rod to coccus ratio (McCoy, 1997). This results
in rapid initial acid production (by the streptococci) and shortens make time.
Lactobacilli produce acid late in manufacture, and are much more proteolytic
than streptococci. Proteolysis during storage increases meltability and decreases
stretchability of cheese (Oberg et al., 1991a, 1991b). Rod to coccus ratio only
slightly influences textural changes during storage (Yun et al., 1995); level of
initial inoculum has a greater influence on texture.
Hassan and Frank, (1997) found that capsule-forming nonropy lactic cul-
tures can mimic some of the physical properties of fat in cheese curd. When
used as starter cultures, the capsule-forming strains significantly increased water
retention by low-fat mozzarella cheese (Perry et al., 1997, 1998).
Starter culture also affects color development during cooking. Many ther-
mophilic cultures use only the glucose portion of the lactose molecule, excreting
galactose (see Chap. 7). High-browning cheeses contain nearly five times more
galactose than low-browning cheeses (Matzdorf et al., 1994). If low-browning
cheese is desired, galactose-utilizing cultures such as Lb. helveticus can be used.
Using Lb. helveticus instead of Lb. delbrueckii subsp. bulgaricus results in moz-
zarella cheese with lower galactose levels, improved melting, and decreased make
time (Oberg et al., 1991a). Excessive heat during stretching (curd temperature
H1102266°C) can inactivate starter culture enzymes and reduce galactose metabolism
and proteolysis during storage (Chen et al., 1994).
3. Swiss Cheese
Starter cultures for Swiss cheese manufacture must survive the high temperatures
used in its manufacture (50–52°C). The starter culture is also responsible for
development of the typical Swiss cheese flavor and eye formation. The typical
164 Hassan and Frank
Swiss cheese starter culture consists of S. thermophilus, Lb. helveticus, and P.
freudenreichii subsp. shermanii. Mesophilic lactococci are sometimes added to
increase acid production early in manufacture. A consistent rate of acid produc-
tion by the starter is important, because more rapid acid production results in
lower moisture content (Turner et al., 1983). Lactose fermentation occurs primar-
ily during the first 24 h of manufacture. Streptococci initially predominate, using
lactose and excreting galactose. Subsequent growth of lactobacilli is required for
complete utilization of galactose (Hutkins et al., 1986). If all residual sugars are
not used, defects from growth of gas-forming microorganisms or brown pigment
formation can occur (Harrits and McCoy, 1997).
Propionibacteria grow on lactate produced by the lactic culture, converting
it to carbon dioxide, propionic acid, acetic acid, and small amounts of other com-
pounds. Propionibacteria can reach 10
9
cfu/g and use more than 50% of the lactate
at the center of the cheese (Fryer and Peberdy, 1977). Swiss cheese is ripened
at 21°C for eye formation and then aged at 10°C for flavor development. There-
fore, the Propionibacterium culture should grow well at 21°C but not at 10°C
(so the eyes do not split) (Harrits and McCoy, 1997). A predictable rate of gas
formation at 21°C is required, because too rapid gas formation results in split
eyes (Hettinga et al., 1974).
High-moisture baby Swiss is manufactured using lower cooking tempera-
tures (approximately 40°C) and therefore is produced, not with thermophilic cul-
tures, but with heat-tolerant lactococci. Propionibacteria are still used for eye
formation.
4. Cultured Buttermilk and Sour Cream
Cultures for buttermilk, sour cream, and similar products must both acidify the
substrate and produce flavor and aroma compounds. Citrate-fermenting bacteria
such as Leuc. mesenteroides subsp. cremoris or Lc. lactis subsp. lactis var. diace-
tylactis are combined with Lc. lactis subsp. lactis or Lc. lactis subsp. cremoris.
Citrate fermentation is discussed in Chapter 7. Diacetyl, the major aromatic com-
pound in these products, can be reduced to acetoin by diacetyl reductase. Cultures
should be selected that are low in diacetyl reductase activity. Acetaldehyde is
often produced during fermentation, giving the product an undesirable ‘‘green
apple’’ or yogurt flavor. Leuconostocs (but not lactococci) can metabolize acetal-
dehyde to ethanol, with a resulting flavor improvement (Peterson, 1997). Exo-
polysaccharide-producing starter cultures might improve the physical properties
of low-fat sour cream.
5. Yogurt
a. Acidification Yogurt is made using a combination of S. thermophilus
and Lb. delbrueckii subsp. bulgaricus. These organisms grow in a cooperative
relationship resulting in rapid acidification. The presence of lactobacilli stimu-
Starter Cultures and Their Use 165
lates growth of the more weakly proteolytic S. thermophilus, because lactobacilli
liberate free amino acids and peptides from casein (Rajagopal and Sadine, 1990).
S. thermophilus, in turn, stimulates growth of Lb. delbrueckii subsp. bulgaricus;
possibly by removing oxygen, lowering pH, and producing formic acid and pyr-
uvate (Radke-Mitchell and Sandine, 1984). Strains can be selected for the degree
to which their growth depends on the presence of other microorganisms (Veda-
muthu, 1994). Yogurt may also contain Lb. acidophilus or other nutritionally
beneficial cultures. The most important characteristics for yogurt cultures are (1)
rapid acidification, (2) production of characteristic balanced flavor, and (3) ability
to produce the desired texture. As with other thermophilic rod-coccus dairy fer-
mentations, initial acidification is from growth of S. thermophilus with lactoba-
cilli growing later in the fermentation. Excessively rapid acidification can re-
sult in overacidification and a harsh flavor. Acidification of yogurt is controlled
by refrigeration, but the culture may continue to acidify slowly at cold tempera-
tures.
b. Flavor The ideal yogurt flavor is a balanced blend of acidity and acetal-
dehyde. This is achieved through culture selection, balance of rod to coccus ratio,
and fermentation control. The main source of acetaldehyde is from conversion
of threonine to acetaldehyde catalyzed by threonine aldolase of Lb. delbrueckii
subsp. bulgaricus (Hickey et al., 1983). Lactobacilli, such as Lb. acidophilus,
which produces alcohol dehydrogenase, convert acetaldehyde to ethanol (Mar-
shall and Cole, 1983). Therefore, yogurt produced with Lb. acidophilus does not
have a typical yogurt flavor. In addition to acetaldehyde, yogurt cultures produce
diacetyl, acetoin, acetone, ethanol, and butanone-2 (Beshkova et al., 1998). Vola-
tile saturated free fatty acids such as acetic, butyric, and capric may also contrib-
ute to the flavor of yogurt. Although yogurt cultures are considered to be weakly
proteolytic, they cause significant proteolysis in yogurt (Tamime and Deeth,
1980) which can lead to the development of bitterness.
c. Texture The texture of yogurt results from a complex interaction be-
tween milk proteins, acid, and exocellular polysaccharide produced by the starter
culture. Important physical properties include firmness, smoothness, viscosity,
and gel stability (susceptibility to syneresis). The starter culture can influence
each of these properties by production of exopolysaccharides.
Yogurt cultures produce exopolysaccharide in a ropy or capsular form (Ar-
iga et al., 1992). Capsular polysaccharides are formed as a discrete structure
surrounding the cell (Fig. 1A) with no apparent interaction with casein (Hassan
et al., 1995a, 1995b). Ropy polysaccharides are produced as filaments that are
not visualized as discrete structures by light microscopy. Hassan et al. (1996a)
classified yogurt cultures into three types: those that do not produce exopolysac-
charide, those that produce capsular polysaccharide, and those that produce both
capsular and ropy polysaccharide. Cultures that produce only ropy polysaccharide
may exist, but an extensive survey has not been reported.
166 Hassan and Frank
Figure 1 Confocal scanning laser micrographs of encapsulated S. thermophilus. (A)
Encapsulated cells in milk visualized using reflected light. (B) pH gradient surrounding
encapsulated cells in milk visualized using a pH-sensitive fluorochrome. Dark areas indi-
cate low pH.
Yogurt cultures produce heteropolysaccharides that consist of different
sugar residues in a repeating pattern. Their production does not depend on the
presence of a specific substrate. In contrast, homopolysaccharides, such as dex-
tran produced by Leuc. mesenteroides, consist of one sugar residue type (in this
instance, glucose), and a specific substrate is required for their production (in
this instance, sucrose). Cerning et al. (1986) found that the heteropolysaccharide
produced by Lb. delbrueckii subsp. bulgaricus comprised primarily galactose,
glucose, and rhamnose in a molar ratio of 4:1:1. On the other hand, S. thermophi-
lus capsules are composed of D-galactose, L-rahmnose, and L-fucose in a ratio
of 5:2:1 (Low et al., 1998). Garcia-Garibay and Marshall (1991) found evidence
that this exopolysaccharide is closely associated with protein and may be better
Starter Cultures and Their Use 167
classified as a glycoprotein. The exopolysaccharide of S. thermophilus is com-
posed mainly of galactose and glucose with a small amount of other sugars (Cern-
ing et al., 1988). Cerning (1990) stated that there is little agreement as to the
precise composition of these polysaccharides.
The influence of ropy polysaccharide on yogurt texture is well documented,
but reported effects must be interpreted with caution, because nonropy cultures
used as controls were not examined for capsule production until recently. There
is general agreement that ropy cultures can benefit yogurt texture by increasing
viscosity and gel stability (Cerning, 1990).
However, overproduction of ropy polysaccharide yields a product with an
undesirable slippery mouth feel and pronounced ropiness. Capsular polysaccha-
ride cannot be overproduced, because capsule size is limited (Hassan et al.,
1995a). Bacterial capsules disrupt the yogurt gel microstructure, producing a
softer texture (Hassan et al., 1995b). Encapsulated cultures with no ropy charac-
teristic produce yogurt that is more viscous, structurally more stable, and less
susceptible to syneresis than do cultures that do not produce capsules (Hassan
et al., 1996a, 1996b). The capsule also slows diffusion of lactic acid away from
the cell, causing the cells to stop acid production sooner (Hassan et al., 1995a).
This helps prevent overacidification of the yogurt. The pH gradient resulting from
encapsulation can be visualized using confocal scanning laser microscopy, as
shown in Figure 1B.
III. STARTER CULTURE PROPAGATION
A. Growth Media
The objective of starter culture propagation is to attain a preparation of active
cells at high density so that fermentation is initiated as rapidly as possible. Provid-
ing adequate nutrients and controlling pH and incubation temperature are neces-
sary to achieve this objective. Even though milk and whey are traditional growth
media for lactic cultures, they provide neither optimal nutrition nor needed pH
control. Consequently, various media formulations and culture growth systems
have been devised to improve on traditional culture propagation.
1. Nutritional Requirements of Lactic Acid Bacteria
Lactic acid bacteria cannot synthesize various vitamins and amino acids. Lacto-
cocci require niacin, pantothenic acid, pyridoxine, and biotin for growth. S. ther-
mophilus requires these vitamins plus nitroflavin, whereas lactobacilli require
pantothenic acid, niacin, and nitroflavin, with some species also requiring cobala-
min (Ma¨yra¨-Ma¨kinen and Bigret, 1993). In regard to amino acids, lactococci
and S. thermophilus cannot synthesize the needed branched chain amino acids
(isoleucine, leucine, valine) or histidine; some strains also require arginine and
methionine (Monnet et al., 1996). Lactobacilli require these amino acids in addi-
168 Hassan and Frank
tion to several others. Leuconostoc spp. require valine and glutamate, and some
species may have additional requirements. The presence of amino acids other
than those required often stimulates growth. Although milk contains many of the
essential amino acids for starter culture microorganisms, these are not present in
sufficient quantity to sustain maximal growth rates (Monnet et al., 1996). Lactic
acid bacteria with greater proteolytic ability have less need for amino acid supple-
mentation of milk-based growth media.
2. Growth Media Formulations
Ingredients commonly used to formulate starter culture media have been de-
scribed by Whitehead et al. (1993) and are presented in Table 5. Lactose is always
used as the major carbohydrate, although low concentrations of maltose, sucrose,
or glucose are sometimes added to stimulate growth (Sandine, 1996). Yeast ex-
tract is a source of nitrogen as well as a supplier of vitamins, minerals, and other
growth stimulants. Casein hydrolysates are added to provide readily available
amino acids. Also, addition of whey protein concentrate to whey or UF (ultra
filtered) whey permeate broth stimulates growth of lactic acid bacteria (Bury et
al., 1998). Heat-stable α-nucleotide, nonprotein nitrogen, or some peptidases
could be responsible for this stimulatory effect (Bury et al., 1998). Corn steep
liquor, although a good source of vitamins, is not often used, because its supply
is limited (Sandine, 1996). Sandine (1996) questioned the need for added antioxi-
dants in media formulations, because acceptable growth can often be achieved
in their absence. Neutralizers, such a ammonium or potassium hydroxide, help
prevent excessive acidity. Phosphates are commonly used in culture media, be-
cause they act both as acid-neutralizing and phage-inhibitory agents.
3. Phage-Inhibitory Media
One of the first improvements in whey- and milk-based culture media was devel-
opment of phage-inhibitory media (see Sec. V).
B. pH Control During Culture Propagation
Although lactobacilli grow best under slightly acidic conditions, other starter cul-
ture microorganisms prefer conditions near neutrality. For example, the optimal
pH for growth of S. thermophilus is 6.5, whereas for Lb. delbrueckii subsp. bul-
garicus, it is 5.8 (Beal et al., 1989). The optimal pH for growth of lactococci
ranges from 6.0 to 6.5 (Ma¨yra¨-Ma¨kinen and Bigret, 1993). As the pH decreases
below the optimal range, growth slows, and as the pH continues to decrease,
cells become susceptible to sublethal acid injury and gradually lose their activity.
The greater the loss of activity, the longer the ripening time required before rennet
addition when making Cheddar cheese. Therefore, maintaining the pH of culture
Starter
Cultures
and
Their
Use
169
Table 5 Ingredients Used in Formulating Bulk Starter Media for Lactic Acid Bacteria
Vitamins Phage-inhibitory
Carbohydrate Nitrogen source and minerals agents Antioxidants Neutralizers
Lactose Milk protein Yeast extract Phosphates Ascorbic acid Carbonates
Maltose Whey protein Corn steep liquor Citrates FeSO
4
Phosphates
Sucrose Hydrolyzed casein Hydroxides
Glucose Oxides
Source: Whitehead et al., 1993.
170 Hassan and Frank
media high enough to avoid acid injury is critical for producing cultures that
consistently have sufficient activity for timely cheese manufacture. Acid injury
in lactococci occurs when the pH declines below 5 (Harvey, 1965). Limited pH
control can be achieved by addition of buffers to culture media. Buffering agents,
such as phosphates and carbonate, allow development of higher cell concentra-
tions, because the pH of the medium stays above 5 for a longer time. However,
the neutralizing ability of the buffering agent is eventually overcome, exposing
cells to excessive acidity. Also, high concentrations of buffers inhibit growth of
some starter strains. Two approaches, internal and external pH control, are cur-
rently used to maintain growth media above pH 5 during culture preparation.
1. External pH Control
External pH control refers to a culture preparation system in which neutralizing
agent is added to the medium during fermentation either manually or mechani-
cally. There may be one or multiple additions of neutralizer. For one-step control,
the pH of the medium is allowed to decrease to approximately 5, after which,
sodium or potassium hydroxide is added to obtain a pH of 6.5–7 (Limsowtin et
al., 1980). The culture is then allowed to incubate an additional 2 h before cooling.
Multiple-step neutralization uses a mechanical system consisting of a pH elec-
trode mounted in the bottom of the culture tank, a pump for adding ammonia to
the tank, and a controller. When the pH declines below 5.8–6.2, the controller
activates the pump to add ammonia until the pH is raised a certain amount (usu-
ally to 6–6.2). When acid production ceases because of lactose limitation, the
culture is cooled (Thunell, 1988). External pH control has an additional advantage
of requiring less phosphate for phage inhibition, because calcium is less soluble
at higher pH. A disadvantage of external pH control is that the higher pH allows
growth of nonstarter microflora even after lactose is depleted (Thunell, 1988).
Therefore, a high degree of sanitation is required to implement this system. Exter-
nal pH control systems produce starter culture with 10 times greater cell concen-
tration than phosphate-buffered media (Thunell, 1988). These cells are also
healthier (i.e., they have no acid injury). The result is that a lower volume of
starter can be used and milk ripening times are reduced. In addition, the culture
produces acid more rapidly after salting (for Cheddar manufacture). More culture
strains produce acceptable activity during cheese manufacture when external pH
control is used for culture propagation as compared with conventional buffered
media (Thunell, 1988).
2. Internal pH Control
Internal pH control describes a culture production system in which an insoluble
neutralizing agent is added to the culture medium. The neutralizing agent is re-
leased in response to acid production. One means of achieving internal pH control
Starter Cultures and Their Use 171
is to use sodium carbonate encapsulated in magnesium stearate (Whitehead et
al., 1993). Magnesium stearate dissolves at pH 5.2–5.3, releasing sodium carbon-
ate. A similar effect is obtained by using buffer salts that are insoluble above a
pH of 5.2 (Mermelstein, 1982). Sandine (1996) considered trimagnesium phos-
phate to be the most effective agent for this purpose. Internal pH control media
have similar advantages to external pH control systems. In addition, a mechanism
for adding neutralizing compound to the medium does not need to be installed.
However, the fermentation tank must be stirred to keep the insoluble neutralizing
agent suspended during fermentation. Agitation may lead to incorporation of suf-
ficient oxygen into the medium to stimulate hydrogen peroxide production, re-
sulting in autoinhibition of the culture (Ma¨yra¨-Ma¨kinen and Bigret, 1993).
C. Incubation Conditions
Incubation temperature can affect activity and strain balance of the starter culture.
Mesophilic cultures are grown at 21°C if growth of leuconostocs is desired; other-
wise, higher temperatures (up to 27°C) are used (McCoy and Leach, 1997). Incu-
bation at 26°C helps maintain strain balance (Collins, 1976). Incubation is usually
for 14–16 h or until a pH of 5 is reached. If pH control is not used, the final pH
should be 4.8. Thermophilic cultures are incubated from 30 to 46°C for 8–10 h.
A final pH value as low as 4.7 is acceptable, but this favors growth of lactobacilli
(McCoy and Leach, 1997). Lower incubation temperatures favor growth of S.
thermophilus and higher temperatures favor lactobacilli. Once the target pH is
reached, the culture is cooled. Most cultures continue to produce acid during
cooling. Mesophilic starters should be cooled to 5 to 7°C and thermophilic cul-
tures to below 12°C (McCoy and Leach, 1997).
IV. COMMERCIAL STARTER CULTURE PREPARATIONS
Manufacturers of cultured dairy foods have several options for meeting their
culture needs. The simplest (and usually most expensive) is to purchase frozen
concentrated cultures that can be used to inoculate directly milk from which prod-
uct will be manufactured. Using these ‘‘direct-to-vat’’ or ‘‘direct-vat-set’’ cul-
tures avoids the possibility that starter culture will become contaminated with
phage during preparation within the plant. Also, appropriate strain balance is
assured. Alternatively, culture can be prepared at the plant. This culture, called
bulk culture, can be prepared from commercially available frozen concentrated
or freeze-dried cultures, or the inoculum can be prepared at the plant. Preparing
inoculum at the plant involves starting with a ‘‘mother’’ culture maintained in
small amounts (approximately 100 mL) of medium. The mother culture is used
to inoculate successively larger amounts of medium (using a 1% inoculum) until
172 Hassan and Frank
sufficient inoculum volume is obtained to prepare the bulk culture. Preparing bulk
culture inoculum at the plant carries an increased risk of phage contamination, so
most plants purchase an inoculum either as a frozen concentrated or freeze-dried
preparation. A new process for continuous production of mixed-strain lactic
starter cultures employs immobilized cells in supplemented whey permeate me-
dium. The advantages of this process are increased acid production and mainte-
nance of strain balance (Lambboley et al. 1997; Sodini et al., 1998).
A. Frozen Concentrated Cultures
Frozen concentrated cultures contain 10
10
–10
11
cfu/g, a sufficient concentration
to allow 70 mL to inoculate 1000 L of medium for bulk culture preparation
(Sandine, 1996). Preparation of frozen concentrated cultures involves (1) growing
cultures under optimal conditions using pH control, (2) harvesting the cells via
centrifugation or ultrafiltration, (3) standardizing the cell suspension to a specific
activity, (4) adding a cryoprotectant, (5) packaging, and (6) rapid freezing using
liquid nitrogen. The pH of the cell concentrate should be 6.6 for lactococci and
5.4–5.8 for lactobacilli (Stadhouders et al., 1971). There are many cryoprotective
agents that can be used, including glycerol, monosodium glutamate, sucrose, and
lactose (Ma¨yra¨-Ma¨kinen and Bigret, 1993). Rapid freezing can also be accom-
plished using a dry ice–alcohol mixture (Sandine, 1996). The frozen concentrate
should be stored at H11002196°C (liquid nitrogen) for best retention of activity, al-
though storage at H1100240°C (dry ice) is also acceptable. Rapid thawing minimizes
cell injury. This is accomplished by immersing the unopened can of cell concen-
trate in cool chlorinated water immediately before use.
B. Freeze-Dried Cultures
When transportation and storage of cultures at H1100240°C is not possible, freeze-
dried cultures are a good alternative to frozen concentrates. Current technology
can provide highly active freeze-dried cultures that, like some frozen concentrated
cultures, can be added directly to milk in the cheese vat. The major disadvantage
of using freeze-dried preparations in this manner is the longer lag phase they
exhibit, adding an additional 30–60 min to the time required to make Cheddar
cheese (Sandine, 1996). Freeze drying reduces the ability of a culture to utilize
exogenous but not endogenous carbohydrates (Riis et al., 1995). Preparation of
freeze-dried cultures is initially similar to that of frozen concentrates. After freez-
ing, the culture concentrate is placed under high vacuum to dehydrate by sublima-
tion. Usually 60–70% of the cells that survived freezing will survive the dehydra-
tion step of the freeze drying (To and Etzel., 1997). The dry cells are then
packaged under aseptic conditions, preferably in the absence of oxygen. Exposure
to oxygen rapidly damages the cells (Yang and Sandine, 1979).
Starter Cultures and Their Use 173
C. Spray-Dried Cultures
Survival of cultures after spray drying is usually much lower than after freeze
drying, because cells are simultaneously exposed to both thermal and dehydration
stresses. The viability of spray-dried cultures depends on many factors including,
growth conditions, age of culture, cell paste loading, processing, rehydration con-
ditions, and cryoprotective used (Champagne et al., 1991).
V. BACTERIOPHAGES
Bacteriophages (phages) are viruses that infect bacteria. Bacteriophagic infection
of starter cultures can result in failure of the fermentation and loss of product.
Whitehead and Cox (1935) first recognized bacteriophagic infection as a cause
of failure of single-strain starter cultures used for Cheddar cheese production.
Excellent conditions for development of bacteriophages were created in the 1950s
when cheese production increased, resulting in more intensive use of facilities
and preparation of larger amounts of lactic cultures (Huggins, 1984). Despite
implementation of control measures, bacteriophagic infection still causes produc-
tion problems in the modern dairy fermentation industry. Adoption of control
strategies based on the use of lactic acid bacteria genetically engineered for bacte-
riophagic resistance should provide substantial improvements in dependability
of starter cultures (Dinsmore and Klaenhammer, 1995).
A. Characteristics of Bacteriophages
1. Morphology/Taxonomy
Bacteriophages that infect lactic acid bacteria usually consist of a head and tail
section. The head can be either isometric or prolate (Fig. 2). An isometric head
consists of 20 equal-size proteins that form an icosohedron. A prolate head has
elongated side units. Phage DNA is enclosed by head proteins. Phages attach to
the host by their tail sections, through which DNA passes into bacteria. Tail
sections are of variable length and may have collars, sheaths, and base plates.
Base plates can be seen at the end of the tail of the phage illustrated in Fig. 3.
Bacteriophages of lactic acid bacteria can be classified by morphology,
serology, and DNA-DNA homology. These classification criteria generally pro-
duce consistent groupings (Lodics and Steenson, 1993). Six morphological types
of lactic phages are commonly encountered. These include small isometric, col-
lared small isometric, short-tailed small isometric, long-tailed small isometric,
large isometric, and prolate (Lodics and Steenson, 1993). Each morphological
type may include several distinct genotypes of which there are 12 (Neve, 1996).
174 Hassan and Frank
Figure 2 Morphology of common bacteriophages of lactic acid bacteria. (A) Isometric
phage with long tails. (B) Prolate phage with short and long tails.
Starter Cultures and Their Use 175
Figure 3 Electron micrograph of isometric phage of Lactococcus lactis. (From Moineau
et al., 1994).
Bacteriophages of S. thermophilus form one homologous grouping as opposed
to bacteriophages of mesophilic lactococci and Lb. delbrueckii, which are geneti-
cally diverse (Jarvis, 1989; Brussow et al., 1994).
2. Phage-Host Interactions
a. Host Range Host range reflects the ability of a specific bacteriophage
to infect different strains of bacteria. Host range varies widely between bacterio-
phages. In addition, susceptibility of specific strains of lactococci to phagic attack
is to some degree based on plasmid-associated resistance factors and is therefore
highly variable. Bacteriophages of Lc. lactis subsp. cremoris tend to have a more
limited host range than bacteriophages of Lc. lactis subsp. lactis (Jarvis, 1989).
Isometric phages of lactococci tend to have limited host ranges, whereas prolate
phages have broader host ranges. Some phages can attack both subspecies of Lc.
lactis (lactis and cremoris). Several phages can attack both Lb. delbrueckii subsp.
bulgaricus and Lb. delbrueckii subsp. lactis (Jarvis, 1989).
b. Lytic Cycle Bacteriophagic infections are caused by either lytic or tem-
perate phages. Infection with lytic (virulent) phages results in release of infectious
viral particles (virions) into the environment, whereas temperate phages incorpo-
rate their DNA into the host chromosome and do not immediately produce new
virions. The sequence of events in the lytic cycle is described by Neve (1996)
176 Hassan and Frank
and is illustrated in Fig. 4. Phagic infection is initiated by adsorption of the virion
onto the surface of the host cell. Only bacteria with specific adsorption sites serve
as hosts for the bacteriophage; the presence of these sites determines to a great
extent the host range of a particular phage. Recognition of an appropriate site
and adsorption to it are mediated by the base plate, spikes, or fibers at the end
of the phage tail. Many phages require Ca
2H11001
for adsorption.
Figure 4 Stages in the lytic cycle where bacteriophage defense mechanisms are active.
Starter Cultures and Their Use 177
After adsorption, the phage injects its DNA into the host. The DNA passes
from the head through the tail into the bacterial cell while the ‘‘empty’’ virion
remains outside. Normal metabolism of the infected cell then ceases as the host
first replicates phage DNA and then phage proteins. This process, called matura-
tion, ends with self-assembly of virions within the host cell. Initially, heads form
around viral DNA followed by attachment of tails. Finally, the lytic cycle is
completed when a lytic enzyme (lysin), encoded on viral DNA, is produced,
resulting in cell lysis and release of infective phagic particles into the surrounding
environment. Lysin released from infected cells can also lyse noninfected cells.
The time from initial adsorption to release of phages is called the latent period.
For lactococcal phages, this period ranges from 10 to 140 mins. The number of
virulent particles released per infected cell is called the burst size. This ranges
from less than 10 to more than 300 for lactococcal phages (Klaenhammer and
Fitzgerald, 1994).
c. Temperate Cycle Infection with a temperate phage does not necessarily
lead to immediate production of new virions. DNA of a temperate phage may
instead be incorporated into the chromosome of the host cell or maintained as a
plasmid within the cell (Cogan and Accolas, 1990). This DNA, referred to as a
prophage, replicates with the bacterium without affecting its metabolism. The
resulting condition, lysogeny, is common in lactococci (Davidson et al., 1990)
and lactobacilli (Sechaud et al., 1988), rare in S. thermophilus (Brussow et al.,
1994), and unreported in Pediococcus, Leuconostoc, and Propionibacterium spp.
(Davidson et al., 1990). Lysogeny can be maintained indefinitely. Lysogenous
bacteria are immune to the infecting and other closely related phages. They main-
tain the potential to produce virulent phages and can spontaneously realize this
potential. Phage production can also be induced by exposing cells to ultraviolet
(UV) light or mitomycin C to inactivate the repressor protein that blocks expres-
sion of growth genes (Lodics and Steenson, 1993).
The extent to which lysogenic bacteria in starter cultures pose a threat to
industrial fermentations is still uncertain (Jarvis, 1989; Davidson et al., 1990).
Temperate phages can mutate to become virulent, resulting in fermentation fail-
ure (Shimizu-Kodata et al., 1983), although spontaneous induction of virulent
phages from lysogenic strains appears to be rare (Teuber and Lembke, 1983).
Surveys of lactococcal phage DNA homology indicate that, although some lytic
phages appear to be variants of temperate phages, this is generally not true
(Davidson et al., 1990).
d. Pseudolysogeny Pseudolysogeny (phage carrier state) occurs when a
bacterial culture carries lytic phages while maintaining an active cell population.
The culture remains active, because only a portion of the total population is sensi-
tive to the phage, with the remaining population retaining the ability to grow
rapidly and produce acid. Establishment of pseudolysogeny depends on the abil-
ity of a culture to produce variants having different degrees and types of phage
178 Hassan and Frank
sensitivity (Lodics and Steenson, 1993). Unlike true lysogeny, phages can be
eliminated from a pseudolysogenous culture by growing it in the presence of
phage-specific antibodies or by repeated culture purification (selection of isolated
colonies on agar plates).
3. Phage Resistance Mechanisms
Phage resistance in lactic acid bacteria is based on at least four different natural
mechanisms (Hill, 1993; Dinsmore and Klaenhammer, 1995; Allison and Klaen-
hammer, 1998): adsorption inhibition, DNA injection inhibition, DNA restriction
and modification systems, and abortive infection. Stages in the lytic cycle where
these mechanisms are active are illustrated in Figure 4. Many lactococci used in
starter cultures exhibit one or more of these resistance mechanisms. Adsorption
inhibition is the failure of phage to attach to the bacterial surface. This can result
from spontaneous mutation modifying the attachment site or from a plasmid-
linked factor (Dinsmore and Klaenhammer, 1995). Plasmids can encode for pro-
duction of polymers that coat attachment sites, preventing phage adsorption.
DNA injection inhibition occurs when phage adsorbs to the cell surface
but phage DNA stays inside the head section and fails to enter the host cell
cytoplasm. This resistance mechanism appears to be rare (Dinsmore and Klaen-
hammer, 1995). A plasmid-encoded injection-blocking system in Lactococcus
was first described by Garvey et al. (1996). They concluded that DNA injection
inhibition resulted from an alteration in plasma membrane components of the
host cell.
Phage resistance based on DNA restriction and modification enzymes (R/
M) is common in lactococci. The restriction enzyme hydrolyzes phage DNA at
a specific site. Host DNA is modified by methylation at this site and is therefore
unaffected by the restriction enzyme. Restriction and modification enzymes are
linked to the same plasmid. It is possible, but rare, for phage DNA to be methyl-
ated by the host modification system before it is hydrolyzed by the restriction
enzyme. When this happens, the phage is able to cause a normal infection. Phages
whose DNA does not contain the targeted restriction site are also unaffected by
this resistance mechanism. Four groups of R/M can be distinguished based on
their enzyme structures and cleavage characteristics (Forde and Fitzgerald, 1999).
Abortive infection is a type of phage resistance resulting in decreased pro-
duction of virulent phages by infected cells but not involving restriction or modi-
fication. Abortive infection results in cell death, but because phage replication
is much reduced, the phage population does not increase sufficiently to affect
culture activity. Abortive infection does not induce genetic changes in the in-
fecting phage. Numerous (at least seven) nonhomologous plasmids encode for
abortive infection resistance, indicating that many different types exist (Dinsmore
and Klaenhammer, 1995; Neve, 1996).
Starter Cultures and Their Use 179
When a host cell with phage resistance is exposed to sufficiently high num-
bers of phages, it is possible for the phage to mutate to overcome the resistance
mechanism. Also, if phage inhibition is not complete, resistant phages are se-
lected (Hill, 1993). If phage DNA is modified by the host enzyme to become
resistant to the restriction enzyme, resulting resistance is lost when the phage
infects a cell that lacks the methylase enzyme. More lasting insensitivity occurs
when phages mutate at the hydrolysis site of the restriction enzyme. Some lacto-
coccal bacteriophages have evolved to have very few sites available for restriction
endonuclease hydrolysis (Dinsmore and Klaenhammer, 1995). Phages also de-
velop insensitivity to abortive injection mechanisms, apparently through point
mutations.
4. Phage Survival
Many bacteriophages have good survival characteristics. Some can survive high-
temperature, short-time pasteurization, so media for starter preparation are usu-
ally heated to at least 85°C for 30 mins to ensure inactivation of the phage (Neve,
1996). Phages can also survive spray drying and storage of milk powder (Chopin,
1980). Phagic particles on surfaces are readily inactivated by chlorine but not by
iodine or acid sanitizers (Anonymous, 1990). Sanitizer inactivation depends on
elimination of organic matter through effective cleaning.
B. Characteristics of Phagic Infection
Bacteriophages are primarily a problem in cheese manufacture. This is probably
because cheese milk (as compared to cultured milks) is given only a mild heat
treatment and because cheese milk and whey are often exposed to a phage-con-
taminated environment. Bacteriophages do not proliferate in cheese curd, because
virions cannot move through the protein matrix. However, cells infected with
phage before coagulation become inactivated during cheese manufacturing. Be-
cause latency periods are normally approximately 30 min (but may be much
longer), a culture may initially show normal growth in cheese milk but then
reduce or stop acid production during manufacture. If one culture preparation is
used to inoculate a series of vats of milk, increasing numbers of phages active
against this culture may develop within the manufacturing plant. The result is
that acid production proceeds normally in the vats of milk inoculated initially
but is delayed later in the production day.
C. Preventing Phagic Inhibition
Preventing inhibition of acid production resulting from phagic infection requires
implementation of control measures throughout the manufacturing process. These
180 Hassan and Frank
should include selection, preparation, and maintenance of cultures free of virulent
phage, controlling entry of phages into the processing facility, and controlling
spread of phages within the facility.
1. Phage-Inhibitory Media
Growth of phages during production of bulk starter can be controlled by using
phage-inhibitory media. These media rely on the ability of phosphate and citrate
salts to bind ionic calcium, thus inhibiting phagic absorption (Reiter, 1956). The
chelating agents can slow growth of the starter culture. Phage-control media often
contain deionized whey, protein hydrolysates, ammonium and sodium phosphate,
citrate salts, and other growth stimulants such as yeast extract (Whitehead, 1993).
Commercial phage-inhibitory media vary widely in their ability to prevent phage
proliferation; the most effective being those that contain sufficient nutrients to
overcome the inhibitory nature of the media and contain citrate buffers (Gulstrum
et al., 1979). Not all bacteriophages are inhibited by the absence of calcium
(Sozzi, 1972; Quiberoni and Reinheimer, 1998), so, to be effective, phage-inhibi-
tory media should be used as only one part of an overall phage-control strategy.
Proliferation of phages during starter preparation can also be avoided by using
cell concentrates designed to be added directly to cheese milk in the vat or by
preparing cultures under strict aseptic conditions.
2. Use of Phage-Resistant Cultures
Lactic acid bacteria vary widely in their susceptibility to bacteriophagic infection,
so the use of resistant strains is an important aspect of phage control. Phage-
resistant strains have been isolated from mixed-culture systems that maintain
activity while carrying low levels of phages (Lodics and Steenson, 1993). Strains
can also be genetically altered to contain plasmids coding for phage resistance
(Klaenhammer, 1991). Phage-resistant variants can be selected by exposure to
factory whey containing phages that have developed during cheese manufacture
(Sandine, 1989). Resistant variants are tested for rapid acid production and added
back to the starter in use in that factory. The use of such a system requires daily
monitoring of whey for phages, but it allows the use of a single mixture of five
or six defined strains over a long time. This approach to phage control is often
used in North America and elsewhere.
Protease-negative strains of lactococci are resistant to phagic infection be-
cause of their slow growth rates (Richardson, 1984). Although more cells must
be used to compensate for lack of growth during cheese manufacture, these vari-
ants offer other advantages, including lowered sensitivity to antibiotics, lowered
heat sensitivity (allowing the use of higher cook temperatures), greater yield be-
cause of lowered casein solublization, and decreased risk of bitter flavor develop-
ment in cheese.
Starter Cultures and Their Use 181
Exopolysaccharide-producing strains are more resistant to phage (Moineau
et al., 1996). Phages that infect and lyse strains producing exopolysaccharide
possess a polysaccharide depolymerase enzyme specific for this particular exo-
polysaccharide (Hughes et al. 1998).
3. Culture Rotation
Culture rotations control bacteriophagic infection by limiting the length of time
that a specific strain or mixture of strains is used. Cultures following each other
in the series are susceptible to different phage types and are therefore unaffected
by phages that may have infected the previous culture. Cultures can be rotated
on a daily basis or after each vat of milk is inoculated. Short rotations over 2–
3 days using 6–12 strains and long (5–10 days) rotations of up to 30 strains are
used (Huggins, 1984). However, the use of a limited number of cultures at any
one time is recommended to reduce exposure to prophages and maintain product
uniformity. Culture rotation does not eliminate phage growth in cheese milk in
vats, but if phage numbers are kept to less than 10,000 pfu/mL of cheese whey,
acid production is not affected (Huggins, 1984). Success of a culture rotation is
limited by availability of phage-unrelated strains with acceptable fermentation
properties. In addition, using many different cultures can result in lack of product
uniformity.
A new type of culture rotation system has been developed by Sing and
Klaenhammer (1993) and Durmaz and Klaenhammer (1995). This system uses
genetic derivatives of a single strain, each with a different phage-resistance mech-
anism. When used in rotation or as mixtures, resistant phages fail to develop,
because they cannot overcome the multiple resistance mechanisms. This type of
rotation avoids the lack of product uniformity associated with conventional cul-
ture rotations and allows continuous use of strains with special properties.
O’ Sullivan et al. (1998) stacked three plasmids encoding distinct phage
resistance mechanisms (adsorption inhibition, R/M, and Abi) in addition to the
lactose proteinase plasmid to generate a host with phage resistance and acceptable
fermentation characteristics. This isogenic single-strain starter rotation system in
which complementary defenses are rotated within one starter limits exposure of
phages to any single defense mechanism.
4. Genetically Modified Resistance Strains
Since phage-resistance plasmids are transferrable by conjugation, application of
genetic engineering technology can introduce industrially significant phage-
resistance starter strains (Coakley et al., 1997; Allison and Klaenhammer, 1998;
O’Sullivan et al., 1998). However, the evolutionary capacity of phages which
allows their genetic modules to be exchanged in addition to the presence of lyso-
182 Hassan and Frank
genic starter cultures show the need for continuous development of novel phage-
insensitive mechanisms and strains (Forde and Fitzgerald, 1999).
5. Sources of Bacteriophages in the Dairy Plant
Bacteriophages in the dairy plant probably are of farm origin, although, as dis-
cussed previously, lysogenic bacteria may also be a source. Although the major
means by which a phage enters the plant is in raw milk; trucks and personnel
having had contact with the farm environment could also be carriers. After moni-
toring a mozzarella cheese factory for 2 years, Bruttin et al. (1997) postulated a
single phage invasion event and diversification of the phage during its residence
in the factory. They then introduced a defined starter system that could not propa-
gate the resident factory phage population. It is not practical to eliminate entry
of phages into the dairy plant, because raw milk continually enters the facility.
However, growth of phages within the plant and dissemination of phages to milk
in the cheese vat can be controlled. Bovine colostrum may have antibodies that
could protect Lc. lactis strains from phage attack (Geller et al., 1998). The main
growth niches for bacteriophages in a cheese plant are raw milk, whey, spilled
product, pools of water, stagnant floor drains, equipment, and soiled walls (Anon-
ymous, 1990). Phage development in these growth niches is controlled by effec-
tive sanitation. Phages are disseminated throughout the dairy plant by aerosol
and human carriers. Air entering cheese manufacturing rooms should be under
positive pressure of high-efficiency particulate air (HEPA) filtered air. When pre-
paring bulk starter, air drawn into the tank when the culture medium cools should
be filter sterilized. Milk in cheese vats is most susceptible to phage contamination
during ripening and setting, so these processes should be accomplished in closed
systems. Whey should be removed to a physically separate facility, because whey
processing produces aerosols that can carry phage particles. Plant personnel with
exposure to whey should not be allowed access to the milk-ripening or bulk
starter facilities.
VI. OTHER CULTURE INHIBITORS
A. Raw Milk–Associated Inhibitors
Lactic starter cultures grow more slowly in raw than in heated milk; a phenome-
non caused by the presence of natural inhibitors. The lactoperoxidase system is
the most significant microbial inhibitor in raw milk, but the presence of aggluti-
nins is an important problem in acid-coagulated cheeses. Other naturally oc-
curring microbial inhibitors in milk include lysozyme and lactoferrin. Mastitic
milk has increased levels of microbial inhibitors and increased phagocytic activity
that are part of the cow’s response to infection. However, mastitic milk is also
Starter Cultures and Their Use 183
higher in protease activity, and the resulting casein fragments can counteract
inhibitor effects and even stimulate growth of weakly proteolytic lactics such as
S. thermophilus (Marshall and Bramley, 1984; Okello-Uma and Marshall, 1986).
1. Lactoperoxidase System
Microbial inhibition by the lactoperoxidase system derives from interaction of
three components: lactoperoxidase, an enzyme native to milk; thiocyanate, de-
rived from hydrolysis of cyanogenic glucosides found in certain feeds; and hydro-
gen peroxide, generated by leukocytes and through oxygen metabolism of lactic
acid bacteria (Limsowtin, 1992). The inhibitor, hypothiocyanite, is produced
when lactoperoxidase catalyzes oxidation of thiocyanate and simultaneous reduc-
tion of hydrogen peroxide. Bovine colostrum and milk contain about 11–45 mg/
L and 13–30 mg/L lactoperoxidase, respectively (Korhonen, 1977). Hydrogen
peroxide is usually the limiting component in raw milk, but thiocyanate is also
often present in suboptimal concentrations (Limsowtin, 1992). Lactoperoxidase
is only partially inactivated by pasteurization (Wolfson and Sumner, 1993). How-
ever, more severe pasteurization temperatures (80°C for 15 s) will completely
inhibit the lactoperoxidase system. This might explain why sometimes milk pas-
teurized at 72°C exhibits better keeping quality than that pasteurized at higher
temperatures (Barrett et al., 1999). The lactic starter cultures most sensitive to
lactoperoxidase inhibition are those that generate hydrogen peroxide. This in-
cludes some strains of Lb. delbrueckii subsp. bulgaricus and Lb. acidophilus
(Guirguis and Hickey, 1987b). Other lactic acid bacteria, including S. thermophi-
lus and some strains of lactococci, are sensitive to lactoperoxidase inhibition
when combined with cultures that produce hydrogen peroxide. The inhibitory
effects of the lactoperoxidase system can be controlled by limiting aeration of
milk, avoiding the use of hydrogen peroxide–generating cultures, using cultures
that degrade hydrogen peroxide, and using heat treatments more severe than pas-
teurization. Lactoperoxidase activity suppresses acid production in yogurt during
refrigerated storage and produces product having a softer texture (Nakada, et al.,
1996; Hirano et al., 1998).
2. Immunoglobulins (Agglutinins)
Bovine milk contains four types of immunoglobulins: IgG1, IgG2, IgM, and IgA
at concentrations of 0.3–0.4, 0.03–0.08, 0.03–0.06, and 0.04–0.06 g/L, respec-
tively (Pakkanen and Aalto, 1997). Lactic starter cultures can interact with immu-
noglobulins in milk to form aggregates or clumps. As the cells produce acid,
casein coagulates around these clumps and they settle out of the milk forming a
sludge (Grandison et al., 1986). Acid production is inhibited, because diffusion
of acid out of the sludge is limited, causing acid inhibition of the culture before
the milk is properly acidified (Hicks and Ibrahim, 1992). This type of inhibition
184 Hassan and Frank
is of significance when acid coagulation is desired, as for cottage cheese, which
exhibits a loss of curd. Culture agglutination can be reduced by selecting aggluti-
nation-resistant cultures, using whey-based culture media with agglutinins re-
moved by protease treatment (Ustunol and Hicks, 1994), homogenization of milk
before culturing (Hicks and Hamzah, 1992), and homogenization of the starter
culture (Hicks et al., 1998). Susceptibility of starter cultures to bind milk immu-
noglobulins can be determined by using an enzyme-linked immunosorbent assay
(ELISA) (Ustunol and Sypien, 1996).
3. Lysozyme
Lysozyme inactivates bacteria by cleaving the glycosidic bond between N-ace-
tylmuramic acid and N-acetylglucoseamine in the peptidoglycan of the cell wall.
Gram-positive bacteria are highly susceptible to lysozyme activity because of the
high peptidoglycan content of their cell wall and a lack of protective lipopolysac-
charide. Bovine milk contains only approximately 0.07–0.6 mg/L (Korhonen,
1977).
4. Lactoferrin
Lactoferrin is an iron-binding protein that inhibits bacteria by denying their ac-
cess to iron. Cow’s milk contains only 20–200 μg/mL of lactoferrin (Masson
and Heremans, 1971), and its activity is limited because it competes with citrate
for binding iron (Batish et al., 1988). Inhibition of starter cultures by lactoferrin
is unlikely to be significant.
B. Antibiotics
Treatment of mastitis in cows involves application of antibiotics. Milk from
treated cows cannot be legally sold, but, occasionally, it becomes mixed with
salable product. The resulting low-level antibiotic contamination may be suffi-
cient to inhibit starter culture microorganisms. As antibiotic levels in milk in-
crease, acid production decreases. Lactic acid bacteria are very sensitive to antibi-
otics commonly used for mastitis treatment. These include penicillin, cloxacillin,
streptomycin, and tetracycline. Milk that tests negative for antibiotics, using Ba-
cillus stearothermophilus as an indicator, can still have sufficient antibiotic to
cause starter culture inhibition (Valladao and Sandine, 1994a). When antibiotics
other than penicillin are present, available methods may not be sufficiently sensi-
tive to detect residues that could cause a 20% reduction in lactic acid production
(Schiffmann et al., 1992).
Sensitivity of starter cultures to antibiotics is highly strain and species de-
pendent. S. thermophilus is more susceptible to penicillin and cloxacillin (β-lac-
Starter Cultures and Their Use 185
tam antibiotics) than are the lactococci, but lactococci are more sensitive to strep-
tomycin and tetracycline (Desmazeaud, 1996). Swiss (Emmenthal) cheese made
with antibiotic-contaminated milk (0.005 IU/mL) exhibited abnormal eye forma-
tion, presumably from inhibition of propionibacteria (Ma¨yra¨-Ma¨kinen and
Migret, 1993).
C. Chemical Sanitizers
Occasionally, chemical sanitizers may contaminate milk, usually as a result of
human error. Chlorine- and iodine-based sanitizers lose their activity in milk and
are, therefore, unlikely to cause starter culture inhibition. Quaternary ammonium
compounds present more potential problems, because they maintain activity in
milk, and lactic acid bacteria are sensitive to low concentrations. Valladao and
Sandine (1994b) observed that all tested Lactococcus strains were inhibited by
20 μg/mL and some were inhibited by only 10μg/mL quaternary ammonium
compound. Thermophilic starter cultures are inhibited at 0.5–2.0 μg/mL quater-
nary ammonium compound (Guirguis and Hickey, 1987a).
Peracetic acid and acid anionic sanitizers can also maintain some activity
in milk (Dunsmore, 1985). Relatively high concentrations of hydrogen peroxide
or quaternary ammonium compound are required to give positive results in antibi-
otic screening tests (Richard and Kerhave′, 1975). The amount of chemical sani-
tizer that might enter milk through lack of rinsing should not be sufficient to
cause culture inhibition (Desmazeaud, 1996). However, problems can be encoun-
tered when sanitizer solution is not drained from tanks or trucks.
VII. INHIBITORY COMPOUNDS PRODUCED BY STARTER
CULTURES
One of the valuable properties of starter cultures is their ability to inhibit growth
of undesirable microorganisms. The main preservative action of lactic starter cul-
tures is a result of acid production. Acids produced by lactic acid bacteria include
not only lactic acid but also lesser amounts of acetic and formic acids. Production
of acids other than lactic acid increases the preservative effect of the culture
because, at equivalent pH, acetic and formic acids have greater inhibitory power
than lactic acid.
Lactic starter cultures also produce nonacidic microbial inhibitors. These
include hydrogen peroxide (which can act by itself or in concert with the lactoper-
oxidase system as previously discussed), carbon dioxide, low molecular weight
carbonyl compounds, and bacteriocins. Production of nonacidic inhibitors by lac-
tic starter cultures is not necessarily advantageous. Undesirable effects include
186 Hassan and Frank
autoinhibition resulting from hydrogen peroxide (produced when oxygen is pres-
ent in the milk) and an inability to be used in multiple-strain cultures as a result
of bacteriocin production.
A. Low Molecular Weight Nonacidic Metabolites
Kulshrestha and Marth (1974a, 1974b) observed that many nonacidic low molec-
ular weight metabolites of lactic acid bacteria have antimicrobial activity but at
concentrations higher than produced in cultured milk. The metabolite with great-
est inhibitory activity is the flavor compound, diacetyl (2,3-butanedione). Jay
(1982) found that yeasts and gram-negative bacteria are inhibited by 200 ppm
diacetyl and that gram-positive bacteria are inhibited by 300 ppm. Although such
levels are not found in cultured dairy products, diacetyl may act in combination
with other compounds to enhance the preservative effect of starter cultures.
B. linens, when growing in a cheese-containing medium, produces an anti-
microbial agent with a broad spectrum of activity, being active against yeasts and
molds, Clostridium botulinum, Staphylococcus aureus, Salmonella spp., Bacillus
cereus, and many yeasts and molds (Grecz, 1964). Volatile sulfur compounds
are at least partially responsible for this activity (Beattie and Torrey, 1984).
B. Bacteriocins
Bacteriocins are proteins or polypeptides with potent bactericidal activity. They
typically have a narrow spectrum of activity against species closely related to
the producing organism. Their production and immunity to their action is plasmid
encoded (with some exceptions). Variation in the presence of immunity genes
may be responsible for the large variation in bacteriocin sensitivity of lactic acid
bacteria (Eijsink et al., 1998). Some bacteriocins are especially interesting, be-
cause their broad spectrum of activity may make them useful for inhibiting spe-
cific pathogenic or spoilage microorganisms. Activity of some bacteriocins
against Listeria spp. is presented in Table 6. Ent. faecium suitable for use as a
starter culture may produce enterocin B, which is active against nisin-resistant
mutans of L. monocytogenes (Schillinger et al., 1998). Production of bacteriocins
by lactic acid bacteria is common, as shown by data in Table 7. However, strains
of lactic acid bacteria selected for use in multiple-strain cultures generally do not
produce bacteriocins so they do not dominate the mixture. Bacteriocins produced
by lactic starter cultures can be divided into three biochemical groups (Barefoot
and Nettles, 1993): lanthionine-containing peptides such as nisin and lacticin 481;
small non–lanthionine-containing proteins or peptides such as lacticin F, lacta-
cin B, and lactococcin A; and large heat-labile proteins such as helveticin and
caseicin 80.
Starter Cultures and Their Use 187
Table 6 Activity of Some Bacteriocins Against Listeria
Species
Producer organism Bacteriocin Inhibition
Lactobacillus
acidophilus Lacticin F H11002
acidophilus Lacticin M H11002
acidophilus Lacticin B H11002
helveticus Helveticin J H11002
plantarum Plantaricin A H11002
Leuconostoc
mesenteroides Mesentericin Y105 H11001
Lactococcus lactis
subsp. lactis Nisin H11001
subsp. cremoris Diplococcin H11002
Streptococcus
thermophilus Thermophilin 347 H11001
Thermophilin A H11002
Propionibacterium
thoenii Propionicin PLG-1 H11001
Pediococcus
acidilactici Pediocin PA-1 H11001
pentosaceus Pediocin A H11001
Source: Harris, 1989; Lyon et al., 1993; Stiles, 1994; Villani et al., 1995;
and Ward, 1995.
Table 7 Frequency of Bacteriocin Production in Lactic Acid
Bacteria
No. positive/
Organism No. tested % Positive
Lactobacillus spp. 11/189 6
Lactobacillus
fermenti 11/121 15
acidophilus 33/152 63
Lactococcus spp. 65/280 23
Streptococcus
thermophilus 13/41 32
mutans 97/130 75
Source: Klaenhammer, 1988; Tagg, et al, 1976; Ward, 1995.
188 Hassan and Frank
1. Lactococci
Lc. lactis subsp. lactis produces the bacteriocin nisin. Nisin was isolated by Mat-
tick and Hirsch (1947) and is the only bacteriocin widely approved for use as a
food additive. (Other bacteriocins can be present in foods as a natural part of the
culturing process.) Nisin is a polypeptide containing 34 amino acids and usually
occurs as a dimer with a molecular weight of 7000 D (Jarvis et al., 1968). It is
the best known of the group of bacteriocins called lantibiotics, which contain
the unusual amino acids, lanthionine, β-methyl lanthionine, and dehydroalanine
(Vanenbergh, 1993). Nisin has a relatively broad spectrum of activity for a bacte-
riocin, with activity against many lactic acid bacteria, spore-forming bacteria,
and L. monocytogenes (Davidson and Hoover, 1993). Its ability to prevent out-
growth of bacterial endospores has led to its use in preventing the late gas defect
in hard cheeses and as an inhibitor of C. botulinum and spoilage microorganisms
in canned foods and processed cheese (Daeschel, 1989). Nisin is heat stable and
has greatest activity under mildly acidic conditions. Like other bacteriocins, the
site of action of nisin is the cytoplasmic membrane (Sahl, 1991).
Lacticin 481, produced by Lc. lactis subsp. lactis, has activity against lacto-
cocci and some lactobacilli, leuconostocs, and clostridia. If produced by starter
cultures used for cheese manufacture, lacticin 481 eliminates the sensitive mi-
croflora from the resulting cheese (Paird et al., 1991). Lc. lactis subsp. lactis
DPC3147 produces lacticin 3147, a broad–host range, two-component bacterio-
cin. It inhibits a wide range of gram-positive bacteria, including Listeria, Clos-
tridium, Staphylococcus, and Streptococcus species but is not active against
gram-negative species (Ryan et al., 1996). Lc. lactis subsp. cremoris produces
diplococcin, which, unlike nisin, has a narrow spectrum of activity (primarily
against other lactococci) and lacks stability. Producers of diplococcin rapidly
predominate in multiple-strain starter cultures. Also, Lc. lactis subsp. lactis var.
diacetylactis produces lactococcin, a bacteriocin which has a bacteriolytic effect
on other lactococci. This lytic action might be useful to accelerate cheese ripening
(Morgan et al., 1995).
2. Lactobacilli
Lactobacilli used in starter cultures can produce many different bacteriocins, most
with a limited range of activity. Lb. helveticus produces helveticin J and lacticin
LP27. Helveticin J is an unusual bacteriocin, because it is coded for on chromo-
somal DNA and is active at neutral pH (Joerger and Klaenhammer, 1986). Lb.
acidophilus produces numerous bacteriocins, including lacticins B and F and aci-
docin J1229 (Muriana and Klaenhammer, 1991; Tahara and Kanatani, 1996); Lb.
casei produces caseicin 80 (Rammelsberg and Radler, 1990); and Lb. delbrueckii
subsp. lactis produces lacticins A and B (Toba et al., 1990). Bacteriocins pro-
duced by Lb. delbrueckii subsp. bulgaricus were recently isolated and character-
Starter Cultures and Their Use 189
ized (Balasubramanyam et al., 1998; Miteva et al., 1998). In addition, Lb. plan-
tarum, which grows well in cheese, produces pediocin AcH, a bacteriocin active
against L. monocytogenes (Ennahar et al., 1996). Properties of these compounds
have been described by Davidson and Hoover (1993).
3. Leuconostocs
Although Stiles (1994) concluded that bacteriocins of leuconostocs are active
against L. monocytogenes but not necessarily against other lactic acid bacteria,
three bacteriocins produced by Leu. mesenteroides TA 33 inhibited various
strains of lactic acid bacteria as well (Papathanasopoulos et al., 1997). In addition,
Leu. mesenteroides subsp. dextranicum J24 synthesizes a bacteriocin named dex-
tranicin 24, which inhibited only other Leuconostoc strains (Revol-Junelles and
Lefebvre, 1996). Leu. mesenteroides subsp. mesenteroides produces mesentero-
cin 52A and mesenterocin 52B (Krier et al., 1998).
4. Propionibacteria
Propionicin PLG-1, a bacteriocin produced by Pr. thoenii, is unusual because of
its broad range of activity, which includes some gram-negative bacteria, including
Escherichia coli, Pseudomonas fluorescens, and Vibrio parahaemolyticus (Lyon
and Glatz, 1991). It is also active against other propionibacteria, lactic acid bacte-
ria, and some yeasts and molds. It is inactivated at temperatures above 80°C,
unlike jenseniin G, which is produced by Pr. jensenii and is stable at 100°C.
Jenseniin has a narrow range of activity but is active against microorganisms
commonly found in Swiss cheese (Grinstead and Barefoot, 1992). Jenseniin G,
which also inhibits yogurt starter, could be useful in preventing overacidification
of yogurt (Weinbrenner et al., 1997).
5. Streptococci
Ward (1995) found that 13 of 41 strains of S. thermophilus produced bacteriocin-
like substances that were active mainly against other S. thermophilus strains. He
purified the bacteriocin, thermophilin A, which is heat stable and acid tolerant.
Villani et al. (1995) isolated thermophilin 347 and determined it to be heat stable
and inhibitory toward L. monocytogenes. Thermophilin T is also produced by S.
thermophilus ACA-DC 0040 and is active against some food spoilage bacteria
such as C. sporogenes and C. tyrobutyricum (Aktypis et al., 1998). A bacteriocin
produced by S. thermophilus 81 was not effective against Lb. delbrueckii subsp.
bulgaricus but inhibited various pathogens (Ivanova et al. 1998).
6. Applications and Commercial Preparations
The dairy industry can take advantage of the preservative properties of bacterio-
cins either by using bacteriocin-producing cultures in the manufacturing process
190 Hassan and Frank
or by adding the bacteriocin-containing preparations directly to a product. Nisin
can be purchased for use as a food additive under the brand name Nisaplin (Aplin
and Barret, Ltd., Wilts, England). It is mainly used in dairy foods for its ability
to inhibit bacterial spore germination.
Skim milk fermented with a bacteriocin-producing strain of P. freudenrei-
chii subsp. shermanii, and when pasteurized, it can be purchased under the brand
name Microgard (Wesman Food, Inc., Beaverton, OR). The presence of propionic
acid, diacetyl, and acetic acid in Microgard enhances the preservative effect of
the bacteriocin (Al-Zoreky, 1988). Microgard is used extensively in the United
States as a preservative in cottage cheese (Daeschel, 1989). Other fermented milk
and whey products containing bacteriocins are also commercially available. In
addition, a novel method for accelerating cheese ripening utilizes bacteriocin-
producing adjunct cultures. The use of a bacteriocin-producing strain of Lc. lactis
subsp. lactis resulted in cheese with increased cell lysis, elevated concentration
of free amino acids, and higher sensory evaluation scores (Morgan et al., 1997).
VIII. MEASUREMENT OF STARTER ACTIVITY
The term activity refers to the ability of starter cultures to produce desirable
changes in fermented dairy products. Activity is a consequence of many factors,
some of which are difficult to quantify, such as physiological state of cultures,
growth conditions, harvesting, and packaging and storage conditions (Spinnler
and Corrieu, 1989). Usually activity measurements are confined to the ability of
starter cultures to acidify milk.
Most activity tests are based on rapid quantification of acid production for
the purpose of strain selection, comparison of different combinations of defined
starters, determining the best harvesting time, or determining culture stability
during storage. Ideally, before activity measurement, cultures should be subcul-
tured twice, cultured overnight in the appropriate broth medium at optimum
growth temperature, and centrifuged at 20000 H11003 gat4°C for 5 min. The pellet
is then washed at 4°C with 50 mM potassium phosphate buffer, pH 6.7, resus-
pended in the same buffer at 5 mM to minimize buffer capacity, and adjusted to
A
650
for use as an inoculum (Demirci and Hemme, 1995). The classic way to
determine starter activity is by measuring the pH of the culture at different time
intervals. Maximum acidification rate (V
m
) (Spinnler and Corrieu, 1989), the ca-
pacity of a culture to respond to a new environment (Barreto et al. 1991), and
the biomass measurement (Olivares et al., 1993) may all be useful determinations.
Activity can be measured by means other than pH, including conductance and
impedance (Lanzanova et al., 1993; Tsai and Luedecke, 1989). These measure-
ments estimate the activity of stored cultures within less than an hour. Activities
other than acid production such as proteolysis (Dermirci and Hemme, 1995),
Starter Cultures and Their Use 191
lipolysis (Kenneally et al., 1998), and β-galactosidase production (Ord’Zez and
Jeon, 1995) can also be determined by other means.
IX. STARTER CULTURES INTERACTIONS
Mixed starter cultures may be composed of various genera, species, and strains
of lactic acid bacteria which together make up a dynamic, complex culture. Their
strain components will differ in growth rate, acid production, aroma production,
proteolytic activity, bacteriocin production and sensitivity, and phagic resistance.
Milk composition can affect strain dominance; for example, the very low concen-
tration of Mn
2H11001
in winter milk leads to poor growth and low numbers of Leuco-
nostoc in a mixed starter (DeMan and Galesloot, 1962).
Different types of interactions can occur in strain mixtures and affect cul-
ture performance (Hugenholtz, 1986) (Table 8). This could lead to slow acidifica-
tion and modification of texture and organoleptic properties of fermented milk
products. Sometimes more than one interaction can occur among particular
strains. For example, the interaction between propionibacteria and Lb. plantarum
in Swiss cheese changes from commensalism to mutalism when lactic acid is
accumulated and Lactobacillus starts to benefit from its removal by propionibac-
teria.
The nature of the interaction among mixed cultures is strain dependent.
Day-to-day transfer of mixed cultures should be employed with caution unless
they have previously demonstrated maintenance of the original proportions
through several transfers.
X. ADJUNCT CULTURES
Adjunct or secondary cultures are those added to cheese for purposes other than
acid production. Such cultures are used to intensify and modify cheese flavor and
to accelerate flavor development. Because adjunct cultures grow during cheese
ripening rather than during curd manufacture, they are unlikely to support phage
production. Examples of adjunct cultures are Pr. freudenreichii subsp. shermanii
in Swiss cheese, B. linens in surface smear-ripened cheese, and P. camemberti
in surface mold-ripened cheeses. In Cheddar cheese making, adjunct cultures
include lactose-negative Lc. lactis subsp. and attenuated (heat-shocked, freeze-
shocked, or solvent-treated) cultures (Fox et al. 1998). Some adjunct cultures
such as thermophilic Lactobacillus spp. that do not grow to a significant extent
in Cheddar cheese can serve as a source of ripening enzymes. In addition, replac-
ing part of a bitter-producing starter with thermophilic Lactobacillus cultures
avoids bitterness development (Fox et al., 1998). However, using a high level
192 Hassan and Frank
Table 8 Possible Interactions Among Dairy Starter Culture Strains
Type of interaction Definition Examples
Competition Populations of two species are 1. In Cheddar cheese (high
mutually limiting because cooking temperature), Lc.
of their joint dependence lactis subsp. lactis will
on a common factor or fac- dominate
tors external to them
2. Competition for nitrogen
nutrients will cause Lc.
lactis to dominate in cul-
ture containing Leu. mes-
enteroides
Amensalism Inhibition of other species by Lc. lactis subsp. lactis produc-
removal of essential nutri- ing nisin inhibits sensitive
ents or formation of toxic strains in mixed cultures
metabolites
Commensalism The species which benefits The prtH11002 variants might profit
from another does not pro- from the prtH11001 variants with-
vide a benefit in return out providing any benefit in
return
Parasitism One organism feeds or repro- Phage-resistant strains having
duces at the expense of an- low growth rate will have
other that is necessarily higher populations in the
damaged by the rela- presence of bacteriophage
tionship
Mutalism Both species benefit from co- S. thermophilus and Lb. del-
growth brueckii ssp. bulgaricus in
yogurt cultures exchange
growth factors
of thermophilic Lactobacillus cultures in Cheddar cheese may alter the flavor.
Recently, adjunct cultures of bacteriocin-producing strains were used to facilitate
starter culture lysis and accelerate cheese ripening (Martinez-Cuesta et al., 1998;
Morgan et al., 1995).
XI. USE OF GENETICALLY MODIFIED STARTER
CULTURES
Conventional strain development relies on selection of natural strains and mu-
tants. However, new technology in genetic manipulation, isolation, and gene
Starter Cultures and Their Use 193
Table 9 Examples of Genetic Modifications of Dairy Starter Cultures
Species Modification References
Lb. casei Transfer peptidase and transport Klein et al., 1995
genes from Lb. delbrueckii
subsp. lactis
Lc. lactis subsp. Creation of a strain deficient in Kuipers et al., 1993
nisin A production
Lc. lactis subsp. Overexpression of proteases or De Vos and Simons, 1994
peptidases
Lc. lactis Transcriptional regulation and evo- Vaughan et al. 1998
lution of lactose genes in the
galactose-lactose operon
Lc. lactis subsp. Lac
H11001
Muc
H11001
variants of plasmid- Wrighi and Tykkynen, 1987
lactis free strains
Lc. lactis Design of a phage-insensitive O’ Sullivan et al., 1998
strain
Lc. lactis β-galactosidase gene from Lb. Mayo et al., 1994
plantarum was cloned and ex-
pressed in Lc. lactis
Lc. lactis Increasing diacetyl production Benson et al., 1994
Pediococcus Improve lactose and galactose up- Caldwell et al., 1996
take and increasing phospho-
beta galactosidase activity by
transferring a lactose plasmid
from Lc. lactis
Lc. lactis subsp. Prt
H11002
strains were converted to Kok et al., 1985
lactis Prt
H11001
by transformation of pro-
teinase gene complex from Lc.
lactis subsp. cremoris
Lc. lactis subsp. Lac
H11001
phenotype was produced by Kempler and McKay, 1979
lactis var. di- transferring of lactose plasmids
acetylactis from Lc. lactis subsp. lactis
Lc. lactis Transfer of a phage-resistance Coakley et al., 1997
plasmid
Lc. lactis Expression of lysin from native Shearman et al. 1992
phage led to rapid lysis to accel-
erate cheese ripening
Lc. lactis subsp. Phage resistance Sanders et al., 1986
lactis and Lc.
lactis subsp.
cremoris
Lc. lactis subsp. Improvement of proteolytic activ- Leenhouts et al., 1991
lactis ity by integration of a plasmid-
encoded proteinase gene from
Lc. lactis subsp. cremoris
194 Hassan and Frank
transfer holds much promise for improved dairy strains. Genetic engineering tech-
niques allow directed changes in existing traits, exchange of traits (protease, bac-
teriocins, carbohydrate metabolism) among closely related strains or species, and
introduction of foreign genes from unrelated strains (Sanders, 1991). Methods
for introducing genes into a new strain include conjugation, transformation, and
transduction.
Although consumption of lactic acid bacteria modified by deletion of ge-
netic information or other self-cloning procedures might not influence potential
hazards of consuming fermented milk products, safety concerns should still be
taken into account. These include possible interactions with the foodborne patho-
genic microorganisms as well as possible influences on process technology and
on nutritional value and allergenic potential of products (Klein et al., 1995).
Among all lactic starter species, mesophilic lactococci are the most studied
host system. Table 9 provides references on the significant genetic modifications
applied to dairy starter species.
Bacteriophage infection is the single most important cause of slow acid
production in dairy fermentations. Consequently, there has been a worldwide
research effort focusing on transferring of different phage resistance traits to im-
prove dairy starter culture performance in the presence of industrial phage. How-
ever, genetically engineered defense strategies (nonnatural) in lactic acid bacteria
suffer the weakness of being highly specific. At present, conjugal transfer of
naturally occurring plasmids is the only accepted approach for genetic improve-
ment of starter cultures, although food-grade cloning systems may be considered
in the future (Coakley et al., 1997). In lactococci, there is a genetic linkage be-
tween phage resistance and bacteriocin production. Phage resistance transconju-
gants were identified by their ability to ferment lactose and their resistance to
the produced bacteriocin (Coakley et al., 1997). Phage resistance is associated
with the sucrose-nisin transposon in lactococci (Gireesh et al., 1992).
Although genetic information presently available allows construction of
tailor-made genetically modified lactic acid bacteria, the use of genetically engi-
neered starter cultures will depend on cost of strain development, regulations,
and consumer acceptance. Although, recombinant DNA technology provides a
potential improvement over the classic methodology of selection, mutation and
strain screening will continue in the immediate future. See Chapter 8 for further
discussion of genetics of lactic acid bacteria.
REFERENCES
Aktypis A, Kalantzopoulos G, Huis in’t Veld J, Brink B. Purification and characterization
of thermophilin T, a novel bacteriocin produced by Streptococcus thermophilus
ACA-DC 0040. J Appl Microbiol 84:568, 1998.
Starter Cultures and Their Use 195
Allison G, Klaenhammer T. Phage resistance mechanisms in lactic acid bacteria. Int Dairy
J 8:207, 1998.
Al-Zoreky N. Microbiological control of food spoilage and pathogenic microorganisms
in refrigerated foods. MS thesis, Oregon State University, Corvallis, OR, 1988.
Anonymous. Bacteriophage. Milwaukee: Chr. Hansen’s Laboratory, Inc, 1990.
Ariga H, Urashima T, Michihata E, Manabu I, Morizono N, Kimura T, Takahashi S.
Extracellular polysaccharide from encapsulated Streptococcus salivarius subsp.
thermophilus OR 901 isolated from commercial yogurt. J Food Sci 57:625,
1992.
Axelsson LT. Lactic acid bacteria: classification and physiology. In: Salminen S, von
Wright A, eds. Lactic Acid Bacteria. New York: Marcel Dekker, 1993, p 1.
Balasubramanyam B, Varadaraj, M. Cultural conditions for the production of bacteriocin
by a native isolate of Lactobacillus delbrueckii ssp. bulgaricus CFR 2028 in milk
medium. J Appl Microbiol 84:97, 1998.
Barefoot SF, Nettles CG. Antibiosis revisited: bacteriocins produced by dairy starter cul-
tures. J Dairy Sci 76:2366, 1993.
Barreto M, Melo E, Almeida, J, Xavier A, Carrondo M. A kinetic method for calculating
the viability of lactic starter cultures. Appl Microbiol Biotechnol 34:648, 1991.
Barrett N, Grandison A, Lewis M. Contribution of the lactoperoxidase system to the keep-
ing quality of pasteurized milk. J Dairy Res 66:73, 1999.
Batish VK, Chandler H, Zumdigni KC, Bhatia KL, Singh RS. Antibacterial activity of
lactoferrin against some common food-borne pathogenic organisms. Aust J Dairy
Technol 43:16, 1988.
Beal C, Llouvet P, Corrieu G. Influence of pH, lactose and lactic acid on growth and
acidification of pure cultures of Streptococcus thermophilus 404 and Lactobacillus
bulgaricus 398. Appl Microbiol Biotechnol 32:148, 1989.
Beattie SE, Torrey GS. Volatile compounds produced by Brevibacterium linens inhibit
mold spore germination (abstr). J Dairy Sci 67(Suppl 1):84, 1984.
Beneke ES, Stevenson KE. Classification of food and beverage fungi. In: Beuchat LR,
ed. Food and Beverage Mycology. 2nd ed. New York: Van Nostrand Reinhold,
1987, p 1.
Benkerroum N, Misbah M, Sandine W, Elaraki A. Development and use of a selective
medium for isolation of Leuconostoc sp. from vegetables and dairy products. Appl
Environ Microbiol 59:607, 1993.
Benson K, Godon J, Renault P, Griffin H, Gasson M. Effect of ilvBN-encoded alpha-
acetolactate synthase expression on the diacetyl production in Lactobacillus lactis.
Appl Microbiol Biotechnol 45:107, 1994.
Beshkova D, Simova E, Frengova G, Simov Z. Production of flavor compounds by yogurt
starter cultures. J Ind Microbiol Biotechnol 20:180, 1998.
Boysen M, Skouboe P, Frisvad J, Rossen L. Reclassification of the Penicillium roqueforti
group into three species on the basis of the molecular genetic and biochemical
profiles. Microbiology 142:541, 1996.
Brock TD. Milestones in Microbiology. Englewood Cliffs, NJ:Prentice-Hall, 1961.
Brussow H, Fremont M, Bruttin A, Sidoti J, Constable A, Fryder V. Detection and classi-
fication of Streptococcus thermophilus bacteriophages isolated from industrial milk
fermentation. Appl Environ Microbiol 60:4537, 1994.
196 Hassan and Frank
Bruttin A, Desiere F, D’ Amico N, Guerin J, Sidoti J, Huni B, Lucchini S, Brussow H.
Molecular ecology of Streptococcus thermophilus bacteriophage infections in a
cheese factory. Appl. Environ Microbiol 63:3144, 1997.
BuchenhU
¨
skes H. Selection criteria for lactic acid bacteria to be used as starter cultures
for various food commodities. FEMS Microbiol Rev 12:253, 1993.
Bury D, Jelen P, Kimura K. Whey protein concentrate as a nutrient supplement for lactic
acid bacteria. Int Dairy J 8:149, 1998.
Caldwell S, Hutkins R, McMahon D, Oberg C, Broadbent J. Lactose and galactose uptake
by genetically engineered Pediococcus species. Appl Microbiol Biotechnol 49:315,
1998.
Cerning J. Exocellular polysaccharides produced by lactic acid bacteria. FEMS Microbiol
Rev 87:113, 1990.
Cerning J, Bouillanne C, Desmazeaud MJ, Landon M. Isolation and characterization of
exocellular polysaccharide produced by Lactobacillus bulgaricus. Biotechnol Lett
8:625, 1986.
Cerning J, Bouillanne C, Landon M, Desmazeaud MJ. Exocellular polysaccharide produc-
tion by Streptococcus thermophilus. Biotechnol Lett 10:255, 1988.
Champagne CP, Gardner N, Brochu E, Beaulieu Y. The freeze-drying of lactic acid bacte-
ria. A review. Can Inst Sci Technol J 24:118, 1991.
Charteris W, Kelly P, Morelli L, Collins J. Selective detection, enumeration and identifi-
cation of potentially probiotic Lactobacillus and Bifidobacterium species in mixed
bacterial populations. Int J Food Microbiol 35:1, 1997.
Charteris W, Kelly P, Morelli L, Collins J. Ingredient selection criteria for probiotic micro-
organisms in functional dairy foods. Int J Dairy Technol 51:123, 1998.
Chassy B, Murphy C. Lactococcus and Lactobacillus. In: Sonenshein AL, Hoch JA,
Losick R. eds. Bacillus subtilis and Other Gram-Positive Bacteria. Washington,
DC: American Society for Microbiology, 1993, p 65.
Chen CM, Bogenrief DB, Jaeggi JJ, Tricomi WA, Johnson ME. Evaluation of mixer
molder temperature and speed on composition, functional and sensory characteris-
tics of 50% reduced-fat mozzarella cheese. J Dairy Sci 77(Suppl 1):15, 1994.
Chopin MC. Resistance of 17 mesophilic lactic Streptococcus bacteriophages to pasteur-
ization and spray-drying. J Dairy Res 47:131, 1980.
Coakley M, Fitzgerald G, Ross R. Application and evaluation of the phage resistance-
and bacteriocin-encoding plasmid pMRC01 for the improvement of dairy starter
cultures. Appl Environ Microbiol 63:1434, 1997.
Cogan TM. History and taxonomy of starter cultures. In: Cogan TM, Accolas JP, eds.
Dairy Starter Cultures. New York: VCH, 1996, p 1.
Cogan TM, Accolas JP. Starter cultures: types, metabolism and bacteriophage. In:
Robinson RK, ed. Dairy Microbiology: The Microbiology of Milk. London: Else-
vier, 1990, p 77.
Collins EB. Influence of medium and temperature on end products and growth. J Dairy
Sci 60:799, 1976.
Commins CS, Johnson JL. Propionibacterium. In: Butler JP, ed. Bergey’s Manual of Sys-
tematic Bacteriology. Vol II. Baltimore: Williams & Wilkins, 1984, p 1346.
Conn HW. Dairy Bacteriology. Bulletin No. 25. Washington, DC: U.S. Department of
Agriculture Office of Experiment Stations, 1895.
Starter Cultures and Their Use 197
Daeschel MA. Antimicrobial substances from lactic acid bacteria for use as food preserva-
tives. Food Technol 43:164, 1989.
Dave RI, Shah NP. Evaluation of media for selective enumeration of Streptococcus ther-
mophilus, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus acidophilus
and bifidobacteria. J Dairy Sci 79:1529, 1996.
Davidson MP, Hoover DG. Antimicrobial components from lactic acid bacteria. In: Salmi-
nen S, von Wright A, eds. Lactic Acid Bacteria. New York: Marcel Dekker, 1993,
p 127.
Davidson BE, Powell IB, Hillier AJ. Temperate bacteriophages and lysogeny in lactic
acid bacteria. FEMS Microbiol Rev 87:79, 1990.
DeMan J, Galesloot T. De invloed van een toevoeging van mangaan aan de melk op de
groei van zuurselbacterien. Neth Milk Dairy J 16:1, 1962.
DeMan J, Rogosa M, Elizabeth M. A medium for the cultivation of lactobacilli. J Appl
Bacteriol 23:130, 1960.
Demirci Y, Hemme D. Acidification test based on the use of biomass for screening of
Leuconostoc. Application to Leuconostoc mesenteroides strains isolated from
French raw milk cheeses. J Dairy Res 62:521, 1995.
Desmazeaud M. Growth inhibitors of lactic acid bacteria. In: Cogan TM, Accolas JP, eds.
Dairy Starter Cultures. New York: VCH, 1996, p 131.
De Vos W, Simmons G. Gene cloning and expression systems in lactococci. In: Gasson
M, De Vos W, eds. Genetics and Biotechnology of Lactic Acid Bacteria. Glasgow:
Chapman & Hall, 1994, p 52.
Dinsmore PK, Klaenhammer TR. Bacteriophage resistance in Lactococcus. Mol Biotech-
nol 4:297, 1995.
Dunsmore D. Effect of residues of five disinfectants in milk on acid production by strains
of lactic starters used for cheddar cheesemaking and on organoleptic properties of
the cheese. J Dairy Res 52:287, 1985.
Durmaz E, Klaenhammer TR. A starter culture rotation strategy incorporating paired
restriction/modification and abortive infection bacteriophage defenses in a single
Lactococcus lactis strain. Appl Environ Microbiol 61:1266, 1995.
Eijsink VGH, Skeie M, Middelhoven PH, Brurberg MB, Nes, IF. Comparative studies of
class IIa bacteriocins of lactic acid bacteria. Appl Environ Microbiol 64:3275,
1998.
Elliker P, Anderson A, Hannesson G. 1956. An agar culture medium for lactic acid strepto-
cocci and lactobacilli. J Dairy Sci 39:1611, 1956.
Ennahar S, Aoude-werner D, Sorokine O, Dorsselaer A, Bringel F, Hubert J, Hasselmann
C. Production of pediocin AcH by Lactobacillus plantarum WHE92 isolated from
cheese. Appl Environ Microbiol 62:4381, 1996.
Forde A, Fitzgerald G. 1999. Bacteriophage defense systems in lactic acid bacteria. Anto-
nie van Leeuwenhoek 76:89, 1999.
Fox PF, McSweeney PL, Lynch CM. Significance of non-starter lactic acid bacteria in
cheddar cheese. Aust J Dairy Technol 53:83, 1998.
Fringa E, Holtz C, Kunz B. Studies about casein degradation by Brevibacterium linens.
Milchwissenschaft 48:130, 1993.
Frisvad JC, Filtenborg O. Terverticillate penicillia: chemotaxonomy and mycotoxin pro-
duction. Mycologia 81:837, 1989.
198 Hassan and Frank
Fryer TF, Peberdy MF. Growth of propionibacteria in Swiss and Egmont cheese. NZ J
Dairy Sci Technol 12:133, 1977.
Garcia-Garibay M, Marshall, VME. Polymer production by Lactobacillus delbrueckii ssp.
bulgarious. J Appl Bacteriol 70:325, 1991.
Garvey P, Hill C, Fitzgerald G. The lactococcal plasmid pNP40 encodes a third bacterio-
phage resistance mechanism, one which affects phage DNA penetration. Appl Envi-
ron Microbiol 62:676, 1996.
Geller B, Kraus J, Schell M, Hornsby M, Neal J, Ruch F. High titer, phage-neutralizing
antibodies in bovine colostrum that prevent lytic infection of Lactococcus lactis in
fermentations of phage-contaminated milk. J Dairy Sci 81:895, 1998.
Ghoddusi H, Robinson R. Enumeration of starter cultures in fermented milk. J Dairy Sci
63:151, 1996.
Gireesh T, Davidson B, Hillier A. Conjugal transfer in Lactococcus lactis of a 68-kilobase-
pair chromosomal fragment containing the structural gene for the peptide bacterio-
cin nisin. Appl Environ Microbiol 58:1670, 1992.
Glatz BA. The classical propionibacteria: their past, present and future as industrial organ-
isms. ASM News 58:197, 1992.
Grandison AS, Brooker BE, Young P, Ford GD, Underwood HM. Sludge formation during
the manufacture of cottage cheese. J Soc Dairy Technol 39:119, 1986.
Grecz N. Natural antibiosis in some varieties of soft surface ripened cheese. In: Melin N,
ed. Microbial Inhibitors in Food. Stockholm: Almqvist and Wiksell, 1964, p
307.
Grinstead DA, Barefoot SF. Jensenin G. A heat-stable bacteriocin produced by Propioni-
bacterium jensenii P126. Appl Environ Microbiol 58:215, 1992.
Guirguis N, Hickey MW. Factors affecting the performance of thermophilic starters. 1.
Sensitivity to dairy starters. Aust J Dairy Technol 41:11, 1987a.
Guirguis N, Hickey MW. Factors affecting the performance of thermophilic starters. 2.
Sensitivity to the lactoperoxidase system. Aust J Dairy Technol 41:14, 1987b.
Gulstrum TJ, Pearce LE, Sandine WE, Elliker PR. Evaluation of commercial phage inhibi-
tory media. J Dairy Sci 62:208, 1979.
Harris LJ, Daeschel MA, Stiles ME, Klaenhammer TR. Antimicrobial activity of lactic
acid bacteria against Listeria monocytogenes. J Food Prot 52:384, 1989.
Harrits J, McCoy D. Swiss cheese. In: Cultures for the Manufacture of Dairy Products.
Milwaukee: Chr. Hansen, Inc, 1997, p 79.
Harvey RJ. Damage to Streptococcus lactis resulting from growth at low pH. J Bacteriol
11:1330, 1965.
Hassan AN, Frank JF. Modification of microstructure and texture of rennet curd by using
a capsule-forming non-ropy lactic culture. J Dairy Res 64:115, 1997.
Hassan AN, Frank JF, Farmer MA, Schmidt KA, Shalabi SI. Observation of encapsulated
lactic acid bacteria using confocal scanning laser microscopy. J Dairy Sci 78:2624,
1995a.
Hassan AN, Frank JF, Farmer MA, Schmidt KA, Shalabi SI. Formation of yogurt micro-
structure and three-dimensional visualization as determined by confocal scanning
laser microscopy. J Dairy Sci 78:2629, 1995b.
Hassan AN, Frank JF, Schmidt KA, Shalabi SI. Rheological properties of yogurt made
using encapsulated nonropy lactic cultures. J Dairy Sci 78:2091, 1996a.
Starter Cultures and Their Use 199
Hassan AN, Frank JF, Schmidt KA, Shalabi SI. Textural properties of yogurt made using
encapsulated nonropy lactic cultures. J Dairy Sci 78:2098, 1996b.
Haysahi K, Cliffe AJ, Law BA. Culture conditions of Brevibacterium linens for production
of proteolytic enzymes. Nippon Shokuhin Kogyo Gakkaishi 37:737, 1990.
Hettinga DG, Reinbold GW, Vedamuthu ER. Split defect of Swiss cheese. I. Effect of
strain of Propionibacterium and wrapping material. J Milk Food Technol 37:322,
1974.
Hickey MW, Hillier AJ, Jago GR. Enzymatic activities associated with lactobacilli in dairy
products. Aust J Dairy Technol 38:154, 1983.
Hicks CL, Hamzah B. Effect of culture agglutination on cottage cheese yield. Cult Dairy
Prod J 27:4, 1992.
Hicks CL, Ibrahim SA. Lactic bulk starter homogenization affects culture agglutination.
J Food Sci 57:1086, 1992.
Hicks C, Morales M, Russell-Campbell E. Use of agglutination-sensitive bulk starters in
the manufacture of stirred curd cheese. J Dairy Sci 81:621, 1998.
Hill C. Bacteriophage and bacteriophage resistance in lactic acid bacteria. FEMS Micro-
biol Rev 12:87, 1993.
Hirano R, Hirano M, Oooka M, Dosako S, Nakajima I, Igoshi K. Lactoperoxidase effects
on rheological properties of yogurt. J Food Sci 63:35, 1998.
Holtz C, Kunz B. Studies on degradation of whey proteins by Brevibacterium linens.
Milchwissenschaft 49:130, 1994.
Hugenholtz J. Population dynamics of mixed starter cultures. Neth Milk Dairy J 40:129,
1986.
Huggins AR. Progress in dairy starter technology. Food Technol 38:41, 1984.
Hughes KA, Sutherland IW, Jones MV. Biofilm susceptibility to bacteriophage attack:the
role of phage-borne polysaccharide depolymerase. Microbiology 144:3039, 1998.
Hull R, Roberts A. Differential enumeration of Lactobacillus acidophilus in yogurt. Aust
J Dairy Technol 3:160, 1984.
Hutkins R, Halambeck SM, Morris HA. Use of galactose-fermenting Streptococcus ther-
mophilus in the manufacture of Swiss, mozzarella, and short-method cheddar
cheese. J Dairy Sci 69:1, 1986.
Ivanova I, Miteva V, Stefanova Ts, Pantev A, Budakov I, Danova S, Moncheva P, Niko-
lova I, Dousset X, Boyaval P. Characterization of a bacteriocin produced by Strepto-
coccus thermophilus 81. Int J Food Microbiol. 42:147, 1998.
Jarvis AW. Bacteriophages of lactic acid bacteria. J Dairy Sci 72:3406, 1989.
Jarvis B, Jeffcoat J, Cheeseman GC. Molecular weight distribution of nisin. Biochim Bio-
phys Acta 168:153, 1968.
Jay JM. Antimicrobial properties of diacetyl. Appl Environ Microbiol 44:525, 1982.
Joerger MC, Klaenhammer TR. Characterization and purification of helveticin J and evi-
dence for a chromosomally determined bacteriocin produced by Lactobacillus
helveticus 481. J Bacteriol 167:439, 1986.
Jollivet N, Bezenger MC Vayssier Y, Belin JM. Production of volatile compounds in
liquid cultures by six strains of coryneform bacteria. Appl Microbiol Biotechnol
36:790, 1992.
Jollivet N, Belin JM, Vayssier Y. Comparison of volatile flavor compounds produced by
ten strains of Penicillium camemberti Thom. J Dairy Sci 76:1837, 1993.
200 Hassan and Frank
Kempler G, McKay L. Genetic evidence for plasmid-linked lactose metabolism in Strepto-
coccus lactis subsp. diacetylactis. Appl Environ Microbiol 37:1041, 1979.
Kenneally P, Leuschner R, Arendt E. Evaluation of the lipolytic activity of starter cultures
for meat fermentation purposes. J Appl Microbiol 84:839, 1998.
Kinsella JE, Hwang D. Biosynthesis of flavors by Penicillium roqueforti. Biotechnol
Bioeng 18:927, 1976.
Klaenhammer TR. Bacteriocins of lactic acid bacteria. Biochemie 70:337, 1988.
Klaenhammer TR. Development of bacteriophage-resistant strains of lactic acid bacteria.
Food Biotechnol 19:675, 1991.
Klein J, Wegmann C, Meyer-Barton E, Plapp R, Henrich B. 1995. Molecular tools for
the genetic modification of dairy lactobacilli. System Appl Microbiol 18:493, 1995.
Klien G, Pack A, Bonaparte C, Reuter G. Taxonomy and physiology of probiotic lactic
acid bacteria. Int J Food Microbiol 41:103, 1998.
Knudson S. Starters. J Dairy Res 2:137, 1931.
Kok J, van Dijl J, van der Vossen J, Venema G. Cloning and expression of a Streptococcus
cremoris proteinase in Bacillus subtilus and Streptococcus lactis. Appl Environ
Microbiol 50:94, 1985.
Korhonen H. Antimicrobial factors in bovine colostrum. J Sci Agr Soc Finland 49:434,
1977.
Krier F, Revol-Junelles AM, Germain P. Production of two bacteriocins by Leuconostoc
mesenteroides subsp. mesenteroides FR52 during batch fermentation. Appl Micro-
biol Biotechnol 50:359, 1998.
Kuipers O, Beerthuyzen M, Siezen R, De Vos W. Characterization of the nisin gene cluster
nisABTCIPR of Lactococcus lactis. Requirement of expression of the nisA and
nisI genes for development of immunity. Eur J Biochem 216:281, 1993.
Kulshrestha DC, Marth EH. Inhibition of bacteria by some volatile and non-volatile com-
pounds associated with milk. II. Salmonella typhimurium. J Milk Food Technol 37:
539, 1974a.
Kulshrestha DC, Marth EH. Inhibition of bacteria by some volatile and non-volatile com-
pounds associated with milk. IV. Streptococcus lactis. J Milk Food Technol 37:
593, 1974b.
Lambboley L, Lacroix C, Champagne CP, Vuillemard JC. Continuous mixed strain meso-
philic lactic starter production in supplemented whey permeate medium using im-
mobilized cell technology. Biotechnol Bioeng 56:502, 1997.
Lanzanova M, Mucchetti G, Neviani E. Analysis of conductance changes as a growth
index of lactic acid bacteria in milk. J Dairy Sci 76:20, 1993.
Law J, Haandrikman A. Proteolytic enzymes of lactic acid bacteria. Int. Dairy J 7:1, 1997.
Leenhouts K, Gietema J, Kok J, Venema G. Chromosomal stabilization of the proteinase
genes in Lactococcus lactis. Appl Environ Microbiol 57:2568, 1991.
Lim K, Huh C, Baek Y, Kim H. A selective enumeration medium for bifidobacteria in
fermented dairy products. J Dairy Sci 78:2108, 1995.
Limsowtin G. Inhibition of starter cultures. Aust J Dairy Technol 47:100, 1992.
Limsowtin G, Heap HA, Lawrence RC. A new approach to the preparation of bulk starter
in commercial cheese plants. NZ J Dairy Sci Technol 15:219, 1980.
Lindsay RC, Day EA, Sandine WE. Green flavor defect in starter cultures. J Dairy Sci
46:863, 1965.
Starter Cultures and Their Use 201
Lodics TA, Steenson LR. Phage-host interactions in commercial mixed-strain dairy starter
cultures: practical significance-a review. J Dairy Sci 76:2380, 1993.
Low D, Ahlgren J, Horne D, McMahon D, Oberg C, Broadbent J. Influence of Streptococ-
cus thermophilus MR-1C capsular exopolysaccharide on cheese moisture level.
Appl Environ Microbiol 64:2147, 1998.
Lyon WJ, Glatz BA. Partial purification and characterization of a bacteriocin produced
by Propionibacterium thoenii. Appl Environ Microbiol 57:701, 1991.
Lyon WJ, Glatz BA. Propionibacteria. In: Hui YH, Khachatourians GG, eds. Food Bio-
technology Microorganisms. New York: VCH, 1995, p 703.
Lyon WJ, Sethi JK, Glatz BA. Inhibition of psychrotrophic organisms by propionicin
PLG-1, a bacteriocin produced by Propionibacterium thoenii. J Dairy Sci 76:1506,
1993.
Marshall VM, Bramley J. Stimulation of Streptococcus thermophilus growth in mastitic
milk. J Dairy Res 51:17, 1984.
Marshall VM, Cole WM. Threonine aldolase and alcohol dehydrogenase activities in Lac-
tobacillus bulgaricus and Lactobacillus acidophilus and their contribution to fla-
vour production in fermented foods. J Dairy Res 50:375, 1983.
Marshall VM, Tamime AY. 1997. Starter cultures employed in the manufacture of biofer-
mented milks. Int J Dairy Technol 50:35, 1997.
Martinez-Cuesta MC, Fernandez de Palencia P, Requena T, Pelaez C. Enhancement of
proteolysis by a Lactococcus lactis bacteriocin producer in a cheese model system.
J Agr Food Chem 46:3863, 1998.
Masson S, Heremans JF. Lactoferrin in milk from different species. Comp Biochem Phys-
iol 39B:119, 1971.
Matalan M, Sandine W. Improved media for differentiation of rods and cocci in yogurt.
J Dairy Sci. 69:2569, 1986.
Mattick ATR, Hirsch A. Further observation on an inhibitor (nisin) from lactic strepto-
cocci. Lancet 2:5, 1947.
Matzdorf B, Cuppett S, Keeler L, Hutkins R. Browning of mozzarella cheese during high
temperature pizza baking. J Dairy Sci 77:2850, 1994.
Mayo B, Gonzalez B, Arca P, Suarez J. Cloning and expression of the plasmid encoded
beta D galactosidase gene from a Lactobacillus plantarum strain of dairy origin.
FEMS Microbiol Lett 122:145, 1994.
Ma¨yra¨-Ma¨kinen A, Bigret M. Industrial use and production of lactic acid bacteria. In:
Salminen S, von Wright A, eds. Lactic Acid Bacteria. New York: Marcel Dekker,
1993, p 65.
McCoy DR. Italian type cheeses. In: Cultures for the Manufacture of Dairy Products.
Milwaukee: Chr. Hansen, Inc, 1997, p 70.
McCoy DR, Leach RD. Culture propagation and handling. In: Cultures for the Manufac-
ture of Dairy Products. Milwaukee: Chr. Hansen, Inc, 1997, p 32.
McDonald L, Mc Feeters R, Daeschel M, Fleming H. 1987. A differential medium for
the enumeration of homofermentative and heterofermentative lactic acid bacteria.
Appl Environ Microbiol 53:1382, 1987.
Mermelstein NH. Advanced bulk starter medium improves fermentation process. Food
Technol. 34(8):69, 1982.
202 Hassan and Frank
Mills OE, Thomas TD. Bitterness development in cheddar cheese: effect of the level of
starter proteinase. NZ J Dairy Sci Technol 15:131, 1980.
Miteva V, Stefanova T, Budakov I, Vanova I, Mitev V, Gancheva A, Liubenov M. Charac-
terization of bacteriocins produced by strains from traditional Bulgarian dairy prod-
ucts. System Appl Microbiol 21:151, 1998.
Moineau S, Pandian S, Klaenhammer TR. Evolution of lytic bacteriophage via DNA ac-
quisition from the Lactococcus lactis chromosome. Appl Environ Microbiol 60:
1832, 1994.
Moineau S, Borkaev M, Holler B, Walker S, Kondo J, Vedamuthu E, Vandenbergh P.
1996. Isolation and characterization of lactococcal bacteriophages from cultured
buttermilk plants in the United States. J Dairy Sci 79:2104, 1996.
Moines M, Groux M, Horman I. La flaveur des fromages. 3. Mise en e′idence de quelques
constituents mineurs de l’aro?me du Camembert. Lait 547:414, 1975.
Monnet V, Condon S, Cogan TM, Gripon JC. Metabolism of starter cultures. In: Cogan
TM, Accolas JP, eds. Dairy Starter Cultures. New York: VCH, 1996, p 47.
Morgan ME. The chemistry of some microbially induced flavor defects in milk and dairy
foods. Biotechnol Bioeng 18:953, 1976.
Morgan S, Ross R, Hill C. Bacteriolytic activity caused by the presence of a novel lacto-
coccal plasmid encoding lactococcin A, B and M. Appl Environ Microbiol 61:2995,
1995.
Morgan S, Ross R, Hill C. Increasing starter cell lysis in cheddar cheese using a bacterio-
cin-producing adjunct. J Dairy Sci 80:1, 1997.
Mossel D, Kleynen-Semmeling A, Vincentie H, Beerens H, Catsaras M. Oxytetracycline-
glucose-yeast extract agar for selective enumeration of moulds and yeasts in foods
and clinical material. J Appl Bacteriol 33:454, 1970.
Muriana PM, Klaenhammer TR. Purification and characterization of lactacin F, a bacterio-
cin produced by Lactobacillus acidophilus 11088. Appl Environ Microbiol 57:114,
1991.
Nakada M, Dosako S, Hirano R, Oaaka M, Nakajima I. Lactoperoxidase suppresses acid
production in yogurt during storage under refrigeration. Int Dairy J 6:33, 1996.
Neve H. Bacteriophage. In: Cogan TM, Accolas JP, eds. Dairy Starter Cultures. New
York: VCH, 1996, p 157.
Oberg CJ, Merrill RK, Moyes LV, Brown R, Richardson GH. Effects of Lactobacillus
helveticus culture on physical properties of mozzarella cheese. J Dairy Sci 74:4101,
1991a.
Oberg CJ, Wang A, Moyes LV, Brown R, Richardson GH. Effects of proteolytic activity
of thermolactic cultures on physical properties of mozzarella cheese. J Dairy Sci
74:389, 1991b.
Okello-Uma I, Marshall V. Influence of mastitis on growth of starter organisms used for
the manufacture of fermented milks. J Dairy Res 53:631, 1986.
Olivares J, Rua B, Susaeta I, Aldamiz-Echevarria P. Growth kinetics of several lactic acid
bacteria useful as starter for ewe’s cheese production. Biotechnol Lett 15:1071,
1993.
Olson NF. The impact of lactic acid bacteria on cheese flavor. FEMS Microbiol Rev 87:
131, 1990.
Ord’Zez G, Jeon I. Evaluation of β-galactosidase activities associated with probiotic lactic
Starter Cultures and Their Use 203
acid bacteria by high performance liquid chromatography. Cult Dairy Prod J 30:
29, 1995.
O’Sullivan D, Coffey A, Fitzgerald GF, Hill C, Ross RP 1998. Design of a phage-insensi-
tive lactococcal dairy starter via sequential transfer of naturally occurring conjuga-
tive plasmids. Appl Environ Microbiol 64:4618, 1998.
Pacher B, Kniefel W. Development of a culture medium for the detection and enumeration
of bifidobacteria in fermented milk products. Int Dairy J 6:43, 1996.
Paird JC, Delorme F, Giraffa G, Commissaire J, Desmazeaud M. Evidence for a bacterio-
cin produced by Lactococcus lactis CNRZ 481. Neth Milk Dairy J 44:143, 1991.
Pakkanen R, Aalto J. Growth factors and antimicrobial factors of bovine colostrum. Int
Dairy J 7:285, 1997.
Papathanasopoulos MA, Krier F, Revol-Junelles AM, Lefebvre G, Le Caer JP, Von Holy
A, Hastings JW. Multiple bacteriocin production by Leuconostoc mesenteroides TA
33a and other Leuconostoc/weisella strain. Current Microbiol 35:331, 1997.
Perry D, McMahon D, Oberg C. Effect of exopolysaccharide producing cultures on mois-
ture retention in low fat mozzarella cheese. J Dairy Sci 80:799, 1997.
Perry D, McMahon D, Oberg C. Manufacture of low fat mozzarella cheese using exopoly-
saccharide producing cultures. J Dairy Sci 81:563, 1998.
Peterson LW. Buttermilk, sour cream, and related products. In: Cultures for the Manufac-
ture of Dairy Products. Milwaukee: Chr. Hansen, Inc, 1997, p 101.
Quiberoni A, Reinheimer JA. Physicochemical characterization of phage adsorption to
Lactobacillus helveticus ATCC 15807 cells. J Appl Microbiol 85:762, 1998.
Radke-Mitchell L, Sandine W. Associative growth and differential enumeration of Strepto-
coccus thermophilus and Lactobacillus bulgaricus: a review. J Food Prot 47:245,
1984.
Rajagopal SN, Sandine WE. Associative growth and proteolysis of Streptococcus ther-
mophilus and Lactobacillus bulgaricus in skim milk. J Dairy Sci 73:894, 1990.
Rammelsberg M, Radler F. Antibacterial polypeptides of Lactobacillus species. J Appl
Bacteriol 69:177, 1990.
Reddy M, Vedamuthu E, Washam C, Reinbold G. Agar medium for differential enumera-
tion of lactic streptococci. Appl Environ Microbiol 24:947, 1972.
Reinbold G, Swern M, Hussong R. 1953. A plating medium for the isolation and enumera-
tion of enterococci. J Dairy Sci 36:1, 1953.
Reiter B. Inhibition of lactic Streptococcus bacteriophage. Dairy Ind 21:877, 1956.
Revol-Junelles AM, Lefebvre G. 1996. Purification and N-terminal amino acid sequence
of dextranicin 24, a bacteriocin of Leuconostoc sp. Curr Microbiol 33:136, 1996.
Richard J, Kerherve′ L. Influence of disinfectant residues on two methods of antibiotic
detection in milk. Rev Laite`re Franc?aise 306:127, 1975.
Richardson GH. Proteinase negative cultures for cheese making. Cult Dairy Prod J 19:6,
1984.
Riis S, Pedersen H, Sorensen N, Jakobsen M. Flow cytometry and acidification power
test as rapid techniques for determination of the activity of starter cultures of Lacto-
bacillus delbrueckii subsp. bulgaricus. Food Microbiol 12:245, 1995.
Ryan M, Rea M, Hill C, Ross R, An application in cheddar cheese manufacture for a
strain of Lactococcus lactis producing a novel broad-spectrum bacteriocin, lacticin
3147. Appl Environ Microbiol 62:612, 1996.
204 Hassan and Frank
Sahl HG. Pore formation in bacterial membranes by cationic lantibiotics. In: Jung G, Sahl
HG, eds. Nisin and Novel Lantibiotics. Bad Honnef, Germany: Escom, Leiden,
1991, p 347.
Sanders M. Genetic approaches for the improvement of strains for Italian cheese manufac-
ture. A review. J Dairy Sci 74:3647, 1991.
Sanders M, Leonhard P, Sing W, Klaenhammer T. Conjugal strategy for construction
of fast acid-producing, bacteriophage-resistant lactic streptococci for use in dairy
fermentations. Appl Environ Microbiol 52:1001, 1986.
Sandine WE. Use of bacteriophage-resistant mutants of lactococcal starters in cheesemak-
ing. Neth Milk Dairy J 43:211, 1989.
Sandine WE. Commercial production of dairy starter cultures. In: Cogan TM, Accolas
JP, eds. Dairy Starter Cultures. New York: VCH, 1996, p 191.
Savat-Brunaud D, Thierry A, Manubois J. Development of a medium simulating Emmen-
tal juice for propionibacteria growth. J Dairy Res 64:573, 1997.
Schiffmann AP, Schutz M, Wiesner HU. False negative and positive results in testing for
inhibitory substances in milk. 1. The influence of antibiotics residues in bulk milk
on lactic acid production of starter cultures. Milchwissenschaft 47:712, 1992.
Schillinger U, Chung HS, Keppler K, Holzapfel WH. Use of bacteriocinogenic lactic acid
bacteria to inhibit spontaneous nisin-resistant mutants of Listeria monocytogenes
Scott A. J Appl Microbiol 85:657, 1998.
Schleifer KH, Kraus J, Dvorak C, Kilpper-Balz R, Collins MD, Fischer W. Transfer of
Streptococcus lactis and related streptococci to the genus Lactococcus gen. nov.
System Appl Microbiol 6:183, 1985.
Sechaud L, Cluzel PJ, Rousseau M, Baumgertner A, Accolas JP. Bacteriophages of lacto-
bacilli. Biochimie 70:401, 1988.
Shearman C, Jury K, Gasson M. Autolysis of Lactococcus lactis expressing a lactococcal
bacteriophage gene. Biotechnology 10:196, 1992.
Shimizu-Kadota M, Sakurai T, Tsuchida N. Prophage origin of a virulent phage appearing
on fermentations of Lactobacillus casei S-1. Appl Environ Microbiol 45:669, 1983.
Sing WD, Klaenhammer TR. A strategy for rotation of different bacteriophage defences
in a lactococcal single strain starter culture system. Appl Environ Microbiol 59:
365, 1993.
Sodini I, Lagace L, Lacroix C, Corrieu G. Effect of continous prefermentation of milk
with an immobilized cell bioreactor on fermentation kinetics and curd properties.
J Dairy Sci 81:631, 1998.
Sozzi PD. Calcium requirements of lactic starter phages. Milchwissenschaft 27:503, 1972.
Spinnler H, Corrieu G. Automatic method to quantify starter activity based on pH measure-
ment. J Dairy Res 56:755, 1989.
Stadhouders J, Hup G, Jansen LA. A study of optimum conditions of freezing and storing
concentrated mesophilic starters. Neth Milk Dairy J 25:229, 1971.
Stiles M. Bacteriocins produced by Leuconostoc species. J Dairy Sci 77:2718, 1994.
Stiles M, Holzapfel W. 1997. Lactic acid bacteria of foods and their current taxonomy.
Int J Food Microbiol 36:1, 1997.
Strauss K. American-type cheeses. In: Cultures for the Manufacture of Dairy Products.
Milwaukee: Chr. Hansen, Inc 1997, p 65.
Tagg JR, Dajanii AS, Wannamaker LW. Bacteriocins of gram-positive bacteria. Bacteriol
Rev 40:722, 1976.
Starter Cultures and Their Use 205
Tahara T, Kanatani K. 1996. Isolation, partial characterization and mode of action of
acidocin J1229, a bacteriocin produced by Lactobacillus acidophilus JCM 1229. J
Appl Bacteriol 81:669, 1996.
Tamime A, Deeth H. Yogurt: technology and biochemistry. J Food Prot 43:939, 1980.
Terraghi E, Sandine W. 1975. Improved medium for lactic streptococci and their bacterio-
phages. Appl Microbiol 29:807, 1975.
Teuber M, Lembke J. The bacteriophages of lactic acid bacteria with emphasis on genetic
aspects of group N lactic streptococci. Antonie van Leewenhoek 49:283, 1983.
Thunell RK. pH-controlled starter: a decade reviewed. Cult Dairy Prod J 23(3):10, 1988.
Thunell RK. Taxonomy of the leuconostocs. J Dairy Sci 78:2514, 1995.
To B, Etzel M. Spray drying, freeze drying, or freezing of three different lactic acid bacte-
ria species. J Food Sci 62:576, 1997.
Toba T, Yoshioka E, Itoh T. Lacticin, a bacteriocin produced by Lactobacillus delbrueckii
subsp. lactis. Lett Appl Microbiol 12:43, 1990.
Trepanier G, Simard RE, Lee BH. Lactic acid bacteria relation to accelerated maturation
of cheddar cheese. J Food Sci 56:1238, 1991.
Tsai K, Luedecke L. Impedance measurement of changes in activity of lactic cheese starter
culture after storage at 4°C. J Dairy Sci 72:2239, 1989.
Turner KW, Martley FG, Gilles J, Morris HA. Swiss-type cheese III. The effect on cheese
moisture of varying the rate of acid production by S. thermophilus. NZ J Dairy Sci
Technol 18:125, 1983.
Ustunol Z, Hicks CL. Use of an enzyme-treated, whey-based medium to reduce culture
agglutination. J Dairy Sci 77:1479, 1994.
Ustunol Z, Sypien C. Determining lactococcal agglutination by ELISA. J Food Sci 61:
1035, 1996.
Valladao M, Sandine WE. Standardized method for determining the effect of various anti-
biotics on lactococcal cultures. J Food Prot 57:235, 1994a.
Valladao M, Sandine WE. Quaternary ammonium compounds in milk: detection by re-
verse phase high performance liquid chromatography and their effect on starter
growth. J Dairy Sci 77:1509, 1994b.
Vandenbergh PA. Lactic acid bacteria: their metabolic products and interference with mi-
crobial growth. FEMS Microbiol Rev 12:221, 1993.
Vaughan E, Pridmore R, Mollet B. Transcriptional regulation and evolution of lactose
genes in the galactose-lactose operon of Lactococcus lactis NCDO2054. J Bacteriol
180:4893, 1998.
Vedamuthu ER. The dairy leuconostocs: use in dairy products. J Dairy Sci 77:2725, 1994.
Vedamuthu E, Reinbold G. The use of candle oats jar incubation for the enumeration,
characterization, and taxonomic study of propionibacteria. Milchwissenschaft 22:
428, 1967.
Villani F, Pepe O, Mauriello G, Salzano G, Moschetti G, Coppola S. Antilisterial activity
of thermophilin 347, a bacteriocin produced by Streptococcus thermophilus. Int J
Food Microbiol 25:179, 1995.
Visser S, Hop G, Exterkate FA, Stadhouders J. Bitter flavour in cheese. 2. Model studies
on the formation and degradation of bitter peptides by proteolytic enzymes from
calf rennet, starter cells, and starter cell fractions. Neth Milk Dairy J 37:169, 1983.
Ward DJ. Characterization of a bacteriocin produced by Streptococcus thermophilus
ST134. Appl Microbiol Biotechnol 43:330, 1995.
206 Hassan and Frank
Weinbrenner D, Barefoot S, Grinstead D. Inhibition of yogurt starter cultures by jenseniin
G, a Propionibacterium bacteriocin. J Dairy Sci 80:1246, 1997.
Whitehead HR, Cox GA. The occurrence of bacteriophage in cultures of lactic strepto-
cocci. N Z J Dairy Sci Technol 16:319–320, 1935.
Whitehead WE, Ayres JW, Sandine WE. A review of starter media for cheese making.
J Dairy Sci 76:2344, 1993.
Wolfson LM, Sumner SS. Antibacterial activity of the lactoperoxidase system: a review.
J Food Prot 56:887, 1993.
Wright A, Tynkkynem S. Construction of Streptococcus lactis subsp. lactis strains with
a single plasmid associated with mucoid phenotype. Appl Environ Microbiol 53:
1385, 1987.
Yang NL, Sandine WE. Acid producing activity of lyophilized streptococcal cheese starter
concentrates. J Dairy Sci 62:908, 1979.
Yun JJ, Barbano DM, Keily L, Kindstedt PS. Mozzarella cheese: impact of rod:coccus
ratio on composition, proteolysis, and functional properties. J Dairy Sci 78:751,
1995.
7
Metabolism of Starter Cultures
Robert W. Hutkins
University of Nebraska
Lincoln, Nebraska
I. INTRODUCTION
For most dairy fermentations, the role of starter culture bacteria is quite simple—
they ferment lactose and produce lactic acid. As a result, the pH is reduced, and
the ensuing low pH serves to preserve the product. In addition, lactic acid and
low pH also are responsible for enhancing syneresis in cheese manufacture
and for causing caseins to coagulate in yogurt, sour cream, and other cultured
dairy products. However, lactic acid bacteria used as dairy starter cultures per-
form a number of other important functions in fermented milk products. They
produce or generate several flavor compounds or flavor precursors, and they pro-
duce enzymes and other products that have profound effects on texture and body
characteristics of cheese and cultured milk products. Not surprisingly, many func-
tions performed by starter culture organisms are directly related to metabolic and
physiological characteristics of those organisms. In this chapter, the specific
means by which carbohydrates and proteins are metabolized and how endpro-
ducts are produced by lactic acid bacteria will be reviewed. The pathways for
flavor production, not only by lactic acid bacteria but also by non–lactic acid
bacteria used as culture adjuncts and by fungi will also be described.
II. CARBOHYDRATE UTILIZATION BY LACTIC
ACID BACTERIA
Lactic acid bacteria are classified as heterotrophic chemoorganotrophs, meaning
that they require preformed organic carbon as a source of both carbon and energy.
207
208 Hutkins
Lactic acid bacteria also lack cytochrome or electron transport proteins, and there-
fore cannot derive energy via respiratory activity. Thus, substrate-level phosphor-
ylation reactions that occur during glycolysis (see below) are the primary means
by which ATP is obtained. There are, however, other means by which these
organisms can conserve energy and save ATP that would ordinarily be used to
perform necessary functions, such as nutrient transport (see below).
Although there are some important differences between how various genera
and species use and metabolize specific carbohydrates, lactic acid bacteria gener-
ally lack metabolic diversity and instead rely on two principal pathways for catab-
olism of carbohydrates. In the homofermentative pathway, hexoses are metabo-
lized via enzymes of the Embden-Meyerhoff pathway (Fig. 1), yielding 2 mol
of pyruvate and 2 mol of ATP per mole of hexose. Pyruvate is subsequently
reduced to lactate by lactate dehydrogenase, so that more than 90% of the starting
material (i.e., glucose) is converted to lactic acid. The NADH formed via the
glyceraldehyde-3-phosphate dehydrogenase reaction is also reoxidized (forming
NAD
H11001
) by lactate dehydrogenase, thus maintaining the NADH/NAD
H11001
balance.
Among lactic acid bacteria used as dairy starter cultures, most are homofermen-
tative, including Lactococcus lactis, Streptococcus thermophilus, Lactobacillus
helveticus, and Lb. delbrueckii subsp. bulgaricus.
In heterofermentative metabolism, hexoses are catabolized by the phospho-
ketolase pathway (Fig. 2), which results in approximate equimolar production of
lactate, acetate, ethanol, and CO
2
. Only 1 mol of ATP is made per hexose. In
actuality, however, product yields for both homo- and heterofermentative metab-
olism can vary, depending on the source and amount of available substrate,
growth temperature, atmospheric conditions, and other factors. Under certain
conditions, for example, some homofermentative organisms can divert pyruvate
away from lactate and toward other so-called ‘‘heterolactic’’ endproducts (see
below). Importantly, the pathway used by a particular strain or culture may have a
profound effect on flavor, texture, and overall quality of fermented dairy products.
Although several species of Lactobacillus are heterofermentative, Leuconostoc
spp. are the only heterofermentative lactic acid bacteria used as starter cultures
in dairy products.
A. Metabolism of Lactose by Lactic Acid Bacteria
As described earlier, lactic acid bacteria generally rely on either the Embden-
Meyerhoff or phosphoketolase pathway for metabolism of sugars. In fact, these
catabolic pathways are only a part of the overall metabolic process used by these
bacteria. The first, and perhaps most important, step in carbohydrate metabolism
involves transport of the sugar substrate across the cytoplasmic membrane and
its subsequent accumulation in the cytoplasm. This process of transport and accu-
Metabolism of Starter Cultures 209
Figure 1 The Embden-Meyerhoff pathway used by homofermentative lactic acid bac-
teria.
mulation is important for several reasons. First, active transport of sugars requires
energy, and much of the energy gained by cells as a result of catabolism must
then be used to transport more substrate. Second, the transport system used by
a particular strain dictates, in part, the catabolic pathway used by that organism.
The transport machinery also plays a regulatory role and can influence expression
210 Hutkins
Figure 2 The phosphoketolase pathway used by heterofermentative lactic acid bacteria.
Metabolism of Starter Cultures 211
of alternative transport systems. Finally, the metabolic behavior of a particular
strain and how that strain functions in fermented dairy foods may be influenced
by the actual operation of the transport system itself.
B. Lactose Phosphotransferase System of Lc. lactis
There are, in general, two different systems used by lactic acid bacteria to trans-
port carbohydrates, and it is convenient to group lactic acid bacteria according
to the system used to transport their primary substrate, lactose. The phosphoenol-
pyruvate (PEP)–dependent phosphotransferase system (PTS) is used by most
mesophilic, homofermentative lactic acid bacteria, especially lactococci used as
starter cultures for cottage, Cheddar, Gouda, and other common cheese varieties.
In contrast, other starter culture bacteria, such as S. thermophilus and Lactobacil-
lus spp. that are used for yogurt, Swiss, and mozzarella cheese production, trans-
port lactose via a lactose permease. Dairy Leuconostoc bacteria also rely on a
lactose permease for uptake of lactose. Some lactococci and lactobacilli have the
ability to use both systems. Not only do these two systems differ in biochemical
characteristics, but energy sources used to drive transport and accumulated intra-
cellular products differ as well. These differences have practical implications.
The Lactococcus lactose PTS, first described by McKay et al. (1969), con-
sists of a cascade of cytoplasmic and membrane-associated proteins that transfer
a high-energy phosphate group from its initial donor, PEP, to the final acceptor
molecule, lactose. Phosphorylation of lactose occurs concurrent with the vectorial
movement of lactose across the cytoplasmic membrane (from out to in) and re-
sults in intracellular accumulation of lactose phosphate. As shown in Figure 3,
there are two cytoplasmic proteins, enzyme I and histidine-containing protein
(HPr), that are nonspecific and function as the initial phosphorylating proteins
for all PTS substrates. The substrate-specific PTS components comprise the en-
zyme II complex, which for the lactose PTS in Lc. lactis, represents three protein
domains (Enz IIA
lac
and Enz IIBC
lac
). The phosphoryl group is transferred first
from PEP to enzyme I, then to HPr, then to the cytoplasmic protein, Enz IIA
lac
,
which then transfers it to the cytoplasmic domain of Enz IIBC
lac
. As lactose is
translocated across the membrane by the integral membrane domain of Enz
IIBC
lac
, it becomes phosphorylated.
The product of the lactose PTS, thus, is lactose-phosphate, or more specifi-
cally, glucose-β-1,4-galactosyl-6-phosphate. Hydrolysis of this compound occurs
via phospho-β-galactosidase, yielding glucose and galactose-6-phosphate. Glu-
cose is phosphorylated by hexokinase (via an ATP) to glucose-6-phosphate,
which then feeds directly into the Embden-Meyerhoff pathway, as described ear-
lier. Galactose-6-phosphate, in contrast, takes a different route altogether, as it
is first isomerized to tagatose-6-phosphate and then phosphorylated to form taga-
tose-1,6-diphosphate (Fig. 4). The latter is then split by tagatose-1,6-diphosphate
212 Hutkins
Figure 3 Signal transduction and the phosphotransferase system in gram-positive bacte-
ria. HPr can be phosphorylated at His-15 (by Enz I) or at Ser-46 by an HPr kinase. The
latter, along with CcpA and fructose diphosphate (FDP), form a complex that recognizes
CRE sites and prevents transcription of catabolic genes. (Adapted from Saier et al., 1995.)
Figure 4 Tagatose pathway in lactococci. Galactose-6-phosphate is formed from hydro-
lysis of lactose-phosphate, the product of the lactose PTS. Isomerization and phosphoryla-
tion form tagatose-1, 6-diphosphate, which is split by an aldolase, yielding the triose phos-
phates that feed into the EM pathway.
Metabolism of Starter Cultures 213
aldolase to form the triose phosphates, glyceraldehyde-3-phosphate and dihy-
droxyacetone phosphate, in a reaction analogous to the aldolase of the Embden-
Meyerhoff pathway. It is important to note that in Lc. lactis, glucose and galactose
moieties of lactose, despite taking parallel pathways, are fermented simulta-
neously.
C. Regulation of the Phosphotransferase System
In Lc. lactis, lactose fermentation is regulated at several levels. First, several
glycolytic enzymes are allosteric, and their activities are therefore influenced by
the intracellular concentration of specific glycolytic metabolites via feedback in-
hibition. During active lactose metabolism (i.e., when lactose is plentiful), the
high intracellular concentration of fructose-1,6-diphosphate (FDP) and low level
of inorganic phosphate stimulate pyruvate kinase. Thus, much of the PEP made
via glycolysis is used to drive ATP synthesis, which is consistent with a period
of active cell growth. The activity of the NADH-dependent lactate dehydrogenase
is also stimulated, which is important because reduced NAD
H11001
, formed via the
glyceraldehyde-3-phosphate dehydrogenase reaction, must be reoxidized to
maintain the NAD
H11001
/NADH balance. In contrast, when lactose is limiting, py-
ruvate kinase activity decreases causing PEP to accumulate, which forms a ‘‘bot-
tleneck’’ in glycolysis. The concentration of triose phosphates subsequently in-
creases, forming a pool of PEP equivalents. Thus, during a period when lactose
is unavailable, a PEP ‘‘potential’’ exists, poising the cell for when lactose is
available (Thompson, 1987).
A second and more effectual mechanism for controlling or regulating lac-
tose metabolism is exerted at the level of the transport machinery itself. In par-
ticular, the phosphorylation state of HPr, the cytoplasmic PTS phosphocarrier
protein, plays a major role in sugar metabolism. As noted earlier, HPr is phos-
phorylated by enzyme 1. This phosphorylation occurs specifically at the histidine-
15 (His-15) residue of HPr. However, HPr can also be phosphorylated at a serine
residue (Ser-46) by an ATP-dependent HPr kinase, which is activated by fructose-
1,6-diphosphate (as would occur during active sugar metabolism). When HPr is
in this state, that is, HPr (Ser-46-P), phosphorylation at His-15 is inhibited; thus,
PTS activity is also inhibited and entry of other potential PTS substrates is pre-
vented. Additional experimental evidence that HPr (Ser-46-P) can directly inhibit
transport of sugars was provided by Saier and coworkers (Ye and Saier, 1995a,
1995b; Ye et al., 1994), who showed that HPr (Ser-46-P) can bind to or otherwise
inactivate sugar permeases, a process known as inducer exclusion. Yet another
means by which HPr (Ser-46-P) regulates sugar flux is via inducer expulsion.
Presumably, this occurs when sugar phosphates have accumulated intracellularly
beyond the rate at which metabolism can occur or when nonmetabolizable sugars
have been taken up. Since these sugar phosphates could inhibit metabolism, they
214 Hutkins
must first be dephosphorylated and then effluxed. In inducer expulsion, therefore,
HPr (Ser-46-P) activates a sugar-specific phosphatase that dephosphorylates the
sugar phosphates so that efflux of the free sugar can then occur (Thompson and
Chassy, 1983).
HPr not only exerts biochemical control on transport, but HPr (Ser-46-P)
also plays an important role at the gene level through its interaction with the
DNA-binding protein, CcpA, or catabolite control protein A. As illustrated in
Figure 3, HPr (Ser-46-P) and CcpA (with the participation of fructose-1,6-diphos-
phate) affect metabolism by blocking transcription of catabolic genes, including
other PTS genes, a process called catabolite repression. CcpA or CcpA-like pro-
teins appear to be widely distributed among gram-positive bacteria, including
several species of lactic acid bacteria (Luesink et al., 1998a), and this mechanism
of gene regulation, therefore, may be common. According to this model of carbon
source–mediated gene regulation, HPr exists in one of two phosphorylation
states, HPr (His-15-P) or HPr (Ser-46-P). The former accumulates when lactose
(or another PTS sugar, such as glucose) is unavailable, since the enzyme II com-
plex is without its substrate. In contrast, when lactose is available and the energy
state of the cell is high, intracellular FDP levels increase and HPr kinase is
activated, causing HPr (Ser-46-P) to accumulate. A complex is then formed be-
tween HPr (Ser-46-P) and CcpA. This complex, along with a glycolytic activator
(fructose-1,6-diphosphate or glucose-6-phosphate), binds to 14–base pair DNA
regions called catabolite responsive elements (CREs) located near the tran-
scription start sites of catabolic genes. When these CRE regions are occupied by
the HPr (Ser-46-P)–CcpA complex, transcription by RNA polymerase is effec-
tively blocked or reduced. In contrast, mutations in ccpA or deletions of cre re-
gions eliminate catabolite repression. Since CRE regions are found in the pro-
moter regions of several catabolic genes, the phosphorylation status of HPr can
have a profound effect on whether these genes are expressed. Identified gene
clusters preceded by CRE regions in lactococci include genes coding for galac-
tose (and thus lactose) and sucrose metabolism. For example, when Lc. lactis is
grown on glucose, a PTS substrate, transcription of genes coding for galactose
metabolism is repressed (Luesink et al., 1998b). Even the presence of galactose
fails to induce expression of gal genes as long as glucose, the repressing sugar,
is present.
Not only does HPr have a negative regulatory role, but it was recently
shown that HPr (Ser-46-P) and CcpA can also activate gene expression (Luesink
et al., 1998b, 1999). Specifically, expression of the las operon, coding for lactate
dehydrogenase, phosphofructokinase, and pyruvate kinase, is activated at high
sugar conditions. The net effect, therefore, is that the phosphorylation state of
HPr serves as a signal for activating expression of genes coding for glycolytic
enzymes when the cell is actively metabolizing sugars. Recent genetic evidence
(Luesink et al., 1999) indicates that HPr is also important in influencing sugar
Metabolism of Starter Cultures 215
uptake by establishing a hierarchy for different sugars preferentially fermented
by Lc. lactis.
Finally, lactose metabolism is also genetically regulated via expression and
repression of the lactose PTS genes (Fig. 5). The lactose metabolism genes in
Lc. lactis, like the genes coding for other important metabolic pathways, are often
located on plasmids of varying size. Strains cured of the lactose plasmid, which
encodes lactose metabolism genes, are unable to ferment lactose. In Lc. lactis
MG1820, the lac genes are organized as an 8-kb operon, consisting of eight genes
in the order lacABCDFEGX (de Vos et al., 1990). The first four genes, lacABCD,
actually code for enzymes of the tagatose pathway and are necessary for galactose
utilization (see below). The lactose-specific genes, lacFEG, code for PTS proteins
and phospho-β-galactosidase. The operon is negatively regulated by LacR, a re-
pressor protein encoded by the lacR gene, which is located upstream of the lac
promoter and which is divergently transcribed (van Rooijen and de Vos, 1990).
In the presence of lactose, lacR expression is repressed, and transcription of the
lac operon is induced. During growth on glucose or when lactose is unavailable
(and cells are uninduced), LacR is expressed and transcription of the lac genes
is repressed. A CRE site is also located near the transcriptional start site of the
lac operon. However, when lacR is inactivated, expression of lac genes becomes
constitutive regardless of carbon source (i.e., under conditions that presumably
would activate CcpA-mediated repression). This implies that LacR, along with
inducer expulsion-exclusion, have primary responsibility for regulating sugar me-
tabolism, rather than CcpA, and that catabolite repression in lactococci is medi-
ated mainly via the concentration of inducer (Luesink et al., 1998).
The lactose PTS, as described earlier for Lc. lactis, also exists in other
dairy lactic acid bacteria, including Lb. casei. However, in Lb. casei, lac genes
are chromosomally encoded and the nucleotide sequence and genetic organization
are different from those in Lc. lactis (Gosalbes et al., 1997). The Lb. casei lac
Figure 5 The lac operon in lactococci. The first four structural genes (lacABCD) code
for enzymes of the tagatose pathway, lacFE code for lactose-specific PTS proteins, and
lacG codes for phospho-β-galactosidase. The divergently transcribed lacR codes for a
repressor; the function of lacX is not known. Promoter sites and directions are shown by
arrows, and potential transcriptional terminators are shown as hairpin loops. The number
of amino acids for each protein is given. (Adapted from de Vos et al., 1990.)
216 Hutkins
cluster (lacTEGF) encodes, respectively, for a regulatory protein, two PTS
proteins, and phospho-β-galactosidase. Genes coding for galactose metabolism
(lacABCD in Lc. lactis) are absent in the Lb. casei lac cluster. Although expres-
sion of lac genes is repressed by a CcpA-mediated process, as in Lc. lactis,an
additional regulatory mechanism dependent on an antiterminator also exists in
Lb. casei (Gosalbes et al., 1999).
D. Lactose Transport and Hydrolysis by S. thermophilus
Although the PTS is widely distributed among lactic acid bacteria, several impor-
tant dairy species rely on a lactose permease for transport and a β-galactosidase
for hydrolysis. Some species have both pathways for lactose, and some have a
PTS for one sugar and a permease for another. The best example of the lactose
permease/β-galactosidase system is that which occurs in S. thermophilus, Lb.
helveticus, and Lb. delbruecki subsp. bulgaricus (Fig. 6). In these bacteria, lactose
accumulates in an unmodified form via the LacS permease. A similar system
also exists in some strains of Lc. lactis, but clearly it is not the primary system.
The lactose permease in S. thermophilus is dramatically different from other,
well-studied lactose permeases, such as the LacY system in Escherichia coli.In
E. coli, lactose transport is fueled by a proton motive force (PMF), and the perme-
ase binds and transports its substrate lactose in symport with a proton. In S.
thermophilus, lactose transport can also be fueled by a PMF, but that is not the
main way the permease can function. Instead, the transporter has exchange or
Figure 6 Lactose transport and hydrolysis by S. thermophilus. Lactose uptake is driven
by galactose efflux; both solutes may be transported in symport with a proton.
Metabolism of Starter Cultures 217
antiporter activity, so that lactose uptake can be driven by efflux of galactose.
That is, ‘‘uphill’’ lactose transport (uptake against a concentration gradient) oc-
curs as a result of ‘‘downhill’’ galactose efflux (Hutkins and Ponne, 1991). Since
generation of a PMF requires ATP (or its equivalent), not having to use the PMF
for lactose uptake conserves energy. The lactose:galactose exchange reaction is
actually quite remarkable, in that, as discussed below, galactose efflux, rather
than galactose utilization, appears to be the preferred pathway for most strains
of S. thermophilus. Why this phenomenon occurs and the important practical
implications for this will be discussed later.
Detailed analysis of the S. thermophilus LacS system has revealed that the
permease protein itself is a hybrid consisting of two distinct regions or domains
(Poolman et al., 1989). The deduced amino acid sequence of the amino-terminal
region is very similar to the melibiose permease of E. coli. However, the carboxy-
terminal region is structurally similar to an E. coli PTS enzyme IIA domain. In
fact, this enzyme IIA–like domain can be phosphorylated by HPr, reducing trans-
port activity of LacS. It now appears that the permease region functions as the
lactose carrier and the enzyme IIA–like domain functions as a regulatory unit.
Hydrolysis of lactose in S. thermophilus occurs via a β-galactosidase that
has modest amino acid homology to other LacZ-like enzymes (30–50%). After
hydrolysis, S. thermophilus rapidly ferments glucose to lactic acid by the
Embden-Meyerhoff pathway, yet most strains, especially those used as dairy
starter cultures, do not ferment the galactose moiety of lactose. Rather, galactose
is effluxed and accumulates in the extracellular medium. In the manufacture of
dairy products made with an S. thermophilus–containing culture, such as yogurt
or mozzarella cheese, galactose may appear in the finished product. With yogurt,
accumulated galactose is of little consequence, but for mozzarella cheese, even
a small amount of galactose can present problems. This is because of the nonenzy-
matic browning reaction that occurs when galactose, a reducing sugar, is heated
in the presence of free amino acids. Since most mozzarella cheese is used for
pizzas, high-temperature baking accelerates nonenzymatic browning reactions.
Cheese containing galactose can brown excessively, a phenomenon considered
as a defect by many pizza manufacturers. Therefore, mozzarella producers may
be asked by their customers to satisfy specifications for ‘‘low-browning’’ or low-
galactose cheese. Although some cheese manufacturers can rely on their cheese-
making know-how and simply modify the production procedures to remove un-
fermented galactose, other manufacturers have chosen to use cultures that have
low-browning potential, as described below.
Why are most strains of S. thermophilus phenotypically galactose negative
(Gal
H11002
) and unable to ferment either free or lactose-derived galactose? Evidence
from several laboratories indicates that S. thermophilus does contain genes neces-
sary for galactose metabolism (see below), but that these genes are not ordinarily
expressed even under inducing conditions. Mutants have been isolated, however,
218 Hutkins
that ferment free galactose, but when these strains are grown on lactose, galactose
utilization is still repressed (Thomas and Crow, 1984, Benateya et al., 1991).
Thus, it has been suggested that of the two routes that galactose can take, the
efflux reaction is favored over the catabolic pathway.
E. Lactose Metabolism by Lactobacillus and Other Lactic
Acid Bacteria
Most other lactic acid bacteria rely on one or the other of the two pathways
described earlier. Table 1 lists the pathways used by species that have been stud-
ied in sufficient detail. With the exception of Lc. lactis and Lb. casei, however,
most dairy lactic acid bacteria do not have a lactose PTS, and instead use a lactose
permease/β-galactosidase system for metabolism of lactose. Some strains have
more than one system; for example, Lc. lactis and Lb. casei have both a lactose
PTS and a lactose permease/β-galactosidase. It is important to note that not all
strains or species that use non-PTS pathways for lactose metabolism excrete ga-
lactose into the medium, as described for S. thermophilus. Many of the lactoba-
cilli and Leuconostoc spp. that transport and hydrolyze lactose by a permease
and a β-galactosidase, respectively, also ferment glucose and galactose simulta-
neously. This is important, because in almost all fermented dairy products made
with a culture containing S. thermophilus, a galactose-fermenting Lactobacillus
sp. is also present (see Chap. 11). For some products, such as Swiss-style cheeses,
the galactose that is effluxed into the curd by S. thermophilus is subsequently
fermented by Lb. helveticus. Otherwise, the free galactose could be fermented
by other members of the microflora, resulting in heterofermentative endproducts
that could contribute to off-flavors and other product defects.
F. Galactose Metabolism
During growth in milk, lactic acid bacteria ordinarily encounter free galactose
only after intracellular hydrolysis of lactose. For lactococci and those lactobacilli
Table 1 Lactose Transport and Metabolic Systems in Dairy Lactic Acid Bacteria
Organism Lactose transport system Galactose pathway
Streptococcus thermophilus Lac permease Leloir
Lactococcus lactis PTS Leloir, tagatose
Lactobacillus delbrueckii Lac permease Leloir
subsp. bulgaricus
Lactobacillus helveticus Lac permease Leloir
Lactobacillus casei PTS, Lac permease Leloir, tagatose
Leuconostoc lactis Lac permease Leloir
Metabolism of Starter Cultures 219
that transport lactose via the PTS, galactose-6-phosphate is the actual hydrolysis
product (resulting from hydrolysis of lactose-phosphate by phospho-β-galactosi-
dase). Galactose-6-phosphate feeds directly into the tagatose pathway, as de-
scribed earlier and in Figure 4. However, as noted earlier, free galactose will
appear and accumulate in fermented dairy products made with thermophilic
starter cultures containing S. thermophilus, Lb. bulgaricus, or other galactose-
nonfermenting strains. Yogurt and mozzarella cheese, for example, can contain
up to 2.5 and 0.8% galactose, respectively. Therefore, metabolism of free galac-
tose may be of practical importance.
For the lactococci and some lactobacilli, free galactose appears to be trans-
ported by either a galactose-specific PTS or by a galactose permease. The intracel-
lular product of the galactose PTS (galactose-6-phosphate) simply feeds into the
tagatose pathway. When galactose accumulates via galactose permease, the intra-
cellular product is free galactose. Subsequent metabolism occurs via the Leloir
pathway, which phosphorylates galactose, and then converts galactose-1-phos-
phate into glucose-6-phosphate (Fig. 7). The latter then feeds into the glycolytic
pathway. Interestingly, in Lc. lactis, galactose permease may be the primary
means for transporting galactose, since it has a much higher apparent affinity for
galactose than the PTS transporter.
The Leloir pathway is used not only by lactococci, but it is also the pathway
used by Lb. helveticus, Leuconostoc spp., and galactose-fermenting strains of S.
thermophilus. During growth on lactose, these bacteria rely on a lactose
Figure 7 Leloir pathway in lactic acid bacteria. Phosphorylation of galactose may re-
quire isomerization by mutarotase (not shown). The subsequent steps convert galactose-1-
phosphate into glucose-6-phosphate, which feeds into the EM pathway (homofermentative
bacteria) or phosphoketolase (PK) pathway (heterofermentative bacteria).
220 Hutkins
permease/β-galactosidase system and therefore generate free intracellular galac-
tose. In some instances, they will also encounter free extracellular galactose, espe-
cially if they are grown in the presence of galactose-nonfermenting strains, as
described earlier. Subsequent galactose fermentation by Lb. helveticus and Leuco-
nostoc lactis occurs via the Leloir pathway. Transport is mediated by a permease,
apparently driven by a PMF. A mutarotase (the product of the galM gene) may
also be necessary to convert β-D-galactose (the product of lactose hydrolysis) to
its anomeric isomer, α-D-galactose, before it can be efficiently phosphorylated
by galactokinase.
Despite the inability of most strains of S. thermophilus to ferment galactose,
genes coding for enzymes of the Leloir pathway appear to be present and func-
tional (Grossiord et al., 1998; Poolman et al., 1990; Mustapha et al., 1995). The
S. thermophilus gal operon consists of four structural genes (galKTEM) and one
divergently transcribed regulatory gene (galR). Transcription of these genes,
however, does not occur in most wild-type strains, accounting for the galactose
nonfermenting phenotype. Mutations in the gal promoter/regulatory region led to
isolation of galactose-fermenting mutants that expressed gal genes and fermented
galactose. Such efforts suggest that genetic modification of S. thermophilus may
provide the basis for obtaining stable galactose-fermenting derivatives that would
be of considerable value to the dairy industry (de Vos, 1996).
Although the gal genes in S. thermophilus, Leuc. lactis, Lc. lactis, Lb.
casei, and Lb. helveticus share significant amino acid sequence homology and
are chromosomally encoded, they are organized in a somewhat different order
(Grossiord et al., 1998). All contain galK (galactokinase), galT (galactose-1-phos-
phate uridyl transferase), and galE (UDP-galactose-4-epimerase), and some clus-
ters also contain the galM gene coding for mutarotase. In S. thermophilus, the
gal genes are located immediately upstream of the lacS-lacZ cluster. There is
also rather significant variation with respect to genetic structure even between
strains of the same species. For example, a galA gene, thought to encode for a
permease, is the first gene in the Lc. lactis MG1363 gal cluster, but this gene
does not appear in gal clusters from other organisms.
The ability of these strains, especially lactobacilli, to ferment galactose can
be quite variable, and strain selection is important. Galactose fermentation by
lactobacilli has also been used as a basis for distinguishing between Lb. helveticus
(Gal
H11001
) and Lb. delbrueckii subsp. bulgaricus (Gal
H11002
). As noted earlier, some cul-
ture suppliers promote ‘‘nonbrowning’’ cultures for use in mozzarella cheese
production; invariably, these cultures contain galactose-fermenting lactobacilli.
G. Alternate Routes for Pyruvate
As described earlier, lactic acid bacteria are ordinarily considered as being either
homofermentative or heterofermentative, with some species being able to metab-
Metabolism of Starter Cultures 221
olize sugars by both pathways. However, sugar metabolism, even by obligate
homofermentative strains, can result in formation of endproducts other than lactic
acid by a variety of pathways (Fig. 8). In general, these alternative fermentation
products are formed as a consequence of accumulation of excess pyruvate and
the requirement of cells to maintain a balanced NADH/NAD
H11001
ratio. That is, when
the intracellular pyruvate concentration exceeds the rate at which lactate can be
formed via lactate dehydrogenase, other pathways must be recruited not only to
remove pyruvate but also to provide a means for oxidizing NADH. These alterna-
tive pathways may also provide cells with the means to make additional ATP.
Under what conditions or environments would pyruvate accumulate? As noted
earlier, when fermentation substrates are limiting, and the glycolytic activator,
fructose-1,6-diphosphate, is in short supply, activity of the allosteric enzyme,
lactate dehydrogenase, is reduced and pyruvate accumulates. Low carbon flux
may also occur during growth on galactose or other less preferred carbon sources,
resulting in excess pyruvate. When the environment is highly aerobic, NADH
that would normally reduce pyruvate is instead oxidized directly by molecular
oxygen and is unavailable for the lactate dehydrogenase reaction.
Several enzymes and pathways have been identified in lactococci and other
lactic acid bacteria that are responsible for diverting pyruvate away from lactic
acid and toward other products (Cocaign-Bousquet et al., 1996; Garrigues et al.,
1997). In anaerobic conditions, and when carbohydrates are limiting and growth
rates are low, a mixed-acid fermentation occurs, and ethanol, acetate, and formate
are formed. Under these conditions, pyruvate-formate lyase is activated, and pyr-
uvate is split to form formate and acetyl-CoA. Acetyl-CoA can be converted to
ethanol and/or acetate. The latter also results in formation of an ATP via acetate
Figure 8 Alternative routes of pyruvate metabolism.
222 Hutkins
kinase. If the environment is aerobic, pyruvate-formate lyase is inactive, and
instead pyruvate is decarboxylated by pyruvate dehydrogenase to form acetate
and CO
2
. Finally, excess pyruvate can be diverted to α-acetolactate via α-
acetolactate synthase. This reaction has other important implications, since α-
acetolactate is the precursor for diacetyl formation.
Although these alternative pathways for pyruvate metabolism are influ-
enced largely by environmental conditions, mutants unable to produce lactate
dehydrogenase also must deal with excess pyruvate and, therefore, produce other
endproducts. Under certain conditions, cells may divert excess pyruvate to highly
desirable products, specifically the aroma compound diacetyl. Ordinarily diacetyl
is made from citrate (see below), but even citrate-nonfermenting cells will make
diacetyl from lactose if appropriate conditions are established or if cells are genet-
ically modified. For example, overexpression of NADH oxidase in Lc. lactis de-
creases lactate formation from pyruvate, and instead α-acetolactate, the precursor
for diacetyl, is formed (de Felipe et al., 1998). Enhancing diacetyl production by
metabolic engineering will be discussed later.
III. PROTEIN METABOLISM
Just as dairy lactic acid bacteria are well suited to utilize lactose as a source of
energy and carbon, they are also well adapted to use casein as a source of nitro-
gen. Lactic acid bacteria cannot assimilate inorganic nitrogen and, therefore, they
must be able to degrade proteins and peptides to satisfy their amino acid require-
ments. The absolute requirement for a system to degrade milk casein was first
demonstrated by McKay and Baldwin (1974), who showed that Lc. lactis C2,
cured of a plasmid containing the proteinase gene, was unable to grow to high
cell density in milk. However, if milk was supplemented with hydrolyzed milk
protein, the plasmid-cured strain grew like the parental strain. We now know that
dairy lactic acid bacteria have evolved highly efficient systems for reducing large
casein subunits to smaller pieces and for supplying cells with all of the amino
acids necessary for growth in milk. The proteolytic system consists of three main
components. The first involves the proteolysis of casein to form a large collection
of peptides. In the second step, peptides are transported into cells by one of
several transport systems. Once inside the cell, peptides are further hydrolyzed
by a diverse group of peptidases to form free amino acids which are ultimately
either metabolized or assimilated into protein (Fig. 9).
A. Proteinase System
Although lactic acid bacteria vary considerably in their ability to degrade milk
protein, most organisms possess similar systems, as typified by the extensively
Metabolism of Starter Cultures 223
Figure 9 Proteolytic system in lactococci. Milk casein is hydrolyzed by cell envelope–
associated proteinase (PrtP) to form oligopeptides, which are transported across the mem-
brane by the oligopeptide transport system (Opp). Intracellular oligopeptides are then hy-
drolyzed by a variety of peptidases (PepA, PepC, PepF, PepO, and PepX) to form amino
acids. Dipeptides and tripeptides and free amino acids, also present in milk, are transported
by dipeptide tripeptide transporters (DtpT, DtpP) and amino acid (AA) transporters. Di-
peptides and tripeptides are further hydrolyzed to amino acids. (Adapted from Mierau et
al., 1997 and Steele, 1998.)
studied proteolytic system of Lactococcus. For Lc. lactis and other dairy lactic
acid bacteria, casein is the primary source of amino acid nitrogen, since the non–
protein nitrogen and free amino acids available in milk (H11021300 mg/L) are quickly
depleted. Because Lc. lactis is a multiple amino acid auxotroph and requires as
many as eight amino acids, casein hydrolysis is essential. Casein utilization by
Lc. lactis begins with elaboration of a cell envelope–associated serine proteinase.
This proteinase, PrtP, is expressed as a large (H11022200 kD), inactive preproprotein-
ase. The leader sequence, which is responsible for directing the protein across
the cytoplasmic membrane, is removed, leaving the remaining protein anchored
to the cell envelope. However, the proproteinase is not active until it is further
processed by the maturation protein, PrtM. The latter presumably acts by induc-
ing an autocatalytic cleavage event that results in hydrolysis of the pro region
of the enzyme, leaving a mature PrtP with a molecular mass of 180–190 kD.
Although the proteinases among different strains of Lc. lactis are all geneti-
cally related and show only minor differences with respect to their amino acid
sequence, the specific casein substrates and hydrolysis products of PrtP enzymes
224 Hutkins
from lactococci can vary considerably. For example, proteinases belong to group
A (formerly P
III
-type) hydrolyze α
S1
-, β-, and K-caseins, whereas group E protein-
ases (formerly P
I
-type) have a preference for β-casein and relatively little activity
for α
S1
- and K-caseins. Still, the functional organization of the PrtP and PrtM
system varies little among lactococci. Both are required for rapid growth in milk,
and genes for both (prtP and prtM, respectively) are induced when cells are
grown in low-peptide media (e.g., milk) and repressed in peptide-rich media.
Over 100 caseinolytic products result from action of PrtP on β-casein (Juil-
lard et al., 1995) Most are large oligopeptides (4–30 amino acid residues) with
a major fraction between 4 and 10 residues. Free amino acids, dipeptides, and
tripeptides are not formed. The first and most abundant oligopeptides formed by
PrtP are generated from the C-terminal end of β-casein (Kunji et al., 1998), and
it now appears that initial hydrolysis events cause casein to unfold so that other
cleavage sites are exposed.
B. Amino Acid and Peptide Transport Systems
Although it was once believed that extracellular peptidases must be present to
degrade further these peptides before transport, it is now well established that
extracellular hydrolysis of peptides formed by PrtP does not occur, at least not
by peptidases. Instead, lactococci and other lactic acid bacteria possess an array
of amino acid and peptide transport systems able to transport substrates of varying
size, polarity, and structure. Some of these are highly specific, whereas others
have rather broad substrate specificity. They also vary as to energy sources used
to fuel active transport.
As described earlier, the concentration of free amino acids in milk is too
low to support growth of lactic acid bacteria. Still, lactococci possess at least 10
amino acid transporters, most of which are specific for structurally similar sub-
strates. If the medium contains an adequate concentration of free amino acids,
these transport systems can deliver enough amino acids to the cytoplasm to sup-
port growth. However, it has been suggested that the primary function of these
transporters may be simply to excrete or efflux excess amino acids from the
cytoplasm to maintain appropriate intracellular pool ratios (Kunji et al., 1996).
That is, if peptides are indeed the primary source of amino acids, then some
amino acids, generated from intracellular peptidases (see later), may accumulate
faster than they can be assimilated. These free amino acids could then diffuse
out of cells down their concentration gradient via the amino acid transporter op-
erating in the reverse or efflux direction. If efflux of an amino acid is accompanied
by a coupling ion (e.g., proton extrusion), then a net increase in the PMF is
obtained. It may even be possible for amino acid efflux to provide enough energy
to drive uptake of peptides (Kunji et al., 1996).
Metabolism of Starter Cultures 225
In contrast to the amino acid transporters, peptide transport is clearly neces-
sary for lactic acid bacteria to grow in milk. Three groups of peptide transport
systems have been identified. Two of these, DtpT and DtpP, transport dipeptides
and tripeptides. DtpT is a large (463 amino acid residues) monomeric, PMF-
dependent transporter that has affinity for hydrophilic peptides. Mutants with a
deletion in the dtpT gene have been obtained and are unable to express DtpT
and transport some peptides. In a defined medium, dtpT mutants grew poorly;
however, growth of these mutants in milk was unaffected, indicating that DtpT
is not essential in milk. DtpP, the other transport system in lactic acid bacteria
that transports dipeptides and tripeptides, is an ATP-dependent transporter that
has high affinity for hydrophobic peptides (Foucaud et al., 1995). It also appears
to be unnecessary for growth of lactococci in milk.
The third and most important peptide transport system in lactic acid bacteria
is the oligopeptide transport system (Opp). Since dipeptides and tripeptides are
not released from casein, neither DtpT nor DtpP is required for growth in milk;
lactococci instead rely on oligopeptides and Opp to satisfy all amino acid require-
ments. Indeed, mutants unable to express genes coding for the Opp system are
unable to transport oligopeptides and are unable to grow in milk (Kunji et al.,
1995; Tynkkynen et al., 1993). Although it was initially not known which oligo-
peptides were actually transported by Opp, many of the structural and genetic
features of the Opp system in Lc. lactis are now well defined (Detmers et al.,
1998). The Opp complex belongs to the ABC (ATP binding casette) family of
transporters and consists of five subunits: two transmembrane proteins (OppB
and OppC), two ATP binding proteins (OppD and OppF), and a membrane-linked
substrate-binding protein (OppA). The five genes coding for Opp are organized as
an operon in the order oppDFBCA. A gene coding for an oligopeptidase (pepO)is
also located immediately downstream of oppA and is cotranscribed with the opp
operon.
The Opp system transports a diverse population of oligopeptides. Although
PrtP releases over 100 peptides from β-casein, only 10–14 peptides apparently
serve as substrates for Opp. All of these oligopeptides contain more than 4 and
fewer than 11 amino acid residues (Kunji et al., 1998). Detailed analysis revealed
that they contain proportionally higher levels of valine, proline, and glutamate
and moderate levels of alanine, leucine, isoleucine, lysine, and serine. Impor-
tantly, these oligopeptides provide all essential amino acids, with the exception
of histidine, needed by lactococci for growth in milk.
C. Peptidases
The third and final step of protein catabolism involves peptidolytic cleavage of
Opp accumulated peptides. Over 20 different peptidases have been identified and
226 Hutkins
characterized, either biochemically and/or genetically, in lactococci and lactoba-
cilli (Table 2). Both endopeptidases (those that cleave internal peptide bonds)
and exopeptidases (those that cleave at terminal peptide bonds) are widely distrib-
uted. Of the latter, only aminopeptidases have been reported; carboxypeptidases
apparently are not produced. In general, concerted efforts of endopeptidases,
aminopeptidases, dipeptidases, and tripeptidases are required fully to utilize pep-
tides accumulated by the Opp system. Although there was once considerable
Table 2 Peptidases from Lactic Acid Bacteria
Peptidase Abbreviation Substrate or specificity
a
Aminopeptidase A PepA Glu/Asp
E
↓
(X)n
Aminopeptidase C PepC X
E
↓
(X)n
Aminopeptidase L PepL Leu
E
↓
X Leu
E
↓
X
E
X
Aminopeptidase N PepN X
E
↓
(X)n
Aminopeptidase P PepP X
E
↓
Pro
E
(X)n
Aminopeptidase X PepX X
E
Pro
E
↓
(X)n
Pyrrolidone carboxylyl
Glu
E
↓
(X)n
peptidase Pcp
Dipeptidase V PepV X
E
↓
X
Dipeptidase D PepD X
E
↓
X
Tripeptidase T PepT X
E
↓
X
E
X
Proiminopeptidase PepI Pro
E
↓
X
E
(X)n
Prolidase PepQ X
E
↓
Pro
Prolinase PepR Pro
E
↓
X
Endopeptidase F PepF (X)n
E
X
E
X
E
↓
X
E
(X)n
Endopeptidase O PepO (X)n
E
X
E
↓
X
E
(X)n
Endopeptidase E PepE (X)n
E
X
E
↓
X
E
(X)n
Endopeptidase G PepG (X)n
E
X
E
↓
X
E
(X)n
a
The positions of the hydrolyzed peptide bonds are shown by arrows.
Metabolism of Starter Cultures 227
debate on the location of these peptidases, it is now well accepted, based on
genetic as well as physical evidence (e.g., lack of signal peptides and anchor
sequences, cell fractionation, and immunogold labeling experiments), that they
are intracellular enzymes. Substrate size and specificity and other properties of
peptidases from lactic acid bacteria have been of considerable interest, not only
because of their physiological importance but also because of the significant role
peptidases play in cheese manufacture and ripening.
1. Endopeptidases
Several endopeptidases have been described, including PepF and PepO in Lc.
lactis (Monnet et al., 1994) and PepE, PepG, and PepO in Lb. helveticus (Chris-
tensen et al, 1999). Most of these endopeptidases are metalloenzymes that contain
sequences typical of zinc-binding domains and hydrolyze oligopeptides of vary-
ing lengths as substrates. It is interesting to note that some endopeptidases (e.g.,
PepF) have pH optima in an alkaline range (7.5–9.0) and that peptidase activity
at pH levels typical of ripened cheese (e.g., H11021 pH 6) are very low. Thus, the
contribution of some of these enzymes either to cell physiology or to cheese
ripening may be minor. In addition, growth of endopeptidase mutants in milk is
not affected (Mierau et al., 1993; Monnet et al., 1994).
2. Dipeptidases and Tripeptidases
Dipeptides and tripeptides that accumulate from the medium or that are formed
from intracellular peptidolytic cleavage of oligopeptides are subsequently hy-
drolyzed by dipeptidases and tripeptidases. Several of these have been purified
and genes have been cloned (see Table 2) (Christensen et al., 1999). Although
these enzymes vary with respect to their biochemical and physical properties, it
appears, based on their substrate specificites, that some dipeptidases and tripepti-
dases serve important functions. Several dipeptidases are also prolinases or proli-
dases and hydrolyze peptides having N- or C-terminal proline residues. For exam-
ple, PepQ from Lc. lactis and PepR from Lb. helveticus hydrolyze the dipeptides
X-Pro and Pro-X, respectively (Boothe et al., 1990; Varmanen et al., 1996). An-
other peptidase that hydrolyzes proline-containing dipeptides and tripeptides has
also been described (Baankries and Exterkate, 1991). The PepT tripeptidase from
lactobacilli has preference for hydrophobic tripeptides (Savijoki and Palva, 2000).
The role of these peptidases in cheese ripening will be discussed later.
3. Aminopeptidases
Aminopeptidases, enzymes that hydrolyze N-terminal peptide bonds and release
N-terminal amino acids, are the most widespread peptidases found in lactic acid
bacteria. Mierau et al. (1997) classified aminopeptidases based on their specific-
228 Hutkins
ity. The ‘‘general’’ or broad-specificity aminopeptidases, PepN and PepC, hy-
drolyze peptides ranging in size from 2 to 12 amino acids, and, in general, have
little activity on proline-containing dipeptides. They are well conserved among
lactococci and lactobacilli.
Because β-casein is proline rich, many of the PrtP–generated oligopeptides
contain proline. As noted above, proline-containing peptides are often poor sub-
strates for general peptidases. ‘‘Specific-task’’ aminopeptidases (e.g., PepA,
PepX, PepP, PepR, and PepI), in contrast, can hydrolyze these proline-containing
peptides. Like other peptidases, these aminopeptidases vary as to substrate size
and specificities. The substrates of PepP from Lc. lactis, for example, are oligo-
peptides containing from 4 to 10 amino acids and having the sequence X-Pro-
Pro-(X)
n
(Mars and Monnet, 1995). In contrast, PepX from Lc. lactis hydrolyzes
similar oligopeptides but in addition can also act on tripeptides, as well as some
non–proline-containing peptides (Mayo et al., 1991). Both the general and spe-
cific aminopeptidases are especially important during cheese manufacture, since
many oligopeptides contribute to bitter-flavored cheese if not degraded. The im-
plications of proline-containing and other bitter peptides in cheese and their effect
on flavor is discussed later.
Although it appears that no single peptidase is essential for cell growth,
inactivation of multiple peptidases clearly is detrimental to growth in milk. Ap-
parently, absence of a particular peptidase that degrades a particular peptide is
not a very serious problem, since alternative peptides and peptidases are readily
available. However, if several peptidases are missing, the rate of peptide hydroly-
sis would be expected to decrease. Indeed, when cells containing multiple muta-
tions in pepO, pepN, pepC, pepT, and pepX were grown in milk, growth rates
were reduced more than 10-fold (Mierau et al., 1996). That mutants reached final
cell densities comparable to that of parent strains suggests that enough essential
amino acids are eventually released by other peptidases.
D. Role of Protein Metabolism in Cheese Manufacture
and Cheese Ripening
Although the PrtP system and components of the peptide transport and hydrolysis
steps are essential for starter culture growth and activity, they also have important
implications during cheese manufacture. Recent identification and characteriza-
tion of many of the genes involved in protein metabolism have made it possible
to construct mutants defective in a single enzymatic or transport activity. Compar-
ing such mutant strains with the isogenic parent has provided a clearer picture
of the role of various proteinase components on cheese properties.
Several studies have established that cheese made with strains deficient in
proteinase activity lack flavor, have poor texture, and otherwise age poorly (Law
et al., 1993). Thus, products of starter culture proteinases, combined with prod-
Metabolism of Starter Cultures 229
ucts of residual coagulant and milk proteases, impart desirable cheese flavor,
either directly or by serving as substrates for additional reactions (Fox and Law,
1991; Urbach, 1995). However, despite the necessary role of PrtP in developing
desirable aged cheese flavor, casein hydrolysis by PrtP also releases several pep-
tides which are bitter. In general, bitter peptides are hydrophobic and their hydro-
lysis requires specific peptidases. Starter culture strains that possess the appro-
priate peptidases necessary to degrade these peptides are often considered as
being ‘‘nonbitter’’ strains, as opposed to ‘‘bitter’’ strains that lack those enzymes
and produce bitter cheese. Several peptidases have been proposed to have de-
bittering activity (Baankreis et al., 1995; Tan et al., 1993). Experiments using
peptidase mutants have provided in vivo evidence for the debittering role of pepti-
dases. Cheese made with PepN or PepX mutants was bitter and had lower organo-
leptic quality (Mierau et al., 1997).
Although it is clear that bitterness, or lack of bitterness, is an important
determinant of cheese flavor and quality, other aspects of protein metabolism
undoubtedly influence the properties of aged cheese. Free amino acids and small
peptides are thought to contribute to ‘‘nutty’’ and ‘‘sweet’’ flavor notes typical
of Swiss, Parmesan, and other cheeses, whereas products of amino acid catabo-
lism are primarily responsible for Cheddar cheese flavor (Fox and Wallace,
1997). Among degradation products formed from amino acids, methanethiol and
other sulfur-containing compounds are considered to be essential in many cheese
varieties, especially those that are surface ripened (Urbach, 1995; Weimer et al.,
1999). Most of these sulfur compounds evolve from methionine and, for Cheddar,
are produced by starter as well as nonstarter bacteria. Catabolism of aromatic
and other amino acids by lactic acid bacteria certainly results in a large number
of volatile compounds, some of which may be desirable, but others may be con-
sidered as flavor defects. However, the specific means by which metabolism of
amino acids occurs and how products of nitrogen metabolism contribute to cheese
flavor and quality await further study.
E. Lactic Acid Bacteria as Flavor Adjuncts
Once it was realized that peptidases from lactic acid bacteria could reduce bitter-
ness and improve cheese flavor, several investigators began to identify suitable
strains and to use them as culture adjuncts in cheese making. Species used as
adjuncts include starter culture strains of Lc. lactis as well as nonstarter strains
of Lb. casei, Lb. helveticus, and Lb. delbrueckii subsp. bulgaricus. In general,
these strains have high peptidase activity. Since addition of such strains to cheese
could also increase acid production, adjunct cultures are often prepared or used
so that actual growth is minimized or prevented, while retaining their enzymatic
activities. For example, using lactose-nonfermenting variants ensures that adjunct
cells will not produce significant acid. Another way to deliver culture adjuncts
230 Hutkins
is to heat- or freeze-shock the cells, treatments that cause cells to lose acid-
forming ability, before addition to milk or curd or to lyse early in the ripening
process. Cell extracts can also be added directly, and commercial products con-
taining peptidase-rich extracts have been developed and are used for accelerated
cheese-ripening programs.
IV. CITRATE METABOLISM
Although rapid fermentation of lactose and production of lactic acid is a primary
requirement for dairy lactic acid bacteria, the ability of selected strains to ferment
citrate and form diacetyl is also an important property in many dairy products.
Diacetyl contributes buttery aroma and flavor attributes in cultured butter, butter-
milk, sour cream, and Gouda and Edam cheeses. Citrate fermentation also results
in formation of CO
2
, which is responsible for eye development in Dutch-style
cheeses. Despite the practical importance of this fermentation, however, only
recently have the key biochemical and metabolic events been defined.
A. Diacetyl Synthesis
Under ordinary conditions, citrate fermentation and diacetyl formation occur only
in those strains of lactic acid bacteria that contain genes coding for transport and
metabolism of citrate. Among the dairy lactic acid bacteria, citrate utilization is
most often associated with Leuconostoc spp. and selected strains of Lactococcus
sp. Accordingly, plasmids containing genes coding for citrate transport have been
found in those strains that ferment citrate (Lo′pez et al., 1998). In Lc. lactis subsp.
lactis biovar diacetylactis, citrate fermentation is linked with an 8-kb plasmid,
whereas in Leuconostoc, citrate genes are associated with plasmids as large as
22 kb. These plasmids contain a cluster of genes that encode citrate permease
(CitP) in Lc. lactis subsp. lactis biovar diacetylactis and CitP and citrate lyase
in Leuc. paramesenteroides (Martin et al., 1999).
How citrate-fermenting lactic acid bacteria actually form diacetyl has been
the subject of considerable debate. Two pathways have been proposed. In both
pathways, citrate is transported by the pH-dependent CitP that has optimum activ-
ity between pH 5 and 6. Transport is mediated by a PMF; however, as described
below, the net bioenergetic effect of citrate metabolism may actually be an in-
crease in the PMF. Intracellular citrate is then cleaved by citrate lyase to form
acetate and oxaloacetate (Fig. 10). Although acetate is ordinarily released into
the medium, oxaloacetate is decarboxylated to pyruvate by oxaloacetate decar-
boxylase. Importantly, the evolved CO
2
can cause eye formation in some cheeses.
Although lactic acid bacteria could conceivably reduce all excess pyruvate to
Metabolism of Starter Cultures 231
Figure 10 Citrate fermentation pathway in lactic acid bacteria. The dashed line indicates
the nonenzymatic, oxidative decarboxylation reaction.
lactate via lactate dehydrogenase, this does not normally occur. This is because
pyruvate reduction requires NADH, which is made during glycolysis, but which
is not formed in the citrate fermentation pathway. Using NADH to reduce citrate-
generated pyruvate would quickly deprive cells of the NADH pool necessary to
reduce pyruvate produced during glycolysis. Instead, excess pyruvate is decar-
boxylated by pyruvate decarboxylase in a thiamine pyrophosphate (TPP)–depen-
dent reaction, and acetaldehyde-TPP is formed. Some researchers have proposed
that an enzyme (diacetyl synthase) is responsible for converting acetaldehyde-
TPP (in the presence of acetyl-CoA) directly to diacetyl. However, no evidence
for the presence of diacetyl synthase currently exists. Instead, the accepted alter-
native pathway for diacetyl synthesis involves first a condensation reaction of
acetaldehyde-TPP and pyruvate catalyzed by α-acetolactate synthase. This en-
zyme apparently has a low affinity for pyruvate in Lc. lactis subsp. lactis biovar
diacetylactis (Km H11005 50 mM); thus high concentrations of pyruvate are necessary
to drive this reaction (Snoep et al., 1992). The product, α-acetolactate, is unstable
in the presence of oxygen and is next nonenzymatically decarboxylated to form
diacetyl. This oxidative decarboxylation pathway is now supported by substantial
biochemical, genetic, and nuclear magnetic resource evidence.
232 Hutkins
Figure 11 Citrate transport in lactic acid bacteria. Citrate is transported via CitP and
lysed to form oxaloacetate. Decarboxylation of the latter consumes a proton and forms
pyruvate, which can be converted to diacetyl (dashed line). Lactate formed via sugar me-
tabolism (or from citrate) is effluxed in exchange for citrate.
Although utilization of citrate by lactic acid bacteria requires several enzy-
matic steps, it appears that citrate fermentation provides cells with no obvious
benefits, as ATP-generating reactions are absent in this pathway and citrate con-
sumption results only in excretion of organic endproducts and CO
2
. Why then
do cells ferment citrate? As noted earlier, the driving force for transport of citrate
is the PMF, with divalent citrate transported in symport with a single proton (Fig.
11). However, during the oxaloacetate decarboxylation reaction, a cytoplasmic
proton is consumed, resulting in an increase in the cytoplasmic pH and an increase
in the ?pH component of the PMF. In addition, when citrate-utilizing bacteria
are grown in the presence of a fermentable sugar and lactate is produced, efflux
of monovalent (anionic) lactate can drive uptake of divalent (anionic) citrate.
Thus, CitP acts as a electrogenic precursor-product exchanger, with a net increase
in the ?ψ or electrical component of the PMF. Both of these mechanisms (electro-
genic exchange and decarboxylation), therefore, result in an increase in the meta-
bolic energy available to the cell (Bandell et al., 1998).
B. Enhancing Diacetyl Formation in Dairy Products
Even among citrate-fermenting lactic acid bacteria, the amount of diacetyl formed
in dairy products is relatively low (H110212 mg/L), and there is much interest in ma-
nipulating growth conditions and cultures in an effort to enhance diacetyl produc-
tion in cheese and cultured milk products. Because citrate transport via CitP re-
Metabolism of Starter Cultures 233
quires low pH (see above), citrate-fermenting strains are usually combined with
acid-producing strains during manufacture of cultured dairy products. Oxygen
can also stimulate diacetyl formation by as much as 30-fold (Boumerdassi et
al., 1996). Presumably, high atmospheric oxygen can reduce activity of lactate
dehydrogenase and accelerate the oxidative decarboxylation reaction responsible
for diacetyl synthesis. In addition, oxygen can oxidize NADH, thereby slowing
the rate at which diacetyl is reduced to acetoin or 2,3-butanediol (see Fig. 10).
Another strategy considered for enhancing diacetyl formation involves genetic
modification of the cultures. Several metabolic steps have been identified at which
mutations or blocks will lead to increased production of diacetyl. Inactivation of
lactate dehydrogenase, for example, results in excess pyruvate, and such cells
could theoretically produce more diacetyl than wild-type cells (even non–citrate-
fermenting lactococci have been genetically manipulated to produce diacetyl).
Enhanced expression of plasmid-borne copies of genes coding for α-acetolactate
synthase or NADH oxidase in Lc. lactis also enhances diacetyl formation by
increasing the concentration of α-acetolactate available for oxidative decarboxyl-
ation (Benson et al. 1996; de Felipe et al., 1998). Similarly, inactivation of the
gene coding for α-acetolactate decarboxylase, the enzyme that forms acetoin di-
rectly from α-acetolactate, also results in an increase in diacetyl production (Mon-
net et al., 1997; Swindell et al., 1996).
V. METABOLISM OF PROPIONIBACTERIA
Although not a lactic acid bacterium, Propionibacterium freudenreichii subsp.
shermanii is an important part of the thermophilic starter culture used to manufac-
ture Swiss-type cheeses. This organism is not only responsible for producing CO
2
that leads to eye or hole formation, but it also produces other compounds, includ-
ing amino acids and their degradation products, that contribute to the characteris-
tic flavor of these cheeses (Gagnaire et al., 1999).
During Swiss cheese manufacture, growth of Pro. freudenreichii subsp.
shermanii does not occur until the primary lactic fermentation is completed and
cheese is moved into a ‘‘warm room’’ held at 20–25°C. Although propionibac-
teria can ferment lactose, essentially none is available at this time and instead
lactate is the primary energy source for their growth in cheese. Fermentation of
lactate yields propionate, acetate, and CO
2
, with a theoretical molar ratio as:
3 lactate → 2 propionate H11001 1 acetate H11001 1CO
2
In cheese, the actual amount of CO
2
may vary either as a result of condensation
reactions, cometabolism with amino acids, or strain variation. The propionate
pathway consists of many reactions, and it requires several metal-containing en-
234 Hutkins
Figure 12 The propionate pathway of propionibacteria. Only the key intermediate com-
pounds are shown. A more complete description of the enzymes and cofactors is given
by Piveteau, 1999.
zymes and vitamin cofactors (Fig. 12). Enzymes of the citric acid cycle are also
required. One mole of ATP is generated per mole of lactate consumed.
Although proteolysis of casein by Pro. shermanii is limited because of low
proteinase activity, it does produce several peptidases (Gagnaire et al., 1999;
Langsrud et al., 1995). These peptidases are located intracellularly, and their sub-
strates are the peptides released by starter culture proteinases and residual milk
and coagulant proteinases. Although no information on peptide transport systems
in propionibacteria is currently available, there is evidence that some peptidases
could be released via autolysis (?stlie et al., 1995). Several peptidases have activ-
ity on proline-containing peptides, accounting for high levels of proline that accu-
mulate in Swiss-type cheeses. In addition, metabolism of the amino acids alanine
and aspartate may contribute to CO
2
production (Langsrud et al., 1995).
VI. METABOLISM OF MOLDS AND OTHER
FLAVOR-CONTRIBUTING MICROORGANISMS
Despite their importance in several cheese types, much less is known about the
metabolism of Penicilium spp. and brevibacteria used to make mold-ripened and
surface-ripened cheeses. These organisms are not really starter cultures, since
they do not contribute to acid development, but they are just as integral to the
cheese making process as are the lactic starter cultures. Accordingly, their main
role in cheese manufacture is to produce flavors and cause desirable changes in
texture and appearance of the finished cheese (also see Chaps. 6 and 11).
Metabolism of Starter Cultures 235
A. Penicillium roqueforti
The mold responsible for the well-known blue-veined appearance of Roquefort,
Gorgonzola, and other blue cheese types is P. roqueforti. Although spores of P.
roqueforti are added to milk or curds before the lactic fermentation, mold growth
does not occur until after the lactic culture has fermented all or most of the
available lactose to lactic acid. Lactic acid serves as an energy source for the
mold. Importantly, consumption of lactic acid causes the pH to rise from about
4.6 to as high as 6.2 (Marth and Yousef, 1991). As P. roqueforti grows in cheese,
substantial proteolysis occurs through elaboration of several extracellular protein-
ases, endopeptidases, and exopeptidases. Amino acids can be subsequently me-
tabolized releasing amines, ammonia, and other possible flavor compounds (that
also may raise the pH). However, the most characteristic blue cheese flavors are
generated from lipid metabolism (Gripon, 1987). As much as 20% of triglycerides
in milk are hydrolyzed by lipases produced by P. roqueforti. Although free vola-
tile fatty acids may themselves contribute to cheese flavor, their metabolism, via
β-oxidation pathways, results in formation of a variety of methylketones. It is
this class of compounds that is responsible for the flavor of blue cheese.
B. P. camemberti
Just as in blue-veined cheeses, growth of P. camemberti in the manufacture of
Camembert and Brie cheeses occurs as a secondary fermentation, and again, lactic
acid is used as an energy source. The subsequent rise in pH (from 4.6 to as high
as pH 7.0 at the surface) because of lactate consumption and ammonia production
provides opportunities for other organisms to grow, and the surface microflora
of Camembert cheese can be quite diverse. The proteinases and peptidases pro-
duced by P. camemberti are similar to those produced by P. roqueforti (Gripon,
1987). Although P. roqueforti grows throughout the cheese mass (because of
deliberate aeration during cheese making), growth of P. camemberti is confined
to the surface; therefore, protein breakdown in the interior of cheese is dependent
on diffusion of excreted enzymes. Production of ammonia, methanethiol, and
other sulfur compounds, presumably derived from amino acids, are also charac-
teristic of Camembert cheese. Lipolysis of triglycerides and fatty acid metabolism
by P. camemberti are just as important in surface-ripened cheese as in blue-
veined cheese, and methylketones are abundant (Gripon, 1987).
C. Brevibacterium linens
Although B. linens is primarily used in the manufacture of Muenster, brick, and
other surface-ripened cheeses, its potential use as a flavor adjunct has led to re-
236 Hutkins
newed interest in the metabolism of this organism (Rattray and Fox, 1999). Most
attention has focused on proteinases and peptidases produced by B. linens and
subsequent formation of volatile flavor compounds from amino acid metabolism.
Unlike lactic acid bacteria that produce a single proteinase (PrtP), B. linens pro-
duces several extracellular and intracellular proteinases and peptidases. Metabo-
lism of released amino acids results in formation of many sulfur-containing com-
pounds, including hydrogen sulfide, methanethiol, and other volatile flavors that
are characteristic not only of surface-ripened cheese but which are also important
in Cheddar cheese. The ability of B. linens to produce these flavor compounds,
along with a high level of proteolytic activity, have led to the use of this organism
as a flavor adjunct in Cheddar-type cheeses (Weimer et al., 1999).
VII. METABOLIC ENGINEERING
Considerable information currently exists on many of the important genes and
metabolic pathways that influence how lactic acid bacteria grow in yogurt,
cheese, and other dairy products. Recently, the genome sequence of Lc. lactis
was reported (Bolotin et al., 1999), and the genome sequence of Lb. acidophilus
is expected to be completed soon. Efforts to use this information to improve or
modify properties of lactic acid bacteria have already begun and are certain to
be accelerated (Hugenholtz and Kleerebezem, 1999). As described earlier in this
chapter, metabolic engineering could be used in several ways to improve dairy
fermentations. Diverting pyruvate from lactate to the flavor compound diacetyl
can be accomplished by genetically disrupting genes coding for lactate dehydro-
genase or α-acetolactate decarboxylase. Similarly, cheese ripening can be accel-
erated by either increasing expression of genes involved in proteolysis or by
induced expression of genes coding for lytic enzymes (de Ruyter et al., 1998;
McGarry et al., 1994). Increased synthesis of an exopolysaccharide by Lc. lactis
subsp. cremoris was achieved by overexpressing the gene coding for fructose-
bisphosphatase, an enzyme that makes more precursors available for polysaccha-
ride synthesis (Looijesteijn et al., 1999). Finally, efforts are underway in several
laboratories to engineer S. thermophilus so that galactose is fermented rather than
released back into the curd or cheese.
REFERENCES
Baankries R, Exterkate FA. Characterisation of a peptidase from Lactococcus lactis subsp.
cremoris HP that hydrolyzes di- and tripeptides containing proline or hydrophobic
residues as the aminoterminal amino acid. System Appl Microbiol 14:317, 1991.
Baankreis R, van Schalkwijk S, Alting AC, Exterkate FA. The occurrence of two intracel-
Metabolism of Starter Cultures 237
lular oligoendopeptidases in Lactococcus lactis and their significance for peptide
conversion in cheese. Appl Microbiol Biotechnol 44:386, 1995.
Bandell M, Lhotte ME, Marty-Teysset C, Veyrat A, Pre′vost H, Dartois V, Divie`s C, Kon-
ings WN, Lolkema JS. Mechanisms of the citrate transporters in carbohydrate and
citrate cometabolism in Lactococcus and Leuconostoc species. Appl Environ Micro-
biol 64:1594, 1998.
Benateya A, Bracquart P, Linden G. Galactose-fermenting mutants of Streptoccous ther-
mophilus. Can J Microbiol 37:136, 1991.
Benson KH, Godon, J-J, Renault P, Griffin HG, Gasson MJ. Effect of invBN-encoded α-
acetolactate synthase expression on diacetyl production in Lactococcus lactis. Appl
Microbiol Biotechnol 45:107, 1996.
Bolotin A, Mauger S, Malarme K, Ehrlich SD, Sorokin A. Low-redundancy sequencing
of the entire Lactococcus lactis IL 1403 genome. Antonie van Leeuwenhoek 76:
27, 1999.
Boothe M, Jennings PV, Fhaolain IN, O’Quinn G. Prolidase activity of Lactococcus lactis
subsp. cremoris AM2: partial purification and characterization. J Dairy Sci 57:245,
1990.
Boumerdassi H, Desmazeaud M, Monnet C, Boquien CY, Corrieu G. Improvement of
diacetyl production by Lactococcus lactis subsp. lactis CNRZ 483 through oxygen
control. J Dairy Sci 79:775, 1996.
Christensen JE, Dudley EG, Pederson JA, Steele JL. Peptidases and amino acid catabolism
in lactic acid bacteria. Antonie van Leeuwenhoek 76:217, 1999.
Cocaign-Bousquet M, Garrigues C, Loubiere P, Lindley NC. Physiology of pyruvate me-
tabolism in Lactococcus lactis. Antonie van Leeuwenhoek 70:253, 1996.
Detmers FJM, Kunji ERS, Lanfermeijer FC, Poolman B, Konings WN. Kinetics and speci-
ficity of peptide uptake by the oligopeptide transport system of Lactococcus lactis.
Biochemistry 37:16671, 1998.
de Felipe FL, Kleerebezem M, de Vos WM, Hugenholtz J. Cofactor engineering: a novel
approach to metabolic engineering in Lactococcus lactis by controlled expression
of NADH oxidase. J Bacteriol 180:3804, 1998.
de Ruyter PGGA, Kuipers OP, Meijer WC, de Vos VM. Food-grade controlled lysis of
Lactococcus lactis for accelerated cheese ripening. Nat Biotechnol 15:976, 1998.
de Vos, WM. Metabolic engineering of sugar catabolism in lactic acid bacteria. Antonie
van Leeuwenhoek 70:223, 1996.
de Vos WM, Boerrigter IJ, van Rooyen RJ, Reiche B, Hengstenberg W. Characterization
of the lactose-specific enzymes of the phosphotransferase system in Lactococcus
lactis. J Biol Chem 265:22554, 1990.
Foucaud C, Kunji ERS, Hagting A, Richard J, Konings WN, Desmazeaud M, Poolman
B. Specificity of peptide transport systems in Lactococcus lactis: evidence for a
third system which transports hydrophobic di- and tripeptides. J Bacteriol 177:4652,
1995.
Fox PF, Law J. Enzymology of cheese ripening. Food Biotechnol 5:239, 1991.
Fox PF, Wallace JM. Formation of flavor compounds in cheese. Adv Appl Microbiol 45:
17, 1997.
Gagnaire V, Molle′ D, S?rhaug T, Le′onil J. Peptidases of dairy propionic acid bacteria.
Lait 79:43, 1999.
238 Hutkins
Garrigues C, Loubiere P, Lindley NC, Cocaign-Bousquet M. Control of shift from homo-
lactic acid to mixed-acid fermentation in Lactococcus lactis: predominant role of
the NADH/NAD
H11001
ratio. J Bacteriol 179:5282, 1997.
Gosalbes MJ, Monedero V, Alpert C.-A., Pe′rez-Mart?′nez G. Establishing a model to study
the regulation of the lactose operon in Lactobacillus casei. FEMS Microbiol Lett
148:83, 1997.
Gosalbes MJ, Monedero V, Pe′rez-Mart?′nez G. Elements involved in catabolite repression
and substrate induction of the lactose operon in Lactobacillus casei. J Bacteriol
181:3928, 1999.
Gripon JC. Mould-ripened cheeses. In: Fox PF, ed. Cheese: Chemistry, Physics and Micro-
biology. Vol 2. Major Cheese Varieties. London: Elsevier, 1987, p 121.
Grossiord B, Vaughan EE, Luesink E, de Vos WM. Genetics of galactose utilisation via
the Leloir pathway in lactic acid bacteria. Lait 78:77, 1998.
Hugenholtz J, Kleerebezem M. Metabolic engineering of lactic acid bacteria: overview
of the approaches and results of pathway rerouting involved in food fermentations.
Curr Opinion Biotechnol 10:492, 1999.
Hutkins RW, Ponne C. Lactose uptake driven by galactose efflux in Streptococcus ther-
mophilus: evidence for a galactose-lactose antiporter. Appl Environ Microbiol 57:
941, 1991.
Juillard V, Laan H, Kunji ERS, Jeronimus-Stratingh CM, Bruins AP, Konings WN. The
extracellular P-type proteinase of Lactococcus lactis hydrolyzes β-casein into more
than one hundred different olipeptides. J Bacteriol 177:3472, 1995.
Kunji ERS, Hagting A, de Vried CJ, Juillard V, Haandrikman AJ, Poolman B, Konings
WN. Transport of β-casein–derived peptides by the oligopeptide transport system
is a crucial step in the proteolytic pathway of Lactococcus lactis. J Biol Chem 270:
1569, 1995.
Kunji ERS, Mierau I, Hagting A, Poolman B, Konings WN. The proteolytic systems of
lactic acid bacteria. Antonie van Leeuwenhoek 70:187, 1996.
Kunji ERS, Fang G, Jeronimus-Stratingh CM, Bruins AP, Poolman B, Konings WN. Re-
construction of the proteolytic pathway for use of β-casein by Lactococcus lactis.
Mol Microbiol 27:1107, 1998.
Langsrud T, S?rhaug T, Vegarud GE. Protein degradation and amino acid metabolism by
propionibacteria. Lait 75:325, 1995.
Law J, Fitzgerald GF, Uniacke-Lowe T, Daly C, Fox PF. The contribution of lactococcal
starter proteinases to proteolysis in Cheddar cheese. J Dairy Sci 76:2455, 1993.
Looijesteijn PJ, Boels IC, Kleerebezem M, Hugenholtz J. Regulation of exopolysaccharide
production by Lactococcus lactis subsp. cremoris by the sugar source. Appl Environ
Microbiol 65:5003, 1999.
Lo′pez P, Drider D, Garc?′a-Quintans N, Corrales MA, Magni C, Mart?′n M, de Mendoza D.
Regulation of expression of the Lactococcus lactis subsp. lactis biovar diacetylactis
citrate transport system. Lait 78:11, 1998.
Luesink EJ, Kuipers OP, de Vos WM. Regulation of the carbohydrate metabolism in Lac-
tococcus lactis and other lactic acid bacteria. Lait 78:69, 1998a.
Luesink EJ, van Herpen REMA, Grossiord BP, Kuipers OP, de Vos WM. Transcriptional
activation of the glycolytic las operon and catabolite repression of the gal operon
Metabolism of Starter Cultures 239
in Lactococcus lactis are mediated by the catabolite control protein CcpA. Mol
Microbiol 30:789, 1998b.
Luesink EJ, Beumer CM, Kuipers OP, de Vos WM. Molecular characterization of the
Lactococcus lactis ptsHl operon and analysis of the regulatory role of HPr. J Bacte-
riol 181:764, 1999.
Mars I, Monnett V. An aminopeptidase P from Lactococcus lactis with original specificity.
Biochim Biophys Acta 1243:209, 1995.
Marth EH, Yousef AE. Fungi and dairy products. In: Arora DK, Mukerji KG, Marth EH,
eds. Handbook of Applied Mycology. Vol 3. Foods and Feeds. New York: Marcel
Dekker, 1991, p 375.
Martin M, Corrales MA, de Mendoza D, Lo′pez P, Magni C. Cloning and molecular charac-
terization of the citrate utilization citMCDEFGRP cluster of Leuconostoc parames-
enteroides. FEMS Microbiol Lett 174:231, 1999.
Mayo B, Kok J, Venema K, Bockelman W, Teuber M, Reinke H, Venema G. Molecular
cloning and sequence analysis of the X-propyl dipeptidyl aminopeptidase gene from
Lactococcus lactis susp. cremoris. Appl Environ Microbiol 57:38, 1991.
McGarry A, Law J, Coffey A, Daly C, Fox PF, Fitzgerald GF. Effect of genetically modi-
fying the lactococcal proteolytic system on ripening and flavor development in
Cheddar cheese. Appl Environ Microbiol 60:4226, 1994.
McKay LL, Baldwin KA. Simultaneous loss of proteinase- and lactose-utilizing enzyme
activities in Streptococcus lactis and reversal by transduction. Appl Microbiol 28:
342, 1974.
McKay LL, Walter RA, Sandine WE, Elliker PR. Involvement of phosphoenolpyruvate
in lactose utilization by group N streptococci. J Bacteriol 99:603, 1969.
Mierau I, Tan PST, Haandrikman AJ, Kok J, Leenhouts KJ, Konings WN, Venema G.
Cloning and sequencing of the gene for a lactococcal endopeptidase, an enzyme
with sequence similarity to mammalian enkephalinase. J Bacteriol 175:2087, 1993.
Mierau I, Kunji ERS, Leenhouts KJ, Hellendoorn MA, Haandrikman AJ, Poolman B,
Konings WN, Venema G, Kok J. Multiple peptidase mutants of Lactococcus lactis
are severely impaired in their ability to grow in milk. J Bacteriol 178:2794, 1996.
Mierau I, Kunji ERS, Venema G, Kok J. Casein and peptide degradation in lactic acid
bacteria. Biotechnol Genet Eng Rev 14:279, 1997.
Monnet C, Schmitt P, Divie`s C. Development and use of a screening procedure for produc-
tion of α-acetolactate by Lactococcus lactis subsp. lactis biovar diacetylactis
strains. Appl Environ Microbiol 63:793, 1997.
Monnet V, Nardi M, Chopin A, Chopin M.-C., Gripon J.-C. Biochemical and genetic
characterization of PepF, an oligopeptidase from Lactococcus lactis. J Biol Chem
269:32070, 1994.
Mustapha A, Hutkins RW, Zirnstein GW. Cloning and characterization of the galactoki-
nase gene from Streptococcus thermophilus. J Dairy Sci 78:989, 1995.
?stlie H, Floberhagen V, Reinbold G, Hammond EG, Vegarud G, Langsrud T. Autolysis
of dairy propionibacteria: growth studies, peptidase activities, and proline produc-
tion. J Dairy Sci 78:1224, 1995.
Piveteau P. Metabolism of lactate and sugars by dairy propionibacteria: a review. Lait 79:
23, 1999.
240 Hutkins
Poolman B, Royer TJ, Mainzer SE, Schmidt BF. Lactose transport system of Streptococcus
thermophilus: a hybrid protein with homology to the melibiose carrier and enzyme
III of phosphoenolpyruvate-dependent phosphotransferase systems. J Bacteriol 171:
244, 1989.
Poolman B, Royer TJ, Mainzer SE, Schmidt BF. Carbohydrate utilization in Streptococcus
thermophilus: characterization of the genes for aldose 1-epimerase (mutarotase) and
UDPglucose 4-epimerase. J Bacteriol 172:4037, 1990.
Rattray FP, Fox PF. Aspects of enzymology and biochemical properties of Brevibacterium
linens relevant to cheese ripening: a review. J Dairy Sci 82:891, 1999.
Saier MH Jr, Chauvaux S, Deutscher J, Reizer J, Ye J-J. Protein phosphorylation and
regulation of carbon metabolism in gram-negative versus gram-positive bacteria.
Trends Biochem Sci 20:267, 1995.
Savijoki K, Palva A. Purification and molecular characterization of a tripeptidase (PepT)
from Lactobacillus helveticus. Appl Environ Microbiol 66:794, 2000.
Snoep JL, Teixeira de Mattos TMJ, Starrenburg MJC, Hugenholtz J. Isolation, character-
ization, and physiological role of pyruvate dehydrogenase complex and α-acetolac-
tate synthase of Lactococcus lactis subsp. lactis bv. diacetylactis. J Bacteriol 174:
4838, 1992.
Steele JL. Genetics and metabolism of starter cultures. In: Marth EH, Steele JL, eds. Ap-
plied Dairy Microbiology. New York: Marcel Dekker, 1998, p 173.
Swindell SR, Benson KH, Griffin HG, Renault P, Ehrlich SD, Gasson MJ. Genetic manip-
ulation of the pathway for diacetyl metabolism in Lactococcus lactis. Appl Environ
Microbiol 62:2641, 1996.
Tan PST, van Kessel TAJM, van de Veerdonk FLM, Zuurendonk PF, Bruins AP, Konings
WN. Degradation and debittering of a tryptic digest from β-casein by aminopepti-
dase N from Lactococcus lactis subsp. cremoris WG2. Appl Environ Microbiol 59:
1430, 1993.
Thomas TD, Crow VL. Selection of galactose-fermenting Streptococcus thermophilus in
lactose-limited chemostat cultures. Appl Environ Microbiol 48:186, 1994.
Thompson J. Regulation of sugar transport and metabolism in lactic acid bacteria. FEMS
Microbiol Rev 46:221, 1987.
Thompson J, Chassy BM. Intracellular hexose-6-phosphohydrolase from Streptococcus
lactis: purification, properties, and function. J Bacteriol 156:70, 1983.
Tynkkynen S, Buist G, Kunji E, Kok J, Poolman B, Venema G, Haandrikman. Genetic
and biochemical characterization of the oligopeptide transport system of Lactococ-
cus lactis. J Bacteriol 175:7523, 1993.
Urbach G. Contribution of lactic acid bacteria to flavour compound formation in dairy
products. Int Dairy J 5:877, 1995.
van Rooijen RJ, de Vos WM. Molecular cloning, transcriptional analysis, and nucleotide
sequence of lacR, a gene encoding the repressor of the lactose phosphoransferase
system of Lactococcus lactis. J Biol Chem 265:18499, 1990.
Varmanen P, Steele JL, Palva A. Characterization of a prolinase gene and its product,
and an adjacent ABC transporter gene from Lactobacillus helveticus. Microbiology
142:809, 1996.
Weimer B, Seefeldt K, Dias B. Sulfur metabolism in bacteria associated with cheese.
Antonie van Leeuwenhoek 76:247, 1999.
Metabolism of Starter Cultures 241
Yan T-R, Azuma N, Kaminogawa S, and Yamauchi K. Purification and characterization
of a novel metallopeptidase from Streptococcus cremoris H61. Eur J Biochem 163:
259, 1987.
Ye JJ, Saier MH Jr. Purification and characterization of a small membrane-associated
sugar-phosphate phosphatase that is allosterically activated by HPr(Ser(P)) of the
phosphotransferase system in Lactococcus lactis. J Biol Chem 270:16740, 1995a.
Ye JJ, Saier MH Jr. Cooperative binding of lactose and the phosphorylated phosphocarrier
protein HPr(Ser-P) to the lactose/H
H11001
symport permease of Lactobacillus brevis.
Proc Natl Acad Sci 92:417, 1995b.
Ye JJ, Reizer J, Cui X, Saier MH Jr. Inhibition of the phosphoenolpyruvate:lactose phos-
photransferase system and activation of a cytoplasmic sugar-phosphate phosphatase
in Lactococcus lactis by ATP-dependent metabolite-activated phosphorylation of
serine 46 in the phosphocarrier protein HPr. J Biol Chem 269:11837, 1994.
8
Genetics of Lactic Acid Bacteria
Jeffery R. Broadbent
Utah State University
Logan, Utah
I. INTRODUCTION
Human civilizations throughout history have placed great practical and economic
value on methodologies to improve keeping qualities of foods. One of the most
ancient of these practices involves fermentation by lactic acid bacteria (LAB)
that are indigenous to raw milk, meat, vegetables, and cereal grains. The LAB are
a diverse group of gram-positive (gram
H11001
) cocci, coccobacilli, and bacilli whose
defining characteristics are that they (1) have a low (H1102155 mol%) G H11001 C content;
(2) are acid tolerant; (3) are nonsporing; (4) are nutritionally fastidious; (5) are
aerotolerant but not aerobic; (6) are unable to synthesize porphyrins; and (7)
have a strictly fermentative metabolism with lactic acid as the major metabolic
endproduct.
The taxonomy of LAB is an active area of research, and several additions
and refinements have been made in recent years. Among them are annexation of
several new genera that satisfy the phylogenetic and physiological definition of
a lactic acid bacterium (e.g., Aerococcus, Alloiococcus, Atopobium, Dolosigranu-
lum, Eremococcus, Gemella, Globicatella, Lactosphaera, Melissococcus, and
Vagococcus) (Axelsson, 1998; Collins et al., 1999; Vandamme et al., 1996), but
which do not hold any important food fermentation species. The LAB that do
have a significant role in food fermentation include Carnobacterium, Enterococ-
cus (En.), Lactobacillus (Lb.), Lactococcus (Lc.), Leuconostoc (Leuc.), Oenococ-
cus, Pediococcus, Streptococcus, Tetragenococcus, and Weissella. Discussions
in this chapter will primarily address genetics of Lactobacillus, Lactococcus,
Leuconostoc, and Streptococcus, because these genera include starter (and non-
243
244 Broadbent
starter) bacteria that are most important to the dairy fermentation industry. How-
ever, species of Carnobacterium, Enterococcus, Pediococcus, and even Aerococ-
cus have been isolated from adventitious populations of LAB in ripening cheese
(Bhowmik and Marth, 1990; Morea et al., 1999), and genes from these and other
LAB may be of interest to the dairy industry. As a result, knowledge gleaned
from genetic studies of these and other nondairy LAB will be noted where it
helps to provide clarity and depth to our view of genetics in dairy LAB. Because
the scope of this chapter limits the degree to which individual topics can be
addressed, readers seeking more detailed discussions of the genetics and microbi-
ology of food-grade LAB are referred to the works of Gasson and De Vos (1994)
and Salminen and von Wright (1998).
A. Why Study the Genetics of Dairy Lactic Acid Bacteria?
Because LAB are common constituents of the raw milk microbiota, it is likely
that fermented milk foods have been part of the human diet since milk was first
collected in containers. Over the centuries, these inadvertent fermentations were
slowly shaped into the more than 1000 unique cheeses, yogurts, and fermented
milks that are available today. Because these products evolved well before the
emergence of microbiological science, their manufacturing processes all relied
upon spontaneous acidification of milk (caused, of course, by endogenous LAB).
It was not until discovery of the lactic acid fermentation by Pasteur in 1857, and
development of pure LAB dairy starter cultures later that century, that the door
to industrialized milk fermentations was opened. Since that time, the economic
value of fermented milk foods, and especially cheese, has experienced dramatic
and sustained growth. Cheese production in the United States alone, for example,
has increased more than 200% in the last quarter century, and total worldwide
production now equals approximately 13 million tons per year (IDF, 1994, 1999).
To sustain such a high level of productivity and diversity, the dairy industry
has become a leader in starter microbiology and fermentation technology. Experi-
ence has proved that industrial production of uniform, high-quality fermented
milk foods is facilitated by use of well-characterized starter bacteria. Thus, even
though a number of traditional milk fermentations still rely on natural souring
of raw milk, virtually all industrialized processes employ starter cultures. Because
the economic vitality of this industry depends to a very large degree on starter
cultures with known, predictable, and stable characteristics, great resources and
efforts have been directed toward understanding the physiology and genetics of
dairy LAB. The knowledge base that has been built from that work can and has
been used genetically to effect precise refinements in metabolic attributes of dairy
starter cultures. With literally hundreds of industrial and academic laboratories
now devoting resources to LAB physiology and genetics research, it is clear that
molecular-genetic strain improvement strategies will play an important role in
Genetics of Lactic Acid Bacteria 245
tomorrow’s dairy industry. Research during the last quarter century focused pri-
marily on cellular biochemistry and development of genetics tools, with limited
application in key areas such as bacteriophage resistance. Work in the coming
decades should see widespread application of this knowledge in ways that will
improve product quality and consistency, promote consumer health and well-
being, reduce manufacturing losses and safety concerns, and further expand the
diversity of fermented dairy products in the market place.
II. GENETIC ELEMENTS
Because of its singular economic importance as the starter bacterium for indus-
trial production of Cheddar and Gouda cheeses, and the relative ease by which
it can be handled in the laboratory, much of our current understanding of genetics
in dairy LAB has come from study of Lc. lactis subsp. lactis and Lc. lactis subsp.
cremoris (henceforth jointly described as Lc. lactis). A third subspecies, Lc. lactis
subsp. hordniae, is not used as a dairy starter and will not be considered further.
In this section, we will examine four types of genetic elements that have been
characterized at the nucleotide sequence level in Lc. lactis and, to a lesser extent,
other dairy LAB. They include plasmid DNA, transposable elements, bacterio-
phages and, most impressively, the bacterial chromosome.
A. Plasmid DNA
Plasmids are extrachromosomal, autonomously replicating DNA molecules that
exist independently of the bacterial chromosome. Molecular and genetic studies
of bacterial plasmids have yielded extraordinary insight into cellular mechanisms
for DNA replication, gene transfer, gene expression, and genetic recombination.
Plasmids have also played an integral role in development and evolution of re-
combinant DNA technologies for many organisms, including dairy LAB.
Most plasmids are covalently closed circular molecules, but linear plasmids
have been reported in several eubacteria including one species of LAB, Lb. gas-
seri (Davidson et al., 1996; Meinhardt et al., 1997). The number of copies at
which a particular plasmid species exists within a bacterium (i.e., its copy num-
ber) varies widely and can range from as few as one or two to tens or even
hundreds of molecules (Actis et al., 1999; Clewell, 1981). Under most conditions,
plasmid-coded functions are not essential to host survival (exceptions involve
properties such as antibiotic resistance that confer a selective advantage under
specific environmental conditions), but they may allow the cell to compete better
with other microorganisms that share their ecological niche. Therefore, if a
daughter cell loses a particular plasmid species through plasmid replication or
segregation errors, it will usually continue to grow and may even predominate
246 Broadbent
over its wild-type population. Loss of the plasmid will, however, result in perma-
nent loss of any trait encoded by that plasmid.
The first reports of plasmid DNA in LAB were published in the early 1970s
by researchers working with En. faecalis and S. mutans (Clewell, 1981). Among
food-grade LAB, it was the long-standing observation that many Lc. lactis dairy
starters permanently lost their acid- or flavor-producing phenotypes (and the
fact that the frequency of these events was increased under plasmid curing con-
ditions) that served to stimulate the first inquiries into the plasmid biology of
these organisms (McKay, 1983). We now recognize that lactococci are an espe-
cially fertile source of plasmid DNA, and that genes for many of this bacterium’s
industrially important traits are encoded by plasmids. The latter discovery en-
livened worldwide interest in LAB plasmid biology and genetics, and we now
know that plasmid DNA is a frequent component of the genome in leuconostocs,
oenococci, pediococci, and some lactobacilli. Plasmids have also been identified
less frequently in other food-grade LAB, including Carnobacterium, S. ther-
mophilus, Tetragenococcus, and Weissella (Benachour et al., 1997; Brito and
Paveia, 1999; Davidson et al., 1996; Martin et al., 1999). The rich diversity of
plasmid species in LAB is fortuitous, because it provides a ready source of extra-
chromosomal replicons to support development of gene-cloning vectors (De Vos
and Simons, 1994; von Wright and Sibakov, 1998; Wang and Lee, 1997). In
addition, although most of these plasmids are cryptic, several interesting and
useful phenotypic properties have been linked to plasmid DNA in food-grade
LAB (Table 1).
1. Plasmid Replication
The segregational and structural stability of extrachromosomal DNA can be in-
fluenced by the mode of plasmid replication (Biet et al., 1999; Gruss and Ehrlich,
1989; Kiewiet et al., 1993; Lee et al., 1998), and the industrial significance of
plasmid DNA in LAB warrants attention to the molecular biology of plasmid
replication and segregation in these bacteria. Characterization of the nucleotide
sequence and genetic organization of plasmid replicons in eubacteria has identi-
fied five distinct systems for plasmid replication; circular plasmids may replicate
via rolling-circle replication (RCR), theta replication, or strand displacement,
whereas linear plasmids are thought to replicate through virus-like processes that
involve formation of circular intermediates (hairpin plasmids) or protein priming
(plasmids with 5′-linked proteins) (Actis et al., 1999; Del Solar et al., 1998;
Meinhardt et al., 1997). The replication system(s) employed by linear plasmids
of Lb. gasseri have yet to be characterized, but nucleotide sequence and structural
analysis of replicons from several circular LAB plasmids has confirmed that these
molecules replicate by RCR or theta mechanisms (De Vos and Simons, 1994;
von Wright and Sibakov, 1998; Wang and Lee, 1997).
Genetics of Lactic Acid Bacteria 247
a. Rolling-Circle Replication The most common type of replication sys-
tem in plasmids from LAB and other gram
H11001
bacteria is RCR, a process that
involves synthesis of single-stranded DNA (ssDNA) intermediates (Fig. 1). Be-
cause ssDNA is a reactive intermediate in all DNA recombination processes,
RCR plasmids are particularly vulnerable to segregational and structural instabil-
ity (Gruss and Ehrlich, 1989; Kiewiet et al., 1993). As might be expected, this
attribute can be problematic to gene-cloning strategies with vectors constructed
from RCR plasmid replicons (Biet et al., 1999; De Vos and Simons, 1994; Lee
et al., 1998).
Plasmids that replicate by the RCR model have been identified in Lc. lactis,
O. oeni, and in several species of lactobacilli, leuconostocs, and streptococci
(including S. thermophilus) (Biet et al., 1999; Khan, 1997). These plasmids are
relatively small (most are 1.3– 10.0-kb pairs), broad host range molecules (many
RCR plasmids from LAB can replicate in Escherichia [Es.] coli) that share sev-
eral structural features (Khan, 1997). These include (1) a rep gene, encoding an
origin-specific replication initiation protein (Rep) that has nicking and religating
activities; (2) a double-strand (plus) origin, ori, where Rep nicks the leading
strand of DNA to initiate replication and where, after each replicative cycle, Rep
nicks a second time to release the leading strand; and (3) a single-strand (minus)
origin, sso, where replication of the lagging strand is initiated (and whose recogni-
tion appears critical in determining plasmid host range and stability). In addition,
RCR plasmids typically encode functions that regulate plasmid copy number.
The three most common mechanisms involve the synthesis of a rep repressor
protein or production of antisense RNAs that either attenuate rep transcription
or inhibit Rep mRNA translation (Khan, 1997).
Amino acid and nucleotide sequence alignments of Rep proteins and their
double-strand origins, respectively, have shown that RCR plasmids can be subdi-
vided into at least five families represented by plasmids pT181, pE194, pC194,
pSN2, and pIJ101 (Khan, 1997). Thus far, most RCR plasmids that have been
characterized in LAB fall within the pE194 and pC194 families, but a few mem-
bers of the pT181 family have also been identified (Alegre et al., 1999; Biet et
al., 1999; Khan, 1997). In addition, several RCR plasmids from LAB and other
gram
H11001
bacteria do not belong to any of the five existing families, which suggests
that the number of RCR plasmid families will expand as more replicons are char-
acterized (Khan, 1997; Wang and Lee, 1997).
Further research to classify RCR plasmids from LAB will serve to clarify
the basic understanding of RCR replicons in general, and it will also benefit
applied dairy science because this property can influence plasmid incompatibility
(and thus the segregational stability of extrachromosomal gene cloning vectors
in LAB hosts with native plasmid DNA). Incompatibility is a term that refers to
the inability of independent replicons to coexist stably within the same host cell in
the absence of any selective pressure. Plasmids that possess identical replication
248
Broadbent
Table 1 Plasmid-Encoded Properties in Food-Grade Lactic Acid Bacteria
Trait Species (reference)
Bacteriocin production/immunity
Class I: lantibiotics Lb. sake, Lc. lactis (Dodd and Gasson, 1994
a
)
Class II: small heat-stable proteins C. piscicola, Lb. acidophilus, Lb. brevis, Lb. curvatus, Lb. johnsonii, Lb. plantarum,
Lb. sake, Lc. lactis, Ln. carnosum, Ln. gelidum, Ln. mesenteroides, P. acidilactici
(Dodd and Gasson, 1994
a
; Herbin et al., 1997; Kanatani et al., 1995; Tichaczek et
al., 1993; Van Reenen et al., 1998; Wang and Lee, 1997
a
)
Class IV: complex bacteriocins P. acidilactici (Schved et al., 1993)
Bacteriophage defense
Abortive infection Lc. lactis (Hill, 1993
a
)
Phage adsorption Lc. lactis (Hill, 1993
a
)
Restriction/modification Lb. helveticus, Lc. lactis (Hill, 1993
a
)
Carbohydrate transport/hydrolysis
Galactose phosphotransferase (PTS) Lb. acidophilus, Lc. lactis (Arihara and Luchansky, 1995
a
; McKay, 1983
a
; De Vos
and Vaughan, 1994
a
)
Lactose PTS Lb. acidophilus, Lb. casei, Lc. lactis (McKay, 1983
a
; De Vos and Vaughan, 1994
a
;
Wang and Lee, 1997
a
)
Lactose (non-PTS) Lb. plantarum, Ln. lactis (De Vos and Vaughan, 1994
a
; Mayo et al., 1994)
Maltose PTS Lactobacillus sp. (Chou, 1992)
Melibiose P. pentosaceus (Ray, 1995
a
)
N-acetyl-D-glucosamine Lb. helveticus (Arihara and Luchansky, 1995
a
)
Raffinose P. pentosaceus (Ray, 1995
a
)
Sorbitol Lactobacillus sp. (Wang and Lee, 1997
a
)
Sucrose P. acidilactici, P. pentosaceus (Ray, 1995
a
)
Genetics
of
Lactic
Acid
Bacteria
249
Citrate transport/hydrolysis Lb. plantarum, Lc. lactis, Ln. lactis, Ln. mesenteroides subsp. mesenteroides, W. par-
amesenteroides (Martin et al., 1999; McKay, 1983
a
, Vaughan et al., 1994; Wang
and Lee, 1997
a
)
Exopolysaccharide biosynthesis Lb. casei, Lc. lactis (Arihara and Luchansky, 1995
a
; Van Kranenburg et al., 1997)
Proteolysis
ATP-dependent proteinase Lc. lactis (Huang et al., 1993)
Endopeptidase Lc. lactis (Nardi et al., 1997)
Extracellular proteinase Lb. helveticus, Lc. lactis (McKay, 1983
a
; Wang and Lee, 1997
a
)
Oligopeptide uptake Lc. lactis (Yu et al., 1996)
Resistance plasmids
Clinical antibiotics
Chloramphenicol Lb. acidophilus, Lb. plantarum, Lb. reuteri, Lc. lactis (Teuber et al., 1999
a
; Wang and
Lee, 1997
a
)
Erythromycin Lb. fermentum, Lb. reuteri (Teuber et al., 1999
a
)
Kanamycin Lactobacillus sp. (Wang and Lee, 1997
a
)
Streptomycin Lactobacillus sp., Lc. lactis (Teuber et al., 1999
a
; Wang and Lee, 1997
a
)
Tetracycline Lb. fermentum, Lc. lactis (Teuber et al., 1999
a
; Wang and Lee, 1997
a
)
Inorganic ions
Arsenate Lb. helveticus, Lc. lactis (McKay, 1983
a
; Wang and Lee, 1997
a
)
Chromate Lc. lactis (McKay, 1983
a
)
Cadmium Lc. lactis (Liu et al., 1996)
Copper Lc. lactis (Khunajakr et al., 1999)
Nisin resistance Lc. lactis (Froseth et al., 1988)
Ultraviolet light Lc. lactis (Chopin et al., 1986)
Small heat-shock protein S. thermophilus (Somkuti et al., 1998)
a
Review paper.
250 Broadbent
Figure 1 Circular plasmid replication by the rolling-circle model (RCR). The light and
heavy lines in each part of the plasmid diagram represent the leading and lagging strand
of DNA, respectively. Key events include (1) binding of the replication initiator protein
Rep (whose active form may be mono-, di-, or multimeric) to the double-strand origin
(ori) produces a structural change in the DNA at ori (e.g., cruciform DNA in pT181); (2)
Rep then nicks the leading strand at a specific site within ori, and an initiation complex
is formed between Rep and host replication factors such as DNA polymerase III, DNA
helicase, and single-stranded-DNA binding protein; (3) DNA replication from the Rep-
dependent nick site proceeds with leading strand displacement until ori is regenerated;
(4) Rep, which is believed to remain in close proximity to the replication fork, terminates
replication via sequential nicking-closing reactions at ori. This releases a circular leading
strand of DNA and an inactivated Rep protein (Rep*) and produces a regenerated double-
strand plasmid; (5) Lagging-strand replication is then initiated at the single-stranded origin
(sso) exclusively by host-encoded proteins that may include RNA polymerase and the
DNA polymerases I and III. Other host factors such as DNA ligase and DNA gyrase, are
also likely involved in plasmid RCR. (Adapted from Khan, 1997.)
Genetics of Lactic Acid Bacteria 251
control mechanisms are incompatible, because the control systems cannot distin-
guish between each molecule, and so replication of either plasmid becomes ran-
dom (Snyder and Champness, 1997). Incompatibility between RCR plasmids
from the same family has been noted, and this phenomenon was attributed to
cross recognition between each molecule’s Rep proteins and ori sequences (Groh-
mann et al., 1998). Plasmid incompatibility between gene-cloning vectors and
native plasmids may also contribute to low transformation efficiencies in LAB
(Luchansky et al., 1988; Posno et al., 1991; Van der Lelie et al., 1988).
b. Theta Replication In contrast to RCR, theta-type plasmid replication
does not involve formation of large regions of ssDNA, and so theta plasmids are
far less vulnerable to DNA rearrangements. The practical significance of this
attribute is highlighted most effectively by studies on Bacillus subtilis that
showed cloning vectors derived from theta replicons can stably accommodate
very large (H11022300-kb) or multimeric DNA inserts (Itaya and Tanaka, 1997; Lee
et al., 1998). Improved stability of large-insert DNA in vectors derived from theta
replicons has also been demonstrated in Lc. lactis (Kiewiet et al., 1993).
Replication of theta plasmids involves strand separation at one or more
specific loci, synthesis of an RNA primer, and then progressive uni- or bidirec-
tional DNA replication with simultaneous synthesis of leading and lagging
strands. Theta-type replicons are very common in gram-negative (gram
H11002
) bacteria
but, as noted above, they appear to occur less frequently than RCR plasmids in
LAB and other gram
H11001
bacteria. Nonetheless, theta replicons have been identified
on small, intermediate-sized, and large plasmids from Lb. helveticus, Lb. sake,
Lc. lactis, P. pentosaceous, T. halophilus, and from several enterococci and
pathogenic streptococci (Benachour et al., 1997; Bruand et al., 1993; Kantor et
al., 1997; Kearney et al., 2000).
Differences in genetic structure and the requirement for host encoded DNA
polymerase I during replication can be used to separate eubacterial theta replicons
into six distinct classes, designated A–F (Bruand et al., 1993; Del Solar et al.,
1998; Meijer et al., 1995; Tanaka and Ogura, 1998). Class A replicons encode
a replication initiation protein, Rep, and have an origin of replication, oriA, com-
posed of an AT-rich region and a series of short, directly repeated sequences
called iterons (which also play an important role in regulation of plasmid copy
number). These plasmids do not require host DNA polymerase I for replication.
Class B, C, E, and F replicons are distinguished by the absence of a typical oriA
sequence, the presence of a plasmid-coded Rep protein (class C and F replicons),
and a requirement for DNA polymerase I (classes B and C). Class D replicons
encode Rep and have an oriA-like sequence, but it is not required for replication.
They are also similar in structure and in their requirement for DNA polymerase
I to class C replicons, but the replicative regions of class D and C plasmids
lack any significant DNA sequence homology (Bruand et al., 1993). Like RCR
252 Broadbent
plasmids, theta-type replicons may also encode a rep repressor protein or anti-
sense RNAs that serve to regulate plasmid copy number (Actis et al., 1999).
Many theta plasmids that have been identified in LAB appear to possess
a class A replicon, and most of these have been isolated from Lc. lactis (Kearney
et al., 2000). However, class D replicons have been found in enterococci and
pathogenic streptococci, and it now looks as though several LAB species may
possess class F theta replicons (Kearney et al., 2000). As with basic studies of
RCR replicons, research into theta plasmid replication in LAB will continue to
provide new insight into basic mechanisms for plasmid replication, copy control,
and segregation in gram
H11001
bacteria (Bruand et al., 1993; Gravesen et al., 1997;
Kearney et al., 2000). Because these factors are directly related to plasmid incom-
patibility (Actis et al., 1999), studies in this area will also facilitate strain improve-
ment efforts that involve introduction of extrachromosomal vectors into LAB
hosts that contain native plasmids. On this note, it is important to point out that
although many Lc. lactis class A theta replicons share regions of high sequence
homology, these plasmids are often compatible with one another (Gravesen et
al., 1995). Nonetheless, incompatibility groups and determinants have been iden-
tified for some theta plasmids in LAB (Gravesen et al., 1997; Seegers et al.,
1994), and additional research is needed to define plasmid incompatibility groups
within and among (for broad host range plasmids) different species of LAB.
B. Transposable Elements
Transposable elements are discrete sequences that have the ability to move from
one site to another in DNA. Three types of mobile genetic elements have been
found in LAB: insertion sequences (IS), transposons, and introns. By virtue of
their mobility, these elements promote genetic rearrangements that can affect the
organization, expression, and regulation of existing genes. In addition to inser-
tional inactivation of target or adjacent genes, transpositional elements can also
induce expression of flanking genes. The latter activity is thought to result from
creation of new promoters that comprise an out-directedH1100235 promoter consensus
sequence that is present in terminal inverted repeats of some elements, and an
appropriately spaced H1100210 hexamer in DNA that flanks the insertion site (Mahil-
lon and Chandler, 1998).
Transposons and IS elements also promote more extensive forms of intra-
genomic rearrangements such as cointegrations, inversions, and deletions. Com-
parative genomic analysis of Lc. lactis, for example, has revealed that an inver-
sion encompassing approximately half of the chromosome in strain ML3 is the
result of homologous recombination between two copies of IS905 (Daveran-Min-
got et al., 1998). Insertion sequence–mediated plasmid cointegration is also well
documented in this species (Anderson and McKay, 1984; Polzin and Shimizu-
Kadota, 1987; Romero and Klaenhammer, 1990).
Genetics of Lactic Acid Bacteria 253
Finally, transposable elements can contribute to genetic variation in bacte-
ria by facilitating horizontal gene transfer between different strains, species, and
genera (Arber, 2000; Brisson et al., 1988). Among the LAB, transposons play
an important role in dissemination of virulence factors among pathogenic entero-
cocci and streptococci (Horaud et al., 1996; McAshen et al., 1999; Teuber et al.,
1999), and recent evidence suggests IS elements were involved in horizontal
transfer of genes for exopolysaccharide production between Lc. lactis and S. ther-
mophilus (Bourgoin et al., 1996 and 1999). From a more practical perspective,
transposable elements can be useful tools for molecular analysis of LAB genetics,
physiology, and metabolism, and for development of integrative gene cloning
vectors (Dinsmore et al., 1993; Israelsen et al., 1995; Le Bourgeois et al., 1992b;
Maguin et al., 1996; Polzin and McKay, 1992; Ravn et al., 2000; Walker and
Klaenhammer, 1994).
1. Insertion Sequences
The IS described in LAB range in size from approximately 0.8 to 1.5 kb, with
16–40 bp inverted repeats on left and right ends (Table 2). Like other prokaryotic
IS, they are compact elements that only encode transposase and cis-acting se-
quences required for transposition, and their location is almost always flanked
by short, direct repeats (3–8 bp) that reveal the target sequence used for insertion
into new sites (Mahillon and Chandler, 1998). Mechanisms involved in IS trans-
position are both varied and complex, and they are quite beyond the scope of
this chapter. Readers interested in this topic are referred to the reviews of Haren
et al. (1999) and Mizuuchi (1992).
Discovery of the first IS element in LAB arose from a series of elegant
experiments to ascertain the cause of abnormal fermentations during production
of a fermented skim milk beverage (Shimizu-Kadota and Sakurai, 1982; Shimizu-
Kadota et al., 1983, 1985). Those studies showed that abnormal fermentations
at several factories were caused by the same virulent bacteriophage, designated
φFSV, which was serologically, morphologically, and biochemically identical to
a temperate phage (φFSW) harbored by the starter bacterium, Lb. casei S-1
(Shimizu-Kadota and Sakurai, 1982; Shimizu-Kadota et al., 1983). Structural
analysis of the φFSV and φFSW genomes revealed φFSV contained 1.3 kb of
additional DNA, and nucleotide sequence analysis revealed this region contained
an IS, designated ISL1. Southern hybridization showed ISL1 was present on the
Lb. casei S-1 chromosome, which led to the conclusion that φFSV arose from
φFSW by ISL1 transposition from the chromosome to a region of the prophage
that controlled lysogeny (Shimizu-Kadota et al., 1985). With this knowledge, the
Yakult company was able to isolate a prophage-cured derivative of Lb. casei
S-1 and eliminate further emergence of φFSV in their factories (Shimizu-Kadota
and Sakurai, 1982).
254
Broadbent
Table 2 Insertion Sequences in Dairy Lactic Acid Bacteria
Original host and Inverted Copies per
element name
a
Size (bp) repeat (bp)
b
IS Family
c
genome Host range (references)
d
Lactobacillus
ISL1 1256 40 1S3 1–3 Lb. casei subsp. casei, Lb. zeae (Shimizu-Kadota et al.,
1985, 1988)
e
ISL2 858 16 IS5 4–21 Lb. helveticus (Zwahlen and Mollet, 1994)
f
ISL3 1494 38 ISL3 1–9 Lb. delbrueckii subsp. bulgaricus (Germond et al., 1995)
g
ISLh1 962 35 IS982 ND
h
Lb. helveticus (Pridmore et al., 1994)
IS125 1024 24 IS30 ND
h
Lb. plantarum (Ehrmann et al., 2000)
IS1163 1180 39 IS3 2 Lb. sake (Skaugen and Nes, 1994)
IS1201 1387 24 IS256 3–16 Lb. helveticus (Tailliez et al., 1994)
IS1223 1492 25 IS3 ND
h
Lb. johnsonii (Walker and Klaenhammer, 1994)
Lactococcus lactis
ISS1 808 18 IS6 1–20 En. faecium, En. hirae, Lb. plantarum, Lc. lactis, Ln. mes-
enteroides subsp. dextranicum, S. thermophilus (Bour-
goin et al., 1996; Ehrmann et al., 2000; Polzin and Shim-
izu-Kadota, 1987; Polzin et al., 1993; Ward et al., 1996)
i
IS214 809 23 IS6 3
j
En. faecium, Lc. lactis (Teuber et al., 1999)
IS215 (IS1077) 1448 14 IS3 1–7
k
Lc. lactis (Bolotin et al., 1999; Teuber et al., 1999)
IS904 1241 39 IS3 5–9 Lc. lactis (Dodd et al., 1990)
IS905 1313 28 IS256 H11350 16 Lc. lactis, S. thermophilus (Dodd et al., 1994; Gue′don et
al., 1995)
IS981 1222 40 IS3 4–26 Lc. lactis, S. thermophilus (Polzin and McKay, 1991;
Gue′don et al., 1995)
Genetics
of
Lactic
Acid
Bacteria
255
IS982 1003 18 IS982 1–20 Lc. lactis (Yu et al., 1995)
IS983 1067 25 IS30 15
k
Lc. lactis (Bolotin et al., 1999; A. Sorokin, personal com-
munication)
Leuconostoc
IS1070 1027 28 IS30 H11350 15 Ln. lactis (Vaughan and De Vos, 1995)
IS1165 1553 39 ISL3 4–13 Ln. mesenteroides subsp. cremoris (Johansen and Kibenich,
1992)
l
Streptococcus thermophilus
IS1193 1411 24 ISL3 ND
h
S. thermophilus (Schmitt et al., 1998)
IS1194 1200 16 IS4 1 S. thermophilus, Lc. lactis (Bourgoin et al., 1998)
m
a
Bacterium from which the element was originally isolated.
b
Length in base pairs of the terminal repeat sequences.
c
Classification scheme based on the major features of prokaryotic IS families. See Mahillon and Chandler (1998) for details.
d
As established from the nucleotide sequence of the IS or one of its isoforms.
e
DNA-DNA hybridizations indicated that this element was not present in 8 other Lactobacillus sp. or 12 species from 8 other genera.
f
DNA-DNA hybridizations indicated this element was not present in Lb. acidophilus, Lb. delbrueckii,orS. thermophilus.
g
DNA-DNA hybridizations indicated this element was not present in Lb. acidophilus, Lb. casei, Lc. lactis,orS. thermophilus.
h
Not determined.
i
ISS1 elements have been divided into three subgroups (α, β, and γ) based on nucleotide sequence homology (Bourgoin et al., 1996). Southern hybridizations
detected homologous sequences in Lb. casei, Lb. plantarum, En. faecalis and P. acidilactici but not in Lb. acidophilus, Lb. gasseri,orLn. paramesenteroides
(Polzin et al., 1993). DNA-DNA hybridizations detected homologous sequences in Lb. casei and Lb. plantarum (Huang et al., 1992).
j
Information on copy number is limited to the Lc. lactis multidrug resistance plasmid pK214.
k
As determined from the nucleotide sequence of the Lc. lactis multidrug resistance plasmid pK214 or of the Lc. lactis IL1403 genome.
l
Homologous sequences were detected by DNA-DNA hybridization in Lb. casei, Lb. helveticus, Ln. lactis, O. oeni, and Pediococcus sp. but not in Lc.
lactis.
m
DNA-DNA hybridization detected homologous sequences in Lc. lactis but not Lb. delbrueckii.
256 Broadbent
Several other IS elements have since been identified in many dairy LAB,
including other species of Lactobacillus, Lc. lactis, S. thermophilus, and leuco-
nostocs (see Table 2). Nucleotide sequence analysis and DNA-DNA hybridiza-
tions have established that several of these elements are present in multiple copies
throughout the LAB genome (plasmids and chromosome), and that related se-
quences are present in most (and probably all) industrially important LAB. Exis-
tence of iso-IS elements (e.g., ISS1) in many different LAB species, and proxim-
ity of these elements to plasmid-borne genes encoding important milk
fermentation properties (e.g., lactose and citrate utilization, proteinase produc-
tion, and phage resistance) suggests that IS were probably important in the evolu-
tionary adaptation of LAB to a milk environment (Bourgoin et al., 1999; David-
son et al., 1996; Magni et al., 1996).
2. Transposons
Two types of transposons can be distinguished in dairy LAB: composite transpo-
sons and conjugative transposons. Composite transposons typically consist of a
nonmobile central region that is flanked on each side by complete IS elements
that provide the transposition factors. Given the frequency at which some IS
occur in the chromosome and plasmid DNAs of Lc. lactis and other dairy LAB
(see Table 2), elements that satisfy the structural definition of a composite
transposon may be quite common in genomes of these bacteria. A few putative
elements have been identified in Lc. lactis and S. thermophilus, but conclusive
proof for intracellular transposition by any naturally occurring composite transpo-
son in food-grade LAB is still lacking (Bourgoin et al., 1999; Duan et al., 1996;
Huang et al., 1993; Romero and Klaenhammer, 1991; Teuber et al., 1999). None-
theless, transposition of an artificial composite transposon that was assembled
with IS946 elements has been demonstrated in Lc. lactis (Romero and Klaenham-
mer, 1991), and functional mobility for some native elements is evidenced by
the fact that they contain IS elements (and intervening DNA regions) that have
clearly been acquired through horizontal gene transfer (Bourgoin et al., 1999;
Teuber et al., 1999). Readers should also recognize that several functionally ac-
tive composite transposons have been identified in enterococci and streptococci,
where these elements contribute to the problematic spread of antibiotic resistance
genes (Horaud et al., 1996; Teuber et al., 1999; Woodford 1998).
a. Conjugative Transposons With a size range of 18–70 kb, the conjuga-
tive transposons of gram
H11001
bacteria are generally larger and more complex mobile
elements than composite transposons. Conjugative transposons were originally
discovered in the late 1970s in pathogenic LAB, and current models for their
transposition are derived largely from studies of the enterococcal transposon
Tn916 and other Tn916-like elements (Salyers and Shoemaker, 1997). Members
Genetics of Lactic Acid Bacteria 257
of the Tn916 family of transposons have a very broad host range that extends
to more than 50 species in 24 bacterial genera (Jaworski and Clewell, 1995).
Like IS and composite transposons, conjugative transposons are able to
excise from and insert into chromosomal or plasmid DNA, but some aspects of
their transposition are more akin to plasmids and temperate bacteriophages than
to other transposable elements. Excision of a conjugative transposon, for exam-
ple, is followed by its conversion into a plasmid-like covalently closed circular
DNA molecule (which is, however, incapable of autonomous replication) that
can be transferred by conjugation in single-stranded form into another (recipient)
cell. Moreover, mechanisms for integration and excision of the circular DNA
intermediate are phage-like in that they require a transposon-encoded integrase,
and excision is stimulated by the transposon’s xis gene product (Salyers et al.,
1995).
As was hinted above, several conjugative transposons have been identified
in enterococcal and streptococcal clinical isolates, and these elements are now
recognized for their integral role in dissemination of antibiotic resistance genes
to many species of bacteria (Teuber et al., 1999). In contrast, the only conjugative
transposons to be conclusively identified thus far in food-grade LAB are the very
large (approximately 70 kb) and genetically related nisin-sucrose transposons of
Lc. lactis. These elements do not appear to encode antibiotic resistance genes
and seem to be far less promiscuous than their enterococcal and streptococcal
counterparts. Evidence for the latter assertion comes from the observation that
although intraspecific conjugation of these transposons has been demonstrated
by several groups, genetic proof for intergeneric transfer has only been docu-
mented once (Broadbent and Kondo, 1991; Broadbent et al., 1995).
Interest in lactococcal nisin-sucrose transposons stems from the finding that
they encode genes for nisin biosynthesis and immunity. Nisin is a broad-spectrum
lantibiotic that is widely used as a preservative to combat gram
H11001
spoilage and
pathogenic bacteria in food (Horn et al., 1991). Structural characterization of
several nisin-sucrose transposons has revealed that conjugative elements can be
separated into two classes, designated I and II, whose structures are represented
by Tn5276- and Tn5278-like transposons, respectively (Rauch et al., 1994). A
third group of nisin-sucrose ‘‘transposons,’’ class III elements, appear to be de-
rived from class II transposons, but the former elements cannot be transferred
by conjugation and probably lack transpositional mobility.
As shown in Fig. 2, group I nisin-sucrose transposons have an IS904 ele-
ment near their left junction, just upstream of genes for biosynthesis of nisin A
(one of two natural nisin variants). Another IS, IS981, lies downstream of the
nisin gene cluster and adjacent to genes for sucrose metabolism via a sucrose-
specific phosphoenolpyruvate-dependent phosphotransferase system. Like
Tn916, genes involved in Tn5276 excision and integration are located near the
258 Broadbent
Figure 2 Genetic organization of the lactococcal group I nisin-sucrose transposon
Tn5276. The transcriptional orientation of genes for nisin biosynthesis (nisA-G), sucrose
utilization (sac), excision (xis), and integration (int) are illustrated by black arrows above
the element, and orientations of putative transposase genes in IS904 and IS981 are indi-
cated by the thick gray arrows. The hatched area represents the region of the transposon
for which DNA sequence information has not yet been reported. Map is not to scale.
right end of the transposon (De Vos et al., 1995). Much of the region between
xis and sacBK (see Fig. 2) has not been described, but phenotypic characterization
of transconjugants suggests it may include genes for conjugative self-transfer,
resistance to certain bacteriophages, and synthesis of N
5
-(carboxyethyl)ornithine
(Gonzales and Kunka, 1985; Thompson et al., 1991). The structure of group II
nisin-sucrose transposons has not been as extensively characterized, but they are
known to lack the left-end copy of IS904 and to encode genes for biosynthesis
of nisin Z instead of nisin A (Rauch et al., 1994).
Very recently, Burrus and coworkers (2000) described an element in S.
thermophilus that appears to represent a new species of conjugative transposon
in LAB. This element, termed ICESt1, is 35.5 kb in length and encodes, near its
right terminus, genes whose products show extensive homology to proteins in-
volved in conjugation, excision, and integration of other conjugative transposons,
including Tn916 and Tn5276. Although conjugal transfer of ICESt1 has not yet
been confirmed, strong evidence for in vivo and int-dependent excision of the
element into a circular intermediate form has been presented. Interestingly,
ICESt1 also contains a truncated copy of the lactococcal element IS981, which
suggests that conjugal transposition of ICESt1 (or a larger transposon from which
it was derived) may have facilitated horizontal gene transfer between Lc. lactis
and S. thermophilus (Burrus et al., 2000).
3. Group I and Group II Introns
Group I and group II introns are ribozymes that catalyze a self-splicing reaction
from mRNA species that contain the intron, and many of these sequences also
function as mobile genetic elements. The most common type of transposition
event noted for group I and group II introns is termed ‘‘homing,’’ wherein the
intron will insert itself into an allele that lacks the cognate element. However,
group II (and perhaps group I) introns can also effect transposition to other loca-
tions in the genome (Lambowitz and Belfort, 1993). Although they were once
thought to be confined exclusively to eukaryotic cells, introns are now known to
Genetics of Lactic Acid Bacteria 259
occur in a wide range of prokaryotes (Belfort et al., 1995). Self-splicing represen-
tatives of both groups have now been identified in LAB, where their discovery
and characterization have shed new light on intron evolution and biology (Foley
et al., 2000; Mikkonen and Alatossava, 1995; Mills et al., 1996).
a. Group I Introns In addition to self-splicing activity, many group I in-
trons encode a site-specific endonuclease that confers homing mobility on the
intron. The mechanism for homing in group I introns is reasonably well under-
stood, and is thought to occur through a recombination repair process that resem-
bles gene conversion. Homing is initiated by the endonuclease, which creates a
double-strand break at a specific target in the intron-free allele, then cleaved DNA
strands of the recipient are partially degraded by exonucleases. The gap created
in recipient DNA is filled in using the donor strand as the template, which results
in coconversion of any exon sequences that were lost to nucleolytic degradation.
It is important to note that mobile, endonuclease-encoding group I introns appear
to be confined to multicopy genomes such as mitochondria, chloroplasts, and
bacteriophages, and this observation has led to suggestions that inefficient double-
strand break repair may limit viability in hosts with a single-copy genome (Lam-
bowitz and Belfort, 1993). Given this background, it is not unexpected to learn
that all mobile group I introns identified to date in LAB reside in bacteriophage
genomes (Foley et al., 2000; Mikkonen and Alatossava, 1995; Van Sinderen et
al., 1996).
The first group I intron identified in a LAB was located in a gene encoding
the large terminase subunit of the Lb. delbrueckii subsp. lactis virulent bacterio-
phage LL-H (Mikkonen and Alatossava, 1995). The LL-H intron is 837 bp in
length and encodes a 168–amino acid (aa) protein that has good homology to
intron-encoded DNA endonucleases found in B. subtilis phages. Although the
extreme 3′ nucleotide of the intron was reported to contain an A instead of the
G found in all other group I introns, in vivo autocatalytic activity was confirmed
by polymerase chain reaction (PCR) analysis of terminase gene cDNA (Mikko-
nen and Alatossava, 1995).
A second putative group I intron has since been located in the genome of
the Lc. lactis temperate bacteriophage r1t (Van Sinderen et al., 1996), and Foley
and coworkers (2000) recently showed that many genetically and ecologically
unrelated S. thermophilus phages contain a functional group I intron in their lysin
gene. The latter work showed that although location of the intron was conserved
among different phages, nucleotide sequence analysis revealed the existence of
several variant introns. Two of these elements, represented by the 1013-bp introns
in phages S3b and ST3, differ by a single nucleotide substitution and contain an
open reading frame (ORF) encoding a 253-aa protein with good homology to
other intron-encoded endonucleases. Three other variant introns, typified by the
elements in phages Sfi6A, S92, and ST64, had deletions in the intron-encoded
260 Broadbent
ORF that yielded elements of 519, 443, and 316 bp, respectively. Another variant
intron in phage DT1 differed from the S92 element by one nucleotide substitution
(Foley et al., 2000). Since the intron-encoded endonuclease is required for mobil-
ity (Lambowitz and Belfort, 1993), it seems unlikely that any of the four latter
variants would display homing activity.
b. Group II Introns Like their group I counterparts, many group II introns
also contain ORFs. In contrast to the former class of introns, however, ORFs
encoded by group II introns produce multidomain proteins with maturase and
reverse transcriptase activities that are involved in self-splicing and mobility reac-
tions, respectively (Dunny and McKay, 1999; Lambowitz and Belfort, 1993).
Only one functional group II intron has been identified to date in LAB, but puta-
tive elements have also been identified in En. faecalis and S. pneumoniae (Dunny
and McKay, 1999). The group II intron whose function has been studied is desig-
nated Ll.ltrB, and it was independently discovered in a gene (ltrB) encoding con-
jugative relaxase by researchers studying the conjugative sex factor of Lc. lactis
strains ML3 (pRS01) and 712 (Mills et al., 1996; Shearman et al., 1996). Both
groups showed Ll.ltrB had in vivo self splicing activity, and Mills et al. (1997)
also demonstrated homing of the intron into an intron-free ltrB allele in Lc. lactis.
The latter observations are particularly significant, because Ll.ltrB was the
first functional group II intron to be identified in any bacterium, and its discovery
has significantly advanced current understanding of group II intron biology. Anal-
ysis of the Ll.ltrB homing pathway in Es. coli and Lc. lactis, for example, has
provided new insight into the mechanism for group II intron mobility in bacteria
(Dunny and McKay, 1999). The model that emerged from those studies suggests
that homing occurs through a novel pathway that is initiated by staggered, double-
strand DNA cleavage at the target site. Two endonuclease activities are required
in this reaction: cleavage of the antisense strand is effected by the Ll.ltrB intron-
encoded protein and the sense strand is cut at the intron insertion locus by reverse
splicing of the intron RNA. Both activities are found in ribonucleoprotein parti-
cles formed by the intron-encoded protein and intron RNA. After reverse splicing
into the cut site, transposition is completed by cDNA synthesis from the intron
template. Unlike group I intron homing, these reactions result in precise integra-
tion of the group II intron without coconversion of flanking 5′ exon sequences.
Group II intron mobility also differs in that it does not require RecA protein and
has very relaxed requirements for flanking exon homology (Cousineau et al.,
1998; Dunny and McKay, 1999).
Finally, these studies have also shown that domain IV of Ll.ltrB is not
essential for self-splicing and can accommodate foreign DNA inserts greater than
1 kb in length. This feature, coupled with the intron’s relatively relaxed target
specificity and absence of exon coconversion during transposition, indicate that
Ll.ltrB may be a useful tool for genetic engineering in bacteria and higher cells
(Dunny and McKay, 1999).
Genetics of Lactic Acid Bacteria 261
C. Bacterial Chromosome
Genes encoding all of the essential housekeeping, catabolic, and biosynthetic
activities of the cell are housed in the chromosome. As such, knowledge of chro-
mosomal structure and organization in dairy LAB has great fundamental and
applied value to the dairy industry. Recent advances in chromosomal mapping
technologies and in nucleotide sequencing resources has sparked an intense inter-
est in bacterial genome analysis, and chromosomes of LAB are certainly no ex-
ception.
Efforts to characterize chromosomes of LAB were begun in the early 1970s
and 1980s by researchers who used DNA-DNA renaturation kinetics to estimate
the genome size (in daltons) of En. faecalis, Lc. lactis, and pathogenic strepto-
cocci (Bak et al., 1970; Jarvis and Jarvis, 1981). Classic methods for gene ex-
change such as transduction and conjugation (see Sec. III.A and III.C) are not
well suited to chromosomal mapping in LAB, so more detailed genome studies
were not feasible until the advent of pulsed-electric field gel electrophoresis
(PFGE) technology in the early 1980s (Le Bourgeois et al., 1993). This methodol-
ogy allows one to purify relatively intact bacterial chromosomes, digest them with
rare-cutting restriction endonucleases, then resolve the large molecular weight
restriction products by electrophoresis in an alternating electric field. If appro-
priate size standards are included in the gel, summation of individual restriction
fragments after PFGE provides a rapid and relatively accurate means to estimate
genome size. By this approach, genome size estimates have now been collected
for strains representing more than 15 species of LAB. These data show that LAB,
like other nutritionally fastidious eubacteria, have a relatively small (approxi-
mately 1.8 to 3.4 megabase pairs) chromosome (Davidson et al., 1996). One of
the practical observations to emerge from this work was that restriction fragment
polymorphisms are common in the PFGE profiles from different strains of the
same LAB species. This finding has led industry and academia to employ PFGE
as a DNA fingerprinting tool for strain identification and for evaluation of strain
lineage (Le Bourgois et al., 1993).
Another important outcome of PFGE technology has been its use, in combi-
nation with other procedures such as Southern hybridization with specific gene
probes, to assemble modest physical and genetic maps of LAB chromosomes.
This strategy has been used to procure maps for chromosomes of several industri-
ally important LAB, including Lc. lactis (Davidson et al., 1995; Le Bourgeois et
al., 1992a; Tulloch et al., 1991), O. oeni (Ze-Ze et al., 1998), and S. thermophilus
(Roussel et al., 1994), and for many of the pathogenic streptococci (Dmitriev et
al., 1998; Gasc et al., 1991; Hantman et al., 1993; Suvorov and Ferretti, 1996).
These maps have confirmed that individual species and even strains may differ
in genomic size and organization, and show that all LAB characterized to date
possess a single and circular chromosome.
262 Broadbent
Finally, PFGE has also facilitated the study of chromosomal geometry and
intraspecific polymorphisms in Lc. lactis and S. thermophilus. Those investiga-
tions identified intraspecific genomic polymorphisms that have arisen by DNA
inversions, insertions, deletions, and translocations, and they provided evidence
that IS elements were involved in many of these events (Davidson et al., 1996;
Leblond and Decaris, 1998; Roussel et al., 1997). As was noted in Sec. II.B,
subsequent work has confirmed that a large genomic inversion in the chromosome
of Lc. lactis ML3 was in fact produced by homologous recombination between
IS905 elements.
As outlined in the preceding paragraphs, development and commercializa-
tion of PFGE technology gave rise to a new microbiological discipline whose
subject involves structural, functional, and comparative analyses of bacterial ge-
nomes. Although PFGE analysis is still an important component of genome re-
search, the most exciting and innovative work in this rapidly growing field is
now being fueled by nucleotide sequence analysis of complete genomes.
1. Comparative Genomics
Compilation and annotation of entire genome sequences has revolutionized bacte-
riology and microbial genetics, and has created almost unimaginable opportuni-
ties to study bacterial evolution, genetics, physiology, and metabolism. Entire
nucleotide sequences for more than 30 different microbial genomes have been
published since 1995, and sequencing projects for over 100 other species are
underway (see http://www.tigr.org/tdb/mdb/mdb.html). The dramatic growth in
genome sequence research is largely the result of technical improvements in auto-
mated DNA sequencers, molecular biology tools, personal computers, and com-
puter software, which now allow even small laboratories to engage in a bacterial
genome project (Frangeul et al., 1999).
For obvious reasons, most of the microbial genome sequencing projects
have focused on species with human clinical significance. It is therefore no sur-
prise that sequencing projects among the LAB have targeted several important
pathogens in this group (e.g., En. faecalis, S. mutans, S. pyogenes, and S. pneu-
moniae). Nonetheless, low-redundancy sequencing of the entire Lc. lactis genome
was recently reported by Bolotin et al. (1999), and genome sequencing projects
are underway for other important dairy LAB, including Lb. acidophilus and Lb.
helveticus.
The value of genome sequence information from both food-grade and
pathogenic LAB species to LAB research cannot be overstated. Such comprehen-
sive knowledge will endow industry and academia with unprecedented power to
determine the means by which LAB have evolved in, interact with, and respond
to milk and cheese environments. It is important to note that sequence acquisition
and annotation are only the first steps in functional genomics research. The physi-
Genetics of Lactic Acid Bacteria 263
ological role and regulation of most of the deduced ORFs must still be confirmed
or identified, and this task could span several decades. Moreover, the speed at
which LAB genomics research can progress will also hinge upon the time and
degree to which genome sequences are made available to the general scientific
community. Nonetheless, the fundamental and applied payoffs of genomic re-
search to the dairy industry are too numerous to list, and many probably cannot
yet be envisioned. A few examples of research outcomes that should be possible
through this exciting work include:
1. Knowledge of global gene regulation and integrative metabolism in
LAB would help answer long-standing questions regarding mecha-
nisms for the health-promoting benefits of certain LAB; identify means
by which some species grow in harsh environments; highlight the most
rational strategies for metabolic and genetic improvements to industrial
strains; and improve molecular biology resources for genetic manipula-
tion of many dairy LAB species.
2. Comparative genomics will build a fundamental understanding of LAB
evolution and taxonomy that will facilitate safety assurance evaluations
of food-grade, genetically modified LAB; provide novel methods for
isolation of new starter and adjunct LAB from different environments;
and yield new strategies to combat the spread of virulence factors by
pathogenic enterococci and streptococci.
D. Bacteriophages
Bacteriophages, or phages for short, are viruses that attack and destroy bacterial
cells. The inhibitory effect of these obligate parasites on dairy starter bacteria
has been recognized for more than 60 years, and their destructive impact on the
cheese and yogurt industries has focused worldwide attention on molecular genet-
ics and evolution of LAB phages. Because industrial fermentations with Lc. lactis
and S. thermophilus starters suffer greatest economic losses, current understand-
ing of LAB phage biology stems largely from phages infecting these two species
(Bru¨ssow et al., 1998; Garvey et al., 1995). However, several groups have de-
scribed bacteriophages infecting other industrially important LAB species, in-
cluding many dairy lactobacilli, and some of these phages have even been charac-
terized at the genome sequence level (Altermann et al., 1999; Kodaira et al.,
1997; Mikkonen et al., 1996). Taxonomically, a few phages with contractile tails
(family Myoviridae) or very short tails (family Podoviridae) have been isolated
from LAB, but most bacteriophages infecting these species belong to the Sipho-
viridae family (phages with long noncontractile tails) of the order Caudovirales
(Bru¨ssow et al., 1998; Caldwell et al., 1999; Davis et al., 1985; D?′az et al., 1992;
Garc?′a et al., 1997; Jarvis et al., 1991, 1993; Manchester, 1997; Park et al, 1998;
264 Broadbent
Se′chaud et al., 1988; Trevors et al., 1983). A detailed description of LAB phage
morphology, infectious cycles, and host range properties are provided in Chapter
6 of this volume and will not be addressed any further here. Instead, this section
will highlight some of the exciting outcomes from molecular genetic research of
LAB bacteriophages.
Unlike the LAB chromosome, where the promise of genomics research
remains largely untapped, the structural, organizational, and evolutionary study of
LAB bacteriophage genomes has progressed rapidly in recent years. The obvious
reason for this difference is that phage genomes are much smaller (sizes range
from 18 to 134 kb) (Prevots et al., 1990) than a bacterial chromosome, and can
therefore be sequenced far more rapidly (and inexpensively). Two of the most
significant outcomes of phage genetics and genomics studies include (1) a more
comprehensive view of bacteriophage diversity and evolution in LAB and (2)
application of phage-derived elements to enhance bacteriophage resistance in
dairy starter bacteria and for genetic manipulation of these species.
1. On the Origin of Phages
The design of effective phage-control strategies for the dairy fermentation indus-
try depends, to a large degree, on sound knowledge of bacteriophage diversity
and evolution. The origin of phages in dairy plants has therefore been the subject
of considerable research and debate, and one of the focal points of this discussion
has been the role of lysogeny in evolution of virulent phages. As was outlined
earlier (see Sec. II.B.1), Shimizu-Kadota and coworkers (1985) showed that a
virulent Lb. casei phage clearly was derived from a prophage in the host starter
bacterium by insertional transposition of ISL1. Discovery that lysogeny is quite
common in dairy LAB, and especially in Lc. lactis, led to speculation that pro-
phages may be an important reservoir of lytic bacteriophages in the dairy industry
(Davidson et al., 1990). We now know that although virulent Lc. lactis phages
can evolve from temperate phages (Davidson et al., 1990), most of the lytic and
temperate phages that infect this species share very little DNA homology and
therefore are not closely related (Garvey et al., 1995). An important exception
involves lytic phages from the P335 species, which do exhibit DNA homology
with temperate bacteriophages and whose frequency in cheese plants is increasing
(Dumaz and Klaenhammer, 2000; Moineau et al., 1994; Walker et al., 1998).
More significantly, new P335 lytic phages evolve by acquisition of host chromo-
somal DNA, and nucleotide sequence analysis of one of these fragments has
confirmed it was derived from prophage components (Dumaz and Klaenhammer,
2000; Moineau et al., 1994).
In contrast to the situation in Lc. lactis, all lytic and temperate S. thermophi-
lus bacteriophages characterized to date belong to a single DNA homology group
(Bru¨ssow et al., 1998), and comparative genomics has revealed that deletions in
Genetics of Lactic Acid Bacteria 265
the lysogenic module of temperate phages probably plays a key role in evolution
of lytic phages (Lucchini et al., 1999a; Tremblay and Moineau, 1999). Fortu-
nately, lysogeny appears to be quite rare in this species (Le Marrec et al., 1997).
Lysogens are more common in dairy lactobacilli (Davidson et al., 1990), how-
ever, and a genetic relationship between lytic and temperate phages from some
of these species has also been established (Auad et al., 1999; Lahbib-Mansais et
al., 1988; Mikkonen et al., 1996; Shimizu-Kadota et al., 1985). As a whole, these
data clearly show that lysogeny has an important (but not exclusive) role in evolu-
tion of new lytic phages in the dairy fermentations industry, and they argue for
development of prophage-cured starter LAB (Shimizu-Kadota and Sakurai,
1982).
From a more fundamental perspective, comparative genomics studies of
LAB Siphoviridae have also yielded rewarding insight into bacteriophage evolu-
tion and taxonomy. As is typical of tailed phages, all LAB phage genomes charac-
terized thus far comprise a linear, double-stranded DNA molecule whose G H11001
C content is parallel to that of the host (Ackermann, 1999). Depending upon the
mechanism by which it is packaged into the capsid (which may differ even be-
tween very closely related bacteriophages), genomes from LAB Siphoviridae
possess cohesive ends or circular permutation with terminal redundancy. Most
phage ORFs appear to be transcribed from a common strand, except in temperate
phages, where a cluster of genes associated with lysogeny is transcribed diver-
gently from those that encode the lytic cycle (Altermann et al., 1999; Garvey et
al., 1995; Klaenhammer and Fitzgerald, 1994; Kodaira et al., 1997; Le Marrec
et al., 1997; Lucchini et al., 1999c; McShan and Ferretti, 1997; Mikkonen et al.,
1996; Venema et al., 1999).
Efforts to further elucidate structure-function properties of LAB bacterio-
phage genomes have been hindered by the experience that protein homology
searches rarely yield useful matches for more than a fourth of the phage-encoded
ORF products (Desiere et al., 1999). Nonetheless, the structural organization of
genes whose function is known or to which a putative role can be assigned has
revealed that functionally related genes are distributed into clusters or modules
whose order is highly conserved among very different phages (Altermann et al.,
1999; Auad et al., 1999; Kodaira et al., 1997; Luccini et al., 1999b, 1999c;
McShan and Ferretti, 1997; Mikkonen et al., 1996; Venema et al., 1999). In
this regard, LAB bacteriophage genomic structure is quite consistent with the
prevailing theory on phage evolution. This theory, termed the modular theory
for phage evolution, was formulated to address the highly recombinogenic nature
of bacteriophages which, of course, makes evolution by linear descent implausi-
ble (Botstein, 1980). By the modular theory, the product of evolution is not a
particular virus but instead a family of interchangeable genetic modules which
individually perform a specific biological function. Thus, individual viruses rep-
resent a combination of modules that have been selected for their singular and
266 Broadbent
coordinated ability to fill a particular niche. Exchange of one module for another
with similar function occurs by recombination between bacteriophages that exist
within a common, interbreeding population (and these viruses can differ widely
in any characteristic except modular construction). Experience now suggests that
single modules may be as small as one gene or even a gene fragment encoding
the single domain of a protein (Luccini et al., 1999c).
A modular mechanism for LAB phage evolution is clearly evidenced by the
recent work of Lucchini et al. (1999b), who showed that genomes of temperate
Siphoviridae from all gram
H11001
bacteria with a low G H11001 C content display the fol-
lowing organization in their morphogenesis and lysogeny modules: DNA packag-
ing–head morphogenesis–tail morphogenesis–tail fiber morphogenesis–lysis–
lysogeny–DNA replication-followed by a module whose function has not been
identified. The workers also noted that these phages may comprise a unique genus
within the Siphoviridae family because even though their morphogenesis module
is evolutionarily closest to the lambda-like Siphoviridae, their lysogeny module
is actually more closely related to that of the P2-like Myoviridae.
Finally, it is important to recognize that since module structure is more
highly conserved than nucleotide or amino acid sequences, similarities that exist
between morphogenesis modules of lambdoid and LAB Siphoviridae can be ex-
ploited to assign putative functions to many LAB phage genes (Chandry et al.,
1997; Desiere et al., 1999). Recent validation of this strategy by Desiere et al.
(1999) should encourage structure-function research in LAB phage genomes that
will eventually provide exciting new insight into the biology of LAB bacterio-
phages and phage-host interactions.
2. New Tools for Biotechnology of Lactic Acid Bacteria
Bacteriophage genomics research has also produced several novel phage defense
mechanisms for dairy starter cultures. The first system to be described involved
insertion of a bacteriophage origin of replication into a streptococcal shuttle vec-
tor (Hill et al., 1990). Lactococcal host cells that carry the recombinant plasmid
display an abortive phage resistance phenotype called Per (for phage encoded
resistance) that is proposed to act by titration of phage replication proteins away
from true phage ori sequences during the early stages of infection (Hill et al.,
1990; McGrath et al., 1999). Although the efficacy of Per-mediated phage resis-
tance was originally established in Lc. lactis, recent work by Foley and coworkers
(1998) suggests Per systems may actually have greater value in S. thermophilus.
The reasons for this are twofold: first, very few natural phage defense systems are
available for this species; and second, Per-type systems appear to confer relatively
broad resistance against S. thermophilus phages (Foley et al., 1998). Other exam-
ples of phage defense systems that have been derived from bacteriophage genetics
include (1) application of antisense mRNA against highly conserved Lc. lactis
phage sequences (Kim and Batt, 1991; Walker and Klaenhammer, 2000); (2) a
Genetics of Lactic Acid Bacteria 267
system for Lc. lactis that places a suicide gene under control of a strictly phage-
inducible promoter to trigger death of host cells upon infection (Djordjevic et
al., 1997); and (3) a mechanism that imparts immunity to temperate phage super-
infection in Lb. casei by constitutive host expression of the phage’s gene for
repressor protein (Alvarez et al., 1999).
Functional genomic analysis of LAB phages has also yielded a variety of
useful tools for molecular genetic manipulation of dairy starter bacteria (Venema
et al., 1999). For example, the integrase gene (int) and attachment sequence (attP)
that mediate site-specific integration of temperate phages into the host chromo-
some have been utilized to develop integration vectors that insert foreign DNA
into a specific locus (attB) on the bacterial chromosome. The int-attP integration
systems offer several important advantages over counterparts that rely upon host-
mediated homologous recombination. These include (1) integration occurs at
attB, the locus normally used for prophage insertion, and is thus less likely to
disrupt cellular functions or viability; (2) integrant stability is usually high under
nonselective conditions; and (3) conservation of the attB sequence in different
bacteria, or flexibility in its recognition by the int-attP cassette, permits use of
these systems in a wide range of bacterial species (Alvarez et al., 1998; Auvray
et al., 1997; Van de Guchte et al., 1994; Venema et al., 1999).
Bacteriophage regulatory sequences and lysin genes can also be useful ele-
ments for biotechnology. As an example, a rapidly inducible and efficient heterol-
ogous gene expression system for Lc. lactis has been developed by incorporation
of a phage origin and middle promoter into a low copy number expression vector
(O’Sullivan et al., 1996). The system is triggered by deliberate infection with an
appropriate bacteriophage, which results in explosive vector replication (i.e., tar-
get gene amplification) coupled with phage-induced transcription of the target
DNA. Other workers have isolated a phage repressor-operator region that encodes
a mutant, temperature-sensitive repressor protein and demonstrated its use for
temperature-inducible gene expression in Lc. lactis (Nauta et al., 1997). Finally,
model studies indicate that phage lysin genes may have application in tightly
regulated suicide cassettes designed to induce starter lysis for accelerated cheese
maturation (De Ruyter et al., 1997).
III. GENE TRANSFER MECHANISMS
Modern genetics flows from the ability to manipulate living cells in ways that
heritably alter their physiological properties. This achievement has become possi-
ble through discovery and refinement of gene transfer mechanisms in bacteria
and higher cells. In this section, we will examine four types of gene transfer
processes that have been established in dairy LAB: transduction, protoplast fu-
sion, conjugation, and transformation. Although each has played some role in
the genetic analysis of dairy LAB, transformation and, to a lesser extent, conjuga-
268 Broadbent
tion have clearly emerged as the most useful methods for genetic manipulation
in these species.
A. Transduction
Transduction is a form of gene transfer which can result from inadvertent packag-
ing of host DNA within a bacteriophage virion during phage replication. Genetic
exchange is effected when the phage particle injects this DNA into another bacte-
rium. Phage-mediated gene exchange in LAB was first described by Sandine et
al. (1962), who noted transduction of tryptophan biosynthesis and streptomycin
resistance markers by a virulent Lc. lactis bacteriophage. This work was signifi-
cant in that it not only provided the first report of transduction in any LAB, it
also represented the first gene transfer system to be identified in a species that
was important to the fermented foods industry.
As a mechanism for gene transfer, transduction has been very useful for
genetic studies in many bacteria, and it supported some of the first genetic experi-
ments in the industrially important LAB. Researchers at the University of Minne-
sota, for example, used transducing temperate phages to establish that two indus-
trially critical traits, lactose-fermenting ability (Lac
H11001
) and proteinase activity
(Prt
H11001
), were encoded by plasmid DNA in Lc. lactis (McKay and Baldwin, 1974;
McKay et al., 1976). This observation was important because (1) it provided a
biological explanation for industry problems with stability of the acid-producing
phenotype (which requires Lac
H11001
and Prt
H11001
) in many dairy starter cultures (Sandine
et al., 1962); and (2) it presented a simple genetic strategy to alleviate the prob-
lem. The latter point is illustrated by the follow-up work of McKay and Baldwin
(1978), who isolated Lc. lactis transductants in which the lactose and proteinase
genes had integrated into the chromosome, and demonstrated that integration
dramatically enhanced the stability of these traits.
Plasmid transduction by virulent or temperate phages has also been demon-
strated in S. thermophilus, Lb. salivarius, and Lb. gasseri (Mercenier et al., 1988;
Raya et al., 1989; Toyama et al., 1971), but even though this form of gene transfer
helped to establish important genetics principles in Lc. lactis, it has not found
similar applications in other food-grade LAB. Much of the current disinterest in
transduction as a tool for genetic studies or improvements in LAB stems from
the relatively narrow host range of transducing phages and, more importantly,
development of more effective gene transfer systems such as conjugation and
transformation.
B. Protoplast Fusion
The protoplast fusion method of gene transfer is founded upon three key observa-
tions: (1) microbial or plant cell walls can be enzymatically removed without
Genetics of Lactic Acid Bacteria 269
deleteriously affecting viability; (2) intercellular membrane fusion can be effected
in the presence of polyethylene glycol; and (3) fusants can regenerate a new
wall on an appropriate medium. Appropriate selection after cell wall regeneration
yields hybrid cells with phenotypic attributes from both parental cell types (Al-
foldi, 1982). Gene transfer by protoplast fusion was first demonstrated in plants
by Kao and Michayluk (1974), but the technology was soon extended to bacteria
(Fodor and Alfoldi, 1976; Schaeffer et al., 1976).
The first protoplast fusion studies in LAB demonstrated exchange of both
plasmid-encoded and chromosomally encoded traits between strains of Lc. lactis
(Gasson, 1980; Okamoto et al., 1983). Reports of interspecific and even interge-
neric gene exchange among LAB followed (Cocconcelli et al., 1986; Iwata et
al., 1986; Kanatani et al., 1990; Smith, 1985), and the method has even seen
limited application for strain improvement (Stoianova et al., 1988). Overall, how-
ever, interest in protoplast fusion technology has never been high because of the
need to establish stringent protoplast formation and regeneration conditions for
individual strains (Alfoldi, 1982). Nonetheless, protoplast fusion may still be a
useful method to combine desirable traits (e.g., production of inhibitors or phage
defense systems) from distinct strains, species, or even genera into a single novel
bacterium.
C. Conjugation
Conjugation is a natural form of gene transfer in bacteria that requires physical
contact between viable donor and recipient cells. Because it facilitates horizontal
gene exchange among populations of both related and unrelated microorganisms,
conjugation has weighty implications on bacterial evolution and adaptation
(Arber, 2000; Firth et al., 1996). Genes required for conjugative transfer are typi-
cally located on self-transmissible plasmids and conjugative transposons, but
transfer of nonconjugative plasmids can also be effected via processes termed
donation and conduction (Steele and McKay, 1989). The former process applies
to nonconjugative plasmids that possess a specific sequence, called the origin of
transfer (oriT), that is required for DNA mobilization. Transfer of these plasmids
relies only upon trans-acting gene products from a conjugative element and not
on cointegrate formation between the nonconjugative and conjugative elements.
In contrast, plasmid transfer by conduction does require cointegration, because
the nonconjugative molecule lacks a functional oriT. Conclusive evidence for
plasmid mobilization by conduction is generally based on presence of cointegrate
plasmids in recipient cells (Steele and McKay, 1989).
As a genetics tool for dairy LAB, conjugation has proved especially useful
to study plasmid biology in Lc. lactis (Kondo and McKay, 1985; Steele and
McKay, 1989). An important outcome of this work has been the finding that
many industrially important traits, including lactose and casein utilization, bacte-
270 Broadbent
riophage resistance, and bacteriocin production, can be transferred by conjugation
(Gasson and Fitzgerald, 1994). This situation is of great practical value to the
dairy industry, because dairy LAB that are genetically improved by a ‘‘natural’’
process like conjugation are not subject to the regulatory and social constraints
that shackle the application of recombinant DNA. As a result, several groups
have used conjugation to genetically enhance bacteriophage resistance in com-
mercial Lc. lactis starter cultures (Klaenhammer and Fitzgerald, 1994) (see Sec.
IV.A for additional details).
Conjugation of native plasmids and chromosomal genes has not been docu-
mented as frequently among other dairy LAB, but the ability of many species to
participate in conjugation has been established through interspecific and interge-
neric transfers of broad host range plasmids such as pAMβ1. These observations
imply that conjugation may help to support genetics research in the many strains
of dairy LAB that still cannot be efficiently or reproducibly transformed (Gasson
and Fitzgerald, 1994; Thompson et al., 1999). In addition, conjugation appears
to be less sensitive than transformation to the size of the DNA to be transferred,
so mobilizable cloning vectors for LAB should also facilitate experiments with
relatively large DNA molecules. Systems for delivery of gene-cloning vectors
by conjugation have been developed, but efforts fully to exploit the versatility
of conjugation as a tool for dairy strain improvement would clearly benefit from
a more holistic understanding of conjugal mechanisms in dairy LAB (Romero
et al., 1987; Thompson et al., 1999).
At present, the most complete models for conjugation have emerged from
studies of the fertility (F) plasmids in gram
H11002
bacteria (Firth et al., 1996). From
those and other models, we can divide conjugal gene transfer into four basic
stages: (1) stable mating pair formation; (2) DNA mobilization; (3) DNA transfer;
and (4) mating pair resolution. In gram
H11002
cells, formation of stable cell-cell contact
requires sex pili which are produced by the donor cell. Gram
H11001
bacteria do not
produce pili, however, so stable mating pair formation between LAB must be
achieved through other mechanisms. In contrast, homologies between conjuga-
tion gene products and noncoding sequences required for DNA transfer suggest
that DNA processing and transfer events which follow stable cell-cell contact
may occur by similar mechanisms in gram
H11002
and gram
H11001
bacteria. This hypothesis
is further supported by the fact that conjugation between gram
H11002
and gram
H11001
bacte-
ria can occur bidirectionally (Trieu-Cuot et al., 1987, 1988).
In gram
H11002
hosts, establishment of a stable mating pair is believed to produce
an intracellular signal that initiates DNA mobilization. One strand of the conjuga-
tive DNA is cleaved by a conjugative relaxase at a specific locus (nic) within
oriT, and a DNA helicase unwinds the nicked strand in the 5′–3′ direction. The
displaced strand is then transported into the recipient cell in single-stranded form,
5′–3′, through a mating bridge that spans both cell membranes. Complementary
strand synthesis in the donor and recipient relies on host enzymes and is thought
Genetics of Lactic Acid Bacteria 271
to occur as DNA transfer proceeds. Once DNA transfer is complete, the mating
pair actively dissociates and the recipient assumes the conjugative phenotype of
the donor cell (for a detailed discussion of conjugal mechanisms in gram
H11002
bacte-
ria, see Firth et al., 1996).
The biochemistry of DNA processing and transfer is not nearly as well
understood in gram
H11001
bacteria, and much of the information that is available is
built from assumptions based on protein and nucleic acid sequence homologies.
Two important exceptions to this theme involve mechanisms for efficient mating
pair formation and DNA mobilization. In mating pair formation, very good mod-
els have emerged from studies of pheromone-inducible plasmid transfer in En.
faecalis and, to a lesser extent, from the Lc. lactis sex factor (Dunny and Leonard,
1997; Gasson et al., 1995; Mills et al., 1998). Sound models for DNA mobiliza-
tion in LAB have also come forward through studies of the streptococcal plasmids
pIP501 and pMV158 (Grohmann et al., 1999; Wang and Macrina, 1995).
1. Mating Pair Formation in Lactic Acid Bacteria: Pheromones
and Sex Factors
Unlike Lc. lactis and other dairy LAB, En. faecalis is a significant cause of human
morbidity and mortality, and conjugation in this species is intimately associated
with dissemination of antibiotic resistance genes and virulence factors (Dunny
and Leonard, 1997). For these reasons, conjugation in En. faecalis has been stud-
ied intensively for more than two decades, and the pheromone-induced plasmid
transfer system in this species is now one of the most thoroughly understood
mechanisms for efficient mating pair formation in gram
H11001
bacteria. Although En.
faecalis is not and should not be used as a dairy starter bacterium, this mechanism
has similarity to that used in lactose plasmid conjugation by Lc. lactis and there-
fore warrants some discussion here.
Several plasmid families and their distinct pheromones have been identified
in En. faecalis, but the most thoroughly characterized plasmids are pAD1 and
pCF10, which encode production of hemolysin and tetracycline resistance, re-
spectively. Stable mating pair formation in En. faecalis cells containing one of
these or another pheromone-induced conjugative plasmid is achieved by a pro-
tein-protein interaction that involves aggregation substance (AS) on donor cells
and enterococcal binding substance on the recipients. The genetic determinant
for AS production is located on pAD1, pCF10, and other pheromone-inducible
plasmids, and its expression is induced (along with genes for other conjugative
functions) by the presence of recipient-produced pheromone in the growth me-
dium (Dunny and Leonard, 1997).
The En. faecalis sex pheromones are small (seven to eight amino acids in
length), hydrophobic, and chromosomally encoded peptides. Most strains pro-
duce a number of distinct pheromones that individually can only act on cells that
272 Broadbent
contain a particular plasmid family member. Induction of pAD1 or pCF10 trans-
fer is initiated by internalization of its cognate pheromone (cAD1 or cCF10) into
donor cells via pAD1- or pCF10-encoded oligopeptide-binding proteins TraC or
PrgZ, respectively, and the chromosomally encoded oligopeptide transport sys-
tem (Opp). Once inside, the pheromone binds to an intracellular regulatory mole-
cule, which then directs expression of pAD1- or pCF10-encoded conjugation
genes. Interestingly, even though regulatory genes on pAD1 and pCF10 have a
similar organization and even some DNA sequence homology, induction of plas-
mid-coded conjugation genes apparently occurs through very distinct routes
(Dunny and Leonard, 1997). Nonetheless, induction results in AS production by
donor cells, which leads to rapid cell aggregation and mating pair formation.
After a recipient has successfully acquired any member of a particular plasmid
family, production of the cognate pheromone for that family is essentially
blocked, and the recipient assumes a conjugative phenotype identical to that of
the original donor (Dunny and Leonard, 1997).
a. Lactococcal Sex Factor Sex pheromone production has not been de-
tected in Lc. lactis or other dairy LAB, but efficient mating pair formation in the
former bacterium is effected by a 135-kD cell surface protein, CluA, that has
significant homology to the En. faecalis AS protein (Godon et al., 1994). The
gene encoding this protein, cluA, is located on the conjugative plasmid pRS01
in strain ML3 and on a homologous but chromosomally integrated sex factor in
the closely related strain 712. This element also encodes a conjugative relaxase
whose gene (ltrB, which contains the group II intron described in Sec. II.B.3)
lies just upstream of the pRS01 origin or transfer, as well as an enzyme (TraD)
that has homology to an Es. coli F plasmid product believed to facilitate transpor-
tation of ssDNA into recipient cells (Firth et al., 1996; Gasson et al., 1995; Mills
et al., 1998). The lactococcal sex factor shows great promise as a genetics tool
for LAB, because it can consummate intergeneric conjugation between Lc. lactis
and lactobacilli, leuconostocs, pediococci, O. oeni, and S. thermophilus (D.A.
Mills, personal communication). Furthermore, as an integrated element in the
host chromosome, the sex factor can reportedly mobilize chromosomal gene
transfer in a counterclockwise direction (Gasson et al., 1995).
Discovery and characterization of the sex factor evolved from detailed stud-
ies of lactose plasmid conjugation in Lc. lactis ML3 and 712 (Dunny and McKay,
1999; Gasson et al., 1995). Lactose-fermenting ability (Lac
H11001
) in these two strains
(and several others) is encoded by a nonconjugative 55-kb plasmid, but Lac
H11001
can
be transferred by conjugation to other lactococci at low frequency. Some Lac
H11001
transconjugants from these donors form very tight cell aggregates (Clu
H11001
) and are
able to transfer Lac
H11001
in secondary matings at frequencies 10
2
-to10
5
-fold higher
than those obtained with the parental strains. Genetic analysis revealed that all
Clu
H11001
and some Clu
H11002
transconjugants contained a novel 104-kb plasmid formed
Genetics of Lactic Acid Bacteria 273
by ISS1-mediated cointegration between the lactose plasmid (which carries two
copies of the IS) and the sex factor. Further study showed lactose plasmid cointe-
gration with the sex factor could occur in more than one orientation, and it was
this feature that appeared to determine whether or not a transconjugant was Clu
H11001
(Dunny and McKay, 1999; Gasson et al., 1995). The mechanism(s) by which
cointegrate formation induces cluA expression is not yet clear, but the absence
of a consensus lactococcal promoter sequence immediately upstream of the cluA
gene has led to speculation that it may involve a promoter in ISS1 (Gasson and
Fitzgerald, 1994; Godon et al., 1994). Other factors must also affect cluA expres-
sion, however, because high-frequency transfer of the sex factor itself has also
been documented (Gasson, 1995). Nonetheless, the role of CluA in cell aggrega-
tion, and the influence of aggregation on conjugation efficiency, are well estab-
lished (Anderson and McKay, 1984; Godon et al., 1994; Wang et al., 1994).
Additional evidence for a functional analogy between En. faecalis and Lc.
lactis mechanisms for efficient mating pair formation was provided by Van der
Lelie et al. (1991), who showed the Clu
H11001
phenotype in Lc. lactis may actually
involve an interaction between CluA and another lactococcal cell surface compo-
nent called aggregation substance (Agg). The genetic determinant(s) for Agg has
not yet been identified, but the substance appears to be synthesized constitutively
by many, although not all, lactococci. Thus, self aggregation only occurs when
both cell surface components are expressed by the same bacterium, but efficient
mating pair formation can occur between CluA
H11002
Agg
H11001
recipients and donor cells
that are either CluA
H11001
Agg
H11001
(phenotypically Clu
H11001
) or CluA
H11001
Agg
H11002
(phenotypically
Clu
H11002
). Taken together, these and other reports of efficient conjugation systems
in gram
H11001
bacteria (Jensen et al., 1996; Reniero et al., 1992) indicate that protein-
mediated donor and recipient aggregation may be an important mechanism for
efficient mating pair formation in bacteria that do not produce pili.
2. DNA Mobilization
In contrast to mechanisms for mating pair formation, DNA mobilization in LAB
and other gram
H11001
bacteria appears to occur through a process very similar to that
used by gram
H11002
cells (Climo et al., 1996; Grohmann et al., 1999; Guzma′n and
Espinosa, 1997; Wang and Macrina, 1995). Mobilization begins with binding of
a conjugative relaxase (frequently called a mobilization or Mob protein) at oriT
to form a nucleoprotein complex called a relaxosome, which may or may not
include additional proteins. All self-transmissible elements possess an oriT, and
as was noted earlier, this cis-acting locus is also found on nonconjugative mobiliza-
ble plasmids (which also usually encode a trans-acting relaxase) that can be trans-
ferred by donation. The relaxosome initiates DNA transfer by cleaving one strand
of the DNA at the nic locus, and then the relaxase remains bound to the 5′ end
of the oriT locus as DNA transfer proceeds. Biochemically, reactions surrounding
274 Broadbent
nucleophilic attack by the relaxase on a specific phosphodiester bond in nic bear
a strong resemblance to those performed by Rep protein during initiation of roll-
ing-circle plasmid replication (see Sec. II.A.1) (Guzma′n and Espinosa, 1997).
Genes encoding conjugative relaxases and oriT regions (which typically
are very close to one another) have been identified on self-transmissible and mo-
bilizable elements in several LAB species (An and Clewell, 1997; Dougherty et
al., 1998; Guzma′n and Espinosa, 1997; Jaworski and Clewell, 1995; Mills et al.,
1998; Van Kranenburg and De Vos, 1998; Wang and Macrina, 1995). Like oriT
regions from other bacteria, most LAB oriT sequences contain a short conserved
sequence that can be used to classify these elements into one of three homology
groups represented by the nic regions from gram-F-like, IncP, and IncQ plasmids.
Exceptions to this observation include the streptococcal plasmid pMV158 and a
few other RCR plasmids in LAB, whose oriT regions encompass a homologous
sequence named RS
A
that is also involved in RCR plasmid cointegration (Guzma′n
and Espinosa, 1997). Nonetheless, all of the oriT sequences that have been char-
acterized in LAB (including members of the pMV158 family) contain a noncon-
served inverted repeat immediately upstream of the conserved nic region (Table
3). A similar structural arrangement exists in the oriT regions of gram
H11002
plasmids,
where the inverted repeat is thought to be involved in termination of DNA transfer
(Lanka and Wilkins, 1995).
Mobilization of nonconjugative DNA in LAB can also occur by conduc-
tion. The most extensively characterized event of this type in dairy LAB is lactose
plasmid conduction by the Lc. lactis sex factor (see Sec. III.C.1), where plasmid
cointegration is mediated by either of two ISS1 elements on the lactose plasmid.
Natural conduction of other plasmids following IS-mediated cointegration has
also been reported in this species (Romero and Klaenhammer, 1990).
In addition, plasmid cointegrates can be produced by homologous recombi-
nation between conjugative and nonconjugative elements, and systems based on
this type of plasmid mobilization have been used to transfer gene cloning vectors
to various LAB that resist transformation (Romero et al., 1987; Smith and Clew-
ell, 1984; Thompson et al., 1999). Very efficient plasmid conduction can also be
induced through cointegration of the conjugative streptococcal plasmid pIP501
with nonconjugative plasmids that are provided with a short, palindromic, recom-
binational ‘‘hot spot’’ from pIP501 (Langela et al., 1993).
In summary, conjugation is an important instrument for biotechnology in
dairy LAB because it provides researchers with a food-grade mechanism for ge-
netic strain improvements, and because it can facilitate genetics research in strains
that are difficult to transform. As was noted at the beginning of this section,
however, efforts to exploit the versatility of conjugation for these purposes would
be served from a more complete understanding of conjugation in LAB. Though
much can be inferred from protein and nucleic acid sequence homologies that
exist between conjugation systems of gram
H11001
and gram
H11002
bacteria, it is important
Genetics
of
Lactic
Acid
Bacteria
275
Table 3 Representative Structures for the Origin of Conjugative Transfer (oriT) in Lactic Acid Bacteria
a
Host genus oriT Family
c
and element Type
b
Nucleotide sequence (5′-3′) (reference)
Enterococcus
Tn916
d
c CAGTCCACGCAGGCGACGTGCGAAGCGGAAGTCGCAGGTGTGGACTGATCTTGCT F-like (Jaworski and
Clewell, 1995)
pAD1 c AGGGTATGAAAATCATACCCTGCCAAAA IncP (An and Clewell,
1997)
Lactobacillus
pLAB1000
e
m ACTTTATAACATAAAGTATAGTGGGTTATACTTTA pMV158 (Josson et al.,
1990)
Lactococcus
pRS01
f
c TTTTTTAACATTGTAAACAAGCTCATTGCGCCCCTCCTTC IncQ (Mills et al.,
1998)
pNZ4000
g
m ACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTGATAGCTTGCAGTA IncP (Van Kranenburg
and De Vos, 1998)
Streptococcus
pIP501 c ATACGAAGTAACGAAGTTACTGCGTATAAGTGCGCCTTAGT IncQ (Wang and Mac-
rina, 1995)
pMV158 m ACTTTATGAATATAAAGTATAGTGTGTTATACTTTACATG pMV158 (Guzma′n and
Espinosa, 1997)
??????????→ ←??????????
?????→ ←?????
???→ ←???
???→ ←????
???????→ ←???????
???????→ ←??????? ↓
????→ ←??? ↓
a
Inverted repeat sequences and defined nic sites are indicated by horizontal and vertical arrows, respectively.
b
Abbreviations: c H11005 conjugative (self-transmissible), m H11005 mobilizable.
c
Classification scheme based on nucleotide sequence homology to oriT regions from gram-negative F-like, IncP, or IncQ plasmids, or from the streptococcal
plasmid pMV158.
d
The Tn916 oriT has been localized to a 466-bp fragment, but the sequence displayed is actually one of three sites in this region that show homology to
the nic regions of F-like (shown) or IncP plasmids.
e
Identification of this oriT region is based entirely on sequence homology to pMV158 (Guzma′n and Espinosa, 1997).
f
The pRS01 oriT has been localized to a 446 bp PstI-XbaI fragment, but the displayed sequence is actually one of five sites within this region that show
homology to the nic regions of IncQ (shown), F-like, or IncP plasmids.
g
pNZ4000 contains two identical and functional copies of this sequence.
276 Broadbent
to recognize that many conjugation genes from LAB lack significant homology
to any known proteins. Although these observations may largely reflect the mech-
anistic differences that are imposed by absence of pili, it is also plausible that
some processes for DNA transfer and mating pair resolution in gram
H11001
bacteria
are quite different from those seen in gram
H11002
cells and even from one another
(Dougherty et al, 1998; Wang and Macrina, 1995). For this reason, it is encourag-
ing to note recent growth in nucleotide sequence data for conjugal elements in
dairy LAB (Burrus et al., 2000; Dougherty et al., 1998; Godon et al., 1994; Mills
et al., 1996, 1998; Van Kranenburg and De Vos, 1998), because this information
should stimulate more fundamental examinations of conjugation in these very
important bacteria.
D. Transformation
Transformation is the process wherein free DNA molecules are introduced into
cells. The power of an efficient and reproducible transformation system is that
it permits us to manipulate genes in vitro and then analyze the consequences on
in vivo molecular and cellular functions. Many bacteria, including some species
of nondairy streptococci, can assume a ‘‘competent’’ state that allows them to
take up DNA from their environment (Havarstein et al., 1997). This ability is
determined by a set of unique genes that encode proteins for extracellular DNA
binding, uptake, and integration. Expression of host competence genes is induced
when the concentration of a host-secreted, competence-stimulating peptide (i.e.,
a competence pheromone) in the medium reaches a critical threshold. Natural
competence has not been demonstrated in any of the food-grade LAB, but Bolotin
et al. (1999) recently reported that the Lc. lactis genome appears to contain a
complete set of competence genes.
In the absence of natural competence, the most effective method for trans-
formation in most bacteria is electroporation. When cellular membranes are ex-
posed to a high-voltage electric field, they become polarized and a voltage poten-
tial develops across the membrane. Electroporation technology is based upon the
discovery that when this potential exceeds a certain threshold, localized break-
down of the membrane forms pores that render the cell permeable to extraneous
molecules (Ho and Mittal, 1996). Under conditions that may be established exper-
imentally, pore formation is reversible and cells remain viable. The mechanism
for entry of DNA or other molecules into cells by electroporation is still unknown,
but the availability of inexpensive and reliable commercial equipment has made
electroporation the method of choice for transformation of many bacteria, fungi,
and higher cells (Lurquin, 1997).
The first reports of transformation by electroporation (electrotransforma-
tion) in dairy LAB appeared in 1987, and by the end of that decade the technology
Genetics of Lactic Acid Bacteria 277
had been successfully applied to Lc. lactis, S. thermophilus, and many species
of Lactobacillus and Leuconostoc (Chassy and Flickinger, 1987; David et al.,
1989; Harlander, 1987; Hashiba et al., 1990; Luchansky et al., 1988; Powell et
al., 1988; Somkuti and Steinberg, 1988). One of the most encouraging observa-
tions to emerge from this and subsequent research is that a single electroporation
protocol can often effect transformation of different strains and even different
genera of LAB. Thus, even though parameters for optimal electrotransformation
of an individual strain will usually need to be established, a general protocol can
frequently provide the starting point for such research.
Another important finding is that electrotransformation frequencies are fre-
quently higher and more reproducible if the thick murein layer is weakened before
electroporation (Bhowmik and Steele, 1993; Buckley et al., 1999; Dunny et al.,
1991; Hashiba et al., 1990; Holo and Nes, 1989; Posno et al., 1991; Powell et
al., 1988; Walker et al., 1996; Wei et al., 1995). This is usually achieved by
propagating cells in a medium that contains relatively high concentrations of
glycine or D/L-threonine, which interfere with cell wall synthesis and assembly.
It should be recognized, however, that inhibition of cell wall synthesis is not
essential for efficient electroporation of some LAB, and in certain instances it
may even be counterproductive (Berthier et al., 1996; Luchansky et al., 1988;
Marciset and Mollet, 1994; Wycoff et al., 1991).
Today, representative strains from virtually all industrially important dairy
LAB species have been successfully transformed by electroporation, but individ-
ual strains from some species—and particularly lactobacilli—are still difficult
or even impossible to transform by any known method. Moreover, even among
LAB that can be electroporated, only a very few strains can be reproducibly
transformed at frequencies greater than 10
4
transformants per microgram of exog-
enous DNA (Berthier et al., 1996; Holo and Nes, 1989; Marciset and Mollet,
1994; Posno et al., 1991; Wycoff et al., 1991). Some factors that appear to limit
efficiency of electrotransformation in LAB include (1) culture growth phase, con-
centration, and membrane lipid composition; (2) host-encoded restriction/modi-
fication systems; and (3) vector size, purity, and compatibility with endogenous
host plasmids (Aukrust and Blom, 1992; Hashiba et al., 1990; Luchansky et al.,
1988; Posno et al., 1991; Van der Lelie et al., 1988). Regardless of its molecular
basis, the broad variability in electroctransformation efficiency that exists among
dairy LAB is unfortunate, because the proficiency at which cells can be trans-
formed is directly related to the ease and flexibility by which recombinant DNA
technologies can be employed for genetics research. It is largely for this reason
that many LAB researchers pursue a strategy wherein gene cloning and character-
ization are done in Es. coli, where electrotransformation efficiencies commonly
exceed 10
8
/μg DNA, after which time DNA constructs are moved into the LAB
of interest by electroporation. This approach suffers from several limitations,
278 Broadbent
however, and genetics research in dairy LAB would clearly profit from a more
fundamental understanding of electrotransformation in these species.
1. Gene Delivery Systems
Vectors for gene cloning in dairy LAB can be divided into two fundamental
categories: (1) extrachromosomal vectors that maintain cloned DNA on an auton-
omously replicating plasmid and (2) integrative vectors that are designed to insert
cloned DNA into the host chromosome. The definitive differences between these
elements are that the latter group are incapable of independent replication in the
host species of interest (i.e., suicide vectors), and they contain specific sequences
that promote vector integration into the host chromosome (see below). Some
features common to both types of cloning vectors include (1) they encode a se-
lectable phenotype that allows transformed cells to be easily distinguished from
nontransformed cells; (2) they possess a ‘‘multiple cloning region’’ that is rich
in unique restriction endonuclease cleavage sites and where foreign DNA can be
inserted into the vector without damage to replication/integration or selection
functions; and (3) they are usually small so that recombinant constructs can be
more easily transformed into host cells. Some cloning vectors will also encode
a second selective phenotype that is abolished by DNA insertions in the multiple
cloning region. Loss of that phenotype is then used to discern transformants that
contain recombinant molecules from those that only acquire vector DNA.
a. Replicative Vectors The first cloning experiments in dairy LAB em-
ployed replicative vectors that were developed for nondairy streptococci and en-
terococci, but a number of high- and low-copy number replicative vectors have
since been built from the RCR and theta plasmid replicons found in dairy species
(De Vos and Simons, 1994; Kondo and McKay, 1985; Von Wright and Sibakov,
1998; Wang and Lee, 1997). Many of these vectors (particularly those based on
RCR replicons) (see Sec. II.A.1) have a broad host range and therefore offer the
added advantage of serving as shuttle vectors for B. subtilis or Es. coli, where
DNA manipulation techniques are particularly well established.
In addition to simple replicative vectors, identification and characterization
of LAB gene expression signals and regulatory sequences has permitted construc-
tion of more specialized cloning vectors designed to facilitate constitutive or
inducible expression of foreign DNA or heterologous protein secretion (De Vos
and Simons, 1994; Kahala and Palva, 1999; Kok, 1996; Savijoki et al., 1997;
Venema et al., 1999). Access to effective gene expression and protein secretion
systems for dairy LAB is a particularly important advancement, because one of
the most economically significant applications of biotechnology involves use of
microorganisms to produce large amounts of industrially useful proteins. The
worldwide industrial enzyme market, for example, has a value in excess of
Genetics of Lactic Acid Bacteria 279
$1.2 billion per year (excluding pharmaceutical uses) with food industry applica-
tions comprising 40% of this market (Williams, 1998). Most of these enzymes
are produced by fermentation with genetically modified bacteria, yeasts, and
molds, and it is reasonable to assert that food-grade microorganisms such as
dairy LAB may offer unique advantages as unicellular factories for production
of enzymes (or other proteins) that are intended for use in human food.
b. Integrative Gene Cloning As is outlined in Section II.A.1, native plas-
mids and replicative vectors are vulnerable to segregational and structural stabil-
ity problems that can result in permanent loss of plasmid-coded traits. Integration
vectors avoid this problem by recombining with the host chromosome. These
constructs are typically assembled in a permissible host such as Es. coli, and
then transferred by electroporation into the (nonpermissive) LAB of interest. Two
mechanisms that have been used to direct random or site-specific vector integra-
tion into the LAB chromosome include IS-mediated transposition and the int-
attP functions from temperate bacteriophages, respectively (see Sec. II.B and
II.D.2 for details and references). The most common scheme for vector integra-
tion in dairy LAB, however, relies on host mechanisms for homologous DNA
recombination (Leenhouts, 1990). These systems typically contain a fragment of
the LAB host chromosome which serves as a substrate for site-specific, homolo-
gous DNA recombination via single- or double-strand crossover. Single crossover
recombination results in integration of the entire vector, whose sequence will
be flanked by direct repeats of the cloned chromosomal fragment. One of the
consequences of single crossover plasmid integration is that the homologous re-
peats formed by integration make the entire structure susceptible to gene amplifi-
cation.
In contrast, double crossover recombination results in the exclusive integra-
tion of vector sequences that lie between the two recombination sites, with con-
comitant loss of the corresponding region of the native host chromosome and
any extraneous vector sequences. Thus, double crossover recombination is often
called replacement recombination. Unfortunately, replacement recombination is
a low-frequency event, which limits its application in strains that suffer from a
poor transformation efficiency. To overcome this problem, many researchers have
abandoned suicide replicons in favor of vectors that display conditional (e.g.,
temperature-sensitive) replication in the LAB host of interest (Bhowmik and
Steele, 1993; Low et al., 1998; Maguin et al., 1992). With these molecules, trans-
formation efficiency and integration events can be uncoupled as transformants
are selected under conditions that permit autonomous replication. Next, single
crossover integrants are obtained by shifting a population of transformants to
nonpermissive conditions, and then a second crossover event is stimulated by
returning integrants to the permissive environment.
Aside from their applications in DNA cloning, integration vectors—partic-
280 Broadbent
ularly those that effect replacement recombination—are also invaluable to func-
tional genetics research. This is because they facilitate the construction, by gene
knockouts, of isogenic mutants that differ only by the action of a single polypep-
tide. By comparing the wild-type culture to its isogenic derivative, the role of
that polypeptide (and its gene) in LAB cellular or industrial processes can be
unequivocally established.
c. Food-Grade Gene-Cloning Systems More than two decades of inten-
sive and worldwide research efforts have given us a tremendous understanding
of biochemistry and genetics in dairy LAB. Important biochemical pathways have
been elucidated, gene transfer systems have been developed for many strains, a
great number of important genes (even entire chromosomes!) have been charac-
terized at the nucleotide sequence level, and mechanisms for gene expression
and protein secretion have been identified. To apply this knowledge toward indus-
trial strain improvements, however, it is imperative that we have gene-delivery
systems that of themselves do not present a safety concern in human food applica-
tions. The most important attributes of these systems, which are termed food-
grade vectors, is that they be genetically well defined and not impart any antibiotic
resistance gene to the host bacterium. The latter requirement is readily met by
vectors that effect replacement recombination, but integrative or replicative gene-
delivery systems whose selectable marker will be retained in the host must encode
a food-grade alternative to antibiotic resistance. Examples of food-grade selection
systems that have been used to satisfy this requirement include auxotrophic com-
plementation, resistance to nisin or other LAB bacteriocins, and ability to ferment
new carbohydrates (Allison and Klaenhammer, 1996; De Vos and Simons, 1994;
Hashiba et al., 1992; Leenhouts et al., 1998; Lin et al., 1996; S?renson et al.,
2000).
IV. GENETIC IMPROVEMENT OF INDUSTRIAL DAIRY
LACTIC ACID BACTERIA
Modern genetics research is founded upon the power to establish cellular and
molecular functions through DNA manipulation, and LAB played an important
role in the origin of this technology. In their landmark research on the ‘‘trans-
forming principle’’ of S. pneumoniae, Avery and coworkers (1944) not only
proved that DNA was the molecule of heredity, they also recognized the distinc-
tion between genetic material (DNA) and products of its expression (in this in-
stance a capsular exopolysaccharide). In his discussion, Avery wrote:
Thus, it is evident that the inducing substance and the substance produced
in turn are chemically distinct and biologically specific in their action . . .’’;
that these induced changes ‘‘are predictable, type-specific, and heritable.’’;
Genetics of Lactic Acid Bacteria 281
and therefore ‘‘If . . . desoxyribonucleic acid actually proves to be the trans-
forming principle. . . ., then nucleic acids of this type must be regarded not
merely as structurally important but as functionally active in determining the
biochemical activities and specific characteristics of pneumococcal cells.
Today, our ability to manipulate animals, plants, and microorganisms ge-
netically to manufacture, modify, or improve products or processes has blos-
somed into a multibillion dollar enterprise that has revolutionized pharmaceutical,
chemical, and agricultural industries. Many of the most exciting and successful
industrial applications of biotechnology involve microbial products or whole mi-
croorganisms. In the agricultural sector, for example, microbial biotechnology
has become an integral component of modern plant and animal production, ag-
ricultural waste management, and food processing operations. Although many
of these applications rely on naturally occurring cells or cell products, use of
recombinant DNA-derived microbial products in agricultural and food systems
is now commonplace. However, a similar statement does not apply to live, geneti-
cally modified microorganisms (GMMs), whose applications in food and agricul-
ture has essentially been drowned in a whirlpool of scientific, political, and social
controversies. The undercurrents that created this vortex are complex and beyond
the scope of this chapter; suffice it to say that in addition to scientific and regula-
tory hurdles, the sociopolitical climate regarding use of recombinant DNA tech-
nology in food systems ranges from outright opposition (e.g., Western Europe,
Australia, and New Zealand) to cautiously acquiescent (e.g., North America and
parts of Asia). A variety of genetically modified agricultural plants are now in
commercial production in the latter countries, but general opposition to genetic
engineering in agriculture will probably continue to resonate through the sociopo-
litical agendas of most other states for years to come. Change will come, but it
will come faster if academicians, industry scientists, and governmental represen-
tatives work to facilitate open and reasoned public discussion on risks and benefits
of biotechnology in agriculture, and to promulgate sound scientific guidelines
and policies.
As we consider commercial applications for genetically modified starter
LAB, it is important to recognize a few basic principles: (1) dairy starter technol-
ogy can be traced to the late 19th century, and the long history of safe application
of LAB in human food means dairy starter bacteria have GRAS status (generally
regarded as safe for use in food by governmental regulatory agencies such as the
U.S. Food and Drug Administration); (2) our knowledge of LAB genetics and
physiology has already identified very clear strategies to improve the industrial
performance of dairy LAB; and (3) many of these improvements can be effected
by mutation or natural gene transfer (e.g., conjugation). From this perspective,
one can envision several simple, yet industrially valuable, genetic alterations to
dairy LAB that do not undermine the GRAS status of these bacteria or influence
the nutritional composition of fermented dairy foods. Two examples of genetic
282 Broadbent
improvements that meet these criteria involve intraspecific transfer of native plas-
mids and by directed metabolic engineering through natural mutation.
A. Enhanced Phage Resistance by Intraspecific Transfer
of Native Plasmids
As noted in Table 1 and Section III.C, bacteriophage resistance is one of several
industrially important traits that may be encoded by plasmid DNA in lactococci,
and many lactococcal phage resistance plasmids can be transferred by conjuga-
tion (Klaenhammer and Fitzgerald, 1994). Since conjugation is a natural form
of gene transfer, dairy LAB that are genetically improved by this process do
not command the regulatory and sociopolitical attention that is directed toward
recombinant DNA technology. Sanders and coworkers (1986) were the first to
capitalize on this fortuitous situation when they introduced pTRK2030, a conju-
gative lactococcal plasmid that encodes restriction/modification and abortive in-
fection phage defense mechanisms, into commercial Cheddar cheese starter bac-
teria. This general strategy has since been emulated by other researchers
(Klaenhammer and Fitzgerald, 1994), and conjugation-derived, bacteriophage-
insensitive dairy starter cultures have been commercially available for many
years.
Conjugation has also been used to obtain strains that contain two or more
plasmids encoding complementary phage defense systems (Klaenhammer and
Fitzgerald, 1994). This capability led Sing and Klaenhammer (1993) to propose
an ingenious phage resistance strategy that is based upon rotation of different
restriction/modification and abortive phage defense mechanisms within a single-
strain Lc. lactis starter background. Those investigators showed that rotation of
isogenic phage-resistant derivatives—which differ in the types and specificities
of phage defense mechanisms they encode—not only thwarts bacteriophage pro-
liferation, it actually removes contaminating phages from the culture medium
(because of the combined action of multiple abortive phage defense systems).
By restricting the starter system to a single strain, this strategy also acts to reduce
the potential for emergence of new phages in the dairy processing environment.
Although intraspecific conjugation of native phage resistance plasmids has
been of great benefit to the dairy industry, the flexibility of this strategy is clearly
limited to plasmids that are self-transmissible or mobilizable (see Sec. III.C). In
some countries, this limitation has been overcome by electroporation with native
phage resistance plasmids, and starter lactococci that have been improved by this
process are now in widespread commercial use.
B. Metabolic Engineering for Diacetyl Production
Diacetyl is an industrially important ‘‘buttery’’ flavor and aromatic compound
that is derived from citrate metabolism by LAB. Recent advances in our under-
Genetics of Lactic Acid Bacteria 283
standing of the genetics of citrate metabolism and mechanisms for diacetyl pro-
duction have yielded several useful strategies to metabolically engineer Lc. lactis
strains for enhanced diacetyl production (De Vos, 1996). One of the most promis-
ing avenues toward this goal involves inactivation of the gene encoding α-aceto-
lactate decarboxylase (aldB), the enzyme that converts α-acetolactate to acetoin
(see Fig. 10 in Chap. 7). This approach results in accumulation of α-acetolactate,
the immediate precursor to diacetyl, which in turn leads to an increased concentra-
tion of diacetyl in the growth medium.
Inactivation of aldB can, of course, be directly achieved by replacement
recombination (Swindell et al., 1996), but naturally occurring aldB mutants can
also be isolated by growth selection in a medium that contains leucine but not
valine. The latter approach is possible because α-acetolactate also serves as an
intermediate compound in biosynthesis of leucine and valine, and leucine is an
allosteric activator of α-acetolactate decarboxylase (Goupil-Feuillerat et al.,
1997). Thus, wild-type lactococci cannot grow in such a medium, because leucine
stimulates conversion of α-acetolactate to acetoin, leaving none to support valine
biosynthesis. Any aldB mutants in the population, however, are able to synthesize
valine in the presence of leucine and so will continue to grow. Regrettably, the
industrial utility of this strategy is rather limited, because most commercial Lc.
lactis strains are auxotrophic for branched-chain amino acids. To overcome this
limitation, Curic et al. (1999) developed an inventive strategy wherein industrial
strains are first transformed with recombinant plasmid-encoding enzymes for
branched-chain amino acid biosynthesis. Selection for naturally occurring aldB
mutants in the transformants can then be done as outlined above, and food-grade
variants of that population obtained by subsequent plasmid curing. Since the final
product of this work is a completely natural mutant that lacks any foreign DNA,
strains that are improved by this approach are likely to see commercial application
in the very near future.
V. SUMMARY
Academic and industrial research efforts over the last quarter century have gener-
ated a solid appreciation for the physiology and genetics of dairy LAB. Most
recent and significant advances in LAB physiology are derived from studies made
possible by recombinant DNA technology. The great advantage of this technol-
ogy in analysis of cellular and industrial processes of LAB is that it facilitates
construction of isogenic mutants that differ only by the action (knockout mutants)
or relative activity (overexpression mutants) of one or more defined polypeptides.
By contrasting the phenotype of the wild-type culture to its isogenic derivative,
the role of that polypeptide in a given process can often be explicitly defined.
The knowledge that is accumulated from this work can then be used to isolate or
construct, by several different mechanisms, new strains with enhanced industrial
284 Broadbent
utility. This approach has already provided industry with strains that are better
able to resist bacteriophage infection or produce higher levels of diacetyl. With
the advent of food-grade recombinant DNA technologies, the potential for com-
mercialization of value-added LAB that have been developed through gene addi-
tions, modifications, or deletions, is truly great. With this knowledge base, it is
anticipated that the dairy industry will soon see more widespread application of
genetic technologies in ways that provide innovation and vitality to the fermented
milk industry for years to come.
REFERENCES
Ackermann HW. Tailed bacteriophages: the order Caudovirales. Adv Virus Res 51:135,
1999.
Actis LA, Tolmasky ME, Crosa JH. Bacterial plasmids: replication of extrachromosomal
genetic elements encoding resistance to antimicrobial compounds. Front Biosci 4:
D43, 1999.
Alegre MT, Rodriguez MC, Mesas JM. Nucleotide sequence analysis of pRS1, a cryptic
plasmid from Oenococcus oeni. Plasmid 41:128, 1999.
Alfoldi L. Fusion of microbial protoplasts: problems and perspectives. In: Hollaender A,
DeMoss RD, Kaplan S, Konisky J, Savage D, Wolf RS, eds. Genetic Engineering
of Microorganisms for Chemicals. New York: Plenum Press, 1982, p 59.
Allison GE, Klaenhammer TR. Functional analysis of the gene encoding immunity to
lactacin F, lafI, and its use as a Lactobacillus-specific, food-grade genetic marker.
Appl Environ Microbiol 62:4450, 1996.
Altermann E, Klein JR, Henrich B. Primary structure and features of the genome of the
Lactobacillus gasseri temperate bacteriophage ?adh. Gene 236:333, 1999.
Alvarez MA, Herrero M, Sua′rez JE. The site-specific recombination system of the Lacto-
bacillus species bacteriophage A2 integrates in gram-positive and gram-negative
bacteria. Virology 250:185, 1998.
Alvarez MA, Rodr?′guez A, Sua′rez JE. Stable expression of the Lactobacillus casei bacte-
riophage A2 repressor blocks phage propagation during milk fermentation. J Appl
Microbiol 86:812, 1999.
An FY, Clewell DB. The origin of transfer (oriT) of the enterococcal, pheromone-re-
sponding, cytolysin plasmid pAD1 is located within the repA determinant. Plasmid
37:87, 1997.
Anderson DG, McKay LL. Genetic and physical characterization of recombinant plasmids
associated with cell aggregation and high frequency conjugal transfer in Streptococ-
cus lactis ML3. J Bacteriol 156:954, 1984.
Arber W. Genetic variation: molecular mechanisms and impact on microbial evolution.
FEMS Microbiol Rev 24:1, 2000.
Arihara K, Luchansky JB. Dairy lactobacilli. In: Hui YH, Khachatourians GG, eds. Food
Biotechnology: Microorganisms. New York: VCH, 1995, p 609.
Auad L, Raisanen L, Raya RR, Alatossava T. Physical mapping and partial genetic charac-
terization of the Lactobacillus delbrueckii subsp. bulgaricus bacteriophage lb539.
Arch Virol 144:1503, 1999.
Genetics of Lactic Acid Bacteria 285
Aukrust T, Blom H. Transformation of Lactobacillus strains used in meat and vegetable
fermentations. Food Res Int 25:253, 1992.
Auvray, F, Coddeville M, Ritzenthaler P, Dupont L. Plasmid integration in a wide range
of bacteria mediated by the integrase of Lactobacillus delbrueckii bacteriophage
mv4. J Bacteriol 179:1837, 1997.
Avery OT, MacLeod CM, McCarty M. Studies on the chemical nature of the substance
inducing transformation of pneumococcal types: Induction of transformation by a
desoxyribonucleic acid fraction isolated from Pneumococcus type III. J Exp Med
79:137, 1944.
Axelsson L. Lactic acid bacteria: classification and physiology. In: Salminen S, von Wright
A, eds. Lactic Acid Bacteria: Microbiology and Functional Aspects. 2nd ed. New
York: Marcel Dekker, 1998, p 1.
Bak AL, Christiansen C, Stenderup A. Bacterial genome sizes determination by DNA
renaturation studies. J Gen Microbiol 64:377, 1970.
Belfort M, Reaban ME, Coetzee T, Dalgaard JZ. Prokaryotic introns and inteins: a panoply
of form and function. J Bacteriol 177:3897, 1995.
Benachour A, Frere J, Flahaut S, Novel G, Auffray Y. Molecular analysis of the replication
region of the theta-replicating plasmid pUCL287 from Tetragenococcus (Pediococ-
cus) halophilus ATCC33315. Mol Gen Genet 255:504, 1997.
Berthier F, Zagorec M, Champomier-Verges M, Ehrlich SD, Morel-Deville F. Efficient
transformation of Lactobacillus sake by electroporation. Microbiology 142:1273,
1996.
Bhowmik T, Marth EH. Role of Micrococcus and Pediococcus species in cheese ripening:
a review. J Dairy Sci 73:859, 1990.
Bhowmik T, Steele JL. Gene replacement in Lactobacillus helveticus. J Bacteriol 175:
6341, 1993.
Biet F, Cenatiempo Y, Fremaux C. Characterization of pFR18, a small cryptic plasmid
from Leuconostoc mesenteroides ssp. mesenteroides FR52, and its use as a food
grade vector. FEMS Microbiol Lett 179:375, 1999.
Bolotin A, Mauger S, Malarme K, Ehrlich SD, Sorokin A. Low-redundancy sequencing
of the entire Lactococcus lactis IL1403 genome. Antonie van Leeuwenhoek 76:27,
1999.
Botstein D. A theory of modular evolution for bacteriophages. Ann NY Acad Sci 354:
484, 1980.
Bourgoin F, Gue′don G, Pebay M, Roussel Y, Panis C, Decaris B. Characterization of a
mosaic ISS1 element and evidence for the recent horizontal transfer of two different
types of ISS1 between Streptococcus thermophilus and Lactococcus lactis. Gene
178:15, 1996.
Bourgoin F, Gue′don G, Gintz B, Decaris B. Characterization of a novel insertion sequence,
IS1194,inStreptococcus thermophilus. Plasmid 40:44, 1998.
Bourgoin F, Pluvinet A, Gintz B, Decaris B, Guedon G. Are horizontal transfers involved
in the evolution of the Streptococcus thermophilus exopolysaccharide synthesis
loci? Gene 233:151, 1999.
Brisson-Noel A, Arthur M, Courvalin P. Evidence for natural gene transfer from gram-
positive cocci to Escherichia coli. J Bacteriol 170:1739, 1988.
Brito L, Paveia H. Presence and analysis of large plasmids in Oenococcus oeni. Plasmid
41:260, 1999.
286 Broadbent
Broadbent JR, Kondo JK. Genetic construction of nisin-producing Lactococcus lactis
subsp. cremoris and analysis of a rapid method for conjugation. Appl Environ Mi-
crobiol 57:517, 1991.
Broadbent JR, Sandine WE, Kondo JK. Characteristics of Tn5307 exchange and interge-
neric transfer of genes associated with nisin production. Appl Microbiol Biotechnol
44:139, 1995.
Bruand C, Le Chatelier E, Ehrlich SD, Janniere L. A fourth class of theta-replicating
plasmids: the pAMβ1 family from gram-positive bacteria. Proc Natl Acad Sci USA
90:11668, 1993.
Bru¨ssow H, Bruttin A, Desiere F, Lucchini S, Foley S. Molecular ecology and evolution
of Streptococcus thermophilus bacteriophages—a review. Virus Genes 16:95, 1998.
Buckley ND, Vadeboncoeur C, LeBlanc DJ, Lee LN, Frenette M. An effective strategy,
applicable to Streptococcus salivarius and related bacteria, to enhance or confer
electroporation competence. Appl Environ Microbiol 65:3800, 1999.
Burrus V, Roussel Y, Decaris B, Gue′don G. Characterization of a novel integrative ele-
ment, ICESt1, in the lactic acid bacterium Streptococcus thermophilus. Appl Envi-
ron Microbiol 66:1749, 2000.
Caldwell SL, McMahon DJ, Oberg CJ, Broadbent JR. Induction and characterization of
Pediococcus acidilactici temperate bacteriophage Syst Appl Microbiol 22:514,
1999.
Chandry PS, Moore SC, Boyce JD, Davidson BE, Hillier AJ. Analysis of the DNA se-
quence, gene expression, origin of replication and modular structure of the Lacto-
coccus lactis lytic bacteriophage sk1. Mol Microbiol 26:49, 1997.
Chassy BM, Flickinger JL. Transformation of Lactobacillus casei by electroporation.
FEMS Microbiol Lett 44:173, 1987.
Chopin MC, Chopin A, Rouault A, Simon D. Cloning in Streptococcus lactis of plasmid-
mediated UV resistance and effect on prophage stability. Appl Environ Microbiol
51:233, 1986.
Chou YC. Development of an electroporation system for transformation and cloning of
the maltose utilization genes from Lactobacillus sp. DB29. MS thesis, Utah State
University, Logan, Utah, 1992.
Clewell DB. Plasmids, drug resistance, and gene transfer in the genus Streptococcus. Mi-
crobiol Rev 45:409, 1981.
Climo MW, Sharma VK, Archer GL. Identification and characterization of the origin of
conjugative transfer (oriT) and a gene (nes) encoding a single-stranded endonucle-
ase on the staphylococcal plasmid pGO1. J Bacteriol 178:4975, 1996.
Cocconcelli PS, Morelli L, Vescovo M, Bottazi V. Intergeneric protoplast fusion in lactic
acid bacteria. FEMS Microbiol Lett 35:211, 1986.
Collins MD, Rodriguez Jovita M, Lawson PA, Falsen E, Foster G. Characterization of a
novel gram-positive, catalase-negative coccus from horses: description of Eremo-
coccus coleocola gen. nov., sp. nov. Int J Syst Bacteriol 49:1381, 1999.
Cousineau B, Smith D, Lawrence-Cavanagh S, Mueller JE, Yang J, Mills D, Manias D,
Dunny G, Lambowitz AM, Belfort M. Retrohoming of a bacterial group II intron:
mobility via complete reverse splicing, independent of homologous DNA recombi-
nation. Cell 94:451, 1998.
Curic M, Stuer-Lauridsen B, Renault P, Nilsson D. A general method for selection of
Genetics of Lactic Acid Bacteria 287
α-acetolactate decarboxylase–deficient Lactococcus lactis mutants to improve dia-
cetyl formation. Appl Environ Microbiol 65:1202, 1999.
Daveran-Mingot ML, Campo N, Ritzenthaler P, Le Bourgeois P. A natural large chromo-
somal inversion in Lactococcus lactis is mediated by homologous recombination
between two insertion sequences. J Bacteriol 180:4834, 1998.
David S, Simons G, De Vos WM. Plasmid transformation by electroporation of Leuconos-
toc paramesenteroides and its use in molecular cloning. Appl Environ Microbiol
55:1483, 1989.
Davidson BE, Powell IB, Hillier AJ. Temperate bacteriophages and lysogeny in lactic
acid bacteria. FEMS Microbiol Rev 87:79, 1990.
Davidson BE, Kordias N, Baseggio N, Lim A, Dobos M, Hillier AJ. Genomic organization
in lactococci. In: Ferretti JJ, Gilmore MS, Klaenhammer TR, Brown F, eds. Genet-
ics of Streptococci, Enterococci, and Lactococci. Dev Biol Stand Vol 85. Basel:
Karger, 1995, p 411.
Davidson BE, Kordias N, Dobos M, Hillier AJ. Genomic organization in lactic acid bacte-
ria. Antonie van Leeuwenhoek 70:161, 1996.
Davis C, Silveira NF, Fleet GH. Occurrence and properties of bacteriophages of Leuconos-
toc oenos in Australian wines. Appl Environ Microbiol 50:872, 1985.
Del Solar G, Giraldo R, Ruiz-Echevarria MJ, Espinosa M, Diaz-Orejas R. Replication
and control of circular bacterial plasmids. Microbiol Mol Biol Rev 62:434, 1998.
De Ruyter PGGA, Kuipers OP, Meyer WC, De Vos WM. Food-grade controlled lysis of
Lactococcus lactis for accelerated cheese ripening. Nature Biotechnol 15:976, 1997.
Desiere F, Lucchini S, Bru¨ssow H. Comparative sequence analysis of the DNA packaging,
head, and tail morphogenesis modules in the temperate cos-site Streptococcus ther-
mophilus bacteriophage Sfi21. Virology 260:244, 1999.
De Vos WM. Metabolic engineering of sugar catabolism in lactic acid bacteria. Antonie
van Leeuwenhoek 70:223, 1996.
De Vos WM, Simons GFM. Gene cloning and expression systems in lactococci. In: Gas-
son MJ, De Vos WM, eds. Genetics and Biotechnology of Lactic Acid Bacteria.
London: Blackie, 1994, p 52.
De Vos WM, Vaughan EE. Genetics of lactose utilization in lactic acid bacteria. FEMS
Microbiol Rev 15:217, 1994.
De Vos WM, Beerthuyzen MM, Luesink EL, Kuipers OP. Genetics of the nisin operon
and the nisin-sucrose conjugative transposon Tn5276. In: Ferretti JJ, Gilmore MS,
Klaenhammer TR, Brown F, eds. Genetics of Streptococci, Enterococci, and Lacto-
cocci. Dev Biol Stand Vol 85. Basel: Karger, 1995, p 617.
D?′az E, Lo′pez R, Garc?′a JL. EJ-1, a temperate bacteriophage of Streptococcus pneumoniae
with a Myoviridae morphotype. J Bacteriol 174:5516, 1992.
Dinsmore PK, Romero DA, Klaenhammer TR. Insertional mutagenesis in Lactococcus
lactis subsp. lactis mediated by IS946. FEMS Microbiol Lett 107:43, 1993.
Djordjevic GM, O’Sullivan DJ, Walker SA, Conkling MA, Klaenhammer TR. A triggered-
suicide system designed as a defense against bacteriophages. J Bacteriol 179:6741,
1997.
Dmitriev A, Suvorov A, Totolian A. Physical and genetic chromosomal maps of Strepto-
coccus agalactiae, serotypes II and III; rRNA operon organization. FEMS Micro-
biol Lett 167:33, 1998.
288 Broadbent
Dodd HM, Gasson MJ. Bacteriocins of lactic acid bacteria. In: Gasson MJ, De Vos WM,
eds. Genetics and Biotechnology of Lactic Acid Bacteria. London: Blackie, 1994,
p. 211.
Dodd HM, Horn N, Gasson MJ. Analysis of the genetic determinant for production of
the peptide antibiotic nisin. J Gen Microbiol 136:555, 1990.
Dodd HM, Horn N, Gasson MJ. Characterization of IS905, a new multicopy insertion
sequence identified in lactococci. J Bacteriol 176:3393, 1994.
Dougherty BA, Hill C, Weidman JF, Richardson DR, Venter JC, Ross RP. Sequence and
analysis of the 60 kb conjugative, bacteriocin-producing plasmid pMRC01 from
Lactococcus lactis DPC3147. Mol Microbiol 29:1029, 1998.
Duan K, Harvey ML, Liu CQ, Dunn NW. Identification and characterization of a mobiliz-
ing plasmid, pND300, in Lactococcus lactis M189 and its encoded nisin resistance
determinant. Appl Bacteriol 81:493, 1996.
Dunny GM, Leonard BAB. Cell-cell communication in gram-positive bacteria. Annu Rev
Microbiol 51:527, 1997.
Dunny GM, McKay LL. Group II introns and expression of conjugative transfer functions
in lactic acid bacteria. Antonie van Leeuwenhoek 76:77, 1999.
Dunny GM, Lee LN, LeBlanc DJ. Improved electroporation and cloning vector system
for gram-positive bacteria. Appl Environ Microbiol 57:1194, 1991.
Durmaz E, Klaenhammer TR. Genetic analysis of chromosomal regions of Lactococcus
lactis acquired by recombinant lytic phages. Appl Environ Microbiol 66:895, 2000.
Ehrmann MA, Remiger A, Eijsink VG, Vogel RF. A gene cluster encoding plantaricin
1.25β and other bacteriocin-like peptides in Lactobacillus plantarum TMW1.25.
Biochim Biophys Acta 1490:355, 2000.
Firth N, Ippen-Ihler K, Skurray RA. Structure and function of the F factor and mechanism
of conjugation. In: Neidhardt FC, Curtiss III R, Ingraham JL, Lin ECC, Low KB,
Magasanik B, Reznikoff WS, Riley M, Schaechter M, Umbarger HE, eds. Esche-
richia coli and Salmonella typhimurium; Cellular and Molecular Biology. Vol 1.
2nd ed. Washington, DC: American Society for Microbiology, 1996, p 1539.
Fodor K, Alfoldi L. Fusion of protoplasts of Bacillus magaterium. Proc Natl Acad Sci
73:2147, 1976.
Foley S, Lucchini S, Zwahlen MC, Bru¨ssow H. A short noncoding viral DNA element
showing characteristics of a replication origin confers bacteriophage resistance to
Streptococcus thermophilus. Virology 250:377, 1998.
Foley S, Bruttin A, Bru¨ssow H. Widespread distribution of a group I intron and its three
deletion derivatives in the lysin gene of Streptococcus thermophilus bacteriophages.
Virology 74:611, 2000.
Frangeul L, Nelson KE, Buchrieser C, Danchin A, Glaser P, Kunst F. Cloning and assem-
bly strategies in microbial genome projects. Microbiology 145:2625, 1999.
Froseth BR, Herman RE, McKay LL. Cloning of nisin resistance determinant and replica-
tion origin on 7.6-kilobase EcoRI fragment of pNP40 from Streptococcus lactis
subsp. diacetylactis DRC3. Appl Environ Microbiol 54:2136, 1988.
Garbutt KC, Kraus J, Geller BL. Bacteriophage resistance in Lactococcus lactis engineered
by replacement of a gene for a bacteriophage receptor. J Dairy Sci 80:1512, 1997.
Garc?′a P, Mart?′n AC, Lopez R. Bacteriophages of Streptococcus pneumoniae: a molecular
approach. Microb Drug Resist 3:165, 1997.
Genetics of Lactic Acid Bacteria 289
Garvey P, Van Sinderen D, Twomey DP, Hill C, Fitzgerald GF. Molecular genetics of
bacteriophage and natural phage defense systems in the genus Lactococcus. Int
Dairy J 5:905, 1995.
Gasc AM, Kauc L, Barraille P, Sicard M, Goodgal S. Gene localization, size, and physi-
cal map of the chromosome of Streptococcus pneumoniae. J Bacteriol 173:7361,
1991.
Gasson MJ. Production, regeneration, and fusion of protoplasts in lactic streptococci.
FEMS Microbiol Lett 9:99, 1980.
Gasson MJ, De Vos WM, eds. Genetics and Biotechnology of Lactic Acid Bacteria. Lon-
don: Blackie, 1994.
Gasson MJ, Fitzgerald GF. Gene transfer systems and transposition. In: Gasson MJ, De
Vos WM, eds. Genetics and Biotechnology of Lactic Acid Bacteria. London:
Blackie, 1994, p 1.
Gasson MJ, Godon J-J, Pillidge CJ, Eaton TJ, Jury K, Shearman CA. Characterization
and exploitation of conjugation in Lactococcus lactis. Int Dairy J 5:757, 1995.
Geller BL, Ivey RG, Trempy JE, Hettinger-Smith B. Cloning of a chromosomal gene
required for phage infection of Lactococcus lactis subsp. lactis C2. J Bacteriol 175:
5510, 1993.
Germond JE, Lapierre L, Delley M, Mollet B. A new mobile genetic element in Lactoba-
cillus delbrueckii subsp. bulgaricus. Mol Gen Genet 248:407, 1995.
Godon JJ, Jury K, Shearman CA, Gasson MJ. The Lactococcus lactis sex-factor aggrega-
tion gene cluA. Mol Microbiol 12:655, 1994.
Gonzales CF, Kunka BS. Transfer of sucrose-fermenting ability and nisin production phe-
notype among lactic streptococci. Appl Environ Microbiol 49:627, 1985.
Goupil-Feuillerat N, Cocaign-Bousquet M, Godon J-J, Ehrlich SD, Renault P. Dual role
of α-acetolactate decarboxylase in Lactococcus lactis subsp. lactis. J Bacteriol 179:
6285, 1997.
Gravesen A, Josephsen J, von Wright A, Vogensen FK. Characterization of the replicon
from the lactococcal theta-replicating plasmid pJW563. Plasmid 34:105, 1995.
Gravesen A, von Wright A, Josephsen J, Vogensen FK. Replication regions of two pairs
of incompatible lactococcal theta-replicating plasmids. Plasmid 38:115, 1997.
Grohmann E, Moscoso M, Zechner EL, Del Solar G, Espinosa M. In vivo definition of
the functional origin of leading strand replication on the lactococcal plasmid pFX2.
Mol Gen Genet 260:38, 1998.
Grohmann E, Guzma′n LM, Espinosa M. Mobilisation of the streptococcal plasmid
pMV158: interactions of MobM protein with its cognate oriTDNA region. Mol Gen
Genet 261:707, 1999.
Gruss A, Ehrlich SD. The family of highly interrelated single-stranded deoxyribonucleic
acid plasmids. Microbiol Rev 53:231, 1989.
Gue′don G, Bourgoin F, Pebay M, Roussel Y, Colmin C, Simonet JM, Decaris B. Charac-
terization and distribution of two insertion sequences, IS1191 and iso-IS981,in
Streptococcus thermophilus: does intergeneric transfer of insertion sequences occur
in lactic acid bacteria co-cultures? Mol Microbiol 16:69, 1995.
Guzma′n LM, Espinosa M. The mobilization protein, MobM, of the streptococcal plasmid
pMV158 specifically cleaves supercoiled DNA at the plasmid oriT. J Mol Biol 266:
688, 1997.
290 Broadbent
Hantman MJ, Sun S, Piggot PJ, Daneo-Moore L. Chromosome organization of Streptococ-
cus mutans GS-5. J Gen Microbiol 139:67, 1993.
Haren L, Ton-Hoang B, Chandler M. Integrating DNA: transposases and retroviral integ-
rases. Annu Rev Microbiol 53:245, 1999.
Harlander SK. Transformation of Streptococcus lactis by electroporation. In: Ferretti JJ,
Curtiss III R, eds. Streptococcal Genetics. Washington, DC: American Society for
Microbiology, 1987, p 229.
Hashiba H, Takiguchi R, Ishii S, Aoyama K. Transformation of Lactobacillus helveticus
subsp. jugurti with plasmid pLHR by electroporation. Agric Biol Chem 54:1537,
1990.
Hashiba H, Takiguchi R, Jyoho K, Aoyama K. Establishment of a host-vector system in
Lactobacillus helveticus with β-galactosidase activity as a selection marker. Biosci
Biotechnol Biochem 56:190, 1992.
Havarstein LS, Hakenbeck R, Gaustad P. Natural competence in the genus Streptococcus:
evidence that streptococci can exchange pherotypes by interspecies recombinational
exchanges. J Bacteriol 179:6589, 1997.
Herbin S, Mathieu F, Brule F, Branlant C, Lefebvre G, Lebrihi A. Characteristics and
genetic determinants of bacteriocin activities produced by Carnobacterium pisci-
cola CP5 isolated from cheese. Curr Microbiol 35:319, 1997.
Hill C. Bacteriophage and bacteriophage resistance in lactic acid bacteria. FEMS Micro-
biol Rev 12:87, 1993.
Hill C, Miller LA, Klaenhammer TR. Cloning, expression, and sequence determination of
a bacteriophage fragment encoding bacteriophage resistance in Lactococcus lactis.
J Bacteriol 172:6419, 1990.
Ho SY, Mittal GS. Electroporation of cell membranes: A review. Crit Rev Biotechnol 16:
349, 1996.
Holo H, Nes IF. High-frequency transformation, by electroporation, of Lactococcus lactis
ssp. cremoris grown with glycine in osmotically stabilized media. Appl Environ
Microbiol 55:3119, 1989.
Horaud T, De Cespedes G, Trieu-Cuot P. Chromosomal gentamicin resistance transposon
Tn3706 in Streptococcus agalactiae B128. Antimicrob Agents Chemother 40:1085,
1996.
Horn N, Swindell S, Dodd H, Gasson M. Nisin biosynthesis genes are encoded by a novel
conjugative transposon. Mol Gen Genet 228:129, 1991.
Huang DC, Novel M, Huang XF, Novel G. Nonidentity between plasmid and chromo-
somal copies of ISS1-like sequences in Lactococcus lactis subsp. lactis CNRZ270
and their possible role in chromosomal integration of plasmid genes. Gene 118:39,
1992.
Huang DC, Huang XF, Novel G, Novel M. Two genes present on a transposon-like struc-
ture in Lactococcus lactis are involved in a Clp-family proteolytic activity. Mol
Microbiol 7:957, 1993.
International Dairy Federation (IDF). Cheese Facts. Washington, DC: National Cheese
Institute, 1994.
International Dairy Federation (IDF). Bulletin 339: The world dairy situation 1999. Brus-
sels: International Dairy Federation, 1999.
Israelsen H, Madsen SM, Vrang A, Hansen EB, Johansen E. Cloning and partial character-
Genetics of Lactic Acid Bacteria 291
ization of regulated promoters from Lactococcus lactis Tn917-lacZ integrants with
the new promoter probe vector, pAK80. Appl Environ Microbiol 61:2540, 1995.
Itaya M, Tanaka T. Experimental surgery to create subgenomes of Bacillus subtilis 168.
Proc Natl Acad Sci USA 94:5378, 1997.
Iwata M, Mada M, Ishiwa H. Protoplast fusion of Lactobacillus fermentum. Appl Environ
Microbiol 52:392, 1986.
Jarvis AW, Jarvis BDW. Deoxyribonucleic acid homology among lactic streptococci.
Appl Environ Microbiol 41:77, 1981.
Jarvis AW, Fitzgerald GF, Mata M, Mercenier A, Neve H, Powell IB, Ronda C, Saxelin
M, Teuber M. Species and type phages of lactococcal bacteriophages. Intervirology
32:2, 1991.
Jarvis AW, Collins LJ, Ackermann HW. A study of five bacteriophages of the Myoviridae
family which replicate on different gram-positive bacteria. Arch Virol 133:75, 1993.
Jaworski DD, Clewell DB. A functional origin of transfer (oriT) on the conjugative
transposon Tn916. J Bacteriol 177:6644, 1995.
Jensen GB, Andrup L, Wilcks A, Smidt L, Poulsen OM. The aggregation-mediated conju-
gation system of Bacillus thuringiensis subsp. israelensis: host range and kinetics
of transfer. Curr Microbiol 33:228, 1996.
Johansen E, Kibenich A. Isolation and characterization of IS1165, an insertion sequence
of Leuconostoc mesenteroides subsp. cremoris and other lactic acid bacteria. Plas-
mid 27:200, 1992.
Josson K, Soetaert P, Michiels F, Joos H, Mahillon J. Lactobacillus hilgardii plasmid
pLAB1000 consists of two functional cassettes commonly found in other gram-
positive organisms. J Bacteriol 172:3089, 1990.
Kahala M, Palva A. The expression signals of the Lactobacillus brevis slpA gene direct
efficient heterologous protein production in lactic acid bacteria. Appl Microbiol
Biotechnol 51:71, 1999.
Kao KN, Michayluk MR. A method for high-frequency intergeneric fusion of plant proto-
plasts. Planta 115:355, 1974.
Kanatani K, Yoshida K, Tahara T, Sakamoto M, Oshimura M. Intraspecific protoplast
fusion of Lactobacillus plantarum. Agric Biol Chem 54:225, 1990.
Kanatani K, Oshimura M, Sano K. Isolation and characterization of acidocin A and cloning
of the bacteriocin gene from Lactobacillus acidophilus. Appl Environ Microbiol
61:1061, 1995.
Kantor A, Montville TJ, Mett A, Shapira R. Molecular characterization of the replicon
of the Pediococcus pentosaceus 43200 pediocin A plasmid pMD136. FEMS Micro-
biol Lett 151:237, 1997.
Kearney K, Fitzgerald GF, Seegers JF. Identification and characterization of an active
plasmid partition mechanism for the novel Lactococcus lactis plasmid pCI2000.
J Bacteriol 182:30, 2000.
Khan SA. Rolling-circle replication of bacterial plasmids. Microbiol Mol Biol Rev 61:
442, 1997.
Khunajakr N, Liu CQ, Charoenchai P, Dunn NW. A plasmid-encoded two-component
regulatory system involved in copper-inducible transcription in Lactococcus lactis.
Gene 229:229, 1999.
Kiewiet R, Kok J, Seegers JFML, Venema G, Bron S. The mode of replication is a major
292 Broadbent
factor in segregational plasmid instability in Lactococcus lactis. Appl Environ Mi-
crobiol 59:358, 1993.
Kim SG, Batt CA. Antisense mRNA-mediated bacteriophage resistance in Lactococcus
lactis subsp. lactis. Appl Environ Microbiol 57:1109, 1991.
Klaenhammer TR, Fitzgerald GF. Bacteriophages and bacteriophage resistance. In: Gas-
son MJ, De Vos WM, eds. Genetics and Biotechnology of Lactic Acid Bacteria.
London: Blackie, 1994, p 106.
Kodaira KI, Oki M, Kakikawa M, Watanabe N, Hirakawa M, Yamada K, Taketo A. Ge-
nome structure of the Lactobacillus temperate phage φgle: the whole genome se-
quence and the putative promoter/repressor system. Gene 187:45, 1997.
Kok J. Inducible gene expression and environmentally regulated genes in lactic acid bacte-
ria. Antonie van Leeuwenhoek 70:129, 1996.
Kondo JK, McKay LL. Gene transfer systems and molecular cloning in group N strepto-
cocci: a review. J Dairy Sci 68:2143, 1985.
Lahib-Mansais Y, Mata M, Ritzenhaler P. Molecular taxonomy of Lactobacillus phages.
Biochimie 70:429, 1988.
Lambowitz AM, Belfort M. Introns as mobile genetic elements. Annu Rev Biochem 62:
587, 1993.
Langela P, Le Loir Y, Ehrlich SD, Gruss A. Efficient plasmid mobilization by pIP501 in
Lactococcus lactis subsp. lactis. J Bacteriol 175:5806, 1993.
Lanka E, Wilkins BM. DNA processing reactions in bacterial conjugation. Annu Rev
Biochem 64:141, 1995.
Leblond P, Decaris B. Chromosome geometry and intraspecific genetic polymorphism in
gram-positive bacteria revealed by pulsed-field gel electrophoresis. Electrophoresis
19:582, 1998.
Le Bourgeois P, Lautier M, Mata M, Ritzenthaler P. Physical and genetic map of the
chromosome of Lactococcus lactis subsp. lactis IL1403. J Bacteriol 174:6752,
1992a.
Le Bourgeois P, Lautier M, Mata M, Ritzenthaler P. New tools for the physical and genetic
mapping of Lactococcus strains. Gene 111:109, 1992b.
Le Bourgeois P, Lautier M, Ritzenthaler P. Chromosome mapping in lactic acid bacteria.
FEMS Microbiol Rev 12:109, 1993.
Lee PC, Park IY, Kim MS, Kim SC. Effect of the replication mode of a plasmid on the
stability of multimeric endoxylanase genes in Bacillus subtilis. J Biotechnol 62:
177, 1998.
Leenhouts K. Development and use of plasmid integration systems for lactococci. Ph.D.
dissertation, University of Groningen, Groningen, The Netherlands, 1990.
Leenhouts K, Bolhuis A, Venema G, Kok J. Construction of a food-grade multiple-copy
integration system for Lactococcus lactis. Appl Microbiol Biotechnol 49:417,
1998.
Le Marrec C, Van Sinderen D, Walsh L, Stanley E, Vlegels E, Moineau S, Heinze P,
Fitzgerald G, Fayard B. Two groups of bacteriophages infecting Streptococcus ther-
mophilus can be distinguished on the basis of mode of packaging and genetic deter-
minants for major structural proteins. Appl Environ Microbiol 63:3246, 1997.
Lin MY, Harlander S, Savaiano D. Construction of an integrative food-grade cloning vec-
tor for Lactobacillus acidophilus. Appl Microbiol Biotechnol 45:484, 1996.
Genetics of Lactic Acid Bacteria 293
Liu CQ, Leelawatcharamas V, Harvey ML, Dunn NW. Cloning vectors for lactococci
based on a plasmid encoding resistance to cadmium. Curr Microbiol 33:35, 1996.
Low D, Ahlgren J, Horne D, McMahon DJ, Oberg CJ, Broadbent JR. Role of Streptococ-
cus thermophilus MR-1C capsular exopolysaccharide in cheese moisture retention.
Appl Environ Microbiol 64:2147, 1998.
Lucchini S, Desiere F, Bru¨ssow H. The genetic relationship between virulent and temper-
ate Streptococcus thermophilus bacteriophages: whole genome comparison of cos-
site phages Sfi19 and Sfi21. Virology 260:232, 1999a.
Lucchini S, Desiere F, Bru¨ssow H. Similarly organized lysogeny modules in temperate
Siphoviridae from low GC content gram-positive bacteria. Virology 263:427,
1999b.
Lucchini S, Desiere F, Bru¨ssow H. Comparative genomics of Streptococcus thermophilus
phage species supports a modular evolution theory. J Virology 73:8647, 1999c.
Luchansky JB, Muriana PM, Klaenhammer TR. Application of electroporation for transfer
of plasmid DNA to Lactobacillus, Lactococcus, Leuconostoc, Listeria, Pediococ-
cus, Bacillus, Staphylococcus, Enterococcus and Propionibacterium. Mol Micro-
biol 2:637, 1988.
Lurquin PF. Gene transfer by electroporation. Mol Biotechnol 7:5, 1997.
Magni C, de Felipe FL, Lopez P, de Mendoza D. Characterization of an insertion se-
quence-like element identified in plasmid pCIT264 from Lactococcus lactis subsp.
lactis biovar. diacetylactis. FEMS Microbiol Lett 136:289, 1996.
Maguin E, Duwat P, Hege T, Ehrlich SD, Gruss A. New thermosensitive plasmid for
gram-positive bacteria. J Bacteriol 174:5633, 1992.
Maguin E, Prevost H, Ehrlich SD, Gruss A. Efficient insertional mutagenesis in lactococci
and other gram-positive bacteria. J Bacteriol 178:931, 1996.
Mahillon J, Chandler M. Insertion sequences. Microbiol Mol Biol Rev 62:725, 1998.
Manchester LN. Characterization of a bacteriophage for Carnobacterium divergens NCFB
2763 by host specificity and electron microscopy. Lett Appl Microbiol 25:401,
1997.
Marciset O, Mollet B. Multifactorial experimental designs for optimizing transformation:
electroporation of Streptococcus thermophilus. Biotechnol Bioeng 43:490, 1994.
Martin M, Corrales MA, de Mendoza D, Lopez P, Magni C. Cloning and molecular charac-
terization of the citrate utilization citMCDEFGRP cluster of Leuconostoc parames-
enteroides. FEMS Microbiol Lett 174:231, 1999.
Mayo B, Gonzalez B, Arca P, Suarez JE. Cloning and expression of the plasmid encoded
β-D-galactosidase gene from a Lactobacillus plantarum strain of dairy origin.
FEMS Microbiol Lett 122:145, 1994.
McAshan SK, Vergin KL, Giovannoni SJ, Thaler DS. Interspecies recombination between
enterococci: genetic and phenotypic diversity of vancomycin-resistant transconju-
gants. Microb Drug Resist 5:101, 1999.
McGrath S, Seegers JFML, Fitzgerald GF, Van Sinderen D. Molecular characterization
of a phage-encoded resistance system in Lactococcus lactis. Appl Environ Micro-
biol 65:1891, 1999.
McKay LL. Functional properties of plasmids in lactic streptococci. Antonie van Leeu-
wenhoek 49:259, 1983.
McKay LL, Baldwin KA. Simultaneous loss of proteinase- and lactose-utilizing enzyme
294 Broadbent
activities in Streptococcus lactis and reversal of loss by transduction. Appl Environ
Microbiol 28:342, 1974.
McKay LL, Baldwin KA. Stabilization of lactose metabolism in Streptococcus lactis C2.
Appl Environ Microbiol 36:360, 1978.
McKay LL, Baldwin KA, Efstathiou JD. Transductional evidence for plasmid linkage
of lactose metabolism in Streptococcus lactis C2. Appl Environ Microbiol 32:45,
1976.
McShan WM, Ferretti JJ. Genetic studies of erythrogenic toxin carrying temperate bacte-
riophages of Streptococcus pyogenes. In: Horaud T, ed. Streptococci and the Host.
New York: Plenum Press, 1997, p 971.
Meijer WJ, de Boer AJ, van Tongeren S, Venema G, Bron S. Characterization of the
replication region of the Bacillus subtilis plasmid pLS20: a novel type of replicon.
Nucleic Acids Res 23:3214, 1995.
Meinhardt F, Schaffrath R, Larsen M. Microbial linear plasmids. Appl Microbiol Biotech-
nol 47:329, 1997.
Mercenier A, Slos P, Faelen M, Lecocq JP. Plasmid transduction in Streptococcus ther-
mophilus. Mol Gen Genet 212:386, 1988.
Mikkonen M, Alatossava T. A group I intron in the terminase gene of Lactobacillus del-
brueckii subsp. lactis phage LL-H. Microbiol 141:2183, 1995.
Mikkonen M, Raisanen L, Alatossava T. The early gene region completes the nucleotide
sequence of Lactobacillus delbrueckii subsp. lactis phage LL-H. Gene 175:49,
1996.
Mills DA, McKay LL, Dunny GM. Splicing of a group II intron involved in the conjuga-
tive transfer of pRS01 in lactococci. J Bacteriol 178:3531, 1996.
Mills DA, Manias DA, McKay LL, Dunny G. Homing of a group II intron from Lactococ-
cus lactis subsp. lactis ML3. J Bacteriol 179:6107, 1997.
Mills DA, Phister TG, Dunny GM, McKay LL. An origin of transfer (oriT) on the conjuga-
tive element pRS01 from Lactococcus lactis subsp. lactis ML3. Appl Environ Mi-
crobiol 64:1541, 1998.
Mizuuchi K. Transpositional recombination: mechanistic insights from studies of Mu and
other elements. Annu Rev Biochem 61:1011, 1992.
Moineau S, Pandian S, Klaenhammer TR. Evolution of a lytic bacteriophage via DNA
acquisition from the Lactococcus lactis chromosome. Appl Environ Microbiol 60:
1832, 1994.
Morea M, Baruzzi F, Cocconcelli PS. Molecular and physiological characterization of
dominant bacterial populations in traditional mozzarella cheese processing. Appl
Microbiol 87:574, 1999.
Nardi M, Renault P, Monnet V. Duplication of the pepF gene and shuffling of DNA
fragments on the lactose plasmid of Lactococcus lactis. J Bacteriol 179:4164,
1997.
Nauta A, Van den Burg B, Karsens H, Venema G, Kok J. Design of thermolabile bacterio-
phage repressor mutants by comparative molecular modeling. Nat Biotechnol 15:
980, 1997.
Okamoto T, Fujita Y, Irie R. Fusion of protoplasts of Streptococcus lactis. Agric Biol
Chem 47:2675, 1983.
O’Sullivan DJ, Walker SA, West SG, Klaenhammer TR. Development of an expression
Genetics of Lactic Acid Bacteria 295
strategy using a lytic phage to trigger explosive plasmid amplification and gene
expression. Biotechnology (NY) 14:82, 1996.
Park KH, Kato H, Nakai T, Muroga K. Phage typing of Lactococcus garvieae (formerly
Enterococcus seriolicida) a pathogen of cultured yellowtail. Fisheries Sci 64:62,
1998.
Polzin KM, McKay LL. Identification, DNA sequence, and distribution of IS981, a new,
high-copy-number insertion sequence in lactococci. Appl Environ Microbiol 57:
734, 1991.
Polzin KM, McKay LL. Development of a lactococcal integration vector by using IS981
and a temperature-sensitive lactococcal replication region. Appl Environ Microbiol
58:476, 1992.
Polzin KM, Shimizu-Kadota M. Identification of a new insertion element similar to gram-
negative IS26, on the lactose plasmid of Streptococcus lactis ML3. J Bacteriol 169:
5481, 1987.
Polzin KM, Romero D, Shimizu-Kadota M, Klaenhammer TR, McKay LL. Copy number
and location of insertion sequences ISS1 and IS981 in lactococci and several other
lactic acid bacteria. J Dairy Sci 76:1243, 1993.
Posno M, Leer RJ, Van Luijk N, Van Giezen MJF, Heuvelmans PTHM, Lokman BC,
Pouwels PH. Incompatibility of Lactobacillus vectors with replicons derived from
small cryptic Lactobacillus plasmids and segregational instability of the introduced
vectors. Appl Environ Microbiol 57:1822, 1991.
Powell IB, Achen MG, Hillier A, Davidson BE. A simple and rapid method for genetic
transformation of lactic streptococci by electroporation. Appl Environ Microbiol
54:655, 1988.
Prevots F, Mata M, Ritzenthaler P. Taxonomic differentiation of 101 lactococcal bacterio-
phages and characterization of bacteriophages with unusually large genomes. Appl
Environ Microbiol. 56:2180, 1990.
Pridmore D, Stefanova T, Mollet B. Cryptic plasmids from Lactobacillus helveticus and
their evolutionary relationship. FEMS Microbiol Lett 124:301, 1994.
Rauch PJG, Beerthuyzen MM, De Vos WM. Distribution and evolution of nisin-sucrose
elements in Lactococcus lactis. Appl Environ Microbiol 60:1798, 1994.
Ravn P, Arnau J, Madsen SM, Vrang A, Israelsen H. The development of TnNuc and its
use for the isolation of novel secretion signals in Lactococcus lactis. Gene 242:
347, 2000.
Ray B. Pediococcus in fermented foods. In: Hui YH, Khachatourians GG, eds. Food Bio-
technology: Microorganisms. New York: VCH, 1995, p. 745.
Raya RR, Kleeman EG, Luchansky JB, Klaenhammer TR. Characterization of the temper-
ate bacteriophage ?adh and plasmid transduction in Lactobacillus acidophilus
ADH. Appl Environ Microbiol 55:2206, 1989.
Reniero R, Cocconcelli P, Bottazzi V. High frequency of conjugation in Lactobacillus
mediated by an aggregation-promoting factor. J Gen Microbiol 138:763, 1992.
Romero DA, Klaenhammer TR. Characterization of insertion sequence IS946, an Iso-ISS1
element, isolated from the conjugative lactococcal plasmid pTRK2030. J Bacteriol
172:4151, 1990.
Romero DA, Klaenhammer TR. Construction of an IS946-based composite transposon in
Lactococcus lactis subsp. lactis. J Bacteriol 173:7599, 1991.
296 Broadbent
Romero DA, Slos P, Castellina RL, Castellina I, Mercenier A. Conjugative mobilization
as an alternate vector delivery system for lactic streptococci. Appl Environ Micro-
biol 53:2405, 1987.
Roussel Y, Pebay M, Gue′don G, Simonet JM, Decaris B. Physical and genetic map of
Streptococcus thermophilus A054. J Bacteriol 176:7413, 1994.
Roussel Y, Bourgoin F, Gue′don G, Pebay M, Decaris B. Analysis of the genetic polymor-
phism between three Streptococcus thermophilus strains by comparing their physi-
cal and genetic organization. Microbiol 143:1335, 1997.
Salminen S, von Wright A, eds. Lactic Acid Bacteria: Microbiology and Functional As-
pects. 2nd ed. New York: Marcel Dekker, 1998.
Salyers AA, Shoemaker NB. Conjugative transposons. Genet Eng (NY) 19:89, 1997.
Salyers AA, Shoemaker NB, Stevens AM, Li LY. Conjugative transposons: an unusual
and diverse set of integrated gene transfer elements. Microbiol Rev 59:579, 1995.
Sanders ME, Leonhard PJ, Sing WD, Klaenhammer TR. Conjugal strategy for construc-
tion of fast acid-producing, bacteriophage resistant lactic streptococci for use in
dairy fermentations. Appl Environ Microbiol 52:1001, 1986.
Sandine WE, Elliker PR, Allen LK, Brown WC. II. Genetic exchange and variability in
lactic Streptococcus starter organisms. J Dairy Sci 45:1266, 1962.
Savijoki K, Kahala M, Palva A. High level heterologous protein production in Lactococcus
and Lactobacillus using a new secretion system based on the Lactobacillus brevis
S-layer signals. Gene 186:255, 1997.
Schaeffer P, Cami B, and Hotchkiss RD. Fusion of bacterial protoplasts. Proc Natl Acad
Sci USA 73:2151, 1976.
Schmitt C, Guedon G, Bourgoin F, Decaris B. Streptococcus thermophilus insertion se-
quence IS1193 transposase gene. GenBank accession number Y13713, 1998.
Schved F, Lalazar A, Henis Y, Juven BJ. Purification, partial characterization and plasmid-
linkage of pediocin SJ-1, a bacteriocin produced by Pediococcus acidilactici. J Appl
Bacteriol 74:67, 1993.
Se′chaud L, Cluzel J-P, Rousseau M, Baumgartner A, Accolas J-P. Bacteriophages of lacto-
bacilli. Biochimie 70:401, 1988.
Seegers JF, Bron S, Franke CM, Venema G, Kiewiet R. The majority of lactococcal plas-
mids carry a highly related replicon. Microbiology 140:1291, 1994.
Shearman C, Godon JJ, Gasson M. Splicing of a group II intron in a functional transfer
gene of Lactococcus lactis. Mol Microbiol 21:45, 1996.
Shimizu-Kadota M, Sakurai T. Prophage curing in Lactobacillus casei by isolation of a
thermoinducible mutant. Appl Environ Microbiol 43:1284, 1982.
Shimizu-Kadota M, Sakurai T, Tsuchida N. Prophage origin of a virulent phage appearing
on fermentations of Lactobacillus casei S-1. Appl Environ Microbiol 45:669, 1983.
Shimizu-Kadota M, Kiwaki M, Hirokawa H, Tsuchida N. ISL1: a new transposable ele-
ment in Lactobacillus casei. Mol Gen Genet 200:193, 1985.
Shimizu-Kadota M, Flickinger JL, Chassy BM. Evidence that Lactobacillus casei insertion
element ISL1 has a narrow host range. J Bacteriol 170:4976, 1988.
Sing WD, Klaenhammer TR. A strategy for rotation of different bacteriophage defenses
in a lactococcal single-strain starter culture system. Appl Environ Microbiol 59:
365, 1993.
Skaugen M, Nes IF. Transposition in Lactobacillus sake and its abolition of lactocin S
Genetics of Lactic Acid Bacteria 297
production by insertion of IS1163, a new member of the IS3 family. Appl Environ
Microbiol 60:2818, 1994.
Smith MD. Transformation and fusion of Streptococcus faecalis protoplasts. J Bacteriol
162:92, 1985.
Smith MD, Clewell DB. Return of Streptococcus faecalis DNA cloned in Escherichia
coli to its original host via transformation of Streptococcus sangrus followed by
conjugative mobilization. J Bacteriol 160:1109, 1984.
Snyder L, Champness W. Molecular Genetics of Bacteria. Washington, DC: ASM Press,
1997.
Somkuti GA, Steinberg DH. Genetic transformation of Streptococcus thermophilus by
electroporation. Biochimie 70:579, 1988.
Somkuti GA, Solaiman DK, Steinberg DH. Structural and functional properties of the
hsp16.4-bearing plasmid pER341 in Streptococcus thermophilus. Plasmid 40:61,
1998.
S?rensen KI, Larsen R, Kibenich A, Junge MP, Johansen E. A food-grade cloning system
for industrial strains of Lactococcus lactis. Appl Environ Microbiol 66:1253, 2000.
Steele JL, McKay LL. Conjugal transfer of genetic material in lactococci: a review. J Dairy
Sci 72:3388, 1989.
Stoianova LG, Polin AN, Egorov NS. Use of the method of protoplast fusion in the selec-
tion of a nisin producer. Antibiot Khimioter 33:203, 1988.
Suvorov AN, Ferretti JJ. Physical and genetic chromosomal map of an M type 1 strain
of Streptococcus pyogenes. J Bacteriol 178:5546, 1996.
Swindell SR, Benson KH, Griffin HG, Renault P, Ehrlich SD, Gasson MJ. Genetic manip-
ulation of the pathway for diacetyl metabolism in Lactococcus lactis. Appl Environ
Microbiol 62:2641, 1996.
Tailliez P, Ehrlich SD, Chopin MC. Characterization of IS1201, an insertion sequence
isolated from Lactobacillus helveticus. Gene 145:75, 1994.
Tanaka T, Ogura M. A novel Bacillus natto plasmid pLS32 capable of replication in Bacil-
lus subtilis. FEBS Lett 422:243, 1998.
Teuber M, Meile L, Schwartz F. Acquired antibiotic resistance in lactic acid bacteria from
food. Antonie van Leeuwenhoek 76:115, 1999.
Thompson J, Nguyen NY, Sackett DL, Donkersloot JA. Transposon-encoded sucrose me-
tabolism in Lactococcus lactis: purification of sucrose-6-phosphate hydrolase and
genetic linkage to N
5
-(L-1-carboxyethyl)ornithine synthase in strain K1. J Biol
Chem 266:14573, 1991.
Thompson JK, McConville KJ, McReynolds C, Collins MA. Potential of conjugal transfer
as a strategy for the introduction of recombinant genetic material into strains of
Lactobacillus helveticus. Appl Environ Microbiol 65:1910, 1999.
Tichaczek PS, Vogel RF, Hammes WP. Cloning and sequencing of curA encoding cur-
vacin A, the bacteriocin produced by Lactobacillus curvatus LTH1174. Arch Mi-
crobiol 160:279, 1993.
Tomita H, Clewell DB. A pAD1-encoded small RNA molecule, mD, negatively regulates
Enterococcus faecalis pheromone response by enhancing transcription termination.
J Bacteriol 182:1062, 2000.
Toyama K, Sakurai T, Ari H. Transduction by temperate phage PLS-1 in Lactobacillus
salivarius. Nippon Saikingaku Zasshi 26:482, 1971.
298 Broadbent
Tremblay DM, Moineau S. Complete genomic sequence of the lytic bacteriophage DT1
of Streptococcus thermophilus. Virology 255:63, 1999.
Trevors KE, Holley RA, Kempton AG. Isolation and characterization of a Lactobacillus
plantarum bacteriophage isolated from a meat starter culture. J Appl Bacteriol 54:
281, 1983.
Trieu-Cuot P, Carlier C, Martin P, Courvalin P. Plasmid transfer by conjugation from
Escherichia coli to gram-positive bacteria. FEMS Microbiol Lett 48:289, 1987.
Trieu-Cuot P, Carlier C, Courvalin P. Conjugative plasmid transfer from Enterococcus
faecalis to Escherichia coli. J Bacteriol 170:4388, 1988.
Tulloch DL, Finch LR, Hillier AJ, Davidson BE. Physical map of the chromosome of
Lactococcus lactis subsp. lactis DL11 and localization of six putative rRNA oper-
ons. J Bacteriol 173:2768, 1991.
Vandamme P, Pot B, Gillis M, De Vos P, Kersters K, Swings J. Polyphasic taxonomy,
a consensus approach to bacterial systematics. Microbiol Rev 60:407, 1996.
Van de Guchte M, Daly C, Fitzgerald GF, Arendt EK. Identification of int and attP on
the genome of bacteriophage Tuc2009 and their use for site-specific plasmid inte-
gration in the chromosome of Tuc2009-resistant Lactococcus lactis MG1363. Appl
Environ Microbiol 60:2324, 1994.
Van der Lelie D, Van der Vossen JMBM, Venema G. Effect of plasmid incompatibility
on DNA transfer to Streptococcus cremoris. Appl Environ Microbiol 54:865, 1988.
Van der Lelie D, Chavarri F, Venema G, Gasson MJ. Identification of a new genetic
determinant for cell aggregation associated with lactose plasmid transfer in Lacto-
coccus lactis. Appl Environ Microbiol 57:201, 1991.
Van Kranenburg R, De Vos WM. Characterization of multiple regions involved in replica-
tion and mobilization of plasmid pNZ4000 coding for exopolysaccharide produc-
tion in Lactococcus lactis. J Bacteriol 180:5285, 1998.
Van Kranenburg R, Marugg JD, Van Swam II, Willem NJ, De Vos WM. Molecular char-
acterization of the plasmid-encoded eps gene cluster essential for exopolysaccharide
biosynthesis in Lactococcus lactis. Mol Microbiol 24:387, 1997.
Van Reenen CA, Dicks LM, Chikindas ML. Isolation, purification and partial characteriza-
tion of plantaricin 423, a bacteriocin produced by Lactobacillus plantarum. J Appl
Microbiol 84:1131, 1998.
Van Sinderen D, Karsens H, Kok J, Terpstra P, Ruiters MH, Venema G, Nauta A. Se-
quence analysis and molecular characterization of the temperate lactococcal bacte-
riophage r1t. Mol Microbiol 19:1343, 1996.
Vaughan EE, De Vos WM. Identification and characterization of the insertion element
IS1070 from Leuconostoc lactis NZ6009. Gene 155:95, 1995.
Vaughan EE, David S, Harrington A, Daly C, Fitzgerald GF, De Vos WM. Characteriza-
tion of plasmid-encoded citrate permease (citP) genes from Leuconostoc species
reveals high sequence conservation with the Lactococcus lactis citP gene. Appl
Environ Microbiol 61:3172, 1995.
Venema G, Kok J, Van Sinderen D. From DNA sequence to application: possibilities and
complications. Antonie van Leeuwenhoek 76:3, 1999.
von Wright A, Sibakov M. Genetic modification of lactic acid bacteria. In: Salminen S,
von Wright A, eds. Lactic Acid Bacteria: Microbiology and Functional Aspects.
2nd ed. New York: Marcel Dekker, 1998, p 161.
Genetics of Lactic Acid Bacteria 299
Walker SA, Klaenhammer TR. An explosive antisense RNA strategy for inhibition of a
lactococcal bacteriophage. Appl Environ Microbiol 66:310, 2000.
Walker DC, Klaenhammer TR. Isolation of a novel IS3 group insertion element and con-
struction of an integration vector for Lactobacillus spp. J Bacteriol 176:5330, 1994.
Walker DC, Aoyama K, Klaenhammer TR. Electrotransformation of Lactobacillus acido-
philus group A1. FEMS Microbiol Lett 138:233, 1996.
Walker SA, Dombroski CS, Klaenhammer TR. Common elements regulating gene expres-
sion in temperate and lytic bacteriophages of Lactococcus species. Appl Environ
Microbiol 64:1147, 1998.
Wang T-T, Lee BH. Plasmids in Lactobacillus. Crit Rev Biotechnol 17:227, 1997.
Wang H, Broadbent JR, Kondo JK. Physical and functional characteristics of cell clumping
in lactose-positive transconjugants of Lactococcus lactis ssp. lactis ML3. J Dairy
Sci 77:375, 1994.
Wang A, Macrina FL. Streptococcal plasmid pIP501 has a functional oriT site. J Bacteriol
177:4199, 1995.
Ward LJ, Brown JC, Davey GP. Identification and sequence analysis of IS1297, an ISS1-
like insertion sequence in a Leuconostoc strain. Gene 174:259, 1996.
Wei M-Q, Rush CM, Norman JM, Hafner LM, Epping RJ, Timms P. An improved method
for the transformation of Lactobacillus strains by electroporation. J Microbiol Meth
21:97, 1995.
Williams D. Food enzyme producers face pressure to innovate. Chem Market Reporter
253 (June 22):FR16, 1998.
Woodford N. Glycopeptide-resistant enterococci: a decade of experience. J Med Microbiol
47:849, 1998.
Wycoff HA, Sandine WE, Kondo JK. Transformation of dairy Leuconostoc using plasmid
vectors from Bacillus, Escherichia, and Lactococcus hosts. J Dairy Sci 74:1454,
1991.
Yu W, Meirau I, Mars A, Johnson E, Dunny G, McKay LL. Novel insertion sequence-
like element IS982 in lactococci. Plasmid 33:218, 1995.
Yu W, Gillies K, Kondo JK, Broadbent JR, McKay LL. Loss of plasmid-mediated oligo-
peptide transport system in lactococci: another reason for slow milk coagulation.
Plasmid 35:145, 1996.
Ze-Ze L, Tenreiro R, Brito L, Santos MA, Paveia H. Physical map of the genome of
Oenococcus oeni PSU-1 and localization of genetic markers. Microbiol 144:1145,
1998.
Zwahlen MC, Mollet B. ISL2, a new mobile genetic element in Lactobacillus helveticus.
Mol Gen Genet 245:334, 1994.
9
Fermented Milks and Cream
Vikram V. Mistry
South Dakota State University
Brookings, South Dakota
I. INTRODUCTION
Fermented milks result from the selective growth of specific bacteria in milk.
These products have evolved around the world over thousands of years and
are believed to have originated in the area that is now the Middle East. These
products probably resulted from the need to extend the shelf life of milk in
the absence of refrigeration (Kosikowski and Mistry, 1997). Storage of raw
milk at ambient temperature probably led to growth of lactic acid and other
bacteria. This bacterial activity produced desirable flavors, and, importantly,
increased the shelf life of milk because of a high acid content. Procedures
of fermented milk production were subsequently refined, the products became
popular, and gradually spread to Asia, Europe, and other parts of the world.
Consumption is now the highest in European countries, but these products
form an important component of the diet in many other countries as well
(Table 1).
Today yogurt, buttermilk, and sour cream are probably the most widely
consumed fermented milk products, but there are many different types of such
products that are either manufactured commercially or produced on a small scale,
and sometimes in homes, for local consumption. In addition to being excellent
sources of nutrients, these products have become popular because of potential
health benefits, which are discussed in Chapter 10.
301
302 Mistry
Table 1 World Consumption of Fermented Milks, 1998
Per capita Per capita
Country (kg) Country (kg)
Netherlands 45.0 Czech Republic 10.0
Finland 38.8 Portugal 9.8 (1997)
Sweden 30.0 Hungary 9.4
Denmark 27.3 Poland 7.4
France 26.9 Slovakia 7.4
Iceland 25.3 USA 7.1 (1997)
Germany 25.0 Australia 6.4
Israel 24.8 Argentina 6.0
Norway 19.3 Canada 3.6
Bulgaria 15.6 Ukraine 3.4
Austria 14.7 South Africa 3.1
Spain 14.5 China 0.2
Source: International Dairy Federation. 1999. World Dairy Situation. Bulletin No. 339.
II. MICROORGANISMS USED TO MANUFACTURE
FERMENT MILK
Microorganisms used to manufacture fermented milk primarily include those that
can ferment lactose to lactic acid and may be either of the mesophilic or thermo-
philic type. Nomenclature for these organisms has evolved over the years as a
greater understanding of their genetics has been acquired. Current nomenclature
of selected microorganisms used to manufacture fermented milks is in Table 2.
Pure strains of these organisms are readily available from commercial suppliers,
but it is not uncommon, especially for small-scale manufacturers, to use product
from a previous batch as culture for the next batch. In such instances, there is a
potential for quality of the endproduct to vary from batch to batch because of
changes in culture characteristics that may occur over repeated transfers. This is
especially evident in products that normally require a combination of organisms
in a specific ratio, such as rods and cocci in a 1:1 ratio for yogurt. Over repeated
transfers as a mixed culture, one of the species is likely to dominate and hence
alter the characteristics of the fermentation and consequently flavor and texture
qualities of the product.
In addition to lactic acid producers, other types of organisms may also be
employed to impart desired flavor or therapeutic properties to fermented products.
Examples include organisms that produce diacetyl or acetaldehyde for flavor or
small amounts of alcohol in products such as kefir. Organisms such as Bifido-
Fermented Milks and Cream 303
Table 2 Nomenclature of Microorganisms Used in the Manufacture of Fermented
Milks
Previous name
a
Current name
Lactobacillus bulgaricus Lactobacillus delbrueckii subsp. bulgari-
cus
Leuconostoc cremoris and Leuconostoc Leuconostoc mesenteroides subsp. crem-
citrovorum oris
Leuconostoc dextranicum Leuconostoc mesenteroides subsp. dex-
tranicum
Streptococcus lactis subsp. cremoris and Lactococcus lactis subsp. cremoris
Streptococcus cremoris
Streptococcus lactis subsp. diacetilactis Lactococcus lactis subsp. lactis (biovar.
and Streptococcus diacetilactis diacetylactis)
Streptococcus lactis subsp. lactis Lactococcus lactis subsp. lactis
Streptococcus salivarius subsp. thermophi- Streptococcus thermophilus
lus
a
The names here reflect the most current previous names. Historically, various names have been used
for these organisms. For example, Leuconostoc dextranicum was previously known as Streptococcus
paracitrovorus. Such nomenclature can be found in Hammer (1928) and Swithinbank and Newman
(1903). Wood and Holzapfel (1995) discuss in detail the nomenclature of lactic acid bacteria.
Source: Kosikowski and Mistry (1997)
bacterium spp. and Lactobacillus acidophilus are added for therapeutic purposes.
Leuconostocs are used in products such as cultured buttermilk to produce diacetyl
via citrate fermentation (Vedamuthu, 1994). Some functions of organisms for
specific applications in fermented milks are given in Table 3, and metabolic path-
ways are discussed in Chapter 7.
A. Enumeration
Legislation in some countries and codex regulations require the presence of viable
organisms in yogurt. In the United States, the National Yogurt Association re-
quires the presence of at least 10 million yogurt bacteria per gram at the time of
consumption if manufacturers wish to display the ‘‘Live and Active Cultures’’
symbol on yogurt packages (Kosikowski and Mistry, 1997). Furthermore, many
fermented milk products possess therapeutic properties largely because of the
presence of selected viable organisms. These organisms have to be present in
specified numbers to impart such therapeutic properties. Therefore, the use of
proper enumeration procedures is vital. Such procedures have been developed
(Dave and Shah, 1996; Frank et al., 1992; International Dairy Federation, 1997a,
304 Mistry
Table 3 Functions and Applications of Microorganisms in Fermented Milks
Culture Function Application
Lactobacillus delbrueckii subsp. bulgaricus Acid and flavor Bulgarian butter-
milk, yogurt, kefir
Lactobacillus acidophilus Acid Acidophilus milk
Lactobacillus kefir Acid Kefir
Streptococcus thermophilus Acid Yogurt
Lactococcus lactis subsp. lactis (biovar. diace- Acid and flavor Sour cream, cul-
tylactis) tured buttermilk
Lactococcus lactis subsp. lactis & Lactococ- Acid Cultured buttermilk,
cus lactis subsp. cremoris sour cream
Leuconostoc lactis & Leuconostoc mesentero- Flavor Cultured buttermilk,
ides subsp. dextranicum sour cream, rip-
ened cream butter
Bifidobacterium longum Acid and flavor Yogurt
Bifidobacterium bifidum
Bifidobacterium breve
Source: Kosikowski and Mistry, 1997.
1997b; Lee et al., 1974; Matalon and Sandine, 1986). Lactic agar is used to
enumerate lactic acid bacteria, whereas deMan, Rogosa, and Sharp (MRS) and
lactobacillus agars are suitable for lactobacilli. Special consideration is given to
products that are made with a combination of cultures. An example is yogurt
that is manufactured with rods and cocci and sometimes also with bifidobacteria.
It is important not only to enumerate but also differentiate these types of organ-
isms. Enumeration procedures such as those that use yogurt lactic agar are recom-
mended for differentiating between rods and cocci. On this agar, Streptococcus
thermophilus colonies are small and white and Lb. delbrueckii subsp. bulgaricus
colonies are large and white and have a white cloudy zone.
A critical issue in enumeration of bacteria in cultured products is the occur-
rence of acid injury to cells, especially during storage of the product. The pH in
most fermented milk products drops to below 4.6 and causes sublethal injury to
surviving lactic acid bacterial cells. Such sublethally injured cells are not able
to multiply in media used in routine counting procedures but require an enriched
medium which will help repair the injured cells (Andrew and Russell, 1984; Ray,
1993). Pariente et al. (1987) demonstrated that counts of heat-injured Lb. casei
were underestimated when Lactobacillus selection (LBS) and Rogosa media were
used for enumeration. Application of soya trypticase broth to recover injured
lactobacilli has been recommended (Briceno-Graciela et al., 1995). Standard
Methods for the Examination of Dairy Products (Frank et al., 1992) suggests the
Fermented Milks and Cream 305
use of standard methods agar (SMA) for enumerating injured cells, but this agar
is not selective. It can be made more selective by adding 0.02% sodium azide,
which does not inhibit lactic acid bacteria but does inhibit others such as enteric
bacilli. In a direct epifluorescent filter technique for differential determination of
sublethally injured bacterial cells, the RNA of viable cells is stained orange by
acridine orange, whereas inactive cells and DNA are stained green (Sto et al.,
1986). This characteristic also is applicable to Lb. delbrueckii subsp. bulgaricus,
S. thermophilus, and Lb. acidophilus. Working with cells injured by freeze dry-
ing, de Valdez et al., (1985) demonstrated that highest recovery was obtained on
LAPTg agar for various lactobacilli and lactococci.
B. Inhibition of Growth
Development of adequate flavor and texture in fermented milk products requires
optimal growth of culture organisms. This is readily attained with proper manu-
facturing conditions and handling of cultures. If a batch starter is used daily,
facilities for aseptic culture transfer and maintenance of cultures should be avail-
able (Kosikowski and Mistry, 1997). Presence of substances in milk such as
phages and sanitizers can inhibit cultures. Antibiotics have a static effect on bacte-
ria, but yogurt bacteria, S. thermophilus and Lb. delbrueckii subsp. bulgaricus,
are particularly sensitive (Reinbold and Reddy, 1974). Penicillin at 0.01 IU/mL
of milk will inhibit these organisms, whereas mesophilic lactococci are not as
sensitive. It is important, therefore, to test every batch of milk for antibiotics.
Bacteriophages of organisms used to manufacture fermented milks have
been identified. Phages of mesophilic lactic acid bacteria are well known to
cheese makers but have also been found in buttermilk production facilities.
Moineau et al. (1996) isolated 27 different phages from 27 buttermilk plants in
the United States. Although not as common as phages of mesophiles, those of
thermophiles, such as yogurt bacteria, have also been reported (Kilic et al., 1996)
and can arrest the fermentation. Phage control systems have been described (Kos-
ikowski and Mistry, 1997) and involve culture rotation, the use of phage-inhibi-
tory media (Vedamuthu, 1992), and, most important, proper sanitation at the
plant. Phage-inhibitory media are usually rich in phosphates to chelate calcium.
Some strains of S. thermophilus do not grow well in high-phosphate media. Chlo-
rine as a sanitizer is very effective against phages. Sanitizers must be used with
caution, however, because residual sanitizers in fermentation vats, piping, or
packaging cups will also inhibit starter organisms. The latter is particularly appli-
cable for products that are fermented in consumer cups. Sanitizers such as quater-
nary ammonium compounds in particular can be a problem. If a residual film of
such sanitizers is left on equipment surfaces, the sanitizers are released slowly
over time and inhibit culture organisms that come in contact with them (Guirguis
and Hickey, 1987a; Miller and Elliker, 1951; Pearce, 1978; Valladao and San-
306 Mistry
dine, 1994). Sensitivity is strain dependent but thermophiles are generally more
sensitive than mesophilic lactococci (Guirguis and Hickey, 1987a).
Another mode of inhibition in milk is by the naturally present lactoperoxi-
dase system. This system has to be activated for inhibition to occur and requires
the presence of the lactoperoxidase enzyme, H
2
O
2
, and thiocyanate. Some starter
bacteria used to produce fermented products, such as Lb. acidophilus and Lb.
delbrueckii subsp. bulgaricus, produce H
2
O
2
during fermentation and conse-
quently activate the lactoperoxidase system. Guirguis and Hickey (1987b) con-
cluded that inhibition by this system was strain dependent and that strains most
affected were those that produced H
2
O
2
. S. thermophilus was not inhibited by
the lactoperoxidase system.
III. TYPES OF FERMENTED MILKS
Numerous types of fermented milks exist around the world (Kosikowski and
Mistry, 1997; Kurmann et al., 1992). Products range from yogurt, which is proba-
bly the most widely known, especially in the Western world, to more regional
products such as mala (or maziwa lala) of Kenya, which is manufactured using
mesophilic cultures, and dahi of India, which is largely made either in the home
or by small-scale dairies. Table 4 lists some major types of fermented milk prod-
ucts of the world, and Fig. 1 shows a sampling of such products. There are distinct
differences in characteristics between the different types of products, depending
on type of organisms and type of milk used. For example, Bulgarian buttermilk
has a very strong acid flavor (2–4% lactic acid), whereas yogurt has a milder
acidic and acetaldehyde flavor. On the other hand, koumiss, which is traditionally
made from mares’ milk, is slightly alcoholic, because yeasts are used in its manu-
Table 4 Major Fermented Milks of the World
Acidophilus milk Kouwonnailio (China)
Bulgarian buttermilk Maziwalala (Kenya)
Cultured buttermilk Sour cream
Cultured cream Yogurt
Kefir Dahi
Koumiss Doog
Viili (Scandinavia) Kishk
Langfil (Scandinavia) Laban
Mast
Yaourt
Zabady
Fermented Milks and Cream 307
Figure 1 A sampling of fermented milk products, including cultured drinks (AB Kultur
drik, Gefilus, and Glacier Yo), yogurt, liquid yogurt (YOP, Yo-Goat, and Yogurito), yogurt
packaged in a tube (Go-Gurt), and buttermilk (Lait Ribot).
facture (Tamime and Robinson, 1988). Texture of products also varies from liq-
uid, such as for cultured buttermilk and liquid yogurt, to thick gel as for yogurt
and sour cream. Some products such as viili from Scandinavia are characterized
by their ropiness, which is intentionally induced by the use of cultures that pro-
duce exopolysaccharides to provide a thick body. Such cultures may also be
used to manufacture low-fat yogurts to provide adequate body. Milk used for
manufacturing fermented products is largely from the cow, but across the world
milk of other species is also employed. In India, for example, the water buffalo
is a common source (Aneja, 1997). Yogurt-like products in Iran are produced
from milk of sheep or goats, and in some parts of Tibet milk of the yak is used
(Kosikowski and Mistry, 1997). The type of milk affects endproduct characteris-
tics partly via influence on growth of culture bacteria.
Thus, fermented milks encompass a wide range of products that possess
diverse characteristics and employ a wide range of manufacturing procedures
that are designed to promote optimal growth and activity of the chosen culture
organisms.
A. Yogurt
The term yogurt (yoghurt) encompasses a wide range of products. Yogurt is a
fermented dairy product, which is generally manufactured from pasteurized milk.
308 Mistry
Its fat content ranges from 0 to over 4% depending on region and legislation.
High-temperature pasteurization of the yogurt mix is employed to obtain a
smooth and firm body. Nonfat dry milk or stabilizers may also be added to in-
crease the water-holding capacity and therefore improve its body. The latter is
particularly applicable to low-fat products.
Several different types of yogurt are commercially available. These include
plain (no added flavors), flavored, liquid, carbonated, and low lactose. The fla-
vored yogurts include the sundae-style in which fruit puree is layered at the bot-
tom of the cup and is mixed with the yogurt before consumption. The other type
is Swiss-style, in which plain yogurt is gently blended with fruit puree before
packaging. Such yogurts require high levels of solids and stabilizer to obtain the
desired high viscosity. Liquid yogurts are popular in Europe, Canada, and Japan,
and differ from gel-type yogurt in that they are in a homogeneous, pourable state.
No whey separation should occur during storage.
Manufacture of yogurt involves several key steps: standardization of mix,
homogenization, heat treatment, cooling to incubation temperature, inoculation
with yogurt cultures, incubation, cooling, and packaging (Rasic and Kurmann,
1978) (Fig. 2).
1. Starter Organisms
Many countries have their own standards of identity for yogurt with regard to
composition as well as starter bacteria (Mareschi and Cueff, 1989). Most coun-
Figure 2 Steps for the manufacture of yogurt. (From Kosikowski and Mistry, 1997.)
Fermented Milks and Cream 309
tries and codex regulations define yogurt as the product obtained by fermenting
milk with a culture that includes Lb. delbrueckii subsp. bulgaricus and S. ther-
mophilus. Some countries permit additional lactic acid bacteria, whereas others,
such as Australia, require only S. thermophilus and a lactobacillus of choice. The
United Kingdom requires Lb. delbrueckii subsp. bulgaricus to which other lactic
acid bacteria can be added.
S. thermophilus (coccus) and Lb. delbrueckii subsp. bulgaricus (rod) are
thermophilic organisms (Fig. 3) and grow best at approximately 45°C but not
above 50°C (Chandan, 1992). They are typically added in a 1:1 ratio. Bulk cul-
tures may be prepared separately from pure strains or frozen concentrates may
be added directly to the mix. The latter eliminates the need to maintain culture
transfer facilities (Kosikowski and Mistry, 1997). Rods and cocci function symbi-
otically to produce typical yogurt characteristics. Either culture independently is
unable to produce the ideal balance of acid and flavor. S. thermophilus initiates
lactic acid production and lowers the oxygen level, which stimulates growth of
Lb. delbrueckii subsp. bulgaricus (Vedamuthu, 1992). The pH is lowered to ap-
proximately 5 by the cocci and then to less than 4 by the rods. The rods in turn
promote growth of S. thermophilus via production of peptides and amino acids.
Figure 3 Electronmicrograph of yogurt showing rods (solid white arrow) and cocci
(dotted white arrow) embedded within the product.
310 Mistry
S. thermophilus is more sensitive to acid than is Lb. delbrueckii subsp.
bulgaricus; hence during extended storage of yogurt, the former (cocci) are likely
to be injured by the acid and gradually die off. Therefore, although the initial
ratio of rods to cocci may be 1:1, this ratio may change in favor of lactobacilli
during storage of the yogurt. As the rate of acid and flavor production is strain
dependent, the rod and coccal strains should be selected so there is a balance of
acid and acetaldehyde production (Vedamuthu, 1992). Rate of acid production
alone should not be the criterion for strain selection. Acetaldehyde is produced
by both S. thermophilus and Lb. delbrueckii subsp. bulgaricus (Wilkins et al.,
1986). Both organisms produce threonine aldolase which helps convert threonine
to acetaldehyde but lactose is also a source.
It is now common in the yogurt industry, particularly in Europe, to enhance
the body of yogurt by using cultures that produce exopolysaccharide (Hassan et
al., 1996; Lavezzari et al., 1998). Some strains of lactic acid bacteria, including
the thermophilic yogurt bacteria, can produce exopolysaccharides that act as sta-
bilizers and thicken the body of yogurt. The polysaccharides can be extracellular
or in encapsulated form (Hassan et al., 1996). Some strains of cultures produce
polysaccharides that can lead to a ropy texture, whereas others provide a thick-
ening effect without ropiness (Lavezzari et al., 1998). This may be important,
because criteria for sensory evaluation of yogurt generally view ropiness as a
defect (Bodyfelt et al., 1988).
In recent years bifidobacteria-containing yogurt has become popular in Ja-
pan, Canada, France, and Germany. Such yogurt is manufactured either with
bifidobacteria singly or as mixed cultures with Lb. acidophilus and S. thermophi-
lus and provide therapeutic properties to yogurt (Rasic and Kurmann, 1983).
Bifidobacteria of human origin are preferred and include Bifidobacterium breve,
Bi. longum, Bi. infantis, and Bi. bifidum. An inoculum rate of H1102210% has to be
used, because bifidobacteria are slow acid producers. Incubation is at 36–42° C
for 6–8 h to enable curd formation and provide viable counts of up to 100 million
per gram in the final product. An advantage in using bifidobacteria is that over-
acidification does not occur in the yogurt during production and storage. Bifido-
bacteria yogurt therefore has a milder (less acidic) taste. To ensure viability dur-
ing storage of yogurt, proper strains of bifidobacteria must be selected (Martin
and Chou, 1992).
2. Defects
Yogurt by nature is a high-acid (low pH) product and is therefore inherently
protected against defects caused by most contaminating organisms. Furthermore,
the high pasteurization temperature used in processing the mix eliminates most
contaminating bacteria. Nevertheless, certain defects, some microbially induced,
Fermented Milks and Cream 311
may occur. Perhaps the most common defect is high acid and consequently high
acetaldehyde flavor (Vedamuthu, 1992). This may develop under improper manu-
facturing and storage conditions. If the rods and cocci are maintained as a mixed
culture, after repeated transfers at high temperature rods will dominate the cul-
ture. They then become the primary acid producers when used to make yogurt
and produce excessive amounts of acid (over 2%). This can be prevented by
maintaining the two cultures separately and adding them in a 1:1 ratio at the time
of inoculation of the mix during manufacture of yogurt (Kosikowski and Mistry,
1997). Another critical factor is the rapid cooling of yogurt after incubation to
prevent continued growth of lactobacilli. Many manufacturers use blast tunnels
for cooling to 10°C within 50 min. Excessive acid production may also lead to
body and texture defects such as shrinkage of curd and wheying-off. Other texture
defects may also occur in yogurt, such as weak or excessively heavy body, which
are generally related to improper use of stabilizers. Proper selection and use of
ingredients, especially stabilizers in the mix, can address these defects. Yogurt
manufacturers often add 2–4% nonfat dry milk to increase the total solids content
to over 15%. This helps to develop a firm body (Kosikowski and Mistry, 1997;
Tamime and Robinson, 1985), and is especially useful in low-fat and nonfat yo-
gurts. A disadvantage is that the resulting yogurt will have a high lactose content
(approximately 6%) that will allow the lactic fermentation to continue. Acidity
of such yogurts is therefore high. An alternative is to concentrate milk by ultrafil-
tration to raise the protein content and lower the lactose level (Mistry and Hassan,
1992; Rasic et al., 1992). The protein concentration that can be used with such
procedures is H110215.6%, since excessive fortification leads to an undesirably firm
body (Mistry and Hassan, 1992).
Another microbially induced defect is bitterness. This occurs if the milk
supply contains spore-forming organisms such as Bacillus subtilis or B. cereus.
Spores of these organisms are able to survive high heat treatment. Yeasts and
molds are acid tolerant. Therefore, contamination by yeasts and molds can be a
problem, particularly in fruit-flavored yogurts if poor-quality contaminated fruit
preserves are used.
B. Cultured Buttermilk
Cultured buttermilk is a lightly salted fermented milk product that is manufac-
tured from nonfat or low-fat milk using mesophilic cultures and flavor-producing
organisms. Unlike yogurt, the flavor of buttermilk includes lactic acid, diacetyl,
and acetic acid. Diacetyl is obtained from citric acid fermentation during manu-
facture of buttermilk. Cultured buttermilk should have a smooth thick body, with
the correct balance of acid and diacetyl flavor (Vedamuthu, 1985). Steps in the
manufacture of buttermilk are summarized in Fig. 4.
312 Mistry
Figure 4 Steps for the manufacture of cultured buttermilk. (From Kosikowski and Mis-
try, 1997.)
1. Starter Organisms
Cultured buttermilk is produced with combinations of mesophilic lactic acid bac-
teria that will produce lactic acid as well as diacetyl. Species used include Lacto-
coccus lactis subsp. cremoris, Leuconostoc mesenteroides subsp. cremoris, and
Lc. lactis subsp. lactis (biovar. diacetylactis). The latter two produce diacetyl
and small amounts of carbon dioxide. Lc. lactis subsp. lactis (biovar. diace-
tylactis) also produces acetaldehyde, which is not desirable in buttermilk, and
therefore this bacterium should be used with caution. The lactic acid producers
thrive on lactose, whereas the flavor producers require the presence of sufficient
citric acid to produce diacetyl. The naturally present citric acid in milk should
be supplemented by the addition of sodium citrate (0.1–0.15%). The flavor pro-
ducers do not produce an appreciable amount of lactic acid but do require acidic
conditions for proper growth and fermentation of citrate. Therefore, sufficient
activity by the lactic acid producers is necessary (pH 5) before flavor producers
can function. Levata-Jovanovic and Sandine (1997) have reported on the use of
a Leuc. mesenteroides subsp. cremoris strain in combination with a ropy Lc.
lactis subsp. cremoris culture for improving the flavor and texture of buttermilk.
Fermented Milks and Cream 313
An important advantage of using leuconostocs is that these organisms are rela-
tively insensitive to phages.
Flavor producers are rather temperature sensitive. If the temperature of
incubation is maintained at 27°C instead of the optimum 22°C, they will not
produce sufficient diacetyl and consequently acid rather than a balance of acid
and diacetyl flavor will dominate the finished product (Kosikowski and Mistry,
1997). Diacetyl-producing bacteria also possess an enzyme that converts diacetyl
to acetyl methyl carbinol (acetoin). This results in a loss in the quantity of diacetyl
in buttermilk (Vedamuthu, 1994). Hence, production of cultured buttermilk re-
quires proper selection of culture bacteria as well as manufacturing conditions
that will induce balanced growth of acid and flavor producers.
Cultured buttermilk typically has a thick, homogeneous body. Vedamuthu
and Shah (1983) patented a procedure for manufacturing such a product using a
mixture of slime-producing Lc. lactis subsp. cremoris and non–slime producing
Lc. lactis subsp. cremoris and/or Lc. lactis subsp. lactis. Ropiness occurred only
if H1102280% of the culture mixture was a slime producer.
2. Defects
In many respects, cultured buttermilk is a delicate product that can have defects
if proper care is not taken during manufacture. On the other hand, culture charac-
teristics and proper manufacturing conditions have been well documented, and,
if employed, good-quality product can be readily obtained. Many defects of cul-
tured buttermilk can be linked to improper culture usage, whereas others are
related to manufacturing procedures. Culture-related defects can be flavor defects
and may indirectly also lead to body defects. Even buttermilk produced under
the best sanitary conditions may lack flavor (flat flavor) if the environment is
not optimal for the growth of flavor producers. For example, a high incubation
temperature (27°C) discourages growth of flavor producers; therefore insufficient
diacetyl will be present. Such defects can be prevented by ensuring that the acid-
producing culture is active, because the flavor producers will be activated only
after sufficient acid has been produced (0.8–0.85%, pH 5) and incubating at 22°C.
Milk should be supplemented with citrate, and after the curd has been broken at
the optimum pH, the product should be rapidly cooled with gentle agitation. This
will prevent degradation of diacetyl. If incubation is not monitored and if fermen-
tation is not halted by cooling, acid production will continue and may even exceed
1%. This process is not reversible and produces a highly acidic product with a
loss of diacetyl (Vedamuthu, 1994). Excessive acidity will also lead to wheying-
off because of a lowered water-holding capacity of the proteins. Such wheying-
off may also result from excessive and high-speed agitation during cooling after
fermentation is completed (Kosikowski and Mistry, 1997). During storage such
314 Mistry
a product will separate into whey and a heavy protein mass that settles to the
bottom.
A weak culture that is contaminated with organisms such as psychrotrophs
and coliforms will lead to unclean, and, in extreme conditions, bitter flavors.
Contaminating bacteria such as coliforms and Pseudomonas spp. possess a rela-
tively high level of diacetyl reductase which degrades diacetyl (Elliker, 1945;
Seitz et al., 1963). One strain of Enterobacter aerogenes had an activity of 345
units of enzyme protein per milligram compared with 100 units for Lc. lactis
subsp. lactis (biovar. diacetylactis) (Seitz et al., 1963). Such enzyme activity
leads to a product that lacks flavor. Good manufacturing and sanitation practices
are therefore vital and can easily prevent such defects. Proper starter maintenance,
including replacement of the mother culture at regular intervals, is also a good
practice to ensure continued high activity of the starter culture.
Some of the aforementioned culture-related defects will eventually lead to
body and texture defects. For example, if the culture lacks adequate activity and
if the product is cooled at low acidity, the finished product will not have optimum
viscosity. In contrast, excessive viscosity can result from cultures such as Lc.
lactis subsp. lactis, which form long chains. Some contaminants produce slime,
which results in a highly viscous product.
C. Sour Cream and Cre`me Fra??che
The two main fermented cream products are sour cream and cre`me fra??che. The
later originated in France but is now also used in other countries. Because of
their high fat content, 18 and 50%, respectively, they are used for dips and top-
pings rather than for direct consumption. Cultures used for these products and
manufacturing procedures are similar to those for cultured buttermilk (Kosikow-
ski and Mistry, 1997). The high-fat and solids contents provide these products
with a thick and heavy body. The manufacturing procedure for sour cream is
especially designed to produce a very thick body. Sour cream typically has a
clean acidic flavor with hints of diacetyl. Mesophilic lactic acid and flavor-pro-
ducing cultures are used along with double homogenizing and a small amount
of rennet for developing body (Fig. 5). Cre`me fra??che, on the other hand, is also
manufactured with the same cultures but the pH is higher (6.2–6.3).
As sour cream is a high-fat product (approximately 70% fat on dry basis),
manufacturing a low-fat, and, particularly a fat-free product, is challenging. Sim-
ply replacing the fat with moisture, as is done in most low-fat cheeses, does not
provide the required thick and smooth body of sour cream. Thickening agents
such as starches, stabilizers, and fat replacers therefore play an important role in
these products. Lee and White (1991) demonstrated that good body and texture
in sour cream of 5 and 10.5% fat could be obtained with gelatin, modified food
starch, or methoxyl pectin. Addition of rennet helps firm the body but also leads
Fermented Milks and Cream 315
Figure 5 Steps for the manufacture of sour cream. (From Kosikowski and Mistry,
1997.)
to syneresis and proteolytic activity. The use of a starch-based texturizing agent
has also been suggested (Dunn and Finocchiaro, 1997). This agent consists of
an insoluble microparticle (titanium dioxide), xanthan gum, and pregelatinized
starch. Commercial milk or egg protein–based microparticulated products used
as fat replacers have application in reduced-fat sour cream production (Singer et
al., 1992) (Fig. 6). The aforementioned procedures provide adequate body to
low-fat sour cream, but development of proper balanced flavor is also important.
Flavor-delivery systems have been developed that consist of fat globules (Singer
et al., 1993) or polyhydroxyalkanoates (Yalpani, 1993) in which large amounts
of fat-soluble flavor compounds are included. When these systems are incorpo-
rated into low-fat and fat-free sour cream, the fat-soluble flavor compounds are
released and complement other compounds that are produced by the starter bac-
teria.
1. Starter Organisms and Product Defects
Most of the culture issues discussed previously for cultured buttermilk apply to
sour cream as well. As with most fermented milk products, good-quality sour
cream can keep for a long time (4 weeks) under refrigeration, because the high-
316 Mistry
Figure 6 Steps for the manufacture of reduced fat sour cream. (From Singer et al., 1992.)
acid content prevents growth of contaminants. During extended storage, however,
enzymes of bacteria that survived pasteurization may cause development of bitter
and unclean flavors via proteolysis. Good manufacturing and sanitation practices
should be employed to prevent such defects.
D. Acidophilus Milk
Acidophilus milk is a fermented milk produced mainly by the use of lactobacilli
and is believed to have therapeutic properties (Gilliland, 1989). It can have an
acid content of up to 2%, which is unpleasant to some, so consumption is limited.
Manufacture of this product first involves sterilization of nonfat or low-fat milk
followed by inoculation (5%) with an active Lb. acidophilus culture. Incubation
is for 24 h at 36°C, and this generally results in a titratable acidity of 1%. After
incubation, the product is cooled and packaged. In addition to tartness, the prod-
uct also has a strong cooked flavor from sterilization of milk before fermentation.
Because of these qualities, the product is not popular. These drawbacks have
been overcome in a product from Finland, which is manufactured by fermenting
demineralized, lactose-hydrolyzed whey with Lb. casei GG and then adding fruit
flavors.
Fermented Milks and Cream 317
An alternative for ingestion of Lb. acidophilus is sweet acidophilus milk.
Initially, this product contained only Lb. acidophilus (Speck, 1975) but now also
includes bifidobacteria. Pasteurized, low-fat, skim, or whole fluid milk is pack-
aged with added viable Lb. acidophilus and bifidobacteria. As the inoculated fluid
milk is held refrigerated, growth of these bacteria does not occur during storage
but occurs in the intestinal tract after consumption. Such growth depends on strain
of Lb. acidophilus used (Collins and Hartlein, 1982). Because these organisms
are present, the milk must always be refrigerated. Shelf life under such conditions
is 2 weeks. Extended storage and/or storage at high temperatures will lead to
curdling of milk from acid produced by the added bacteria. A similar Swedish
fluid milk product contains Lb. reuteri in addition to Lb. acidophilus and bifido-
bacteria.
E. Kefir
Kefir is originally a Russian liquid fermented milk product (Tamime et al., 1999).
Approximately equal amounts of lactic acid and alcohol are produced during
fermentation. Typical flavor results from a balance between lactic acid, diacetyl,
aldehyde, ethanol, and acetone. Fizz is provided by the carbon dioxide that is
also produced during fermentation. In the manufacture of kefir, milk is heated
to 85°C for 30 min and cooled to an inoculation temperature of 22°C. It is then
inoculated with kefir grains and fermentation occurs over 12–16 h. The kefir
grains are then filtered out and reused.
1. Starter Organisms
Kefir grains consisting of yeasts, bacteria, and polysaccharides are used for kefir
production (Tamime and Marshall, 1997). The yeasts include Saccharomyces
kefir and Torula spp. or Candida kefir and bacteria include Lb. kefir, leuconostocs,
lactococci, and various others. Takizawa et al. (1998) isolated 120 strains of
lactobacilli from kefir grains; the most prominent was Lb. kefirogranum. The
grains require proper care and should be held using routine sanitary practices.
Contaminants such as coliforms, micrococci, and bacilli, if present, will lead to
a variety of flavor defects.
Kefir-like products with only small amounts of alcohol and with flavors
such as strawberry are also manufactured in the United States. Yeasts and various
Lactobacillus spp. and Lactococcus spp. are used.
F. Koumiss
Koumiss also is a product of Russian origin and is largely used in that country
for therapeutic purposes (Kosikowski and Mistry, 1997; Moreau, 1992). It is
318 Mistry
made with a combined acid and alcohol fermentation traditionally from mare’s
milk but cow’s milk also can be used. Even though the acid content of koumiss
is high, no curd is visible because of the relatively low protein content of mare’s
milk (2%) (Kosikowski and Mistry, 1997). Fermentation is accomplished with a
combination of Lb. delbrueckii subsp. bulgaricus and a lactose-fermenting yeast,
Torula spp. The finished product contains 1.0–1.8% lactic acid, 1.0–2.5% etha-
nol, and carbon dioxide. The latter makes for a frothy product.
G. Fermented Milks of Scandinavia
Scandinavians are among the highest consumers of fermented milk products. It
is not surprising, therefore, that some unique fermented products have originated
in Scandinavian countries. Examples include viili, langfil, keldermilk, skyr, ymer,
and several others. Some of these products possess unique characteristics such
as a heavy, ropy body obtained by the use of specially selected cultures, which,
in some instances, includes mold (Tamime and Marshall, 1997; Tamime and
Robinson, 1988).
Viili is a fermented product of Finland that may be either plain or flavored
with fruit. The fat content may vary from 2 to almost 12%, depending on classifi-
cation (such as low fat, full fat). Milk is heated to a high temperature (83°C for
20–25 min), tempered to the incubation temperature of 20°C, and inoculated with
4% starter culture consisting of Lc. lactis subsp. lactis, a diacetylactis culture,
Leuc. mesenteroides subsp. cremoris, and Geotrichum candidum, a mold. Incuba-
tion occurs in consumer cups at 20°C for 24 h (final acidity of 0.9%). The purpose
of incubation in consumer cups is to allow fat to rise to the surface during incuba-
tion where the geotrichum mold will grow and contribute to the typical musty
aroma. Furthermore, complex carbohydrates formed by the organisms used give
the product a heavy, ropy characteristic.
Ymer is a fermented product of Denmark that has a high protein content
of 5–6%. Current commercial procedures use ultrafiltration technology to con-
centrate the milk protein before fermentation (Tamime and Marshall, 1997). Con-
centration by some of the more traditional procedures involves either allowing
curd to drain or applying heat to curd to induce syneresis. Before fermentation,
milk receives a high-heat treatment (90–95°C for 3 min). Incubation is at 20–
22°C with an inoculum consisting of Lc. lactis subsp. lactis (biovar. diacetilactis)
and Leuc. mesenteroides subsp. cremoris. Consequently, the product has a pleas-
ant acidic flavor balanced with hints of diacetyl.
Another concentrated fermented product of Scandinavia is skyr. This prod-
uct is from Iceland and has almost 13% protein. Such a high concentration is
achieved commercially with the help of a centrifugal separator similar to one
used in the manufacture of quarg. Skim milk is fermented with thermophilic
lactic acid bacteria similar to those used for yogurt along with lactose-fermenting
Fermented Milks and Cream 319
yeast. Small amounts of rennet may also be added to obtain proper body. With
active cultures, a pH of 4.6 is obtained within 4–6 h at 40°C. After an additional
18 h at 18–20°C, the pH drops to 4, the product is pasteurized, and is then centri-
fuged at 35–40°C for concentration. Because of the presence of yeast, ethanol
occurs in the final product along with lactic acid, diacetyl, acetaldehyde, and
acetic acid.
H. Fermented Milks of India
India, the largest milk-producing country in the world today, has a long history
of dairying (Aneja, 1997). Production and consumption of milk and milk products
date back many thousands of years. Today, numerous indigenous products are
available locally. Of these, fermented milk products such as dahi, lassi, srikhand,
and misti doi are important parts of the diet.
Dahi is a product made by fermenting milk of the cow or water buffalo
milk with lactic acid bacteria. It has a clean, acidic flavor with slight hints
of diacetyl. The texture is similar to that of yogurt. Much of the dahi con-
sumed in India is either made at home or by small dairies. In both instances,
the culture usually consists of the previous day’s product, but pure cultures
are also available. Hence, composition of culture and consequently flavor
can vary from batch to batch. The legal standards of identity for dahi that is
produced commercially and sold in the market are the same as for milk from
which dahi is made (Aneja, 1997). The manufacturing procedure for dahi is
simple. Milk of the cow, water buffalo, or a mixture is briefly boiled and cooled
to room temperature. It is then inoculated with 0.5–1.0% culture and incu-
bated at room temperature for 12–16 h. With an active culture, the final pH
is 4.5–4.7. Because room temperature in tropical countries varies according
to the season, it is not uncommon to find thermophilic cultures in dahi. Dahi
typically contains a mixture of S. thermophilus, Lb. delbrueckii subsp. bulgar-
icus, Lc. lactis subsp. lactis, Lc. lactis subsp. cremoris, Lc. lactis subsp. lactis
(biovar. diacetylactis), Lb. helveticus, Lb. casei, and Lb. acidophilus (Masud et
al., 1991). The initial boiling step eliminates undesirable organisms from the
milk, but it is important to have an active culture. After repeated transfers, the
culture may lack activity and, in the absence of adequate acid production, undesir-
able flavors from growth of yeasts and mold may occur. Because yeasts tolerate
acid, it is important to prevent postheating contamination of the milk with these
microbes.
Lactic acid bacteria of dahi have antimicrobial effects against pathogenic
and spoilage bacteria (Balasubramanyam and Varadaraj, 1994; Dave et al., 1992;
Srinivasan et al., 1995). Some of these effects come from cell-free extracts and
are believed to be associated with production of H
2
O
2
by lactobacilli and bacterio-
cin-like compounds by some lactococci (de Vuyst and Vandamme, 1994).
320 Mistry
Dahi is typically stored at room temperature; hence lactic acid continues
to develop rapidly after its manufacture. Researchers have attempted to eliminate
this by introducing nisin (25 IU/mL) in dahi after fermentation is completed
(Kumar et al., 1998).
Dahi is consumed as such and is also used as a base for producing other
products. Examples include lassi, srikhand, and ghee. Lassi is a liquid product
that is manufactured by blending water and dahi and mixing to a uniform consis-
tency. The ratio of dahi to water depends on the consistency desired. The product
is lightly salted or sweetened.
Srikhand is a popular product that is manufactured at home and also com-
mercially (Patel and Chakraborty, 1988). Fresh dahi is drained either with a
cheesecloth overnight or with the help of a centrifuge. The drained curd is mixed
with an equal proportion of sugar and enough cream to adjust the fat content to
5–6%. Additional flavorings such as fruits, nuts, and spices may be added. The
final product has 40–45% moisture, 5–6% fat, 40–45% sugar, and a shelf life
of at least 30–35 days at 10°C (Patel and Chakraborty, 1987). Postproduction
acidification is restricted by the presence of a large amount of sugar, but spoilage
occurs through growth of yeasts and mold and the presence of heat-stable proteo-
lytic and lipolytic enzymes that cause undesirable flavors. The shelf life can be
improved to almost 2 months by pasteurizing the product before packaging (Pra-
japati et al., 1991). The use of nisin as a preservative has also been suggested
(Sarkar et al., 1996b). It is also important to ensure that good-quality sugar is
used, such as that which is hot-air treated to improve the microbial quality of
srikhand (Patel and Chakraborty, 1987). Antibacterial effects of dahi described
above also apply to srikhand (Sarkar et al., 1996a).
Ghee is clarified milk fat and has been used for cooking in India for
thousands of years. Although it is not a fermented product, some procedures to
manufacture ghee use dahi as a base. Dahi, when churned, is separated into a
fat-rich product (butter) and buttermilk. Butter is then heated to 110–120°C,
cooled, and filtered. When cooled, it has a granular texture. Much of the flavor
of this product results from metabolites of the lactic fermentation during dahi
manufacture.
A fermented product similar to dahi called misti doi is popular in eastern
India. The manufacturing procedure is similar to that of dahi except that before
boiling 6–6.5% sugar is added to milk. The intense heating concentrates milk
and gives it a slight brownish color. Approximately 1% culture (previous day’s
product) is added and incubation occurs at approximately 40°C for 12–15 h.
Thermophilic lactic organisms predominate. For example, in one study, 45% of
total isolates were S. thermophilus, 35% were S. lactis, and 20% were Enterococ-
cus faecalis (Sarkar et al., 1992). Although this product is commonly produced
at home and in small-scale dairies, standardized commercial procedures for large-
scale production have been developed.
Fermented Milks and Cream 321
IV. FERMENTED MILKS OF THE MIDDLE EAST
Fermented milk products have a long history in Middle Eastern countries (El-
Gendy, 1983). Popular products include laban rayeb, labneh (concentrated yo-
gurt), kishk, and zabady. Other regional names for some of these products also
exist. Laban rayab is traditionally prepared by pouring unhomogenized whole
milk in pots and held at room temperature. Fat rises to the surface and is removed.
The defatted milk undergoes a natural fermentation and then is ready for con-
sumption. Variations of this product are laban khad and laban zeer. The former
is prepared by allowing milk to ferment in a goat pelt, whereas the latter is made
in earthenware pots called zeer which are used for incubation. The season, and
hence the temperature, will determine the dominating microflora of these prod-
ucts. Generally, lactococci dominate in the cold season and lactobacilli in the
warm season. Laban zeer is used to make another highly nutritious product called
kishk. To prepare this product, laban zeer is mixed with wheat grains that have
been softened by boiling in water, sun-dried, and ground. The mixture undergoes
a 24-h fermentation. The product, now with high viscosity, is divided into small
pieces and then sun-dried and stored until consumed. Spices may be added.
Kishk, which has approximately 8% moisture and 1.85% acidity, has a shelf life
of several years (El-Gendy, 1983).
A concentrated fermented product called labneh that has 7–10% fat is pro-
duced in several Arabian countries. It is made at home using traditional proce-
dures as well as on a large scale in dairies. The basic procedure for this product
involves concentration of milk after fermentation is completed. For commercial
production, skim or whole milk is fermented with yogurt cultures, but strains
that produce exopolysaccharides are not used because of the difficulty in remov-
ing whey after fermentation (Tamime and Robinson, 1988). The fermented prod-
uct is then separated with the help of centrifugal separators such as those used
in manufacturing quarg. Alternatively, milk is fermented after concentration by
ultrafiltration to the desired composition. A traditional product of Egypt similar
to labneh is zabady, which is made by fermenting milk that has been concentrated
by boiling with thermophilic cultures in porcelain containers (El-Gendy, 1983).
REFERENCES
Andrew MHE, Russell AD. The Revival of Injured Microbes. New York: Academic Press,
1984.
Aneja RP. Traditional dairy delicacies. In: Gupta PR, ed. Dairy India. New Delhi: PR
Gupta. 1997, pp 371–386.
Balasubramanyan BV, Varadaraj MC. Dahi as a potential source of lactic acid bacteria
active against foodborne pathogenic and spoilage bacteria. J Food Sci Technol-
Mysore 31:241–243, 1994.
322 Mistry
Bodyfelt FW, Tobias J, Trout GM. The Sensory Evaluation of Dairy Products. New York:
Van Nostrand Reinhold, 1988.
Briceno AG, Martinez R. Comparison of methodologies for the detection and enumeration
of lactic acid bacteria in yogurt. Arch Latinoam Nutr 45:207–212, 1995.
Chandan RC. Yogurt. In: Hui YH, ed. Dairy Science and Technology Handbook. Vol 2.
Product Manufacturing. New York: VCH, 1992, pp 1–56.
Collins EB, Hartlein K. Influence of temperature of lactobacilli on nonfermented acido-
philus milks. J Dairy Sci 65:883–886, 1982.
Dave RI, Shah NP. Evaluation of media for selective enumeration of Streptococcus ther-
mophilus, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus acidophilus,
and bifidobacteria. J Dairy Sci 79:1529–1536, 1996.
Dave RI, Dave JM, Sannabhadti SS. Antibacterial activity of buffalo milk dahi prepared
using S. thermophilus strains as starter culture. Indian J Dairy Sci 45:607–610,
1992.
de Valdez GF, de Giorio GS, Ruiz-Holgado AA, Oliver G. Influence of the recovery
medium on the viability of injured freeze-dried lactic acid bacteria. Milchwis-
senschaft 40:518–520, 1985.
de Vuyst L, Vandamme EJ. Bacteriocins of Lactic Acid Bacteria: Microbiology, Genetics,
and Applications. New York: Blackie, 1994.
Dunn JM, Finocchiaro ET. Starch-based texturizing agents and methods of manufacture.
US Patent 5614243:Mar 25, 1997.
El-Gendy SM. Fermented foods of Egypt and the Middle East. J Food Prot 46:358–367,
1983.
Elliker PR. Effect of various bacteria on diacetyl content and flavor of butter. J Dairy Sci
28:93–102, 1945.
Frank JF, Christen GL, Bullerman LB. Tests for groups of microorganisms. In: Marshall
RT, ed. Standard Methods for the Examination of Dairy Products. 16th Ed. Wash-
ington, DC: Am Public Health Association 1992, pp 278–279.
Gilliland SE. Acidophilus milk products: A review of potential benefits to consumers. J
Dairy Sci 72:2483–2494, 1989.
Guirguis N, Hickey MW. Factors affecting the performance of thermophilic starters. 1.
Sensitivity to dairy sanitizers. Aust J Dairy Technol 42:11–13, 1987a.
Guirguis N, Hickey MW. Factors afferting the performance of thermophilic starters. 2.
Sensitivity to the lactoperoxidase system. Aust J Dairy Technol 42:14–16, 1987b.
Hammer BW. Dairy Bacteriology. New York: Wiley, 1928.
Hassan AN, Frank JF, Schmidt KA, Shalabi SI. Rheological properties of yogurt made
with encapsulated nonropy lactic cultures. J Dairy Sci 79:2091–2097, 1996.
International Dairy Federation. Mesophilic Starter Cultures. Enumeration of Citrate
Fermenting Lactic Acid Bacteria: Int Dairy Fed Standard 180. Brussels: IDF,
1997a.
International Dairy Federation. Yogurt. Enumeration of Characteristic Microorganisms:
Int Dairy Fed Standard 117B. Brussels: IDF, 1997b.
International Dairy Federation. World Dairy Situation, Bulletin 339. Brussels: IDF, 1999.
Kilic AO, Pavlova SI, Ma W, Tao L. Analysis of lactobacillus phages and bacteriocins
in American dairy products and characterization of a phage isolated from yogurt.
Appl Environ Microbiol 62:2111–2116, 1996.
Fermented Milks and Cream 323
Kosikowski FV, Mistry VV. Cheese and Fermented Milk Foods. Vol 1. Origins and Princi-
ples. Westport, CT: Kosikowski, 1997.
Kumar R, Sarkar S, Misra AK. Effect of incorporation of nisin on the quality of dahi. J
Dairying Foods Home Sci 17:13–24, 1998.
Kurmann JA, Rasic JL, Kroger M. Encyclopedia of Fermented Fresh Milk Products. New
York: Van Nostrand Reinhold, 1992.
Lavezzari D, Sozzi T, Pirovano F. Microorganisms producing polysaccharides: differentia-
tion between ropy and thickening strains. In: Texture of Fermented Milk Products
and Dairy Desserts. Brussels: IDF, 1998, pp 71–77.
Lee FY, White CH. Effects of stabilizers and rennet on sensory and physical properties
in lowfat sour cream. J Dairy Sci 74:(Suppl 1) 126 (Abstr), 1991.
Lee SY, Vedamuthu ER, Washam CJ, Reinbold GW. An agar medium for the differen-
tial enumeration of yogurt starter bacteria. J Milk Food Technol 37:272–276,
1974.
Levata-Jovanovic M, Sandine WE. A method to use Leuconostoc mesenteroides subsp.
cremoris 91404 to improve milk fermentations. J Dairy Sci 80:11–18, 1997.
Mareschi JP, Cueff A. Essential characteristics of yogurt and regulation around the world.
In: Chandan RC, ed. Yogurt: Nutritional and Health Properties. McLean, VA: Na-
tional Yogurt Association, 1989, pp 11–28.
Martin JH, Chou KM. Selection of bifidobacteria for use as dietary adjuncts in cultured
dairy foods: 1—tolerance to pH of yogurt. Cultured Dairy Prod J 27:(4)21–26,
1992.
Masud T, Sultana K, Shah MA. Incidence of lactic acid bacteria isolated from indigenous
dahi. Asian Australasian J Animal Sci 4:329–331, 1991.
Matalon ME, Sandine WE. Improved media for differentiation of rods and cocci in yogurt.
J Dairy Sci 69:2569–2576, 1986.
Miller DD, Elliker PR. Effect of quaternary ammonium compounds on activity of lactic
acid starter bacteria in milk and cheese. J Dairy Sci 34:279–286, 1951.
Mistry VV, Hassan HN. Manufacture of yogurt from a high milk protein powder. J Dairy
Sci 75:947–957, 1992.
Moineau S, Borakev M, Holler BJ, Walker SA, Kondo JK, Vedamuthu ER, Vandenbergh
PA. Isolation and characterization of lactococcal bacteriophages from cultured but-
termilk plants in the United States. J Dairy Sci 79:2104–2111, 1996.
Moreau M. Mare milk. Equ’idee Bull d’information sur les Equides 6:55–63, 1992.
Pariente JM, Ryan JJ, Adkinson RW, Gough RH. Enumeration of heat injured Lactobacil-
lus casei using five different growth media. J Dairy Sci 70:(Suppl 1) 80 (Abstr),
1987.
Patel RS, Chakraborty BK. Storage stability of shrikhand manufactured from different
sources of milk solids. Jpn J Dairy Food Sci 36:209–216, 1987.
Patel RS, Chakraborty BK. Shrikhand—a review. Indian J Dairy Sci 41:109–115, 1988.
Pearce LE. Quaternary ammonium detergent sanitizers and starter activity. NZ J Dairy
Sci Technol 13:56–58, 1978.
Prajapati JP, Upadhyay KG, Desai HK. Study on influence of post-production heat treat-
ment on quality of fresh shrikhand. J Food Sci Technol-Mysore 28:365–367, 1991.
Rasic JL, Kurmann JA. Yogurt. Copenhagen: Technical Publishing House, 1978.
Rasic JL, Kurmann JA. Bifidobacteria and Their Role. Basel: Birkhauser Verlag, 1983.
324 Mistry
Rasic JL, Kosikowski FV, Bozic Z. Nutrient yogurt from low lactose milk using a com-
bined lactase-UF retentate procedure. Milchwissenschaft 47:32–35, 1992.
Ray B. Sublethal injury, bacteriocins, and food microbiology. ASM News 59:285–291,
1993.
Reinbold GW, Reddy MS. Sensitivity or resistance of dairy starter and associated microor-
ganisms to selected antibiotics. J Milk Food Technol 37:517–521, 1974.
Sarkar S, Dave JM, Sannabhadti SS. Characterisation of isolates of lactic acid bacteria
from market sample of misti dahi. Indian J Dairy Sci 45:33–36, 1992.
Sarkar S, Kuila RK, Misra AK. Antimicrobial properties of srikhand. Indian J Dairy Sci
49:270–276, 1996a.
Sarkar S, Kuila RK, Misra AK. Effect of incorporation of gelodan TMSB 253 (stabilizer
cum preservative) and nisin on the microbiological quality of shrikhand. Indian J
Dairy Sci 49:176–184, 1996b.
Sato J, Omata Y, Kodama Y, Noda K. Applications of DEFT in the dairy industry. J Jpn
Soc Food Sci Technol 33:117–124, 1986.
Seitz EW, Sandine WE, Elliker PR, Day EA. Distribution of diacetyl reductase among
bacteria. J Dairy Sci 46:186–189, 1963.
Singer NS, Latella J, Yamamoto S. Reduced fat sour cream. US Patent 5096730:Mar 17,
1992.
Singer NS, Pookote S, Hatchwell LC, Anderson G, Shazer AG, Booth BJ. Flavor delivery
system for fat free foods. US Patent 5202146:Apr 13, 1993.
Speck ML. Market outlook for acidophilus food products. Cultured Dairy Prod J 10:8,
1975.
Srinivasan R, Sarkar S, Pramanik KK, Misra AK. Isolation and characterization of
lactococcus species producing bacteriocins. Indian J Dairy Sci 48:596–602,
1995.
Swithinbank H, Newman G. Bacteriology of Milk. London: John Murray, 1903.
Takizawa S, Kojima S, Tamura S, Fujinaga S, Benno Y, Nakase T. The composition of
the lactobacillus flora in kefir grains. Syst Appl Microbiol 21:121–127, 1998.
Tamime AY, Marshall VME. Microbiology and technology of fermented milks. In: BA,
Law ed. Microbiology and Biochemistry of Cheese and Fermented Milk. London:
Chapman & Hall, 1997, pp 57–152.
Tamime AY, Robinson RK. Yogurt Science and Technology. New York: Pergamon Press,
1985.
Tamime AY, Robinson RK. Fermented milks and their future trends. Part II. Technological
aspects. J Dairy Res 55:281–307, 1988.
Tamime AY, Muir DD, Wszolek M. Kefir, koumiss and kishk. Dairy Ind Int 64:(5)32–
33, 1999.
Valladao M, Sandine WE. Quaternary ammonium compounds in milk: Detection by re-
verse-phase high performance liquid chromatography and their effect on starter
growth. J Dairy Sci 77:1509–1514, 1994.
Vedamuthu ER. What is wrong with cultured buttermilk today? Dairy Food Sanit 5:8–
13, 1985.
Vedamuthu ER. The yogurt story—past, present and future. Dairy Food Environ Sanit
11:202–203, 265–267, 310–311, 371–374, 444–446, 513–514, 583–585, 729–
733, 12:220–221, 351–354, 1992.
Fermented Milks and Cream 325
Vedamuthu ER. The dairy leuconostoc: use in dairy products. J Dairy Sci 77:2725–2737,
1994.
Vedamuthu ER, Shah RB. Method for the preparation of naturally thickened and stabilized
fermented milk products and products produced thereby. US Patent 4328097:May
3, 1983.
Wilkins DW, Schmidt RH, Shireman RB, Smith KL, Jezeski JJ. Evaluating acetaldehyde
synthesis from L-[
14
C(U)] threonine by Streptococcus thermophilus and Lactobacil-
lus bulgaricus. J Dairy Sci 69:1219–1224, 1986.
Wood BJB, Holzapfel WH. The Genera of Lactic Acid Bacteria. New York: Chapman &
Hall, 1995.
Yalpani M. Polyhydroxyalkanoate flavor delivery system. US Patent 5225227:Jul 6, 1993.
10
Probiotics and Prebiotics
Stanley E. Gilliland
Oklahoma State University
Stillwater, Oklahoma
I. INTRODUCTION
Metchnikoff (1908) theorized that Lactobacillus delbrueckii subsp. bulgaricus
could grow in the intestinal tract of humans and displace any putrefying bacteria
that are present. Displacement of this group of bacteria was thought to reduce
production of toxic compounds that adversely affect the human body, thus en-
abling humans to live longer. Research done since Metchnikoff’s period has
shown that Lb. delbrueckii subsp. bulgaricus neither survives nor establishes it-
self in the gastrointestinal tract. However, other species of lactobacilli have been
reported to provide some beneficial effects through growth and action in the gas-
trointestinal tract. This group of bacteria and others are now often referred to as
probiotics. Although there are other possibilities, cultures most often mentioned
as probiotics for humans include Lb. acidophilus, Lb. casei, and Bifidobacterium
species. These species along with Propionibacterium species and Lb. reuteri are
the ones most often considered for use as probiotics for livestock. All these spe-
cies can survive and grow in the intestinal tract, and thus have the potential to
provide benefits. Certain yeast cultures also are considered as being probiotics
for livestock even though the yeasts are not expected to survive and grow in the
gastrointestinal tract.
Bacteria normally used as starter cultures for some fermented milk prod-
ucts, such as Lb. delbrueckii subsp. bulgaricus and Streptococcus thermophilus
used to manufacture yogurt, also may provide benefits, but not through the ability
to survive and grow in the intestinal tract. Benefits they provide come primarily
from serving as a source of enzymes needed to improve digestion of nutrients
327
328 Gilliland
in the gut. For example, β-galactosidase is needed for hydrolysis of lactose in
the small intestine (Gilliland and Kim, 1983).
Whereas some reports indicate that the nutritional value of milk can be
improved by certain fermentations (Hargrove and Alford, 1980), this chapter fo-
cuses on the potential help or nutritional benefits that result from growth or action
of probiotic microorganisms following their ingestion. Several benefits are possi-
ble from such microorganisms, including control of intestinal infections, control
of serum cholesterol levels, beneficial influences on the immune system, improve-
ment of lactose utilization in persons who are classified as being lactose maldiges-
tors, and anticarcinogenic action. Research is continuing in each of these areas
to provide definite scientific evidence that could permit specific health claims to
be made for dairy products containing one or more of this group of probiotic
organisms. Several publications have focused on these in more detail (Gilliland,
1990; Lee and Salminen, 1995; Sissons, 1989). Foods containing such micro-
organisms may be promoted as functional foods in the future.
II. POTENTIAL BENEFITS
Most of the potential benefits to be discussed will focus on those applicable to
human health or nutrition. A separate section addresses the issue of probiotics
for livestock use.
A. Control of Growth of Undesirable Organisms
in the Intestinal Tract
Lb. acidophilus, Lb. casei, and species of Bifidobacterium can inhibit growth of
undesirable microorganisms that might be encountered in the gastrointestinal
tract. Most of the older reports dealing with this type of control focused on a
therapeutic approach; in that cultured products made with these organisms were
used to treat infections of various types (Gordon et al., 1957; Winkelstein, 1955).
Some studies involving these organisms were poorly done and improper controls
were used, so it is difficult to draw definite conclusions concerning the benefit of
probiotic organisms. The newer approach is to provide consumers with products
containing the probiotic organisms for use as preventive treatment in controlling
intestinal infections. Studies using chickens as animal models and in which the
birds were dosed with specific intestinal pathogens following consumption of
cells of Lb. acidophilus have shown that the lactobacilli do exert control over
Salmonella infections (Watkins and Miller, 1983). Feeding lactobacilli to birds
before challenge with pathogens followed by continued consumption of Lb. aci-
dophilus after the challenge dose resulted in best control of pathogens, sug-
Probiotics and Prebiotics 329
gesting that continuous consumption of the probiotic organism is desirable. Re-
searchers conducting this study also showed that Lb. acidophilus was effective
in controlling Escherichia coli in the intestinal tract of chickens (Watkins et al.,
1982).
In recent years, several other studies have shown the efficacy of certain
probiotic organisms in controlling growth of undesirable microorganisms in the
intestinal tract. A product containing a selected culture of lactobacilli and devel-
oped and marketed in Argentina has been useful in controlling intestinal infec-
tions (Oliver et al., 1999). Consumption of milk fermented with Lb. casei signifi-
cantly decreased the severity of diarrhea in children in day care centers in France
(Pedone et al., 1999). Consumption of cells of Lb. acidophilus controlled small
bowel overgrowth in patients with kidney failure (Simenhoff et al., 1996). Inges-
tion of cells of Bi. bifidum reduced shedding of rotavirus (Duffy et al., 1994).
Selected strains of Lb. acidophilus excreted an antimicrobial substance active
against Helicobacter pylori both in vivo and in vitro (Coconnier et al., 1998).
Just how the probiotic bacteria function in inhibiting growth of undesirable
microorganisms in the intestinal tract is not clear. Many of the probiotic organ-
isms produce substances that are inhibitory in vitro; however, it is difficult to
confirm the activity of these compounds in vivo. The probiotic bacteria in ques-
tion all produce large amounts of acid during their growth, because they rely on
fermentation to obtain energy for growth. However, the antagonistic action that
they produce toward undesirable microorganisms apparently is not caused just
by acid produced during their growth. Several of these organisms produce anti-
biotic-like substances, some of which have been classified as bacteriocins, which
may be involved in the antagonistic action toward these pathogens. Bacteriocins,
according to the classic definition, are bacterial proteins active against organisms
closely related to the producer organism (Tagg et al., 1976). This may limit the
breadth of action of these inhibitory substances produced by probiotic bacteria.
They would not be expected to have any effect on gram-negative intestinal patho-
gens. Furthermore, because of their sensitivity to proteolytic enzymes, bacterio-
cins may not survive the digestive function of the intestines.
Antimicrobial substances, other than bacteriocins, produced by probiotic
bacteria have been implicated in recent publications as having a possible role in
controlling intestinal pathogens. A low molecular weight nonproteinaeous mate-
rial produced by a Lactobacillus culture was active against a broad range of
gram-negative and gram-positive bacteria (Silva et al, 1987). These researchers
suggested the inhibitory agent to be a short-chain fatty acid other than lactic or
acetic. Reuterin, an antimicrobial agent produced by Lb. reuterii, has a broad
spectrum of activity. It has been characterized as a mixture of various forms of
β-hydroxypropionaldehyde (Talarico and Dobrogosz, 1989). It also could be ac-
tive in the control of pathogens.
330 Gilliland
Competitive exclusion by probiotic bacteria is another mechanism that has
been suggested as being important in controlling intestinal infections (Watkins
and Miller, 1983). Competitive exclusion involves the ability of lactobacilli or
bifidobacteria to occupy binding sites on the intestinal wall, thereby preventing
attachment and growth of enteric pathogens.
Definitive scientific data showing the mechanism of action whereby these
probiotic bacteria may exert inhibitory actions toward pathogens in the intestinal
tract would make it easier to select the most effective strains of probiotic bacteria
for use in dairy products to help control intestinal infections in humans. Most
likely the antagonistic actions produced by probiotic bacteria toward intestinal
pathogens result from a combination of factors.
B. Improvement of Immune Response
Enhancement of the body’s immune response by consuming cells of certain
lactobacilli increases resistance of the host to intestinal infections (Lessard and
Brisson, 1987; Perdigon et al., 1990a; Sato et al., 1988; Romond et al., 1997).
Of the lactobacilli, Lb. casei seems to be the primary one involved (Perdigon
et al., 1990B). Bi. longum also can stimulate the immune system to control E.
coli in the gastrointestinal tract (Romond et al., 1997). As with other charac-
teristics of the lactic acid bacteria, the relative ability of probiotic bacteria
to cause such an effect probably varies tremendously among strains of indivi-
dual species. Researchers in this area have suggested that this action involves
activation of macrophages which in turn destroy pathogenic organisms in the
body. It also has been suggested that consumption of these organisms is followed
by secretion of components into the intestinal tract which are inhibitory toward
certain of the foodborne pathogens. This enhancement of the immune system
increases the host defense mechanisms and could be very important for control
of foodborne illnesses. This may be a key explanation as to how certain probiotic
microorganisms used as dietary adjuncts can exert control over intestinal infec-
tions.
C. Improvement of Lactose Digestion
People who lack the ability to digest lactose adequately are classified as lactose
maldigestors. (In the past, terms such as ‘‘lactose intolerance’’ or ‘‘lactose malab-
sorption’’ have been used to describe this condition). The problem results from
inadequate levels of β-galactosidase in the small intestine to hydrolyze ingested
lactose adequately. Once a lactose maldigestor consumes sufficient lactose, it
passes into the large intestine where it undergoes an uncontrolled fermentation
that results in symptoms of cramps, flatulence, and diarrhea. These symptoms
often follow consumption of milk by such individuals. Because lactose maldiges-
Probiotics and Prebiotics 331
tion results from inadequate levels of an enzyme to hydrolyze lactose in the small
intestine, the possibility exists for providing such an enzyme via the diet. Inclu-
sion of a purified enzyme such as β-galactosidase in the diet is rather expensive
and survival of the enzyme during passage through the stomach likely would be
minimal. Research has shown that the presence of viable starter cultures in yogurt
can be beneficial to lactose maldigestors (Gilliland and Kim, 1984; Kolars et
al., 1984). This beneficial action results from presence of β-galactosidase in the
bacterial cells. Apparently being inside the bacterial cells protects the enzyme
during passage through the stomach so that it is present and active when yogurt
reaches the small intestine. Once the yogurt culture reaches the small intestine,
it interacts with bile, which increases permeability of the cells of these bacteria
and enables the substrate to enter and be hydrolyzed (Noh and Gilliland, 1992).
The enzyme remains inside the cell upon exposure to bile rather than leaking out
into the surrounding medium. As mentioned previously, the starter cultures used
for yogurt manufacture (Lb. delbrueckii subsp. bulgaricus and S. thermophilus)
are not bile resistant and thus are not expected to survive and grow in the intestinal
tract. Despite this limitation, consumption of these bacteria provides a means of
transferring β-galactosidase into the small intestine where it can improve lactose
utilization in lactose maldigestors.
Nonfermented milk containing cells of Lb. acidophilus also can be benefi-
cial for lactose maldigestors (Kim and Gilliland, 1983). This organism, unlike
the yogurt starter cultures, can survive and grow in the intestinal tract. However,
a similar mechanism in improving lactose utilization in lactose maldigestors to
that observed for yogurt bacteria is probably involved. β-Galactosidase activity
of cells of Lb. acidophilus is greatly increased in the presence of bile because
of increased cellular permeability (Noh and Gilliland, 1993). As with yogurt cul-
tures, cells of Lb. acidophilus do not lyse in the presence of bile, but their perme-
ability is increased permitting lactose to enter the cells and be hydrolyzed. Be-
cause Lb. acidophilus can survive and grow in the intestinal tract, it is reasonable
to expect, however, that additional β-galactosidase may be formed after ingestion
of milk containing this organism.
There has been some controversy over whether or not acidophilus milk is
effective in improving lactose utilization by lactose maldigestors; however, if the
cells contain sufficient levels of β-galactosidase before ingestion, it is reasonable
to assume they will provide such a benefit. Results of studies that have suggested
milk containing Lb. acidophilus is ineffective (Payne et al., 1981; Saviano et al.,
1984) in improving lactose digestion might be questioned, because no evidence
was provided concerning cultures used or the procedure by which they were
produced. In those studies, it is possible, that insufficient β-galactosidase was
present in milk containing cells of Lb. acidophilus at the time of consumption.
One of the studies (Saviano et al., 1984) indicated that no β-galactosidase activity
was detected in milk containing Lb. acidophilus.
332 Gilliland
Based on the proposed mechanism for improving lactose digestion by yo-
gurt cultures, it seems reasonable that consumption of any product containing
bacterial cells having adequate intracellular β-galactosidase activity could pro-
vide a benefit such as improving lactose utilization. Because this enzyme usually
is inducible in most microorganisms, it is important that before ingestion the
organism be grown in a medium containing lactose. This becomes particularly
important when cells of probiotic bacteria grown in some medium other than
milk are added to nonfermented milk. The level of β-galactosidase activity also
varies among strains of Lb. acidophilus as well as among commercial yogurt
cultures. Therefore, it is important to consider the level of β-galactosidase activity
in probiotic or starter cultures to be used for improving lactose digestion in lactose
maldigestors. It also is important for the activity to remain high during transporta-
tion and storage of such products so that the consumer receives the product con-
taining enough of the enzyme to provide a benefit.
D. Anticarcinogenic Actions
Anticarcinogenic or antimutagenic activities have been reported for several cul-
tures used to manufacture various fermented milk products (Goldin and Gorbach,
1984; Oda et al., 1983; Reddy et al., 1983; Shahani et al., 1983). Some of these
studies have involved products containing probiotic bacteria expected to survive
and grow in the intestinal tract, whereas others have involved only bacteria used
to manufacture the product and which are not normally expected to survive and
grow in the intestinal tract. For instance, consumption of yogurt by mice inhibited
development of certain tumors (Reddy et al., 1983). This represents another po-
tential health benefit for a cultured product without necessarily involving one of
the traditional probiotic bacteria. In other studies involving human subjects, a
culture of lactobacilli exhibited potential in controlling cancer of the colon (Gol-
din and Gorbach, 1984). The lactobacillus used in this study was later identified
as Lb. casei.
Lb. acidophilus, Lb. casei, and Lb. delbrueckii subsp. bulgaricus are spe-
cies most often mentioned as having potential to provide anticarcinogenic actions.
For Lb. delbrueckii subsp. bulgaricus, which is not normally considered a probi-
otic organism, the anticarcinogenic action apparently is associated with sub-
stances produced by the organism during manufacture of yogurt as opposed to
being produced in the body following consumption of yogurt. However, for Lb.
acidophilus and Lb. casei growth or action in the gastrointestinal tract seems to
be important. Part of the benefit may involve direct effects in inhibiting tumor
formation. However, the main effect may result indirectly through inhibiting
growth of undesirable bacteria that form carcinogens in the large intestine (Goldin
and Gorbach, 1984). Thus, this may represent another benefit in being able to
control growth of undesirable organisms in the gastrointestinal tract.
Probiotics and Prebiotics 333
E. Control of Serum Cholesterol
In the 1970s, two studies were published that suggested organisms such as Lb.
acidophilus can potentially reduce serum cholesterol levels in humans. One of
these studies involved milk fermented with what was described as a ‘‘wild’’ strain
of lactobacillus and then fed to a group of men on a high-cholesterol diet (Mann
and Spoerry, 1974). The study was designed to evaluate the influence of a surfac-
tant (Tween 20) on serum cholesterol levels. The researchers theorized that the
surfactant would increase absorption of cholesterol from the intestine and thus
increase serum cholesterol levels. However, the serum cholesterol level in both
groups of men, that is, those receiving the surfactant and those who did not,
decreased! This was one of the first studies that suggested consumption of a
fermented dairy product could reduce serum cholesterol levels in humans. How-
ever, neither the organism involved in the fermentation nor the mechanism was
identified. In another study, cells of Lb. acidophilus added to infant formula re-
duced serum cholesterol in infants receiving the formula (Harrison and Peat,
1975), whereas infants receiving the formula without cells of Lb. acidophilus
exhibited increased serum cholesterol levels. The researchers concluded that Lb.
acidophilus, through its growth in the intestine, in some way influenced the serum
cholesterol level, although no mechanism was suggested.
Several studies have shown that animals consuming milk containing cells
of Lb. acidophilus had lower serum cholesterol levels than did animals that did
not receive milk containing the lactobacilli (Danielson et al., 1989; Gilliland et
al., 1985; Grunewald, 1982). Some strains of Lb. acidophilus can actively assimi-
late or take up cholesterol during growth in laboratory media (Gilliland et al.,
1985; Gopal et al., 1996). This occurs when the organisms are grown anaerobi-
cally in the presence of bile. A portion of the cholesterol is incorporated into the
cellular membrane of Lb. acidophilus (Noh et al., 1997). There is variation among
strains of this organism in their ability to exert control over serum cholesterol
levels (Gilliland et al., 1985). Pigs on a high-cholesterol diet fed a strain of Lb.
acidophilus that actively assimilated cholesterol during growth in laboratory me-
dia had significantly lower serum cholesterol levels than did pigs receiving a
strain of Lb. acidophilus that did not actively assimilate cholesterol in laboratory
media (Gilliland et al., 1985). This suggests the ability to assimilate cholesterol
in laboratory media provides an indication of the potential of this organism, if
consumed, to exert some control over serum cholesterol levels. Similar findings
were noted when a mixture of Lb. johnsonii and Lb. reuteri was fed to pigs (du
Toit et al., 1998).
Another activity of Lb. acidophilus that may be important is its ability to
deconjugate bile acids. This provides yet another mechanism whereby ingested
Lb. acidophilus might exert control of serum cholesterol levels. Deconjugation
of bile acids by lactobacilli can occur in the small intestine. Lb. acidophilus more
334 Gilliland
actively deconjugates glycocholic acid than it does taurocholic acid (Corzo and
Gilliland, 1999). This becomes significant because the dominant conjugated bile
acid in the human intestine is glycocholic acid. Free bile acids are less well ab-
sorbed in the small intestine than are conjugated bile acids and thus more are
excreted through feces (Chickai et al., 1987). Excretion of bile acids through
feces represents one of the major mechanisms whereby the body eliminates cho-
lesterol. This is because cholesterol is a precursor for synthesis of bile acids and
many bile acids that are excreted from the body are replaced by synthesis of new
ones. Thus, there is a potential for reducing the cholesterol pool in the body.
Furthermore, free bile acids do not support absorption of cholesterol from the
intestinal tract as well as do conjugated ones (Eyssen, 1973). Thus, deconjugation
of bile acids in the intestinal tract may reduce the efficiency by which cholesterol
is absorbed from the intestinal tract.
Research into the potential of Lb. acidophilus to exert hypocholesterolemic
effects in humans has indicated tremendous variation among strains of Lb. acido-
philus isolated from the human intestinal tract in their ability to assimilate choles-
terol (Buck and Gilliland, 1994). Evaluation of strains of Lb. acidophilus used
commercially in cultured or culture-containing dairy products in the United States
has revealed that none is particularly active in assimilating cholesterol from labo-
ratory media (Gilliland and Walker, 1990). On the other hand, new strains that
are very active in this regard have been isolated from the human intestinal tract,
and thus they may provide greater potential for use as dietary adjuncts to assist
in controlling serum cholesterol levels (Buck and Gilliland, 1994). Of 122 isolates
of Lb. acidophilus obtained from human intestinal sources, several were identified
as having great potential for exerting control over serum cholesterol levels, be-
cause they were very active in assimilating cholesterol during growth in a labora-
tory medium. They were far more active in this regard than were the currently
commercially available strains of Lb. acidophilus. One of these strains is pres-
ently used in the Netherlands to produce a fermented yogurt product named Fysiq
which is promoted as being useful in helping maintain a healthy cholesterol level.
This strain of Lb. acidophilus has been used in a human feeding trial of hypercho-
lesterolemic individuals and caused a significant reduction in serum cholesterol
levels (Anderson and Gilliland, 1999).
There may be other probiotic organisms that can help to control serum
cholesterol levels. Some of these include Lb. casei (Brashears et al., 1998) and
Bifidobacterium species (Gopal et al., 1996). Bi. longum removes cholesterol
from laboratory media much the same as does Lb. acidophilus and incorporates
part of it into the cellular membrane of this bacterium (Dambekodi and Gilliland,
1998). Lb. casei also can remove cholesterol from laboratory growth media. How-
ever, no evidence was found for association of cholesterol with the cellular mem-
brane of this bacterium (Brashears et al., 1998). Both these organisms also can
deconjugate bile acids. Currently there is great interest throughout the world in
Probiotics and Prebiotics 335
the potential of these bacteria to exert some control over serum cholesterol levels
in hypercholesterolemic individuals.
III. HEALTH CLAIMS
There is potential for probiotic cultures to provide health and nutritional benefits
for consumers. However, data are insufficient in most instances to permit specific
health claims to be made in the United States for dairy products containing such
bacteria. Improvement of lactose utilization by lactose maldigestors is a possible
exception. Before specific health claims can be made for most of these products,
it is necessary for clinical trials to establish that the benefits indeed occur. Such
trials should be conducted using only probiotic bacteria that have been selected
for a specific activity. In other words, they should be selected in some manner to
ensure they likely will produce the desired health or nutritional benefits (Gilliland,
1990).
In some European countries, products containing probiotics are marketed
as providing certain health benefits. As an example, one in the Netherlands has
been promoted as helping to maintain healthy cholesterol levels. Others have
been promoted as helping to maintain desirable intestinal microflora. With recent
approval to promote oat fiber and soy protein for specific health benefits in the
United States, it may be possible in the future for other functional foods, such
as those containing probiotics, to be marketed as providing certain health or nutri-
tional benefits to consumers.
IV. CHARACTERISTICS NEEDED FOR PROBIOTIC
CULTURES
It is unreasonable to expect one strain of any of the species of probiotic bacteria
to provide all of the aforementioned potential health or nutritional benefits. In
the past, most knowledge gained concerning variations among strains of lactic
acid bacteria has focused on the ability of these organisms to produce desired
organoleptic properties in cultured products and to do so as rapidly as possible.
Very little, if any, attention has focused on potential health or nutritional benefits
possible from these cultures. Most commercially available strains of probiotic
bacteria have not been selected for any specific activity except perhaps to have
their identity confirmed as being the indicated organism. To be successful as
probiotic cultures, they must be selected for their ability to provide the targeted
benefit for the consumer.
If cultured or culture-containing dairy products are to be useful as func-
tional foods in providing health or nutritional benefits for consumers, it is ne-
336 Gilliland
cessary to alter the basis used for selecting commercial lactic acid bacteria.
The cultures not only will have to be selected for their ability to produce de-
sired organoleptic properties in the cultured product, but also will need to be
evaluated for those factors related to potential health or nutritional benefits
(Gilliland, 1989, 1990). Thus, the primary factor to be considered in this selection
is that the culture(s) must be able to produce the desired benefit. Furthermore,
the culture should retain that ability during production, manufacturing, distribu-
tion, and storage of the product before reaching the consumer. If the desirable
action requires that the organism must grow in the intestinal tract, then charac-
teristics that enable the organism to grow well under these conditions must
be considered. To help ensure the ability of the organism to establish itself or
grow in the intestine, it is important to consider the bile tolerance of the strain
selected. Probiotic bacteria under consideration tend to be host specific (Fuller,
1973; Lin and Savage, 1984; Morishita et al., 1971). Therefore, it is necessary
to consider the source of the organism. In other words, it is desirable to select
the strain that is compatible with the host (i.e., humans) for which the product
in intended.
In some instances, a product such as yogurt, which is made with the tradi-
tional yogurt culture, Lb. delbrueckii subsp. bulgaricus and S. thermophilus, also
is supplemented with cells of Lb. acidophilus and/or Bifidobacterium species. If
such a procedure is used to provide the consumer with the beneficial organisms,
then care must be exercised to ensure that adequate numbers of probiotic organ-
isms are present. Some probiotic cultures with the potential for providing health
and nutritional benefits may not grow as well in milk during manufacture of
fermented milk products as those that traditionally have been used for producing
such products. Thus, research may be necessary to determine ways to improve
growth of probiotic organisms in milk so that the consumer is provided with
adequate numbers of these potentially beneficial bacteria.
To ensure any of the potential health or nutritional benefits that might be
derived from probiotic cultures, it is necessary to test properly cultures and prod-
ucts containing them to be sure the consumer receives the product that is most
likely to provide the intended benefit. If such products are to be designated as
being functional foods and are to be effective, it is necessary to use properly
selected probiotic cultures. This may result in the need for several types of milk
products each containing a different selected strain(s) of the probiotic culture to
provide the specific desired health or nutritional benefits.
V. PROBIOTICS FOR LIVESTOCK
Probiotics used for livestock often are referred to as direct-fed microbials. Their
use is based on concepts which have been set forth during the past century for
Probiotics and Prebiotics 337
potential benefits of lactic acid bacteria in humans. There is currently great inter-
est in the use of probiotics by the livestock industry. A major reason for this
interest is that probiotics offer a potential replacement for subtherapeutic levels
of antibiotics in livestock diets. The microorganisms involved in this group of
probiotics are the same species as used for humans plus yeast cells.
Much of the early research reported in evaluating probiotics for livestock
was poorly done. Often the research reports did not provide information concern-
ing the culture used, nor did they indicate the number of viable organisms in the
product at the time of use. Furthermore, no basis was provided for having selected
the particular organisms used. In the early marketing of such probiotic products
for livestock, many products contained very low numbers, if any, of the organ-
isms indicated on the product label (Gilliland, 1981).
As with humans, one strain of one species of a probiotic organism should
not be expected to provide all of the possible benefits for all species of livestock.
Even though the idea of using probiotics as livestock feed supplements is not
new, there is much to be learned about the proper selection of strains of microbial
species for use as probiotics to produce the desired effect. A mixture of bacterial
species or strains may be required to yield such desired effects as improved
growth and performance.
Much of the research which has been published concerning the potential
of certain probiotic bacteria to control intestinal pathogens has been done using
animal models. Thus, it is reasonable to expect that probiotics could function in
helping control these undesirable bacteria in livestock. It is important to find
means of controlling these intestinal pathogens in livestock, since they can find
their way into the food supply at slaughter or through the use of waste or run-
off water from livestock operations to fertilize fruits and vegetables.
There has been more research reported on the use of probiotics to control
intestinal pathogens in poultry than in any other animal species. With germ-free
chicks as an animal model, for example, it was demonstrated that Lb. acidophilus
exerted control over Salmonella species and Escherichia coli in this animal
(Watkins and Miller, 1983; Watkins et al., 1982). Using conventional chicks (1-
day-old), successful use of Lb. salivarius to prevent colonization of chicks with
Salmonella Enteritidis also has been shown (Pascual et al. 1999).
Some have suggested the use of a probiotic-like product made up of intesti-
nal flora of healthy chickens to inoculate baby chicks. This has been named the
competitive exclusion concept. It was accomplished by administering the mixed
intestinal microorganisms from healthy adult chickens to newly hatched chicks
(Nurmi et al., 1992). The idea behind this was that once established, the flora
from healthy chickens could exclude infection by salmonellae. This approach is
currently being advocated in the poultry industry in the United States. A problem
associated with this approach, however, is the lack of control over composition
of the mixed culture used to inoculate the chicks.
338 Gilliland
Perhaps the greatest interest in the livestock industry for the use of probiot-
ics is to obtain improved growth and feed efficiency. This likely involves more
than just control of undesirable microorganisms in the animal’s digestive system.
The mechanisms whereby such improvement could be obtained are presently
unknown. Probiotics could provide some specific nutrients that enhance growth
or increase appetite so the animal consumes more feed. Feeding of a probiotic
product containing a mixture of four species of lactobacilli resulted in increased
growth and improved the feed-to-gain ratio of broilers (Jin et al., 1998). Lactoba-
cilli as feed supplements also improved feed intake and weight gain in lambs
(Wallace and Newbold, 1993). Inclusion of viable yeast cells in animal feeds can
provide a benefit in several livestock species; for example, both meat and milk
production have thus been increased in cattle (Wallace and Newbold, 1993).
The stress of weaning young animals in most livestock species results in
development of scours. Probiotics containing lactobacilli such as Lb. acidophilus
can reduce or eliminate this problem in calves as well as in pigs and lambs (Jons-
son and Conway, 1992; Wallace and Newbold, 1993).
The possible mechanisms of action in livestock are probably similar to
those reported for humans. Control of intestinal pathogens, for instance, could
involve direct inhibitory action by the probiotic bacteria or could result from
stimulation of the immune system. Improved growth and performance are more
difficult to explain. Although it may be that this, in part, results from control of
undesirable microorganisms, it is likely that it involves far more. Some microor-
ganisms in a probiotic mixture could provide an enzyme in a manner similar to
that involved in improvement of lactose digestion in humans. In a preliminary
study in our laboratories, for instance, we have shown that a strain of Lb. acido-
philus having a high level of amylase activity increased growth and feed effi-
ciency in newly weaned pigs on a starch-based diet (unpublished data). Although
several studies have noted improvement in growth and performance of livestock
given various probiotics, we need to determine the mechanism whereby this im-
provement occurs. Then we will be better able to select appropriate probiotic
organisms for use in livestock feeds.
VI. PREBIOTICS
Food (or feed) ingredients that are not digestible by humans (or livestock) that
might provide benefit to the consumer by stimulating growth or activity of bacte-
ria in the gastrointestinal tract are considered to be potential prebiotics. The large
intestine is the most often considered sight of action for these substances, al-
though they could have some impact on microorganisms in the small intestine.
For the most part, these prebiotic compounds contain oligosaccharides,
which are not normally digested in the gastrointestinal tract except by resident
Probiotics and Prebiotics 339
bacteria (Fooks et al., 1999). Theoretically, any dietary component reaching
the large intestine undigested could be a potential prebiotic. However, oligosac-
charides are most often considered and have received most attention as prebiotics.
Oligosaccharides that have been considered as prebiotics include fructo-oligosac-
charides, gluco-oligosaccharides, galacto-oligosaccharides, transgalacto-oligo-
saccharides, isomalto-oligosaccharides, xylo-oligosaccharides, and soybean
oligosaccharides. Inulin-type fructo-oligosaccharides have been the ones most
investigated as prebiotics. Much of the focus has been on their ability to enhance
growth of Bifidobacterium species. These bacteria can hydrolyze such oligosac-
charides and use them as an energy source to support their growth. They use
them in preference to other complex carbohydrates such as starch. Fermentation
of these soluble fibers in the large intestine results in production of short-chain
fatty acids (primarily acetic, propionic, and butyric) (Flock and Moussa, 1998).
These fatty acids are important to the host in lipid metabolism.
Inulin is extracted from chicory roots with hot water. Partial hydrolysis
of this extract yields fructo-oligosaccharides, sometimes referred to as fructans
(Roberfroid et al., 1997). These fructans are considered bifidogenic and increase
growth of Bifidobacterium species in the intestinal tract, primarily in the large
intestine. Galacto-oligosaccharides have a similar effect (Sako et al., 1999). En-
hancing growth of this group of beneficial bacteria should improve their ability
to exert an antagonistic action toward undesirable intestinal microorganisms such
as pathogens. This should result in reduced shedding of intestinal pathogens by
both humans and livestock when prebiotics are included in the diet.
Fructo-oligosaccharides in animal diets reportedly decrease the amount of
fecal putrefactive compounds released, which implies an alteration in the intesti-
nal microflora (Farnworth, 1993). This may be important in control of odors from
livestock wastes.
Prebiotics, particularly oligosaccharides, apparently can be used alone to
modify the intestinal flora, particularly in the large intestine. Since prebiotics
tend to enhance growth of Bifidobacterium species in the intestine, a product
containing a prebiotic and a selected strain of Bifidobacterium species could en-
hance beneficial effects for the host. This might improve the control of intestinal
pathogens or bacteria that create malodors in livestock waste.
REFERENCES
Anderson JW, Gilliland SE. Effect of fermented milk (yogurt) containing Lactobacillus
acidophilus L1 on serum cholesterol in hypercholesterolemic humans. J Am Coll
Nutr 18:43, 1999.
Brashears MM, Gilliland SE, Buck LM. Bile salt deconjugation and cholesterol removal
from media by Lactobacillus casei. J Dairy Sci 81:2103, 1998.
340 Gilliland
Buck LM, Gilliland SE. Comparisons of freshly isolated strains of Lactobacillus acido-
philus of human intestinal origin for ability to assimilate cholesterol during growth.
J Dairy Sci 77:2925, 1994.
Chickai T, Nakao H, Uchida K. Deconjugation of bile acids by human intestinal bacteria
implanted in germ-free rats. Lipids 22:669, 1987.
Coconnier MH, Lievin V, Hemery E, Servin AL. Antagonistic activity against Helico-
bacter infection in vitro and in vivo by the human Lactobacillus acidophilus strain
LB. Appl Environ Microbiol 64:4573, 1998.
Corzo G, Gilliland SE. Bile salt hydrolase activity of three strains of Lactobacillus acido-
philus. J Dairy Sci 82:472, 1999.
Dambekodi PC, Gilliland SE. Incorporation of cholesterol into the cellular membrane of
Bifidobacterium longum. J Dairy Sci 81:1818, 1998.
Danielson AD, Peo ER Jr, Shahani KM, Lewis AJ, Whalen PJ, Amer AM. Anti-cholestere-
mic property of Lactobacillus acidophilus yogurt fed to mature boars. J Anim Sci
67:966, 1989.
Duffy LC, Zielezny MA, Talty MR, Dryja D, Altaie SS, Griffiths E, Ruffin D, Barrett H,
Ogra PL. Reduction of virus shedding by B. bifidum in experimentally induced
MRV infection. Dig Dis Sci 39:2334, 1994.
duToit M, Franz CMAP, Dicks LMT, Schillinger U, Haberer P, Warlies B, Ahrens F,
Holzapfel WH. Characterization and selection of probiotic lactobacilli for a prelimi-
nary minipig feeding trial and their effect on serum cholesterol levels, faeces pH
and faeces moisure content. Int J Food Microbiol 40:93, 1998.
Eyssen H. Role of the gut microflora in metabolism of lipids and sterols. Proc Nutr Soc
32:59, 1973.
Farnworth ER. Fructans in human and animal diets. In: Suzuki M, Chatterton NJ, eds.
Science and Technology of Fructans. Boca Raton, FL: CRC Press, 1993, p 257.
Flock MH, Moussa K. Probiotics and dietary fiber. J Clin Gasteroenterol 27:99, 1998.
Fooks LJ, Fuller R, Gibson GR. Prebiotics, probiotics and human gut microbiology. Int
Dairy J 9:53, 1999.
Fuller R. Ecological studies of the Lactobacillus flora associated with the crop epithelium
of the fowl. J Appl Bacteriol 36:131–139, 1973.
Gilliland, SE. Enumeration and identification of lactobacilli in feed supplements marketed
as sources of Lactobacillus acidophilus. Okla Agr Exp Sta Res Rep MP-112:263,
1981.
Gilliland SE. Acidophilus milk products: a review of potential benefits to consumers. J
Dairy Sci 72:2483, 1989.
Gilliland SE. Health and nutritional benefits from lactic acid bacteria. FEMS Microbiol
Rev 87:175, 1990.
Gilliland SE, Kim HS. Effects of viable starter culture bacteria in yogurt on lactose utiliza-
tion in humans. J Dairy Sci 67:1, 1984.
Gilliland SE, Nelson CR, Maxwell C. Assimilation of cholesterol by Lactobacillus acido-
philus. Appl Environ Microbiol 59:377, 1985.
Gilliland SE, Walker DK. Factors to consider when selecting a culture of Lactobacillus
acidophilus as a dietary adjunct to produce a hypocholesterolemic effect in humans.
J Dairy Sci 73:905, 1990.
Probiotics and Prebiotics 341
Goldin BR, Gorbach SL. Alterations of the intestinal microflora by diet, oral antibiotics,
and Lactobacillus: decreased production of free amines from aromatic nitro com-
pounds, azo dyes, and glucuronides. J Nat Cancer Inst 73:689, 1984.
Gopal A, Shah NP, Roginski H. Bile tolerance, taurocholate deconjugation and cholesterol
removal by Lactobacillus acidophilus and Bifidobacterium spp. Milchwissenschaft
51:619, 1996.
Gordon D, Macrae J, Wheater DM. A lactobacillus preparation for use with antibiotics.
Lancet 272:889, 1957.
Grunewald KK. Serum cholesterol levels in rats fed skim milk fermented with Lactobacil-
lus acidophilus. J Food Sci 47:2078, 1982.
Hargrove RE, Alford JA. Growth response of weanling rats to heated, aged, fractionated,
and chemically treated yogurts. J Dairy Sci 63:1065, 1980.
Harrison VC, Peat G. Serum cholesterol and bowel flora in the newborn. Am J Clin Nutr
28:1351, 1975.
Jin LZ, Ho YW, Abdullah N, Jalaludin S. Growth performance, intestinal microbial popu-
lations, and serum cholesterol of broilers fed diets containing Lactobacillus cultures.
Poultry Sci 77:1259, 1998.
Jonsron E, Conway P. Probiotics for pigs. In: Fuller R, ed. Probiotics The Scientific Basis.
London: Chapman & Hall, 1992, p 259.
Kim HS, Gilliland SE. Lactobacillus acidophilus as a dietary adjunct for milk to aid lactose
digestion in humans. J Dairy Sci 66:959, 1983.
Kolars JC, Levitt MD, Aouji M, Saviano DA. Yogurt—an autodigesting source of lactose.
N Engl J Med 310:1, 1984.
Lee YK, Salminen S. The coming of age of probiotics. Trends Food Sci Technol 6:241–
245, 1995.
Lessard M, Brisson GJ. Effects of Lactobacillus fermentation product on growth, immune
response and fecal enzyme activity in weaned pigs. Can J Anim Sci 67:509, 1987.
Lin JHC, Savage DC. Host specificity of the colonization of murine gastric epithelium
by lactobacillus. FEMS Microbiol Lett 24:67–71, 1984.
Morishita YT, Mitsuoka T, Kaneuchi CC, Yamamoto S, Ogota M. Specific establishment
of lactobacilli in the digestive tract of germ-free chicks. Jpn J Microbiol 15:531–
538, 1971.
Mann GV, Spoerry A. Studies of a surfactant and cholesteremia in the Maasai. Am J Clin
Nutr 27:464, 1974.
Metchnikoff E. The Prolongation of Life Optimistic Studies. New York: Putnam’s, 1908.
Noh DO, Gilliland SE. Influence of bile on cellular integrity and β-galactosidase of Lacto-
bacillus acidophilus. J Dairy Sci 76:1253, 1993.
Noh DO, Gilliland SE. Influence of bile on β-galactosidase activity of component species
of yogurt starter cultures. J Dairy Sci 77:3532, 1994.
Noh DO, Kim SH, Gilliland SE. Incorporation of cholesterol into the cellular membrane
of Lactobacillus acidophilus ATCC 43121. J Dairy Sci 80:3107, 1997.
Nurmi E, Nuotio L, Schneitz C. The competitive exclusion concept: development and
future. Int J Food Microbiol. 15:237, 1992.
Oda M, Hasegawa H, Komatsu S, Kambe M, Tsuchiya F. Antitumor polysaccharide from
Lactobacillus species. Agric Biol Chem 47:1623, 1983.
342 Gilliland
Oliver G, Gonzalez S, Moreno R. Fermented milk for biotherapy. Interciencia 24:177,
1999.
Pascual M, Hugas M, Badiola JI, Monfort JM, Garriga M. Lactobacillus salivarius CTC
2197 prevents Salmonella enteritidis colonization in chickens. Appl Environ Micro-
biol. 65:4981, 1999.
Payne DL, Welch JD, Manion CV, Tsegaye A, Herd LD. Effectiveness of milk products
in dietary management of lactose malabsorption. Am J Clin Nutr 34:2711,
1981.
Pedone CA, Bernabeu AO, Postaire ER, Bouley CF, Reinert P. The effect of supplementa-
tion with milk fermented by Lactobacillus casei (strain DN-114 001) on acute diar-
rhea in children attending day care centers. Int J Clin Pract 53:179, 1999.
Perdigon G, Alvarez S, Demacias MEN, Roux ME, Holgado APR. The oral administration
of lactic acid bacteria increases the mucosal intestinal immunity in response to en-
teropathogens. J Food Prot 53:404, 1990a.
Perdigon G, Demacias MEN, Alvarez S, Oliver G, Holgado AAPR. Prevention of gastro-
intestinal infection using immunobiological methods with milk fermented with Lac-
tobacillus casei and Lactobacillus acidophilus. J Dairy Res 57:255, 1990b.
Reddy GV, Friend BA, Shahani KM, Farmer RE. Antitumor activity of yogurt compo-
nents. J Food Prot 46:8, 1983.
Roberfroid MB, VanLoo JAE, Gibson GR. The bifidogenic nature of chicory inulin and
its hydrolysis products. J Nutr Sci 128:11, 1998.
Romond MB, Haddou Z, Mielcareck C, Ramond C. Bifidobacteria and human health:
regulatory effect of indigenous bifidobacteria on Escherichia coli intestinal coloni-
zation. Anaerobe 3:131, 1997.
Sato K, Saito H, Tomioka H, Yokokura T. Enhancement of host resistance against Listeria
infection by Lactobacillus casei: efficacy of cell wall preparation of Lactobacillus
casei. Microbiol Immunol 32:1189, 1988.
Sako T, Matsumoto K, Tanaka R. Recent progress on research and applications of non-
digestible galacto-oligosaccharides. Int Dairy J 9:69, 1999.
Saviano DO, El Ansuar AA, Smith DE, Levitt MD. Lactose malabsorption from yogurt,
pasteurized yogurt, sweet acidophilus milk and cultured milk in lactose-deficient
individuals. Am J Clin Nutr 40:1219, 1984.
Shahani KM, Friend BA, Bailey PJ. Antitumor activity of fermented colostrum and milk.
J Food Prot 46:385, 1983.
Silva M, Jacobus NV, Deneke C, Gorbach SL. Antimicrobial substance from a human
Lactobacillus strain. Antimicrob Agents Chemother 31:1231, 1987.
Simenhoff ML, Dunn SR, Zollner GP, Fitzpatrick MED, Emery SM, Sandine WE, Ayres
JW. Biomodulation of the toxic and nutritional effects of small bowel bacterial
overgrowth in end-stage kidney disease using freeze-dried Lactobacillus acido-
philus. Miner Electrolyte Metab 22:92, 1996.
Sissons JW. Potential of probiotic organisms to prevent diarrhoea and promote digestion
in farm animals—a review. J Sci Food Agric 49:1–13, 1989.
Tagg JR, Dajani AS, Wannamaker LW. Bacteriocins of gram-positive bacteria. Bacteriol
Rev 40:722, 1976.
Talarico TL, Dobrogosz WJ. Chemical characterization of an antimicrobial substance pro-
duced by Lactobacillus reuteri. Antimicrob Agents Chemother 33:674, 1989.
Probiotics and Prebiotics 343
Wallace RJ, Newbold CJ. Probiotics for ruminants. In: Fuller R, ed. Probiotics The Scien-
tific Basis. London: Chapman & Hall, 1993, p 317.
Watkins BA, Miller BF. Competitive gut exclusion of avian pathogens by Lactobacillus
acidophilus in gnotobiotic chicks. Poultry Sci 62:1772, 1983.
Watkins BA, Miller BF, Neil DH. In vivo inhibitory effects of Lactobacillus acidophilus
against pathogenic Escherichia coli in gnotobiotic chicks. Poultry Sci 61:1298,
1982.
Winkelstein A. Lactobacillus acidophilus tablets in the therapy of various intestinal disor-
ders: a preliminary report. Am Pract Digest Treatment 1:1637, 1955.
11
Cheese Products
Mark E. Johnson
University of Wisconsin–Madison
Madison, Wisconsin
I. INTRODUCTION
The origin of cheese is lost in antiquity. But, most assuredly, milk was contami-
nated with lactic acid bacteria, which through acidification of the milk, created
conditions unfavorable for growth of other bacteria. As the story goes, milk held
in storage vessels (animal stomachs) clotted, making cream cheese, the ‘‘mother
of all cheeses.’’ The acid environment caused milk proteins to clot. It was a
great leap forward when centuries later humans discovered the use of coagulating
enzymes. This led to production of less sour cheeses. Natural contamination of
milk or cheese by bacteria, yeasts, and molds led to development of a multitude
of flavor sensations in cheese as it aged. Imagine, a long time ago, when humans
first tasted that odorous morsel covered with colorful molds, yeasts, and bacteria.
But now consider a world without Roquefort, Stilton, Limburger, or Gruye`re.
Boring! Unthinkable!
Modern cheese making is controlled and has been refined through strict
adherence to manufacturing guidelines and careful selection of specific lactic acid
bacteria and ripening microorganisms. Even so, sometimes there are problems.
No cheese is produced in a sterile environment, so contamination is inevitable.
One of the chief causes of poor flavor quality in cheese is the undesirable metabo-
lism of contaminating microorganisms. A preventable cause of poor-quality fla-
vor is that many retailers sell products long after they have reached the end of
their expected shelf life. The ability of a cheese to age well with regard to undesir-
able microbial growth depends on cheese composition, manufacturing protocol,
level of contamination, and ability of the contaminants to grow in cheese. There-
345
346 Johnson
fore, cheese maker, retailer, and consumer must be aware of limitations of the
product with regard to growth of contaminants and defects that they cause. It
must be kept in mind that not all undesirable attributes of a cheese result from
contaminating microorganisms. Some cheese defects may be caused by poor milk
quality (late lactation milk, milk from mastitic animals high in enzymes of animal
origin, i.e. lipase and protease), inappropriate rate of acid development by the
starter, or poor manufacturing and storage regimens.
Although there are more than 1000 named varieties of cheeses worldwide,
this chapter discusses only the major types.
II. DAIRY CHEMISTRY AND THE CHEESE–MAKING
PROCESS
For many cheese makers, there is an art to making cheese. To cheese manufactur-
ers, it is commonly a routine, strictly controlled process. No matter how it is
made, cheese is a complex entity in a constant state of change, which has been
likened to an ecological community of living organisms in which microbiological
activities affect and are influenced by chemical changes.
Production of cheese involves two interconnected phases: The first is to
develop the desired composition and pH, and the second is to develop desired
physical and flavor characteristics. The first phase is controlled through milk
composition and manufacturing protocol, particularly rate and extent of acid de-
velopment by the starter during the manufacturing process. The second phase is
influenced by the first but is dictated by metabolism of a variety of microorgan-
isms and by enzymatic and chemical reactions. This process is called ripening,
curing, or maturation, and depending on the cheese variety, may take many
months to complete.
In concept, manufacture of cheese is simple. In reality, it is a complex
process governed by a series of interrelated chemical and physical phenomena.
During cheese making, a coagulum is formed in which milk proteins (caseins)
are clotted, entrapping the milk fat, water, and water-soluble components. Further
manipulations of the coagulum (cutting, heating, stirring) and development of
acid result in controlled moisture expulsion and desired physical and chemical
changes of caseins. The resulting curd and whey mixture is separated, with curd
being formed into blocks, wheels, or other shapes.
Development of desired flavor, body, and texture is brought about through
a combination of the activity of specific introduced microflora and enzymes as
well as naturally occurring or contaminating bacteria and enzymes. Part of the
initial maturation process involves physical changes to the protein brought about
through a decrease in pH, loss of calcium, and hydration of casein. Without the
ripening process, it would be impossible to distinguish one variety of cheese
Cheese Products 347
from another except to note that different cheeses may have different physical
characteristics.
Milk solids are composed of protein (casein and whey protein), milkfat,
lactose, citric acid, and mineral salts (usually associated with the casein) collec-
tively called ash. The composition of milk varies considerably between species
and individual animals. It is affected by breed and genetics of the animal, feed,
environmental conditions, lactation number, stage of lactation, and animal health.
All of these factors can also influence cheese making and cheese characteristics.
An average composition of cow milk is as follows: 87.6% water, 3.9% milk fat,
3.1% true protein (82% caseins, 18% whey proteins), 4.6% lactose, 0.7% ash
(also see Chap. 1).
There are three basic ways to make cheese, but a given variety is made
with only one method. All methods involve development of acid by a select group
of lactic acid bacteria called the starter. All methods involve some means of
concentrating the milk solids (mostly milkfat and protein) by expelling a portion
of the aqueous phase of milk (serum or whey).
Rennet curd cheeses (most varieties) are made by clotting milk with a coag-
ulating enzyme (all are proteolytic enzymes) such as chymosin (the most active
ingredient in rennet). Acid curd cheeses (cottage, cream) are made with acidifica-
tion of milk sufficient to cause casein to form a clot. Heat-precipitated curd
cheeses (ricotta, queso blanco) are made with a combination of low pH and high
heat to precipitate proteins (both casein and some whey proteins).
Fresh or nonripened cheeses such as cottage and mozzarella can be made
by direct addition of acid (acetic, lactic, or citric). Cheeses made by this method
are called direct acid cheeses (e.g., direct acid mozzarella).
A. Rennet Curd Cheese Manufacture
Rennet curd cheeses are those in which the coagulum is formed by activity of a
coagulant, an enzyme mixture with particular proteolytic activity. Coagulants are
commonly called rennets. Calf rennet is derived from an extract of calf stomachs,
but there are other rennets derived from different sources: fungi, other animals,
and some plants, especially thistles. All contain proteolytic enzymes, which,
through their activity, help to destabilize casein micelles in milk, an event that
subsequently transforms milk from a liquid to a semisolid (coagulum). Chymosin
is the desired coagulating enzyme in calf rennet, but because of cost, demand, and
the lack of calf stomachs, most chymosin used in the United States is produced by
genetically engineered bacteria, yeasts, or molds. Fermentation-derived chymosin
is highly purified (100% purity) and is used in liquid or tablet form. Chymosin
is the preferred coagulant, because it has specificity toward one peptide bond in
κ-casein. Although chymosin hydrolyzes bonds in casein molecules at other sites
when they are accessible, the specific site of hydrolysis that occurs during coagu-
348 Johnson
lation is Phe
105
-Met
106
. The nonspecific proteolytic activity of some other coagu-
lants causes concern over excessive proteolysis, leading to a soft-bodied cheese,
bitter flavor defects, and reduced cheese yield.
Caseins exist in complexes of discretely arranged molecules called mi-
celles. There are four types of casein molecules, α
s1
, α
s2
, β, and κ-caseins. The
exact molecular arrangement of molecules is not known, but it is hypothesized
that micelles are composed of groups of casein molecules linked together through
various types of bonding, including calcium phosphate bridges, and most impor-
tantly electrostatic and hydrophobic interactions. A hydrophilic (and negatively
charged) portion of κ-casein molecules protrudes from the micelle surface, giving
the micelle stability from spontaneous aggregation.
At the normal pH of milk (6.6–6.7), micelles carry a net negative charge
because of the nonprotonated amino, carboxyl, and phosphate groups on caseins.
Through electrostatic repulsion and stearic hindrance via the ‘‘hairs’’ of κ-casein,
micelles are stable (show no tendency to flocculate or gel) and remain as individ-
ual entities. Activity of the coagulant removes the protruding, hydrophilic region
on the κ-casein molecule. This eliminates stearic hindrance and reduces the nega-
tive charge at the micelle surface. With loss of these barriers, micelles begin to
come together (clot formation). Ionic calcium (added as CaCl
2
or released from
micelles through acidification of milk) allows adjacent micelles to aggregate
through hydrophobic and electrostatic interactions. Eventually (20–30 min), ca-
sein micelles form a continuous network of aggregates called the clot or coagu-
lum. Milkfat, water, and water-soluble components (serum) are entrapped within
the casein network. Undenatured whey proteins are water soluble and do not
participate in forming the network but are trapped in spaces (pores) that form
between aggregates of micelles.
Once the desired firmness of the coagulum has been reached, it is cut into
small cubes or pieces (curd). The firmer the coagulum when cut and the larger
the curd particles, the higher the moisture content of cheese. After the coagulum
is cut, casein molecules continue to interact and squeeze out serum trapped be-
tween them, and with exogenous pressure, curds shrink and become firmer. This
process is called syneresis and is enhanced by lowering the pH, increasing the
temperature of curd (cooking process), and stirring the curd. Therefore, the rate
of acid development by the starter has a great influence over moisture content
of cheese and control over the rate of acid development is key to successful
cheese manufacture. Body (soft to firm) texture (grainy to smooth), melt, stretch,
chewiness, oil release during baking, casein hydration, and color of cheese are
directly controlled by pH. In addition, growth and metabolism of microorganisms
and flavor development are strongly influenced by pH.
Each variety of cheese has a desired rate and extent of acid development,
which if not met or compensated for, may result in too much or too little moisture
Cheese Products 349
or too high or too low pH, creating undesirable physical and flavor characteristics
in cheese. At the proper time, curd is separated from whey and treated appropri-
ately as dictated by the variety of cheese. Curd may be continuously stirred as
whey is being removed or it may be allowed to mat. Curd may be salted first
and then formed into the desired shape or formed first and then salted by placing
the cheese into brine. Pressing of blocks, cylinders, or wheels of cheese removes
trapped whey from the cheese and helps individuals curds to fuse, forming a
solid mass of cheese. Not all cheeses require pressing. The unripened cheese is
then ready for maturation. Camembert and surface-ripened cheeses (Limburger)
will be inoculated with specific microorganisms at this time.
B. Acid Curd Cheeses
Acid curd cheeses do not rely on activity of a coagulating enzyme to clot milk.
Instead, milk is acidified by direct addition of acid or through lactic acid devel-
oped by starter bacteria. At a pH of approximately 5.2, caseins in milk begin to
flocculate and eventually gel as the pH decreases. Gelation is the consequence of
acidification-induced physicochemical changes to caseins. At neutral pH, casein
micelles remain as individual entities and are unable to interact or form aggre-
gates. This is, in part, caused by charge repulsion (micelles are negatively
charged). In addition, hydrophilic regions of κ-casein molecules protrude from
the micelle core and prevent hydrophobic cores of adjacent micelles from inter-
acting (stearic repulsion).
As the pH is lowered, the calcium-phosphate complex disintegrates and
some casein molecules dissociate from micelles. There is also a reduction of the
net negative charge on casein molecules, an increase in hydrophobic interactions,
and it is thought that the protruding portion of casein molecules falls back onto
the casein micelle core. The net result is that micelles and solubilized casein
molecules begin to form aggregates, eventually leading to formation of a continu-
ous network of aggregates and visible gel (pH H110114.95). In cottage cheese, the gel
is cut into small cubes at a pH of 4.65–4.75. Serum (whey) is immediately ex-
pelled from the curd.
In cream cheese manufacture, the gel is stirred at pH 4.4–4.8 rather than
cut as in cottage cheese, and whey is removed by centrifugation. Traditionally,
clotted milk was put into bags of cheesecloth and hung to filter out serum. A
low pH of cheese tends to produce a grainy or gritty product. Separated cheese
is packaged (cold-pack cream cheese) or processed. Hot-pack cream cheese is
made by blending cold-pack cream cheese with cream, whole milk, salt, stabiliz-
ers, and skim milk solids and heating the mixture to (72–74°C). The homogenized
blend is packaged hot. Microbiologically induced defects are similar to those in
cottage cheese but are less likely to occur, because the cheese is packaged hot.
350 Johnson
C. Acid-Heat Coagulated Cheese
The premise for manufacture of acid-heat coagulated cheeses is to heat milk to
78–80°C and then acidify milk by direct addition of citric, acetic, or lactic acid
to the desired pH (5.8–5.9 for ricotta, 5.2–5.3 for queso blanco). Milk for queso
blanco can also be first acidified by lactic acid bacteria (Lactococcus spp.) and
then heated. Heating of the milk (ricotta milk is usually a mixture of sweet whey,
whey protein concentrate, and milk) causes coagulation and flocculation of ca-
seins and whey proteins. In ricotta cheese manufacture, proteins and entrapped
fat are removed or filtered from the remaining serum and drained until packaged.
In queso blanco cheese manufacture, curds are allowed to settle and whey is
drained. Curds are then salted and pressed. Both cheeses are consumed fresh,
and because denatured whey protein forms a network with the casein, the cheeses
resist melting during frying or baking. Because of the high-heat treatment under
acidic conditions, survival of bacteria other than spore formers is minimal, but
contamination during packaging is of concern. Microbiologically induced defects
are comparable to those of cottage cheese. Most defects are caused by growth
of Pseudomonas sp., yeasts, and molds.
III. INFLUENCES OF MICROBIOLOGICAL QUALITY
AND MILK COMPOSITION ON CHEESE QUALITY
The microbiological quality and composition of milk play an integral part in the
quality of the cheese made from it. Cheese can be made from grade A or grade
B milk, but cottage, cream, and mozzarella cheeses must be made from grade A
milk only. The bacterial count of grade A milk, as determined by a standard
bacterial count or loop count, cannot exceed 100,000/mL at the time of receipt
or collection. The bacterial count of grade B milk cannot exceed 300,000/mL
(Wisconsin Administrative Code). Processors often pay premiums for low bacte-
rial count milk as an enticement to farmers to produce high-quality milk. In prac-
tice, processors have recorded that milk from greater than 90% of producers has
a bacterial count of less than 20,000/mL. The bacteria found in the milk arise
from contamination (especially from air and biofilms on equipment) or from the
animal itself (see Chap. 2).
The level of contamination is reflective of the cleanliness of the entire milk-
ing operation, including that of the animal before milking. Clostridia and lactic
acid bacteria generally originate in silage and other feeds and are concentrated
in feces. High levels of clostridia in silage indicate poor lactic acid fermentation
(Stadhouders and Spoelstra, 1990). Feces can get on the udder, and if the udder
is not cleaned, milk can become contaminated. Improper cooling rates or final
holding temperatures of milk result in high numbers of bacteria reflective of an
Cheese Products 351
environment conducive to microbial growth. Most bacteria in milk are, not sur-
prisingly, psychrotrophic bacteria and they are the contaminants likely to grow
at the low temperature at which milk must be stored (not to exceed 7°C for grade
A and 10°C for grade B within 2 h after milking). Pseudomonas spp. are usually
the dominant psychrotrophic organisms found in milk. Although these bacteria
are easily killed by pasteurization, they produce lipases and proteases, which are
not totally inactivated by this heat treatment (Griffiths et al., 1981). The enzymes
are active in milk and can cause bitterness (protein hydrolysis) and rancidity
(milk fat hydrolysis) in products made from milk if the level of activity is high
enough (Cousin, 1982). Milk may be held for 2 days (legally) after receipt at the
factory and microbial counts will undoubtedly increase. It is growth of Pseudo-
monas sp. during refrigerated milk storage that concerns the cheese maker.
A more important cause of rancidity in milk and cheese is activity of en-
demic animal lipases (milk lipase). The level of activity of this enzyme is in-
creased in milk obtained from animals with mastitis (udder infection). In this
instance, lipase activators and somatic cells are secreted from blood into milk.
Somatic cells are used as an indicator of cow health and limits have been set by
individual states (not to exceed 750,000/mL) (Wisconsin Administrative Code).
Milk from mastitic animals has decreased casein content, the major protein found
in milk, although the total amount of all proteins (whey proteins increase) may
decrease only slightly, if at all (see Chap. 1).
The composition, quality, and amount of cheese produced are greatly af-
fected by the casein content of milk. The other proteins, collectively called whey
proteins, are water soluble and contribute much less to cheese yield. The lower
the casein content of milk, the lower the yield of cheese. Cheese makers do not
routinely directly measure casein in milk, because the test is expensive and takes
too long to complete. Instead, they use fast, inexpensive, automated tests to mea-
sure total protein. Casein content is calculated by multiplying the percentage of
total protein by 0.82. In mastitic milk, however, the amount of casein as a percent-
age of total protein decreases. Cheese makers cannot predict this value. Rather
a high somatic cell count indicates that the casein content of milk may be reduced.
Consequently, the cheese maker commonly pays premiums for low somatic cell
count milk.
IV. MILK PRETREATMENT: CLARIFICATION,
STANDARDIZATION, AND HEAT TREATMENT
All milk received by the cheese plant is first tested for the presence of antibiotics.
Milk containing antibiotics must be dumped (liquid manure or landspread) even
though, if diluted with other milk, a negative test could be obtained. Raw milk,
as the cheese maker receives it, is almost universally filtered to remove extrane-
352 Johnson
ous matter (straw, hay, and large clumps of bacteria). The Code of Federal Regu-
lations establishes fat (milk fat content by weight of the cheese solids or fat in
the dry matter [FDM]) and moisture limits for some cheeses. These values are
called the standard of identity. The casein to milkfat ratio in milk determines the
FDM of cheese, whereas moisture is controlled by the manufacturing process.
The use of whole milk almost always results in cheese with an FDM of at least
50%. To manufacture cheeses with a lower FDM, such as part-skim mozzarella
or Swiss cheese, milkfat is removed or skim milk is added to whole milk. The
process of manipulating the composition of milk is called standardization and is
becoming more popular for all cheese types because of economic considerations
and a desire for uniformity of cheese composition and cheese yield.
A. Heat Treatment
Heat treatment given milk before cheese making varies from country to country,
cheese maker to cheese maker, and cheese to cheese. Pasteurization of milk is
a legal requirement in the United States for fresh cheeses such as cottage, mozza-
rella, and reduced-fat varieties. It is based on a 9-log destruction of Coxiella
burnetti. Cheeses made from unpasteurized milk must be held for 60 days at a
temperature not less than 1.7°C (Code of Federal Regulations, 1995). It is thought
that pathogens will die out during this time period because of acidic conditions
in cheese and growth of nonstarter lactic acid bacteria. However, this may not
be true, especially if the level of contamination is high. Manufacturers who do
not pasteurize milk use another heat treatment (65–70°C for 16–20 s), but the
trend is toward pasteurization. A main argument against pasteurization is that
cheeses made from pasteurized milk tend to have a milder flavor (the flavor takes
longer to develop or the flavor is atypical of raw-milk cheese). Research into
development of flavor in cheese may provide means to overcome this perceived
obstacle, but the question of safety of raw-milk cheeses remains. Pasteurization
is not a guarantee of safety, because milk or cheese can be contaminated after
the milk has been pasteurized. When cases of illness can be attributed to con-
sumption of cheese containing pathogens (a rare event), often the cheese is manu-
factured under poor hygienic conditions, is a fresh cheese, is made from unpas-
teurized milk, or the rate and extent of acid development were curtailed (Johnson
et al., 1990a). The rate of acid development is critical (as well as contamination
in the first place), since some bacteria, especially coliforms, will not grow well
at low pH and higher acid cheeses. It is not uncommon to find coliform bacteria
in washed curd cheese varieties (lower in acid content—baby Swiss, reduced-
fat varieties) or in cheeses where the acid development was slow (especially
because of phagic infection).
The effectiveness of pasteurization in killing bacteria in milk depends on
initial microbial numbers, composition (fat and sugar), and thermoresistance of
Cheese Products 353
individual microorganisms. The thermal death time of bacteria is logarithmic.
This implies that within a given population of a single strain of microorganism,
some individuals will survive pasteurization and other individuals will be killed.
By definition, thermoduric microorganisms survive pasteurization, and by con-
vention, thermoduric bacteria are classified as being thermoduric based on the
potential for individual bacterial cells within a population to survive pasteuriza-
tion. Genera containing thermoduric species include Microbacterium, Micrococ-
cus, Bacillus spores, Clostridium spores, Streptococcus, Coryneform, Enterococ-
cus, and Lactobacillus. Some of these bacteria are responsible for a variety of
cheese defects (Hull et al., 1992), such as excessive softening of cheese, splits
and cracks, off-flavors, and abnormal color. Thermoduric bacteria may colonize
in the regenerative section of the pasteurizer. Indeed, a solution to keep numbers
of thermoduric microorganisms low is to clean and sanitize the pasteurizer more
often.
Although rarely used in the United States, a specially designed centrifuge
called a Bactofuge (bactofugation) is used to remove most of the bacterial cells
and spores (empirically 98%) from milk. Two streams of milk result from bacto-
fugation, the ‘‘cleaned’’ milk and the bactofugate containing bacterial spores and
cells. If used, the bactofugate is heated to 130°C for a few seconds, but the milk
is pasteurized. The two fractions are then recombined. Bactofugation is used in
Europe in lieu of sodium nitrate in controlling outgrowth of Clostridium tyrobu-
tyricum spores, whose metabolism results in gassy, rancid cheese. The use of
sodium nitrate in cheese is not permissible in the United States.
After heat treatment, milk is cooled to the temperature conducive for
optimal starter activity and pumped into specially designed vessels called
vats. Cheese vats vary in size, with the larger vats holding as much as 22,700
kg and the smaller commercial vats holding approximately 4500–6800 kg.
Vats are generally double walled to permit controlled indirect heating of milk.
If starter is used, it can be added while milk is being pumped into the cheese vat
or after the vat is filled. The temperature of milk at the time starter is added is
determined by the type of cheese to be made, type of starter, and the desired
temperature at the time of coagulant addition, but it is generally between 31 and
34°C.
B. Starters
The strains and balance of strains of bacteria used in starters is often dictated by
tradition as much as it is by manufacturing protocol and desired cheese character-
istics. The choice of starter depends on the desired rate and extent of acid develop-
ment (pH) during manufacture, proteolytic activity of the strains, flavor (and gas
formation if desired), and conditions encountered during manufacture and storage
such as pH, acidity, salt, and temperature profiles. Mesophiles are sometimes used
354 Johnson
to manufacture mozzarella (non–pasta filata type) and Swiss varieties instead of
the traditional thermophilic starters. In these instances, a lower cook temperature
is used and the resultant cheese is generally higher in moisture and may have a
slightly different flavor profile (more acid, less buttery). The amount of starter
used is based on the rate of acid development desired by the manufacturer and
is dictated by cheese variety, but it is influenced by strain and how the culture
was propagated (conditions of growth such as media, pH control, and age). This
is an important concept, because amounts of starter listed in literature for cheese
manufacture can be misleading (e.g., use of 1% w/w starter grown with no pH
control may be equivalent to using 0.2% w/w starter grown with pH control).
Additional information about starter cultures is given in Chapters 6, 7, and 8.
The use of artisinal cultures is not common in the United States. These cultures
are mixtures (unknown composition) of several genera, species, and strains of
lactic acid bacteria. They may contain lactococci, lactobacilli, leuconostocs,
streptococci, and enterococci and probably give the cheese special flavor charac-
teristics.
V. CHEESE MICROBIOLOGY
The diversity of cheese-manufacturing protocols, ripening regimens, and compo-
sition makes cheese a complex subject microbiologically. It is a misconception
to think of cheese microflora in terms of the type of cheese; for example, all
Cheddars, blue cheeses, and so on. Each individual cheese (not type) has its own
unique microflora regardless of the starter or any deliberately added secondary
ripening microorganisms (e.g., molds or yeasts). There is an extensive list of
adventitious microorganisms that can grow in or on cheese, but their presence
in any cheese is governed by chance. These nonstarter, nondeliberately added
microbes are contaminants to milk or cheese. Thus, the contaminants that are
found in any cheese result because the specific microbes happen to be in milk
or on equipment, in air, or on humans that have had direct contact with the milk
or cheese. It is extremely difficult to interpret data on microbial content of cheese
because of chance contamination. In addition, the cheese environment plays a
critical role in growth of microorganisms.
Microorganisms that grow in cheese or at least maintain viability follow
the same set of criteria (pH, moisture, salt, acidity/type of acid, redox potential,
nutrient availability, competition, temperature, anaerobic/aerobic conditions) as
in any food product. Two factors determine the microflora of cheese: presence
and survival of the microorganism and ability of the microorganism to grow.
During cheese maturation, environmental conditions can change suffi-
ciently to allow growth of initially inhibited contaminants, or conditions may
become even more inhospitable. The cheese environment is dynamic. Thus, the
Cheese Products 355
microflora in cheese can be considered to be a dynamic ecological system. Few
studies on bacterial viability in cheese have been completed in which changes
in cheese chemistry during maturation are correlated with its effect on the mi-
croflora.
A complicating factor in the study of cheese microflora is methodology
used to isolate microorganisms. Selective media may provide too harsh an envi-
ronment for recovery and growth of injured or stressed cells. Microorganisms
may be viable and metabolically active but not culturable with current methods.
Nonselective media may not be appropriate to detect low numbers in a competi-
tive environment.
Why is it important to study the microorganisms in cheese? Pathogens in
cheese are of utmost importance. However, flavor quality (both desirable and
undesirable) of cheese is also a consequence of the metabolism of microorgan-
isms. Additionally, some textural defects can be directly attributed to growth and
metabolism of microorganisms.
Molecular techniques are being applied selectively to determine the pres-
ence of individual species and strains of bacteria in cheese. The polymerase chain
reaction (PCR) is a rapid procedure for in vitro enzymatic amplification of a
defined segment of DNA (Atlas and Bej, 1994). It is particularly useful in identi-
fying the proverbial needle in the haystack and individual strains of bacteria. A
unique oligonucleotide sequence (probe) can be used specifically to identify
(through amplification) the presence of DNA from particular bacteria in cheese.
Enumeration of the bacteria is not necessary, but the bacteria may no longer be
alive. DNA extracted from individual bacteria isolated using traditional tech-
niques can also be tested to determine the exact species or strains of bacteria.
Of particular interest is rapid detection of low levels of pathogens in milk and
cheese (Herman et al., 1995). The technique has also been applied to identify
species of Clostridium in cheese (Klijn, 1995), new strains of Lactococcus lactis
subsp. cremoris (Salama et al., 1993), individual strains of Lactobacillus helveti-
cus (Drake et al., 1996) and nonstarter lactobacilli in Cheddar cheese (Fitzsim-
mons et al. 1999).
Many of the adjuncts used to enhance flavor of cheese are Lactobacillus
spp. and are often not easily differentiated from other strains of lactobacilli by
biochemical tests. Complicating the situation is that lactobacilli are the dominant
nonstarter lactic acid bacteria found in cheese. Selective media for lactobacilli
cannot differentiate between adjunct and contaminant lactobacilli. This makes
it difficult to determine numbers of individual strains of lactobacilli in mixed
populations of lactobacilli. It is important to follow numbers of individual strains
of lactobacilli (or other bacteria) to study the cause and effect of Lactobacillus
spp. (or other bacteria) on flavor development in cheese. In addition, the ability
unequivocally to determine the presence of patented or licensed strains of ad-
juncts can be useful for legal purposes.
356 Johnson
A. Cottage Cheese
Cottage cheese curd is made from grade A pasteurized skim milk. Fortification
of milk low in casein (H110212.4% casein or H110219% total milk solids) with very low
heat–treated nonfat dry milk can improve cheese yield and quality (Emmons and
Tuckey, 1967).
Milk is inoculated with Lc. lactis subsp. lactis and cremoris, with the latter
being generally preferred. Commercially, cottage cheese is usually made with a
‘‘short set’’; that is, 4–5 h elapse between time of starter addition (milk pH 6.60,
31–32°C) and time of cutting (coagulated milk pH 4.70–4.8). However, a ‘‘long-
set’’ method is also used. To promote efficiency, the long-set method is some-
times used. Vats are filled with milk (20–22°C) and starter is added so that over-
night (9–12 h) the pH of milk decreases to 4.90. Thus, when the cheese maker
returns at the start of the workday, the milk coagulum is almost ready to cut. In
the short-set method, the inoculation rate of the starter is 3–5% w/w of milk;
whereas in the long-set method, much less (0.5–2% w/w) starter is used.
The pH at which curd is cut and the final pH of the curd after processing
are critical for yield and cheese quality but vary among processing plants. This
variability results from a variety of factors, including casein content of milk, heat
treatment of milk, and rate of acid development by the starter. Overacidification
or underacidification leads to brittle curd that shatters when stirred. Tiny pieces
of curd may be lost in subsequent manufacturing steps, causing a loss in yield;
or if retained, they may cause graininess (many hard bits of curd) and lack of
uniform curd size (a visual defect that downgrades the product). Most manufac-
turers use a very small amount of coagulant. This enables curd to be cut at slightly
higher pH. Curd is less fragile and yield is higher.
Once the coagulum is cut, the curd and whey mixture is heated to 54–57°C
(in approximately 2 h) and held (15–20 min) until proper firmness is reached.
Rate of heating and final temperature can prevent overacidification and firms
curd (removes whey). Although strain dependent, most lactococci do not produce
significant amounts of acid at temperatures above 40°C and are reduced in num-
ber by the cooking procedure (Collins, 1961). Pseudomonas spp. and Enterobac-
teriaceae, common spoilage bacteria of cottage cheese, are also sensitive to the
cooking procedure, which greatly reduces their number. The lethality of the cook-
ing procedure is time and temperature dependent and is determined by the initial
bacterial load. Therefore, the lower the bacterial population at the time curd
reaches the final cooking temperature, the more effective a given heat treatment
is.
After correct curd firmness is reached, most whey is removed and curd is
washed two or three times with cold water. The wash step removes lactic acid
and lactose and helps to control the level of acidity (acidic taste) in the finished
cheese. Water is acidified (pH 4.5–6.0) and chlorinated (5–10 ppm) or pasteur-
Cheese Products 357
ized to kill bacteria. Washing cools curd rapidly to less than 5°C, which is essen-
tial to keep growth of contaminating bacteria to a minimum. After the last wash
water is removed, pasteurized cold cream dressing is added and the product is
packaged. The amount of fat in the cream dressing determines the fat content of
the final cheese, so reduced-fat cottage cheese is made by adjusting the solids
and fat content of the cream dressing.
Contaminated equipment and air are the most likely sources of spoilage
bacteria in creamed cottage cheese. Although cottage cheese curd is acid (pH
approximately 4.5–4.7), the pH of the final commercial product, creamed cottage
cheese, is higher (5.0–5.3). The pH of the creamed cheese can be manipulated
by the acidity of the cream dressing. Low product pH (5) may lead to free whey
accumulation (clotting and syneresis of cream dressing) during storage, whereas
a higher pH allows for increased growth of contaminating bacteria. The final
product should be stored at less than 5°C. Although salt is added in the dressing,
the salt in moisture ratio (S/M) of creamed cottage cheese (1–2%) is not high
enough to hinder growth of contaminating bacteria. The dressing also contains
lactose, which can be fermented by undesirable microorganisms and starter if
they survive the heating step.
In properly manufactured creamed cottage cheese, the environmental con-
ditions within the cheese (low acid, relatively high pH, low S/M) are not harsh
enough strongly to inhibit growth of most psychrotrophic contaminants. Thus,
similar to conditions in raw or pasteurized milk, microorganisms able to grow
fastest at low storage temperatures are the dominant ones found in cottage cheese
(Cousin, 1982). Gram-negative psychrotrophic bacteria such as pseudomonas
(particularly P. fluorescens, P. fragi, and P. putida), Enterobacteriaceae (coli-
forms, especially Enterobacter aerogenes, E. agglomerans, and Escherichia
coli), Alcaligenes, Achromobacter, and Flavobacterium are the contaminants
most likely to be found in cottage cheese (Brocklehurst and Lund, 1985; Marth,
1970). All these bacteria are destroyed by pasteurization. Pseudomonas spp. are
obligately aerobic and predominate at the surface, whereas coliforms are aerobic
and facultatively anaerobic and sometimes can be found throughout the cheese.
Their growth and metabolism, as well as that of yeasts and molds, result in unde-
sirable flavors (called unclean, putrid, rancid, fruity, and yeasty), surface film
(Brockelhurst and Lund, 1985; Davis and Babel, 1954), and discoloration.
As with other cheeses, consumer acceptance of cottage cheese flavor varies
considerably. Cottage cheese is consumed as a fresh product (a few days to 4
weeks old) and the ingredients (milk, nonfat dry milk, cream) can all influence
the flavor (Bodyfelt et al., 1988). However, three main concerns can be controlled
microbiologically: level of acidity, diacetyl (aroma), and level of undesirable
flavors. The wash treatment and cream dressing can be used to adjust pH and
acidity of cheese. Diacetyl can be added directly as a starter distillate or can be
formed in the cream dressing through metabolism of citric acid by Lc. lactis
358 Johnson
subsp. lactis biovar. diacetylactis and Leuconostoc spp. However, in addition
to development of undesirable flavors, Pseudomonas spp., Alcaligenes, and E.
aerogenes can oxidize diacetyl to acetoin, a flavorless compound (Seitz, 1963).
This results in cheese that is bland or flat in flavor.
Growth of microorganisms in cottage cheese is inhibited most effectively
by low storage temperature (H110215°C), but it is also affected by pH and antimicrobi-
als. Potassium sorbate may be added to control yeasts, molds, and certain bacteria
(Liewen and Marth, 1985; Sofos and Busta, 1982), although it may impart bitter-
ness in creamed cottage cheese at levels greater than 0.075% (Bodyfelt, 1981).
As with other acids, the effectiveness of sorbate depends on the sensitivity of
spoilage organisms and is a function of antimicrobial concentration of the undis-
sociated form of the acid in the aqueous phase (pKa). It is enhanced by lower
pH, the symbiotic effect of other antimicrobials, lower initial microbial load, and
lower storage temperature. Thus, the degree of shelf life extension resulting from
the use of sorbate is directly related to the quality of the initial product and
subsequent handling (Bodyfelt, 1981).
Microgard (Wesman Foods, Inc., Beaverton, OR) is grade A skim milk that
has been fermented by Propionibacterium freudenreichii and then pasteurized. It
is widely used by the cottage cheese industry to inhibit growth of gram-negative
bacteria, some yeasts, and some molds. The actual inhibitory compound is a
bacteriocin (700 D, heat stable, and proteinaceous in nature) (Daeschel, 1989).
Direct injection of CO
2
into cream dressing has been shown to inhibit
growth of Pseudomonas (Chen and Hotchkiss, 1991), Listeria monocytogenes,
and Clostridium sporogenes (Chen and Hotchkiss, 1993). The technique has been
used commercially (Mans, 1995) without the side effect of ‘‘carbonation’’ flavor
in the cheese. It is claimed substantially to improve the shelf life. It is believed
that the CO
2
enters cells and inhibits growth or kills cells by lowering the pH
within the cell. The technique is more effective at 4°C than 7°C.
The relatively short storage time (2–4 weeks) and rapid attainment and
maintenance of low temperature during storage (5°C) probably preclude growth
of contaminating lactobacilli. However, if the temperature of storage is high
enough (7°C), as may occur in retail outlets, metabolism of lactobacilli may be
a potential problem. Of particular concern is acid development through metabo-
lism of lactose by either the nonstarter lactobacilli or surviving starter bacteria
or lactococci used in fermentation of the cream dressing. Poor acidification results
in free whey or watery cheese and an acid-tasting product. Growth and metabo-
lism of psychrotrophic microorganisms are also increased.
In the past, mixed-strain cultures, which included high levels of Lc. lactis
subsp. lactis biovar diacetylactis were inadvertently used. These bacteria produce
gas (CO
2
) from cometabolism of lactose and citric acid. The gas causes the curd
to float, but the curd structure is also disrupted and weakened, leading to curd
that is more easily shattered as the curd is stirred (Sandine et al., 1957).
Cheese Products 359
B. Internally Ripened Blue Mold Cheeses
Roquefort, Stilton, blue, and Gorgonzola are examples of cheeses in which devel-
opment of flavor is dominated by metabolism of Penicillium roqueforti or P.
glaucum. These molds grow throughout cheese (internally ripened) and are able
to grow in the low-oxygen, high-salt conditions that are typical of these cheeses
(Godinho and Fox, 1981; Golding, 1937). To facilitate exchange of air with CO
2
produced in cheese (via mold metabolism), cheese is manufactured to produce
an open texture and is pierced or punched with large-bore needles. If the texture
is too tight, mold only grows near the puncture. In addition, internally mold-
ripened cheeses may also be surface ripened with yeasts and bacteria (e.g., Stil-
ton); a process that provides for distinctive taste sensations in a number of
cheeses, including Limburger.
By international agreement, Roquefort cheese must be made from sheep
milk, in the Roquefort Valley of France, and ripened in naturally air-conditioned,
high-humidity caves near the town of Roquefort, (Bertozzi and Panari, 1993).
Similarly, manufactured cheese produced from cow milk in the United States and
other countries is called blue (bleu) cheese. Morris (1981) provides an excellent
technical description of the manufacture of blue-veined cheeses.
Blue cheese is usually made from a blend of heat-treated (raw) or pasteur-
ized skim milk and homogenized cream, whereas Roquefort is made from nonho-
mogenized raw, whole sheep milk. The purpose of homogenization is to break
up large fat globules. Sheep milk naturally contains more small globules. Homog-
enization results in a whiter curd (and increased contrast with the blue mold),
increased flavor development through enhanced lipase activity (Morris et al.,
1963), and a more porous, crumbly texture. Pasteurization destroys most of the
milk lipase, which is believed to aid in ripening of cheese and kills most non-
starter bacteria, especially lactobacilli, which might play an important role in
overall development of characteristic flavor. Milk is inoculated with spores
(10
3-4
/mL milk) of P. roqueforti. Some manufacturers prefer to inoculate curd
instead. Either method ensures that spores and thus flavor development will occur
evenly throughout cheese. During manufacture, steps are taken to produce a po-
rous or open texture. The starter is Lc. lactis, and citrate-metabolizing strains
(Lc. lactis subsp. lactis biovar diacetylactis and Leuconostoc sp.) are sometimes
added. Carbon dioxide produced through metabolism of citric acid expands me-
chanical openings in cheese, which in turn allows for more intrusive growth of
mold. The coagulum is cut when very firm into large cubes (0.95 cm diameter).
The whey and curd mixture is heated to 35–37°C, held for 30 min with agitation,
and then whey is removed. Curds may be salted. Dry curds are put into hoops
(drained vessels) and allowed to sit for several days at 21–27°C. This encourages
complete fermentation of lactose, results in a cheese with a pH of 4.8–4.9, and
permits full drainage of whey. The body is desirably brittle and crumbly. Im-
360 Johnson
proper whey drainage may result in soft, mushy surface areas during storage.
These areas are ideal for growth of yeasts and putrefactive bacteria such as Pseu-
donomas sp. and Acinetobacter (Smith et al., 1987).
Cheeses are brine salted or rubbed with salt for several days. Roquefort
cheese must be dry salted by regulation. After salting, cheeses are pierced with
0.24-cm diameter needles and placed in a curing room (10°C at 90–95% humid-
ity) for 2–4 weeks or until mold growth begins to appear at openings of holes.
Piercing allows for transfer of oxygen and CO
2
to stimulate growth and metabo-
lism of P. roqueforti. P. roqueforti is more tolerant of low oxygen, high CO
2
,
and high salt than most other species of molds. After sufficient mold growth,
cheeses are wrapped and stored (matured) for 2–4 months at (10°C). In France,
later curing of cheese occurs in the famous caves of Roquefort. After proper
curing, cheeses are cleaned of surface growth (molds, yeasts) and repackaged for
sale.
Metabolism of molds (lipolysis and proteolysis) during maturation is essen-
tial for development of the distinctive blue cheese flavor (Goghill, 1979). A dis-
tinctive yeast flora also develops on Roquefort, including Debaromyces hansenii,
Candida sp., and Kluyveromyces lactis (Besancon et al., 1992). The intensity of
mold-derived flavors is so strong that, although other microorganisms are present
in such high numbers (yeasts, micrococci, and lactobacilli), their contribution to
flavor of blue cheese cannot be ignored, nor neither can it be ascertained.
The salt in moisture in the interior of blue cheeses can be as high as 6–
8%. This inhibits growth of lactococci and Leuconostoc sp. Free fatty acids re-
leased through lipolysis and via oxidative decarboxylation are converted to
methyl ketones. Of particular importance in blue-veined cheeses are 2-heptanone
and 2-nonanone, without which there is no distinctive blue cheese flavor. Second-
ary alcohols, methyl and ethyl esters derived from fatty acid metabolism and
proteolysis, are essential for the well-balanced and distinctive flavor of blue-
veined cheeses (Kinsella and Hwang, 1976). Molds require oxygen to grow, albeit
at low levels, for P. roqueforti. With P. roqueforti, too little oxygen can result
in a change in color from blue-green to greenish yellow. This situation can occur
if cheese is vacuum packaged. Proper color returns when the cheese is exposed
to air.
During initial salting and ripening of blue cheese, there is a conspicuous
lack of visible growth of mold and yeasts on the surface. The low pH and high
salt content keep the level of these microorganisms in check (Godinho and Fox,
1981). Some manufacturers also use a hot brine treatment (72°C for 20) to kill
microorganisms at the cheese surface. However, as cheese matures, salt diffuses
in and the pH rapidly increases (5.8 up to 6.5). Yeasts and molds metabolize lactic
acid and hydrolyze protein, releasing ammonia and amino acids. Both metabolic
activities result in pH increase. During maturation, microorganisms once held in
check by adverse conditions (low pH) can begin to grow. Salt-tolerant bacteria
Cheese Products 361
such as L. monocytogenes and Staphylococcus aureus (de Boer and Kuik, 1987)
are of particular concern (see Chap. 13). Since blue cheese is often added as
an ingredient to salad dressings, the presence of undesirable bacteria such as
heterofermentative lactobacilli can be a potential problem. Although the cheese
does not contain any sugar, the dressing may. Metabolism of sugar by heterofer-
mentative lactobacilli produces gas and an unattractive salad dressing.
C. Externally Mold-Ripened Cheeses: Camembert and Brie
Camembert and Brie are essentially the same cheeses, but in France are made
in different regions. Brie cheese wheels are also larger in diameter (Masui and
Yamada, 1996) and may be produced with S. thermophilus starter. Whole milk,
sometimes with cream added (double-cream Brie), is inoculated with Lactococ-
cus sp. After considerable acid development by the starter, coagulant is added.
The coagulum is very firm when cut. This results in a higher moisture cheese.
The coagulum is cut into large pieces, 1.6-cm diameter, stirred, and dipped into
forms. Alternatively, uncut coagulum may be dipped directly into forms. The
height of finished cheese is important, because the degree of ripening of cheese
depends on its thickness. Curd settles in forms, which are turned approximately
6–8 h after being filled. There is no cooking or heating step. No pressure is
applied. As in blue cheese, the starter continues to produce acid until it becomes
self-inhibited at pH 4.7–4.8.
Cheese is removed from forms and brined or dry-salted (salt rubbed or
sprinkled on the surface). After salt is absorbed (1 day), spores of P. camemberti
are sprayed onto the surface. Spores may also be added directly to the milk.
Cheese is not pierced as in blue cheese, so mold does not grow in the interior
of the cheese unless there is an area of unfused curd (mechanical openings or
holes). Cheese is transferred to shelves in rooms of high relative humidity (90–
95%) at 10°C. It is placed on mats or perforated sheets to allow air contact with
as much surface area as possible. This permits growth of the mold evenly over
the entire surface area of the cheese. Cheese is also turned regularly to expose
bottom areas and keep soft cheese from being imprinted with the perforated mats
or sticking to them. After approximately 2 weeks in ripening rooms, mold has
developed sufficiently, and cheese is wrapped for sale. It is then stored at a low
temperature (4–7°C) for further ripening (2–4 weeks).
Slow growth of mold may indicate a too-high salt content or too-low pH.
To prevent the latter, water may be added to milk or whey to remove some of
the lactose before curd is transferred to forms. The practice has also been applied
in the manufacture of blue cheese.
Before growth of P. camemberti, cheese is firm, crumbly, and acid. As
mold grows, it metabolizes lactic acid and hydrolyzes protein. Just beneath the
surface growth, cheese is very soft, creamy, and appears slightly translucent and
362 Johnson
more yellowish than the interior portion of the cheese. As ripening continues,
the interior becomes progressively softer and creamier just as at the surface. This
progression is referred to as ripening from the outside to the inside. The change
in the body of cheese results, in part, from migration of ammonia from the inside
to the outside of the cheese. Migration of ammonia from the outside to the inside
of the cheese raises the pH of cheese from 4.8 to H110226.5. This alters hydration of
casein with the net result of an increase in fluidity of cheese. With an increase
in pH, naturally occurring milk proteinase, plasmin (not active at low pH), hydro-
lyzes protein, further softening cheese. Eventually, the entire cheese becomes
soft and creamy. Overripening either by poor stock maintenance or by design
results in cheese that is very fluid and that ‘‘runs’’ when cut open.
Metabolism of P. camemberti results in hydrolysis of milkfat (lipolysis)
and subsequent oxidative decarboxylation of free fatty acids to methyl ketones
(Molimard and Spinnler, 1996). Of particular importance to the flavor of Camem-
bert are 1-octen-3-ol, 1, 5-octadien-3-ol, and 2-methylisoborneol (Karahadian and
Lindsay, 1985). In the United States, Camembert and Brie are generally ripened
with mold only. However, Karahadian and Lindsay (1985) postulated that growth
of Brevibacterium linens on cheeses imported from France resulted in develop-
ment of sulfur compounds: dimethyl disulfide, dimethyl trisulfide, and methional.
Other regional differences in flavor may arise from metabolism of particular mi-
croflora contaminating the surface of cheese. Nooitgedagt and Hartog (1988)
found yeasts (predominantly D. hansenii, Yarrowia lipolytica, K. marxianus, and
Candida spp.), and Geotrichum candidum and a few cheeses with greater than 10
4
staphylococci, greater than 10
5
E. coli, and greater than 10
7
Enterobacteriaceae.
D. Cheeses with Eyes
Swiss, baby Swiss, Gouda, and Edam are among cheeses characterized by devel-
opment of circular openings called eyes. Eyes develop through formation of CO
2
by metabolism of specific secondary bacteria. In Swiss-type cheeses, gas (CO
2
)
is formed by P. fruedenreichii subsp. shermanii through metabolism of lactic
acid. In Gouda and Edam cheeses, CO
2
is formed from metabolism of citric acid
by Leuconostoc spp. and Lc. lactis subsp. lactis biovar diacetylactis.
These are the most difficult of cheeses to manufacture because of the strict
grading regimen they must pass. Eye development is key, and this is sometimes
the only criterion by which these cheeses are graded. Reinbold (1972) and Olson
(1969) have provided detailed descriptions on manufacture of these cheeses. The
method of manufacture is similar for all cheeses with eyes.
Starters for Swiss and baby Swiss cheese are predominantly S. thermophi-
lus with small amounts of Lb. delbrueckii subsp. bulgaricus, Lb. helveticus, and
Lb. lactis. Depending on the manufacturer, Lc. lactis may also be used to ensure
fermentation of all sugar, including residual galactose. The propionibacteria are
added with the lactic starter.
Cheese Products 363
Lc. lactis is used as starter for Gouda and Edam cheeses. Gouda and Edam
are manufactured similarly, but Edam is lower in moisture and fat content.
The main objective in making cheeses with eyes is to produce a pliable
curd mass. This is necessary for development of round eyes rather than slits or
cracks. Pliability or elasticity of cheese results from both protein density and
physicochemistry (strongly influenced by pH and bound calcium). As CO
2
is
formed, it accumulates at locations where air has been entrapped during pro-
cessing or at sites where the curd is not tightly fused. Gas exerts pressure on the
protein network. If the protein network is elastic, it bends or gives but does not
break, forming an eye. If the protein network cannot withstand the pressure, it
breaks and a slit is formed. Elasticity is a phenomenon related to hydration of
casein, calcium-phosphate bonding, and electrostatic and hydrophobic interac-
tions between casein molecules. Thus, rate and extent of acid development (pH)
at whey drainage and pressing must be carefully controlled. To accomplish this,
slow acid development is necessary and separation of curd and whey generally
occurs at a relatively high pH.
In Swiss cheese, after cutting, curd is heated to 48–53°C and held for 30–
60 min depending on the desired moisture content and pH. In Gouda and baby
Swiss varieties, a portion of whey (25% of milk weight) is drained and replaced
with hot water to raise the temperature of curds and whey to 38–39°C. Addition
of water not only heats curd but also dilutes lactose, thereby controlling the pH
of cheese. Alternatively, Swiss cheese manufacturers can control the pH by add-
ing warm water to milk and cold water to cool curd before whey drainage (com-
bined water addition is approximately 7–10% of weight of milk). The high heat
used in Swiss cheese manufacture inhibits acid development and partially inacti-
vates the coagulant (depends on type of coagulant). The starter is not killed and
resumes acid development as curd cools.
In larger commercial manufacturing plants, regardless of cheese type, curd
and whey are pumped together into a smaller vessel or rectangular tower that
concentrates curd into a single large mass. Pressure is applied and serum is
squeezed from curd.
In the traditional method of Swiss cheese manufacture, all curd from the
cheese vat (a round kettle) is enclosed in a cheese cloth, lifted into the cheese
form, whey is manually pushed out of the curd mass, and cheese is pressed.
Because serum is at a high pH during pressing, less calcium phosphate is dis-
solved in whey as compared to cheeses of a more acidic nature at drain (Cheddar
or mozzarella). Phosphate acts as a buffer and helps keep pH of curd from getting
too low. Low pH (5.1) inhibits growth of Propionibacterium sp. and is involved
in development of a short, inelastic body in cheese. After pressing, the curd mass
is brine salted.
To ensure curd fusion and complete sugar metabolism, cheese is held at
7°C (prewarm room) for several days. Cheese is then placed in a warm room
(10–13°C for Gouda and 20–26°C for Swiss).
364 Johnson
The temperature affects both growth of the eye former and elasticity of the
protein network. The warmer the cheese, the more elastic the protein. Rate of
gas development is critical. If gas develops too rapidly and the casein network
cannot handle the gas pressure, the cheese splits. If gas forms too slowly, the
cheese maker may leave cheese in the warm room for too long, resulting in too
much proteolysis. When gas does develop, curd is no longer elastic, resulting in
splits. After the eyes form, Swiss cheese is cooled and stored (5°C) to prevent
further gas development.
Gouda cheese may be ripened for extended periods at the warm room tem-
perature. Because citric acid is limiting in cheese, there is no fear of excessive
gas being formed by the added lactococci or Leuconostoc. However, in Swiss
cheese, there is excess substrate (L-lactic acid) and potential for continued gas
formation unless the cheese is cooled (Fedio et al., 1994; Hettinga et al., 1974).
The search is underway to find a Propionibacterium sp. that does not form gas
during storage (Hofherr et al., 1983). Cold cheese is not elastic, so if gas is
formed, it expands existing eyes and they split. As cheese ages, casein is hy-
drolyzed (proteolysis) by residual coagulant, nonstarter bacteria, and plasmin (na-
tive milk proteinase). Proteolysis eventually destroys elastic properties of the
casein network. Thus, if gas is formed in cheese after much proteolysis has oc-
curred, slits are formed.
In all cheeses with eyes, undesirable gas formation can occur if large num-
bers of C. tyrobutyricum are active. Their growth usually occurs months after
cheese is made and after much proteolysis has occurred. The result is split eyes
or newly formed large slits called cracks. Metabolism by C. tyrobutyricum also
results in rancidity and H
2
S formation (Langsrud and Reinbold, 1974). The latter
gives rise to the term stinker cheese or stinkers for short. Metabolism at the
surface of cheese by Pseudomonas spp., yeasts, and enterococci also produce
stinkers.
Certain varieties of cheese with eyes, for example, Gruyere and Danbo,
are also surface ripened (see Sec. IV. G).
E. Surface-Ripened Cheeses
Limburger and traditional brick cheese are known for their highly malodorous
character. For certain individuals, they literally stink; to the connoisseur, they
smell in a pleasant sort of way. The strong odors arise from putrefaction of pro-
tein, which releases ammonia and sulfide compounds (H
2
S and methyl mer-
captan).
These cheeses are made from whole milk with Lactococcus spp. starters.
After cutting the coagulum, a portion of whey is removed (25–50% of milk
weight) and replaced with hot water. This raises the temperature and removes
lactose from curd, which prevents cheese from becoming too acidic, a develop-
Cheese Products 365
ment that could delay ripening. There are several variations to this procedure,
but the net result is the same. After 30–60 min, whey is drained while curd is
stirred. If an open-bodied cheese is desired, all or most whey is removed. Curd
is put into forms and may or may not be pressed. Once pressed, cheese is brined,
‘‘smeared,’’ and placed in a high-humidity room (90–95% relative humidity) at
13–15°C. Cheese is slightly acid after brining (pH 5.2–5.4). The pH depends on
amount of whey removed and water added during manufacture. Once brined,
cheese is inoculated with the smear. The smear is a mixture of several microor-
ganisms, most importantly yeasts, micrococci, Arthrobacter and B. linens, which
develop as a layer on a cheese surface as it ripens. Smearing is done by scraping
the smear layer from an already ripened cheese into a brine solution and then
rubbing fresh cheeses with the smear-containing brine. This procedure is repeated
every few days until luxurious growth occurs. Microorganisms in the smear may
be purchased separately, mixed, and the cheeses inoculated. Arthrobacter and B.
linens give the smear a red-orange color. Yeasts (D. hansenii, Candida spp., G.
candidum, and Y. lipolytica) metabolize lactic acid and the pH of the cheese
increases (Eliskases-Lechner and Ginzinger, 1995; Iya and Frazier, 1949). Micro-
coccus spp. (M. varians, M. caseolyticus, and M. freudenreichii) begin to grow,
followed by B. linens and Arthrobacter (Lubert and Frazier, 1955). The pH must
be greater than 5.5 for B. linens to grow (Kelly and Marquardt, 1939). Yeasts
also synthesize vitamins (pantothenic acid, niacin, and riboflavin), which may be
essential for B. linens to grow. A symbiotic relationship thus exists between
growth of yeasts and B. linens (Purko et al., 1951). The length of time the smear
is left on cheese and size of cheese influence its flavor intensity.
Limburger cheese is cut into small loaves (6.4 H11003 6.4 H11003 13 cm) before
smearing, and the smear is not removed. Traditional brick cheeses are larger
pieces and, again, the smear is not removed. In less pungent brick cheese, the
smear is washed off after 4–10 days. If the smear is left on cheese, ripening
continues. Ripening of cheese involves extensive proteolysis, with release of am-
monia, H
2
S, and methyl mercaptan (Grill et al., 1966). These flavor compounds
diffuse into cheese. Metabolism of lactic acid at the surface of cheese, ammonia
migration into the cheese, and proteolysis on the inside, caused by coagulant and
plasmin, eventually lead to a fluid interior. The cheese is runny when cut. Because
of pH increase, microorganisms once held in check by low pH can then begin
to multiply. L. monocytogenes, staphylococci, and coliforms are of major concern
(see Chap. 13).
F. Colby, Sweet Brick, Muenster, Havarti
Colby, sweet brick, Muenster, and Havarti are consumed with minimum ripening,
generally between 1 and 3 months. Inferior products are often sold if the cheese
is aged for a longer time. These cheeses are low in acid, because lactose is rinsed
366 Johnson
from the curd, and they have a pH of approximately 5.2–5.4. Lactococci are used
as starter in Colby and brick cheese but S. thermophilus is preferred for Muenster.
Some manufacturers also use Lb. delbrueckii subsp. bulgaricus if S. thermophilus
is used. Havarti cheese is manufactured with lactococci with added Leuconostoc
sp. and citrate-metabolizing Lc. lactis subsp. lactis biovar diacetylactis. Once the
coagulum is cut, curds are heated to 36– to 37°C if lactococci are used as the
starter and 39–41°C if thermophilic cultures are used. In Muenster and brick
cheeses, there is little or no acid development before putting curd into forms.
In Colby manufacture, the pH of curd at whey drainage is approximately
6.1. Whey is drained and curds are continually stirred as water (30–32°C) is
sprinkled on them. This not only cools the curd but also removes lactic acid and
lactose. All whey is then removed and curd is salted, put into forms, pressed,
and stored. The result is a cheese with a pH of 5.2–5.3 and many mechanical
openings. Cool, firm curd does not fuse completely even when pressed. Vacuum
packaging closes the openings and cheese forms a tight knit texture, but this is
not allowed in authentic Wisconsin Colby.
In Muenster cheese, curd and whey are pumped into rectangular open-
ended forms, lightly pressed, brined, and stored. In manufacture of brick and
Havarti, once the coagulum is cut, a portion of whey is drained and replaced with
hot water to heat curds to 36–37°C. Curds are then handled as with Muenster. The
more whey removed before putting curd into forms, the more mechanical open-
ings appear in cheese. Cheeses are brined and stored. Havarti is ripened at 13–
16°C for 2–6 weeks; Muenster and sweet brick are stored at 7°C and are ready
for consumption within a month.
G. Cheddar Cheese
Cheddar cheese is consumed when it is anywhere from 1 month to several years
of age. Pasteurized or heat-treated (67–70°C for 20 s) whole milk is used. Lacto-
coccus spp. is the starter, with Lc. lactis subsp. cremoris being preferred for long-
hold cheese. Once the coagulum is cut, curd is heated to 38–39°C. After proper
stir-out, whey is completely drained and curd is either continuously stirred (stirred
curd Cheddar) or allowed to mat (Cheddared curd, also called milled curd Ched-
dar). Stirred curd is preferred if the cheese will be used for process cheese. Ched-
dared curd is preferable for table cheese. Cheddared curd cheese is thought to
develop a better flavor and has a smoother body than stirred curd cheese. When
the curd reaches the desired pH, curd is salted. In Cheddared curd, the matted
curd is cut into large pieces, which are periodically turned (Cheddared) in the
vat until the proper pH is reached (pH 5.4–5.5). The slabs of curd are then cut
into finger-sized pieces (milled), salted, put into forms, and pressed. Cheeses are
generally stored at 7–9°C. There is considerable variation in details of Cheddar
cheese manufacture resulting from mechanization of the process, size of vats,
Cheese Products 367
rate of acid development by starter, and whims of the manufacturer. The pH of
cheese at 1 week is generally 4.95–5.1.
H. Pasta Filata Cheeses: Mozzarella and Provolone
Manufacture of pasta filata cheeses is almost identical to milled curd Cheddar
cheese. S. thermophilus (cocci) and Lb. delbrueckii subsp. bulgaricus or Lb.
helveticus (rods) are used as starter. The ratio of cocci to rods used varies from
manufacturer to manufacturer, but ratios of 1:1, 3:1, 5:1, or 1:0 are commonly
used. The cocci are the main acid producers. Lactococci are sometimes added.
As with Cheddar cheese, considerable variation exists in manufacture of mozza-
rella and provolone cheeses. Mozzarella is a common name applied to various
cheeses made similarly (Code of Federal Regulations, 1995). There is some de-
bate over the appropriateness of allowing non–pasta filata cheese to be called
mozzarella; these cheeses are being made and sold as mozzarella especially as
a kosher product.
Provolone is lower in moisture but higher in fat than mozzarella cheese.
Lipases are added to milk and lipolysis results in a light piquant or rancid flavor
in provolone. After the coagulum is cut, the curd and whey mixture is heated to
42–43°C. At pH 6.1, whey is drained and curd may be cut into slabs and stacked.
At a pH of 5.15–5.35, curd is milled and placed in a hot-water bath (70–88°C)
and kneaded. The pulling or stretching of the molten curd mass gives the pasta
filata cheeses their name, but it also imparts a fibrous body to the cheese. The
temperature of the cheese (57–63°C) varies with time of exposure to mixing and
water temperature. Coagulating enzymes vary in their heat sensitivity and the
residual coagulant can play a major role in determining the physical characteris-
tics of cheese (melt, stretch, oiling off, burning, chewiness) (Kindstedt, 1993).
Starter may or may not survive the heat treatment of the curd. This has a major
impact on metabolism of residual sugar and consequently Maillard-browning re-
actions when cheese is subsequently heated on pizza (Johnson and Olson, 1985).
After curd is stretched, it is shaped (usually into cylinders), placed in cold water
to cool, and eventually brined.
High-moisture fresh mozzarella can be eaten immediately, but the more
familiar pizza-type mozzarella (low-moisture, part skim) is aged for a few days.
This short ripening period (4–7 days) allows for equilibrium between hydrogen
ions (H
H11001
) and colloidal calcium phosphate and for any free moisture within the
cheese to be absorbed by the casein network. If water is not absorbed, it (also
referred to as expressible serum) will come out during shredding of the cheese.
As cheese ages, proteolysis results in an increase in melt and a decrease in stretch-
ability when used in cooking. This occurs in all cheeses but is most noticeable
in mozzarella because of demands that are placed on the physical characteristics
of this cheese when baked or fried.
368 Johnson
The physical properties of any cheese are determined by pH, composition,
and proteolysis (Kindstedt, 1993). Thermophilic starter strains do not use the
galactose portion of the lactose molecule, and it accumulates in cheese (Hutkins
and Morris, 1987). The use of galactose-fermenting starter strains (Mukherjee
and Hutkins, 1994) may reduce the level of galactose. Residual galactose and
lactose are responsible, in part, for browning of cheese when baked (Johnson
and Olson, 1985). Dehydration and scorching of protein during baking results in
browning with a darker color in the presence of sugar. Residual sugar is also a
prime substrate for heterofermentative lactobacilli and coliforms. Gas formation
by these bacteria leads to ‘‘blown’’ cheeses (splits, eyes) and puffy packages.
Yeast contamination via brine is also a potential problem.
I. Parmesan and Romano
S. thermophilus (cocci) and Lb. helveticus or Lb. delbrueckii subsp. bulgaricus
(rods) are used to manufacture grana cheeses, Parmesan and Romano. The ratio
of cocci to rods varies according to the manufacturer but ratios of 1:1, 3:1, or
8:1 are common. Some manufacturers also add a small amount of Lc. lactis to
ensure complete sugar metabolism. Reduced-fat milk is used for both. Moisture
content is low (32% maximum for Parmesan, 34% maximum for Romano). Par-
mesan must be aged 10 months and has a minimum FDM of 32%, whereas Ro-
mano must be aged 5 months and has a minimum FDM of 36% (Code of Federal
Regulations, 1995). There is an effort to reduce aging requirements for Parmesan
to 6 months. Indeed, some companies have received a temporary variance
allowing for the shorter ripening period as long as the cheese has the same flavor
as the more aged cheese. Parmesan and Romano are manufactured similarly. The
coagulum is cut softer and finer than for other cheeses to ensure a drier finished
cheese. Fast acid development by the starter is desired. After cutting, the curd
and whey mixture is heated to 45–47°C and stirred until the pH of whey is
approximately 5.8–6.0. Whey is then drained. Curds are continuously stirred until
all whey is removed. The low pH and high heat during stir-out enhances synere-
sis. Curds are put into forms (usually 9- to 18-kg wheels), pressed overnight, and
brine salted for several days to 2 weeks. Some manufacturers brine only a few
days and apply salt to the cheese after it is removed from the brine. This method
of salting is called dry salting and may require several days of application to
achieve the desired salt level. Alternatively, curds first may be salted, put into
forms, and then pressed. This process produces what is referred to as barrel
cheese. The cheese is not brine salted, and the process usually requires a longer
stir-out and application of less salt. If the salt content is too high, it may inhibit
fermentation of all the sugar. Residual sugar may participate in Maillard-brow-
ning reactions, especially if the cheese is further dried (with heat) to produce
grated cheese. After brining, the cheese is stored at 7–10°C. Traditionally, wheels
Cheese Products 369
of cheese are coated with an oil to prevent mold growth and coated with wax at
a later date. Some modern manufacturers coat the cheese with a polymer con-
taining a mold inhibitor (natamycin).
Although Parmesan and Romano cheeses are made similarly, they taste
distinctively different. Pregastric esterase or lipase is added to the milk for manu-
facture of Romano but not to milk for manufacture of Parmesan. Thus, the flavor
of Romano is rancid or picante, whereas that of Parmesan is described as sweet
and nutty.
J. Reduced-Fat Cheeses
Demand by consumers has led to development of reduced-fat versions of popular
cheese varieties. Early attempts did not meet with tremendous success because
of poor physical and flavor characteristics. Adjustments to the manufacturing
protocol, including the use of selected starter strains and particular attention to
dairy plant hygiene, have greatly improved the quality of these cheeses. Young,
mild-flavored cheese with a reduction in fat content of 25–33% as compared to
the full-fat cheeses have almost, if not actually, duplicated the quality (flavor and
body) of the full-fat counterparts. Cheeses with a fat reduction of greater than
50% have yet to achieve similar results. It is more likely that these cheeses have
taken on their own unique flavor and are being accepted on their own merits
rather than in comparison to other cheeses.
Reduced-fat versions of cheeses are similar to their full-fat counterparts in
that they are subject to the same microbiologically induced defects and for the
same reasons. However, the ecology (variety of bacteria and changes over time)
of the cheeses may or may not be the same; this has not yet been studied. Cheese
with less fat is firmer than cheese with higher fat content. To overcome this
problem, reduced-fat cheeses are manufactured to contain much higher moisture
contents. But higher moisture means higher lactose in the cheese, which, in turn,
means that the cheese is high in acid after the starter ferments the sugar. To
avoid producing an acidic cheese, many manufacturers of reduced-fat cheeses
(regardless of type) use whey dilution or curd rinsing to remove some lactose.
However, reduced-fat Cheddar is also being made commercially without a rinse
treatment by using a specific manufacturing protocol to retain the buffering capac-
ity of the cheese (Johnson and Chen, 1995). Cheese contains more acid (up to
2% lactic acid compared with less than 1.6% lactic acid in full-fat Cheddar) but
both may have the same pH. Compared with full-fat cheeses, most reduced-fat
versions are higher in moisture and pH and generally lower in salt (lower S/M)
and lactic acid. Thus, the cheese environment and chemistry is not the same
between full-fat and reduced-fat cheeses, and the reduced-fat cheeses may be
more susceptible to growth of undesirable bacteria, especially coliforms. Of
course other contaminants such as lactobacilli also grow more rapidly in lower
370 Johnson
salt, lower acid, reduced-fat cheeses. Reduced-fat cheeses may have a tendency
to increase in pH more rapidly than full-fat counterparts because of lower acid
levels and increased proteolysis. Conditions are thereby created that are more
favorable to growth of bacteria in general.
The consequences of reduction of fat on flavor of aged Cheddar cheese are
well recognized (i.e., lack of similar flavor intensity at similar age), but the differ-
ence in flavor is less evident in reduced-fat versions of cheeses in which the
full-fat version is mild-flavored (Muenster, brick, Gouda). Reduced-fat Cheddar
cheese made with a curd rinse tastes similar to Colby. Reduced-fat Cheddar made
without a curd rinse has more Cheddar flavor than one made with a rinse, but
development of flavor still lags behind that of full-fat Cheddar.
Although reduced-fat cheeses have met with some consumer acceptance,
there appears to be a universal concern that cheeses not ripened deliberately by
yeasts or molds lack flavor. As a result, adjunct bacteria, particularly Lactobacil-
lus spp., are being used commercially to enhance cheese flavor.
K. Process Cheese and Cold-Pack Cheeses
Process cheese, cheese spreads, and cheese foods are produced from other
cheeses. A mixture of cheeses (may be several varieties, ages, and flavor) is
blended with milkfat (butter oil), water, ‘‘melting salts’’ (such as sodium phos-
phates, citrates) and, in the manufacture of spreads and foods, added whey pow-
ders. Depending on type of product and shelf life requirements, the mixture is
stirred and heated to 70–140°C for 2–15 min. It is then packaged (filled) or made
into slices. The rate of cooling depends on size and shape of cheese but may
take several hours to reach temperatures below 38°C. This is in excess of pasteur-
ization, so most microorganisms are killed with the exception of spore formers.
Of particular concern are C. sporogenes, C. tyrobutyricum, C. butyricum, C. botu-
linum (see Chap. 13), and B. polymyxa. The presence of coliforms or yeasts is
indicative of low processing temperature, especially at filling or negligent sanita-
tion. In addition to composition, pH and a
w
, the presence of melting salts may
be inhibitory to the growth of clostridia (Steeg et al., 1995; Tanaka et al. 1986).
Nisin will also inhibit growth of clostridia (Roberts and Zottola, 1993).
Cold-pack cheese is prepared by mixing, without the aid of heat, a blend
of cheese, acid, salt, flavoring, stabilizers, and water. Cold-pack cheese food may
also include whey powder, buttermilk, and nonfat dry milk. Cold-pack cheeses
must be made from cheeses made with pasteurized milk or held for at least 60
days at a temperature above 1.67°C. Because such cheese is not heated, microbial
quality is subject to microbial content of ingredients. In addition, cold-pack
cheese food contains lactose, a readily available food source for many potential
contaminants as well as starter bacteria. Starter fermentation of residual lactose
can cause the pH to drop and free moisture to appear at the surface of the cheese.
Cheese Products 371
The major microbiological problem with these products is growth of yeasts and
molds, especially if free moisture is available at the surface. Antimycotic agents
such as potassium sorbate are permitted (not to exceed 0.3%).
VI. CHEESE RIPENING—INFLUENCE OF
MICROORGANISMS
Microorganisms found in cheese can be classified into two groups: those that are
deliberately added, such as starters and adjuncts, and those that are adventitious
contaminants. The primary role of starter bacteria is to produce acid at a consis-
tent rate, but it would be wrong to assume that their role is limited to this. The
starter has a major impact on flavor in cheese consumed fresh. As cheese matures,
direct contribution to flavor by the starter diminishes as nonstarter flora grow.
Although, in most instances, the exact means by which starter bacteria or adjunct
microorganisms contribute to development of flavor is controversial, they can
both influence cheese maturation. Development of flavor in blue, Camembert,
Limburger, Romano, and provolone cheeses is clearly dominated by microorgan-
isms or enzymes deliberately applied to them. With other varieties of cheese,
however, development of flavor is not clearly understood. Scores of compounds
with the potential to affect flavor have been isolated from a variety of cheeses.
But the full duplication of cheese flavor chemically has eluded us.
Olson (1990) described the possible role of starter bacteria in cheese flavor
development as follows: fermentation and depletion of fermentable carbohydrates
create an environment that controls growth and composition of adventitious flora.
This is accomplished through development of acids, creation of low oxidation-
reduction potential during early stages of cheese maturation, and competition for
nutrients. In addition, starters can develop flavor compounds directly and indi-
rectly through their metabolic activities (Crow et al., 1993). (See Chap. 7 for
more details on the influence of carbohydrate metabolism and proteolysis by
bacteria on cheese flavor development.)
Autolysis of starters (and adjuncts) releases nutrients that serve as metabo-
lites for other microorganisms in cheese (Thomas, 1987b). Also, activity of re-
leased intracellular peptidases can contribute to the increase in the free amino
acid pool within cheese (Lane and Fox, 1996). Amino acids can, in turn, be
metabolized by other bacteria directly to flavor compounds or can react chemi-
cally with other constituents in cheese to produce flavor compounds (Griffith and
Hammond, 1989). Any bacteria thriving in cheese can potentially influence flavor
of cheese through synthesis of flavorful metabolites. Characterization of flavor
in most cheeses is lacking; thus the direct connection between microbial metabo-
lism and cheese flavor is also limited. Another problem hampering the study of
influence of starter and nonadded microflora on flavor in cheese is a lack of
372 Johnson
consensus on what constitutes cheese flavor, especially in varieties of cheese not
ripened by yeasts or molds. There is an element of distrust in that what one person
perceives to be true cheese flavor may not be the same as what another might
consider to be cheese flavor. Consequently, results of experiments on flavor en-
hancement or acceleration of flavor development are often met with skepticism.
Starters are the dominant bacteria found in cheese initially. Numbers range
from 10
6
to 10
9
/g cheese. As cheese ages, their numbers decrease and numbers
of nonstarter bacteria increase. The rate at which this happens depends on strain
of starter and initial numbers and type of nonstarter bacteria. Lactobacilli consti-
tute most nonstarter lactic acid bacteria in Cheddar cheese (and probably most
cheeses), with the dominant species of quality cheese being Lb. casei and Lb.
plantarum (Fox et al., 1998; Franklin and Sharpe, 1963; McSweeney et al., 1993;
Peterson and Marshall, 1990). Heterofermentative lactobacilli may be present
with no visible sign of gas production (Laleye et al., 1987). Lactobacillus num-
bers in raw milk are greatly reduced by pasteurization. The presence of lacto-
bacilli in pasteurized milk generally indicates high (10,000/mL) numbers in raw
milk or postpasteurization contamination. Type and strains of nonstarter bacteria
found in cheese are dependent on initial numbers in milk (especially if raw milk
is used), biofilm formation on equipment and subsequent contamination, and abil-
ity of individual strains to survive and compete in the cheese environment (pH,
salt, a
w
, acidity, temperature, availability of nutrients).
Addition of Lactobacillus adjuncts has been suggested as a means of con-
trolling numbers of adventitious lactobacilli by, at least initially, outcompeting
other microflora in cheese (Martley and Crow, 1993). However, depending on
strain, the adjunct culture may die or may not compete well against nonstarter
microflora; thus the ecology of cheese can change as it matures. Dominance of
cheese microflora by lactobacilli has led to numerous studies advocating addition
of defined strains of lactobacilli to milk or cheese to reduce bitterness, enhance
flavor, or develop particular textural or physical attributes in the cheese (El-Soda,
1993). Other bacteria, particularly B. linens, have also been used commercially
to enhance flavor of Cheddar and reduced-fat cheeses. The use of adjunct bacteria
to accelerate flavor development has met with some resistance by manufacturers,
because the flavor developed in cheese is not the same as flavor of cheese without
the adjunct. Consistency of flavor quality is a major goal of the cheese maker.
Not surprisingly, reduced-fat varieties of cheese more closely mimic the full-fat
counterpart if the same adjunct is used in both cheeses.
VII. ASSESSMENT OF MICROBIOLOGICALLY INDUCED
DEFECTS IN CHEESE
It is difficult at times to assess quality problems occurring with cheese. A thor-
ough knowledge of all aspects of cheese making is required for detective work
Cheese Products 373
necessary to determine cause and effect relationships that may lead to a cheese
quality problem. Foremost is identification of the problem. Is the problem really
microbially related or is it the result of mechanistic shortcomings of manufacture?
For example, openings in cheese can be a result of either pressing cold curd
(mechanical) or gas formation by heterofermentative bacteria.
Second, if the problem is microbially induced, how did the organism gain
access to the product and is the problem exacerbated by the manufacturing proto-
col, handling, storage, pH, or composition of cheese? For example, residual sugar
in cheese because of incomplete fermentation by the starter can be fermented by
contaminating heterofermentative bacteria leading to gassy cheese. Incomplete
fermentation, in turn, can result from a change in composition of starter because
of improper starter preparation. Perhaps cheese was cooled prematurely, too
much salt was added, or bacteriophage killed the starter. Regardless of circum-
stances, a contaminating organism must be present and must grow. If the microor-
ganism is present but does not grow, there is no problem. Many legal questions
have arisen because of this simple concept.
The problem results from growth of a microorganism. Perhaps, had cheese
not been temperature abused, the microorganism would not have grown! Cheese
is not made in a sterile environment. It is inevitable that contaminating microor-
ganisms will be present in cheese. It is not inevitable that they will cause a prob-
lem in cheese.
Prevention of undesirable growth of microorganisms in cheese involves
four steps: (1) Keep the microorganism out of milk or prevent its growth in milk
(hygiene on the farm, quickly cooling the milk, short time between milking and
cheese making). (2) Kill the bacteria (pasteurization). (3) Manufacture the cheese
to prevent contamination (dairy plant hygiene). (4) Create an environment within
the cheese so that if the microorganism is present, its growth will be limited
(proper pH, salt, fermentation of all sugar, low storage temperature). However,
the most universally accepted (but not always properly practiced) method of pre-
venting defects caused by microorganisms is sanitation. In this regard, develop-
ment of biofilms is important.
Many bacteria can form biofilms or can become associated with them. Bio-
films consist of microorganisms immobilized at a surface, typically embedded
in an organic polymer matrix of bacterial origin (Marshall, 1992). Biofilms can
develop on almost any wet surface (equipment) (Criado et al., 1994). Microorgan-
isms attach to the surface or to other organic material already attached to the
surface, excrete copious amounts of extracellular polymers, and grow vigorously,
creating a biofilm. Bacteria can form biofilms within a few hours of initial attach-
ment to a surface. As the biofilm becomes thicker, the outer layer is sloughed
off as the result of turbulence (e.g., milk stirring in a vat). Microorganisms within
sloughed-off pieces contaminate milk. Other organisms can also attach to the
biofilm. Sanitizers are less effective against biofilms, because the sanitizer reacts
only with the outer layer and extracellular polymers protect microorganisms.
374 Johnson
Therefore biofilms must be removed before sanitizers are applied. The cleaning
regimen becomes paramount in controlling bacterial contamination (see also
Chap. 14).
A. Molds
Airborne mold spores are ubiquitous, but, upon germination, they require oxygen
to grow and sporulate. Therefore, mold growth on the surface of cheeses exposed
to air is to be expected. Molds are not supposed to grow on cheeses that are
vacuum packaged, but they sometimes do. Molds tend to grow on cheese where
pockets of air exist between the packaging material and cheese surface (Hocking
and Faedo, 1992). Growth is limited by the amount of residual oxygen. Low
oxygen levels may dictate species of molds found. The most common molds
found on vacuum-packaged Cheddar cheeses are Penicillium spp. (especially P.
commune, a blue mold), and Cladosporium spp. (especially C. cladosporioides,
a black mold). Other molds found on different cheeses include Aspergillus, Fu-
sarium, Mucor, Scopulariopsis, and Verticillium. Penicillium spp. appear to be
the dominant type of molds that grow on cheeses (Lund et al., 1995). P. commune
is the most widespread and frequently occurring species found on all cheese types
and in smear of surface-ripened cheeses (Lund et al., 1995). Although Aspergillus
spp. and Penicillium spp. are the dominant fungi isolated from air in cheese
plants, Penicillium spp. are the dominant fungi isolated from cheese with very
low levels of Aspergillus also being present.
Potassium sorbate and natamycin are used to control mold growth. Sorbate-
resistant strains of Penicillium metabolize sorbic acid to yield 1,3-pentadiene,
which has a kerosene-like odor (Marth et al., 1966). If sorbic acid is added to
the cheese and the cheese is made into processed cheese, the sorbate is diluted.
Sensitive strains are then able to grow and may produce 1,3-pentadiene. The
maximum amount of sorbic acid permitted for use in cheese is 0.3% by weight
(Code of Federal Regulations, 1995), which is not enough to inhibit all strains
of Penicillium but adequate to inhibit Aspergillus spp. (Liewen and Marth, 1984).
In cheeses with a rind (e.g., Gouda, Parmesan), a polymer coating is applied
to prevent mold contamination and for appearance. Sorbates or natamycin are
incorporated into the coating. Sorbates diffuse into cheese and may cause off-
flavors, but natamycin diffuses very little and does not give cheese an objection-
able flavor (de Ruig and van den Berg, 1985).
B. Yeasts
Although growth of yeasts is desirable in surface-ripened and some mold-ripened
cheeses, it is not desirable in most other varieties. The heterofermentative meta-
bolic activity (alcohol and CO
2
) of yeasts sometimes makes them particularly
Cheese Products 375
easy to identify as spoilage organisms even though visible colonies are not ob-
served. The cheese tastes yeasty, a taste reminiscent of raw fermented bread
dough (Horwood et al., 1987). But not all contaminating yeasts produce the typi-
cal yeasty smell. Some very proteolytic yeasts produce stinker cheeses. The smell
resembles that of rotten eggs and is often associated with white spots on the
cheese surface. Lipolytic activity can lead to rancid flavors (free fatty acids), and
the combination of alcohols and free fatty acids can lead to fruity flavors. Al-
though yeasts are commonly associated with slimy surface defects, other putre-
factive organisms such as Pseudomonas spp. and Enterococcus spp. contribute
greatly to the defect. A major factor contributing to growth of yeast, or any con-
taminating organism, is a wet cheese surface. This situation can occur for several
reasons. As cheese matures, proteolysis results in release of moisture held by the
protein network. If cheese is warmed or if it is ripened at greater than 7–8°C,
moisture collects at the surface of cheese; that is, the cheese ‘‘sweats.’’ Moisture
(serum) laden with potential nutrients (lactic acid, dissolved peptides, amino
acids) accumulates between the packaging material and cheese, setting up an
ideal situation for rapid microbial growth. Cheese must first be contaminated.
Excellent plant hygiene is necessary, because yeasts are common contaminants
in the dairy plant environment (wet surfaces, spilled milk, whey). A major source
of yeasts is brines (Kaminarides and Laskos, 1992; Viljoen and Greyling, 1995),
and thus brined cheeses tend to be more prone to yeast contamination. In addition,
the high salt at the surface of the cheese draws moisture, creating an environment
that favors yeasts. The most frequently isolated yeasts are Candida spp., Y. lipo-
lytica, K. marxianus, G. candidum, D. hansenii, and Pichia spp. (Fleet, 1990;
Hocking and Faebo, 1992; Rohm, 1992; Viljoen and Greyling, 1995).
Yeasts and molds are common on the surface of rind cheeses, a large group
of traditional European cheeses. These are cheeses that are not covered or pack-
aged but rather allowed to mature ‘‘in air.’’ The humid conditions of storage and
high-salt environment at the surface (most are brined cheeses) create conditions
selective for yeasts and molds. However, with these cheeses, growth of mold and
yeasts is expected if not demanded.
C. Gassy Defects in Cheese
In Swiss, Gouda, Havarti, Roquefort, and similar varieties of cheese, the con-
trolled development of gas by bacteria during maturation is desired. The result
of gas formation in these cheeses is development of eyes (Swiss, Gouda) and
expansion of preexisting mechanical openings deliberately formed during manu-
facture. In any cheese, however, gas formation can lead to undesirable develop-
ment of slits, small round eyes (sweet holes), or blown, ‘‘puffy’’ packages.
Whether a slit or a sweet hole develops is determined by physical properties of
cheese. Eyes are formed if cheese can be deformed without fracturing. This prop-
376 Johnson
erty is determined by cheese composition, temperature of cheese, rate of gas
formation, and, most importantly, pH and degree of proteolysis (Grappin et al.,
1993; Luyten et al., 1991).
In general, a minimum population on the order of 10
6
colony-forming units
per gram is necessary before openness from gas production occurs (Martley and
Crow, 1996). Nonstarter flora most often associated with slit formation in cheese
are obligate heterofermentative lactobacilli, C. tyrobutyricum, and facultative lac-
tobacilli. Others encountered but far less often are coliforms, yeasts, ‘‘wild’’
propionibacteria, and Leuconostoc. Incidence of slits or blown cheese and caus-
ative organism is reflective of microbial quality of milk, overall dairy plant hy-
giene, heat treatment given milk, post–heat-treatment contamination, rate and
extent of acid development, residual sugar, cheese environment, pH, and redox
potential. Pasteurization is very effective at killing all coliforms, leuconostocs,
and most strains of lactobacilli and greatly reducing the level of all microorgan-
isms except clostridial spores.
Fermentation of residual sugar (lactose or galactose) is a common source
of carbon dioxide in cheese (Fig. 1). The level of sugar and speed at which it
is eliminated by homofermentative starter is critical. Slow starter activity and
incomplete fermentation by thermophilic starters are chief causes of residual
Figure 1 Slits in mozzarella cheese caused by fermentation of residual lactose by L.
fermentum.
Cheese Products 377
sugar. S. thermophilus and Lb. delbrueckii subsp. bulgaricus do not ferment the
galactose moiety of the lactose molecule and release it into cheese. Addition of
mesophiles or Lb. helveticus to the starter can eliminate galactose from cheese.
However, in pasta filata cheeses, the heat treatment given cheese can greatly
reduce the level of starter. The starter must be able to ferment sugar at the low
temperature (7°C) at which the cheese is stored, an unlikely possibility with ther-
mophilic starter.
Cometabolism of citric and lactic acids by facultative lactobacilli, Lb. casei,
and Lb. plantarum, is another source of carbon dioxide (Fryer et al., 1990; Laleye
et al., 1987; Lindgren et al., 1990; Thomas, 1987a). Because facultative lactoba-
cilli are ubiquitous in cheese, their metabolism is regarded as the cause of tiny
slits in cheese when no other potential gas-forming bacteria are found.
Lactic acid fermentation by propionibacteria and clostridia is also a major
source of gas in cheese. These organisms are regarded as the culprits in late
blowing of cheese. As cheese ages, extensive proteolysis results in an increase
in pH and release of amino acids, which stimulate their growth. Although many
strains of clostridia can ferment lactic acid, C. tyrobutyricum is probably the only
one that is significant in cheese (Klijn et al., 1995) (Fig. 2).
Other minor contributors to gas formation in cheese are amino acid catabo-
lism (nonstarter lactobacilli, propionibacteria, Lc. lactis subsp. lactis) and the use
Figure 2 ‘‘Blown’’ provolone cheese contaminated with C. tyrobutyricum.
378 Johnson
of urea by streptococci (Martley and Crow, 1996). However, decarboxylation of
glutamic acid into carbon dioxide and 4-aminobutyric acid is the main source of
eye and split formation in cheese made with a particular thermophilic starter
composed of S. thermophilus and Lb. helveticus (Zoon and Allersma, 1996).
D. Discoloration in Cheese
Color is an important sensory attribute of cheese, and consumers avoid cheese
that is discolored. Annatto-colored cheeses (Cheddar, Colby) are susceptible to
light-induced, oxidation, which turns affected areas pink (Hong et al., 1995).
Govindarajan and Morris (1973) reported that hydrogen sulfide produced from
amino acid metabolism by nonstarter bacteria in cheese is responsible for forma-
tion of a pink precipitate of norbixin, a component of annatto. Cheese color can
also be bleached under acid conditions but the color returns as the pH of the
cheese increases during maturation. This defect is common when whey is en-
trapped between curd particles (mechanical openings). Lactose in whey is fer-
mented, forming localized areas of low pH (H110215) and consequently bleached
color. Color of non–annatto-colored cheeses is influenced by what the animal
ate (more grass a more yellow color), fat content (more yellow cheese), homoge-
nization (whiter cheese), and especially pH. At low pH (H110215), casein molecules
aggregate and diffract light (makes the cheese white). As the pH increases, casein
aggregates become more separated and the color becomes more yellow or gray.
In skim milk cheeses, cheese will become translucent.
Parmesan, Romano, and Swiss cheeses are susceptible to a defect known
as pink ring. As the name implies, a pink ring develops around the outside of
the cheese and can progressively develop throughout the cheese from the outside
to the inside. The pink becomes brown with age. It is most common in air-ripened
cheeses (non–vacuum-sealed cheese). Shannon et al. (1977) implicated metabo-
lism of tyrosine by certain strains of Lb. helveticus and Lb. delbruekii subsp.
bulgaricus as the cause for the pink ring defect. The presence of oxygen appears
to be necessary for development of the defect. It is more common in stirred-curd
direct-salted Parmesan cheese (nonbrined) in which air is incorporated during
the lengthy stir-out and is not subsequently removed by fermentation or vacuum
packaging. Mallaird browning has also been implicated in pinking in which resid-
ual galactose is present in cheese because of metabolism of thermophilic starters.
Nonstarter lactobacilli may ferment residual sugar, creating compounds that
eventually form the pink to brown color.
Brown or red spots in Swiss cheese have been traced to growth of certain
strains of ‘‘wild props,’’ Pr. thoenii (Baer and Ryba, 1992) or Pr. jensenii (Britz
and Riedel, 1994). White spots, which are also soft, have been observed on brine-
salted cheeses and have been traced to growth of enterococci or yeasts. Entero-
cocci may be in cheese rather than cheese being contaminated via brine. The
Cheese Products 379
cheese environment (higher pH, lower acid, lower salt content) may determine
the potential for growth of enterococci.
E. Calcium Lactate Crystals
White crystalline material on the surface of Cheddar and Colby cheese is often
confused with mold growth. It is, however, calcium lactate, a racemic mixture
of L(H11001) and D(H11002)-lactic acid (Severn et al., 1986) (Fig. 3). Lactose fermentation
by Lactococcus spp. produces L(H11001)-lactic acid. Growth of nonstarter lactic acid
bacteria, particularly lactobacilli and pediococci, racemize L(H11001)-lactic acid to
D(H11002)-lactic acid (Thomas and Crow, 1983). Crystals can also form in the interior
of cheese but generally form where moisture (serum) can collect (Johnson et al.,
1990b). Not all crystalline material is calcium lactate but may be composed of
tyrosine (from proteolysis) or calcium phosphate (Conochie and Sutherland,
1965). Recently, crystals of only L(H11001)-lactic acid have been isolated from Ched-
dar cheese (M. Johnson, personal observation), and the cheese does not contain
high levels of lactobacilli or pediococci. Manufacturing practices allowing for
high calcium and lactic acid in cheese exacerbate calcium lactate crystallization.
Loose packaging which allows moisture to collect at the surface of the cheese
also leads to higher incidence of calcium lactate crystals.
Figure 3 Calcium lactate crystals on Cheddar cheese.
380 Johnson
REFERENCES
Atlas RM, Bej AK. Polymerase chain reaction. In: Gerhardt P, Murray RGE, Wood WA,
Krieg NR, eds. Methods for General Molecular Bacteriology. Washington, DC:
American Society for Microbiology, 1994.
Baer A, Ryba I. Serological identification of propionibacteria in milk and cheese samples.
Int Dairy J 2:299, 1992.
Bertozzi L, Panari G. Cheeses with appellation d’origine contro?le′e (AOC): factors that
affect quality. Int Dairy J 3:297, 1993.
Besancon X, Smet C, Chabalier C, Rivemale M, Reverbel JP, Ratomahenina R, Galzy P.
Study of surface yeast flora of Roquefort cheese. Int Dairy J 17:9, 1992.
Bodyfelt FW. Sensory and shelf-life characteristics of cottage cheese treated with sorbic
acid. Proceedings of the Second Biennial Marschall International Cheese Confer-
ence, Madison, WI, 1981, pp 406–425.
Bodyfelt FW, Tobias J, Trout GM. Sensory evaluation of cultured milk products. In: The
Sensory Evaluation of Dairy Products New York: Van Nostrand Reinhold, 1988,
p 227.
de Boer E, Kuik D. A survey of the microbiological quality of blue-veined cheeses. Neth
Milk Dairy J 41:227, 1987.
Britz TJ, Riedel K-HJ. Propionibacterium species diversity in Leerdammer cheese. Int J
Food Microbiol 22:257, 1994.
Brockelhurst TF, Lund BM. Microbiological changes in cottage cheese varieties during
storage at 7°C. Food Microbiol 2:207, 1985.
Carini S. Lysozyme: activity against clostridia and use in cheese production—a review.
Microbiol Aliments Nutr 3:299, 1995.
Chen JH, Hotchkiss JH. Effect of dissolved carbon dioxide on the growth of psychro-
trophic organisms in cottage cheese. J Dairy Sci 74:2941, 1991.
Chen JH, Hotchkiss JH. Growth of Listeria monocytogenes and Clostridium sporogenes
in cottage cheese in modified atmosphere packaging. J Dairy Sci 76:972, 1993.
Code of Federal Regulations. Title 21. Part 133. Cheeses and related cheese products.
Rockville, MD: Office of the Federal Register National Archives and Records Ad-
ministration, 1995, p 295.
Coghill D. The ripening of blue vein cheese: a review. Aust J Dairy Technol 34:72, 1979.
Collins EB. Resistance of certain bacteria to cottage cheese cooking procedures. J Dairy
Sci 44:1989, 1961.
Conochie J, Sutherland BJ. The nature and cause of seaminess in cheddar cheese. J Dairy
Res 32:35, 1965.
Cousin MA. Presence and activity of psychrotrophic microorganisms in milk and dairy
products: a review. J Food Prot 45:172, 1982.
Crow VL, Coolbear T, Holland R, Pritchard GG, Martley FG. Starters as finishers: starter
properties relevant to cheese ripening. Int Dairy J 3:423, 1993.
Criado M, Sua′rez B, Ferreiro′s CM. The importance of bacterial adhesion in the dairy
industry. Food Technol 48(2):123, 1994.
Daeschel MA. Antimicrobial substances from lactic acid bacteria for use as food preserva-
tives. Food Technol 43(1):164, 1989.
Cheese Products 381
Davis PA, Babel FJ. Slime formation on cottage cheese. J Dairy Sci 37:176, 1954.
de Ruig WG, van den Berg G. Influence of the fungicides sorbate and natamycin in cheese
coatings on the quality of the cheese. Neth Milk Dairy J 39:165, 1985.
Drake M, Small CL, Spence KD, Swanson BG. Rapid identification of Lactobacillus sp.
in dairy products using the polymerase chain reaction. J Food Prot 59:1031, 1996.
Eliskases-Lechner F, Ginzinger W. The yeast flora of surface-ripened cheeses. Milchwis-
senschaft 50:458, 1995.
El Soda M. Accelerated maturation of cheese. Int Dairy J 3:531, 1993.
Emmons DB, Tuckey SL. Cottage Cheese and Other Cultured Milk Products. New York:
Pfizer, 1967.
Fedio WM, Ozimek L, Wolfe FH. Gas production during the storage of Swiss cheese.
Milchwissenschaft 49:3, 1994.
Fitzsimmons NA, Cogan TM, Condon S, Beresford T. Phenotypic and genotypic charac-
terization of non-starter lactic acid bacteria in mature cheddar cheese. Appl Environ
Microbiol 65:3418, 1999.
Fleet GH. A review: yeasts in dairy products. J Appl Bacteriol 68:199, 1990.
Fox PF, McSweeney PLH, Lynch CM. Significance of non-starter lactic acid bacteria in
cheese. Aust J Dairy Technol 53:83, 1998.
Franklin JG, Sharpe ME. The incidence of bacteria in cheese milk and cheddar cheese
and their association with flavor. J Dairy Res 30:87, 1963.
Fryer TF, Sharpe ME, Reiter B. Utilization of milk citrate by lactic acid bacteria and
‘‘blowing’’ of film wrapped cheese. J Dairy Res 37:17, 1970.
Godinho M, Fox PF. Effect of NaCl on the germination and growth of Penicillium roque-
forti. Milchwissenschaft 36:205, 1981.
Golding NS. Gas requirements of mold 1. Penicillium roqueforti. J Dairy Sci 20:319,
1937.
Govindarajan S, Morris HA. Pink discoloration in cheddar cheese. J Food Sci 38:675,
1973.
Grappin R, Lefier D, Dasen A, Pochet S. Characterizing ripening of Gruye`re de Comte′:
influence of time X temperature and salting conditions on eye and slit formation.
Int Dairy J 3:313, 1993.
Griffith R, Hammond EG. Generation of Swiss cheese flavor compounds by reactions of
amino acids with carbonyl compounds. J Dairy Sci 72:604, 1989.
Griffiths MW, Phillips JD, Muir DD. Thermostability of proteases and lipases from a
number of species of psychrotrophic bacteria of dairy origin. J Appl Bacteriol 50:
289, 1981.
Grill H Jr, Patton S, Cone JF. Aroma significance of sulfur compounds in surface-ripened
cheese. J Dairy Sci 49:409, 1966.
Herman LMF, De Ridder HFM, Vlaemynck GMM. A multiplex PCR method for the
identification of Listeria spp. and Listeria monocytogenes in dairy samples. J Food
Prot 58:867, 1995.
Hettinga DH, Reinbold GW, and Vedamuthu ER. The split defect of Swiss cheese. 1.
Effect of strain of Propionibacterium and wrapping material. J Milk Food Technol
37:322, 1974.
Hocking AD, Faebo M. Fungi causing thread mould spoilage of vacuum packaged cheddar
cheese during maturation. Int Dairy J 16:123, 1992.
382 Johnson
Hofherr LA, Glatz BA, Hammond EG. Mutagenesis of strains of Propionibacterium to
produce cold-sensitive mutants. J Dairy Sci 66:2482, 1983.
Hong CM, Wendorff WL, Bradley RL. Factors affecting light-induced pink discoloration
of annatto-colored cheese. J Food Sci 60:94, 1995.
Horwood JF, Stark W, Hull RR. A fermented, yeasty flavour defect in cheddar cheese.
Aust J Dairy Technol 42:25, 1987.
Hull R, Toyne S, Haynes I, Lehman F. Thermoduric bacteria: a reemerging problem in
cheesemaking. Aust J Dairy Technol 47:91, 1992.
Hutkins RW, Morris HA. Carbohydrate metabolism by Streptococcus thermophilus: a re-
view. J Food Prot 50:876, 1987.
Iya KK, Frazier WC. The yeast in the surface smear of brick cheese. J Dairy Sci 32:475,
1949.
Johnson EA, Nelson JH, Johnson ME. Microbiological safety of cheese made from heat-
treated milk. Part II. Microbiology. J Food Prot 53:519, 1990a.
Johnson ME, Chen CM. Technology of manufacturing reduced-fat cheddar cheese. In:
Malin EL, Tunick MH, eds. Chemistry of Structure-Function Relationships in
Cheese. New York: Plenum Press, 1995, p 331.
Johnson ME, Olson NF. Non-enzymatic browning of mozzarella cheese. J Dairy Sci 68:
3143, 1985.
Johnson ME, Riesterer BA, Chen C, Tricomi B, Olson NF. Effect of packaging and storage
conditions on calcium lactate crystallization on the surface of cheddar cheese. J
Dairy Sci 73:3033, 1990b.
Kaminarides SE, Laskos NS. Yeasts in factory brine of feta cheese. Aust J Dairy Technol
47:68, 1992.
Karahadian C, Lindsay RC. Contribution of Penicillium sp. to the flavors of Brie and
Camembert cheese. J Dairy Sci 68:1865, 1985.
Kelly CD, Marquardt JC. The influence of hydrogen ion concentration and salt on the
surface flora of Limburger cheese. J Dairy Sci 23:309, 1939.
Kindstedt PS. Effect of manufacturing factors, composition, and proteolysis on the func-
tional characteristics of mozzarella cheese. Crit Rev Food Sci Nutr 33:167, 1993.
Kinsella JE, Hwang D. Biosynthesis of flavors by Penicillium roqueforti. Biotechnol
Bioeng 18:927, 1976.
Klijn N, Nieuwendorf FFJ, Hoolwerf JD, van der Waals CB, Weerkamp AH. Identification
of Clostridium tyrobutyricum as the causative agent of late blowing in cheese by
species-species PCR amplification. Appl Environ Microbiol 61:2919, 1995.
Laleye LC, Simard RE, Lee B-H, Holley RA, and Giroux RN. Involvement of heterofer-
mentative lactobacilli in development of open texture in cheeses. J Food Prot 50:
1009, 1987.
Lane CN, Fox PF. Contribution of starter and adjunct lactobacilli to proteolysis in cheddar
cheese during ripening. Int Dairy J 6:715, 1996.
Langsrud T, Reinbold GW. Flavor development and microbiology of Swiss cheese—a
review. J Milk Food Technol 37:26, 1974.
Liewen MB, Marth EH. Inhibition of penicillia and aspergilli by potassium sorbate. J Food
Prot 47:554, 1984.
Liewen MB, Marth EH. Growth and inhibition of microorganisms in the presence of sorbic
acid: a review. J Food Prot 48:364, 1985.
Cheese Products 383
Lindgren SE, Axelsson LT, McFeeters RG. Anaerobic L-lactate degradation by Lactoba-
cillus plantarum. FEMS Microbiol Lett 66:209, 1990.
Lubert DJ, Frazier WC. Microbiology of the surface ripening of brick cheese. J Dairy Sci
38:981, 1955.
Lund F, Filtenborg O, Frisvad JC. Associated mycoflora of cheese. Food Microbiol 12:
173, 1995.
Luyten H, van Fleet T, Walstra P. Characterization of the consistency of Gouda cheese:
rheological properties. Neth Milk Dairy J 45:33, 1991.
Mans J. Looking for Mr. Longlife. Dairy Foods 96:65, 1995.
Marshall KC. Biofilms: an overview of bacterial adhesion, activity, and control at surfaces.
ASM News 58:202, 1992.
Marth EH. Spoilage of cottage cheese by psychrophilic microorganisms. Cultured Dairy
Prod J 5:14, 1970.
Marth EH, Capp CM, Hasenzahl L, Jackson HW, Hussong RV. Degradation of potassium
sorbate by Penicillium sp. J Dairy Sci 49:197, 1966.
Martley FG, Crow VL. Interactions between non-starter microorganisms during cheese
manufacture and ripening. Int Dairy J 3:461, 1993.
Martley FG, Crow VL. Open texture in cheese: the contributions of gas production by
microorganisms and cheese manufacturing practices. J Dairy Res 63:489, 1996.
Masui K, Yamada T. French Cheeses. New York: DK Publishing, 1996.
McSweeney PLH, Fox PF, Lucey JA, Jordan KN, Cogan TM. Contribution of the indige-
nous microflora to the maturation of cheddar cheese. Int Dairy J 3:613, 1993.
Molimard P, Spinnler HE. Review: compounds involved in the flavor of surface mold-
ripened cheeses: origins and properties. J Dairy Sci 79:169, 1996.
Morris HA. Blue-Veined Cheeses. New York: Pfizer, 1981.
Morris HA, Jezeski JJ, Combs WB, Kuramoto S. Free fatty acids, tyrosine, and pH changes
during ripening of blue cheese made from variously treated milks. J Dairy Sci 46:
1, 1963.
Mukherjee KK, Hutkins RW. Isolation of galactose-fermenting thermophilic cultures and
their use in the manufacture of low browning mozzarella cheese. J Dairy Sci 77:
2839, 1994.
Nooitgedagt AJ, Hartog BJ. A survey of the microbiological quality of Brie and Camem-
bert cheese. Neth Milk Dairy J 42:57, 1988.
Olson NF. Ripened Semisoft Cheeses. New York: Pfizer, 1969.
Olson NF. The impact of lactic acid bacteria on cheese flavor. FEMS Microbiol Rev 87:
131, 1990.
Peterson SD, Marshall RT. Nonstarter lactobacilli in cheddar cheese: a review. J Dairy
Sci 73:1395, 1990.
Purko M, Nelson WO, Wood WA. The associative action between certain yeasts and
Bacterium linens. J Dairy Sci 34:699, 1951.
Reinbold GW. Swiss Cheese Varieties. New York: Pfizer, 1972.
Roberts RF, Zottola EA. Shelf-life of pasteurized process cheese spreads made from ched-
dar cheese manufactured with a nisin producing strain. J Dairy Sci 76:1829, 1993.
Rohm H, Eliskases-Lechner F, Bra¨uer M. Diversity of yeasts in selected dairy products.
J Appl Bacteriol 72:370, 1992.
Salama MS, Sandine WE, Giovannoni SJ. Isolation of Lactococcus lactis subsp. cremoris
384 Johnson
from nature by colony hybridization with rRNA probes. Appl Environ Microbiol
59:3941, 1993.
Sandine WE, Anderson AW, Elliker PR. How to avoid floating curd when making cottage
cheese. Food Engin 29:84, 1957.
Seitz EW, Sandine WE, Elliker PR, Day EA. Distribution of diacetyl reductase among
bacteria. J Dairy Sci 46:186, 1963.
Severn DJ, Johnson ME, Olson NF. Determination of lactic acid in cheddar cheese and
calcium lactate crystals. J Dairy Sci 69:2027, 1986.
Shannon EL, Olson NF, Deibel RH. Oxidative metabolism of lactic acid bacteria associ-
ated with pink discoloration in Italian cheese. J Dairy Sci 60:1693, 1977.
Smith DA, Mikolajcik EM, Lindamood JB. Causative organisms and chemical nature of
the Swiss cheese rind rot defect. Cultured Dairy Products J 22:9, 1987.
Sofos JN, Busta FF. Sorbates. In: Branen AL, Davidson PM, eds. Antimicrobials in Foods.
New York: Marcel Dekker, 1983, p 141.
Stadhouders J, Spoelstra SF. Prevention of the contamination of raw milk by making good
silage. Bulletin of the IDF # 251:24, 1990.
Tanaka NE, Traisman E, Plantinga P, Finn L, Flom W, Meske L, Guggisberg J. Evaluation
of factors involved in antibotulinal properties of pasteurized process cheese spreads.
J Food Prot 49:526, 1986.
Ter Steeg PF, Cuppers HGAM, Hellemons JC, Rijke G. Growth of proteolytic Clostridium
botulinum in process cheese products: 1. Data acquisition for modeling the influence
of pH, sodium chloride, emulsifying salts, fat dry basis, and temperature. J Food
Prot 58:1091, 1995.
Thomas TD. Acetate production from lactate and citrate by non-starter bacteria in cheddar
cheese. NZJ Dairy Sci Technol 22:25, 1987a.
Thomas TD. Cannibalism among bacteria found in cheese. NZJ Dairy Sci Technol 22:
215, 1987b.
Thomas TD, Crow VL. Mechanism of D(H11002)-lactic acid formation in cheddar cheese. NZJ
Dairy Sci Technol 18:131, 1983.
Viljoen BC, Greyling T. Yeasts associated with cheddar and Gouda making. Int Dairy J
28:79, 1995.
Zoon P, Allersma D. Eye and crack formation in cheese by carbon dioxide from decarbox-
ylation of glutamic acid. Neth Milk Dairy J 50:309, 1996.
12
Fermented By-Products
David R. Henning
South Dakota State University
Brookings, South Dakota
I. INTRODUCTION
The manufacture of cheese from milk generates approximately 9 lb of whey for
each 1 lb of cheese. This by-product of cheese manufacturing has posed serious
disposal problems for many cheese makers. Table 1, shows that sweet whey,
derived from most rennet-coagulated cheeses, is approximately 93% water and
6.35% solids, with about 76% of the solids being lactose. Acid whey, derived
from acid-coagulated cheeses, is compositionally similar to sweet whey except
it has higher lactic acid and ash contents. Using a ratio of 9 lb of whey produced
for each 1 lb of cheese, it can be calculated that approximately 74 billion lb of
whey was produced in 1998 when U.S. cheese production (including cottage
cheese curd) totaled 8.23 billion lb, according to the National Agricultural Statis-
tical Service, USDA (1999). Approximately 1.18 billion lb of dry whey was
produced for human and animal consumption. This dry whey represents approxi-
mately 25% of the whey solids resulting from cheese manufacture during the
year. The remaining whey solids were used as concentrated whey for human and
animal food (122 million lb), whey protein concentrates (288 million lb), lactose
(469 million lb), partially delactosed and demineralized whey (105 million lb),
whey solids in wet blends (37 million lb), fermented whey products (including
ethanol production), sewage disposal, land disposal, or animal feed.
As cheese-manufacturing plants increase in size, the use of sewage treat-
ment facilities, land disposal, and return of whey to farmers become less viable
options. Whey disposal through sewage systems can overload the treatment facili-
ties by its high biochemical oxygen demand (BOD). The BOD for whey is be-
385
386 Henning
Table 1 Composition of Some Commercial Fluid and Dried Wheys
Fluid Fluid Dried Dried
sweet acid Condensed sweet acid
Component whey
a
whey
b
acid whey whey whey
Total solids, % 6.35 6.5 64.0 96.5 96.0
Moisture, % 93.70 93.50 33.5 3.5 4.0
Fat, % 0.5 0.04 0.6 0.8 0.6
Protein total, % 0.8 0.75 7.6 13.1 12.5
Lactose, % 4.85 4.90 34.9 75.0 67.4
Ash, % 0.50 0.80 8.2 7.3 11.8
Lactic acid
c
, % 0.05 0.40 12.0 0.2 4.2
a
From Cheddar cheese.
b
From cottage cheese.
c
Estimated true lactic acid after substituting basic acidity.
Source: Adapted from Mavropoulou and Kosikowski, 1973.
tween 30,000 and 60,000 ppm (Sienkiewicz, 1990). A plant discharging 1000
gal of whey to a sewage system creates a load equivalent to that of more than
1000 domestic users.
The component of whey that poses the greatest disposal problem is lactose.
Ultrafiltration of whey in production of whey protein concentrates results in a
deproteinized effluent that retains nearly the same level of BOD as the original
whey. To deal effectively with the whey problem, lactose must be removed from
the waste stream and converted to nonpolluting products. Several industrial prod-
ucts are derived from whey. Refined food-grade lactose can be used in the phar-
maceutical industry for compression with additives into pills, used as carriers for
antibiotic powder, or used in infant foods. Some industrial products derived from
lactose by chemical processes are lactulose, lactitol, lactitol palmitate, lactosyl
urea, lactobionic acid, galactooligosaccharides, and galactose/glucose syrups
(Yang and Silva, 1995). This chapter describes some of the fermentation options
that convert lactose and whey into products that can relieve the burden of whey
disposal for cheese manufacturers. Production of methane from lactose and dairy
wastes is discussed in Chapter 18. The discussions in this chapter are grouped
into human food products and industrial products.
Fermentation of lactose is one form of energy-yielding microbial metabo-
lism in which the organic substance, lactose, is incompletely oxidized and another
organic compound acts as the electron acceptor. The microbial fermentation pro-
cesses do not result in stoichiometric conversion of lactose into the desired prod-
ucts, because the microorganisms use lactose as a source of carbon for cellular
processes.
Fermented By-Products 387
Fermentation products from whey were reviewed by Marth (1970). Since
that review, the most significant change in the techniques of whey fermentation
processes has been membrane processing of whey to customize the feedstock
for fermentations. Ultrafiltration allows separation of proteins from lactose-rich
permeate. Reverse osmosis allows concentration of lactose to more usable levels
and thereby assists in obtaining desired fermentation endproducts at levels that
make economic recovery possible; for example, to obtain a beer with 4–5% etha-
nol instead of 2–2.5%. This increased ethanol level makes the distillation process
more cost efficient. The use of electrodialysis can reduce the mineral level in
concentrated whey and permeate preparations. High mineral content of concen-
trated whey retards microbial growth.
Anaerobic digestion of whey or whey permeate is discussed in Chapter 18.
The primary product from the anaerobic digestion is biogas, a mixture of CO
2
and CH
4
with small amounts of H
2
and H
2
S.
II. WHEY FERMENTATION BY-PRODUCTS
A. Food Products
1. Wine
Whey wines can be made from whey or whey permeates with a final alcohol
content of approximately 2.25–14.0%. The fermentation of lactose to carbon di-
oxide and ethanol results in 0.54 g of ethanol for each gram of lactose. The
alcohol content of a wine derived from cheese whey would be approximately
2.4%, assuming there is an efficiency of approximately 90% conversion of the
lactose to ethanol.
Kosikowski and Wzorek (1986) prepared whey wines from a reconstituted
acid whey powder. They removed the proteins by ultrafiltration. The permeate
had a total solids concentration of 26–28% before demineralizing to a mineral
level of 1% or less. Any residual whey taints after fermentation were removed
with bentonite and charcoal at the levels of 5 and 2 g/L, respectively.
Processes for whey wine production before the advent of ultrafiltration were
limited to a low alcohol percentage in the final wine. The lactose level of the
fermentable whey had to be increased to about twice the level of the desired
alcohol content of the finished product. Without mineral removal techniques,
growth of most ethanol-producing yeasts and bacteria would be inhibited. To
overcome these limitations, whey was fortified with other fermentable car-
bohydrates. According to Sienkiewicz and Riedel (1990), the most common
carbohydrate additives are sucrose and glucose, although honey has been used.
Demineralization of the carbohydrate-fortified whey before fermentation was
recommended by Larson (1976).
388 Henning
2. Whey Champagne
Serwovit, whey champagne, is produced in Poland (Sienkiewicz and Riedel,
1990). The starting material is deproteinated acid whey, sucrose and caramelized
sugar, a dry yeast, fruit flavoring, and water. Yeast and fruit flavorings are added
to the pasteurized base of whey, water, and sugars. The mixture is bottled and
the fermentation occurs in the bottle at 18°Cin8–12h.
3. Whey Beers
Whey beers are produced with and without malt addition (Sienkiewicz and Rie-
del, 1990). Whey has a high mineral content similar to wort obtained from malt
mash. Also, carmelization of the lactose develops a flavor suggestive of dried
malt. The use of beta-galactosidase to hydrolyze lactose provides the brewer’s
yeast with the glucose moiety of lactose, but galactose is generally not fermented.
The use of ultrafiltration to provide a protein-free permeate has improved the
flavor by removing insoluble proteins which have a distinctive flavor. The makers
of whey beers are particularly concerned that all the fat be removed so the foam-
ing ability of beer is not suppressed. Hops are usually brewed into the beer.
A malted whey beer contains a maximum of 30% whey and is brewed with
hops. Bottom-fermenting yeasts are used with this product.
A whey malt beer is a sweeter beverage that contains a maximum of 50%
whey and additional fermentable carbohydrates such as starch and glucose syrup.
Hops are brewed into the beer and the color is adjusted with roasted malt. A top-
fermenting yeast is used. This product is pasteurized and a secondary fermenta-
tion with yeast and added sugar proceeds before bottling.
A whey-nutrient beer is weakly alcoholic. It is brewed from deproteinated
whey and hops and has a mineral mix added to it before fermentation. The product
is pasteurized before bottling.
Elmer and Clark (1982) reported on the use of an 85.0% hydrolyzed whey
permeate as a replacement for 12.2% of the brewing extract in production of
beer. The permeate was produced by reverse osmosis and had approximately
18% total solids. A 50-barrel brew was produced and held for 5 months. Flavor
stability and foam character were similar to those of commercial brews from the
same brewer.
Supplementing mash with lactose and lactase (0.2% of the weight of the
added lactose) gave good results according to Polish workers (Sienkiewicz and
Riedel, 1990).
4. Beer-like Beverages
Russian workers developed two beverages in the late 1960s that contained added
sugar, flavorings, and raisins (Sajanschsehaukas, 1968). Botschyu is brewed with
Fermented By-Products 389
hops and fermented with yeasts; it contains approximately 3.8% alcohol. The
other, Bodrost, is fermented with kefir fungi and lactic acid bacteria.
5. Other Fermented Beverages
Rivella has been a popular sparkling fermented whey beverage with an alpine
herb flavor (Susli, 1948). Introduced in Switzerland in 1952, this product is a
fermented deproteinized whey condensed to a 7:1 concentration. Flavoring and
sugar are added to the concentrate, and it is refiltered, diluted to beverage strength,
and carbonated before bottling.
Gefilus, available in Europe, is an apricot-peach flavored drink prepared
by fermenting a lactose-hydrolyzed cheese whey with a patented strain of Lacto-
bacillus casei ssp. rhamnosum (Lactobacillus GG or Gefilac). The whey drink
contains 10
8
colony-forming units per milliliter of the strain GG. The drink is
accepted by consumers who do not like traditional fermented dairy products
(Salminen et al., 1991).
B. Industrial Products
1. Culture Media
Richardson et al. (1977) pioneered work on the use of fresh Cheddar or Swiss
cheese whey as a low-cost alternative to nonfat dry milk or commercial bacterio-
phage-inhibitory media for propagation of lactic starter cultures for cheese mak-
ers. Incorporation of a phosphate-stimulant blend provided protection for the lac-
tic starter culture organisms against bacteriophage action and provided minerals
and vitamins needed for acceptable activity. The recommended use of the phos-
phated whey medium (PWM) was in a system incorporating pH control. The
fortifying phosphate-stimulant blend consists of 44.4% NaH
2
PO
4
, 42.2%
Na
2
HPO
4
, 8.66% Ardamine ‘‘Yes’’ (a dehydrated yeast autolysate), Yeast Prod-
ucts, Inc., Paterson, NJ, 4.43% NZ Amine NAK (a protein hydrolysate), Quest
International, Norwich, NY, 0.22% MgSO
4
, 0.04% MnSO
4
, and 0.04% FeSO
4
.
The phosphate-stimulant blend is added to liquid Cheddar or Swiss cheese whey
at a rate of 1.17%. The PWM is heated to 89–95°C for 45 min, cooled to 21–
27°C, and inoculated with the desired culture strains. Incubation of the culture
in a specially equipped tank allows monitoring of the pH of PWM and controlled
addition of neutralizing agents such as NH
4
OH, anhydrous ammonia, or NaOH
to maintain the pH in a range of 6.0–6.3.
Starter cultures prepared with the PWM-pH control procedure have grea-
ter activity than those grown in conventional bacteriophage-inhibitory or milk
media. The amounts of PWM-pH control starter culture needed for Monterey
cheese manufacture was 20–33% of the amount of milk medium starter culture.
390 Henning
Cheese made with PWM-pH control was normal in all parameters, including
yield.
Whitehead et al. (1993) reviewed the subject of starter media for cheese
making and introduced the concept of internal neutralization of the lactic acid
produced during starter culture production. The acid-neutralizing components of
the medium can be added as insoluble salts, which dissolve when acid is pro-
duced, or they may be encapsulated in compounds that gradually release neu-
tralizing compounds during acid production. Experiments reported by this group
showed that neutralized starters maintain their activity for longer periods (up to
10 days) than starter cultures prepared in unneutralized milk or phage-inhibitory
media. Trials with the internally neutralized medium in cottage cheese manufac-
ture by Ogden (1981) showed a reduction of 42% in the amount of starter was
possible in comparison to skim milk starter. This work also showed an increase
in curd yield of 2.8%.
2. Ethanol
Several lactose-fermenting yeasts can produce ethanol during the fermentation
of lactose. Strains of Kluyveromyces marxianus (formerly K. fragilis), Torula
cremoris, and Candida kefyr efficiently convert lactose to ethanol. The strain K.
marxianus NRRLY 2415 produced up to 12% ethanol for Kosikowski and
Wzorek (1982) from a demineralized acid whey permeate with 24% lactose in
7–14 days at 30°C. Laboratory studies by Rogosa (1947) indicated a 91% conver-
sion of lactose to alcohol, but Rajagopalan and Kosikowski (1982) were only
able to obtain 84.3% of the theoretical maximum yield, or about 0.45 g of ethanol,
from each gram of lactose.
Commercial whey to ethanol facilities in the United States are based on
the integrated Carbery process developed at Express Dairy in West Cork, Irish
Republic. The ethanol plant was commissioned in April 1978 and is located on
site at a cheese-manufacturing plant that has condensing and drying capabilities.
Cheddar cheese whey is ultrafiltered, with the retentate destined for whey protein
concentrate (WPC) powders and the permeate as a feedstock for the ethanol fer-
menters. A bottom-fermenting yeast culture and fresh permeate are pumped to
one of six 25,000-gallon fermenter vessels. The vessels are similar in design to
those used in English breweries. They have a cone bottom and are 50 ft in height
and 12 ft in diameter. Large compressors inject filtered air into the bottom of
the fermenter tanks. This injection of air prevents the yeast from settling. The
fermentation requires approximately 20 h. The cheese operation generates about
110,000 gallons of permeate per day, so a battery of six 25,000-gallon fermenters
allows one fermenter to be filling, one to be emptied, and four to be in active
fermentation at any time. At the end of fermentation, fermenter contents, which
contain approximately 2.8% alcohol, are centrifuged and the yeast cream is recov-
Fermented By-Products 391
ered. The clear liquid is pumped to a balance tank until it is distilled. After distilla-
tion, the ethanol is 96.5% by volume (Sandbach, 1981). The residue from the still
has a BOD that is reduced to approximately 5–10% that of the whey permeate.
The Carbery process has been improved by several of the whey ethanol
operations in the United States. One improvement is preconcentration of the whey
permeate by reverse osmosis to increase the lactose concentration to obtain a
greater percentage of ethanol in the fermenter.
Although food-grade ethanol can be converted into other products such
as acetic acid, the use for most ethanol is in gasoline blends. National Chem-
ical Products in South Africa initiated whey fermentation in the mid-1970s
for alcohol fuel production. Other countries that produce alcohol fuel from
whey fermentation are Canada, France, Ireland, Japan, the Netherlands, New
Zealand, and the United States. In the United States, the largest whey to alcohol
facility is at the Golden Cheese Company in Corona, CA. This integrated opera-
tion processes more than 2.25 million lb of whey per day and makes more than
150,000 lb of whey protein concentrate human food ingredients and 50,000 gal
of 200-proof (100%) fuel-grade ethanol per week. The ethanol plant has eight
48,000-gal fermenters that are used to batch ferment the lactose to ethanol in
18–30 h. Yeast is recovered from beer (4–5% ethanol) and reused in subsequent
batches for up to 10 times. The beer is collected in two beer wells until it is
heated and distilled. The distillation process uses glycol to form an azeotrope
(Morris, 1986). After distillation of the azeotrope, 200-proof ethanol is obtained.
The residues after distillation are further processed into animal feed proteins. The
BOD level of the waste stream is reported to be less than 10,000 ppm (Ahmed,
1991).
Cheese whey or whey permeate has a relative cost advantage as a substrate
for ethanol production. If permeate is used, costs include transportation, ultrafil-
tration, and concentration. However, the cheese manufacturer avoids the cost of
reducing the BOD of whey at the cheese-making facility. Although corn starch
has been the substrate used for most fuel ethanol in the United States, production
costs of ethanol from corn depend on the price of corn and the value of by-
products associated with the ethanol produced. The 1995 corn to ethanol industry
included 43 plants in 20 states producing 1.4 billion gal of ethanol. This ethanol
from corn used 5.3% of the U.S. corn crop of 1994.
Zhou and coworkers (1992) at the University of Nebraska–Lincoln
developed a cofermentation process to combine whey and corn substrates. The
cost of alcohol production from corn is high relative to whey because of the
value of the corn. Corn represents about half the cost of the ethanol. A pro-
cess that could provide approximately 28% of the fermentable carbohydrates
from whey can positively affect the economics of the process. Also, a whey
ethanol plant is usually limited in capacity by the availability of whey in the
region.
392 Henning
A cofermentation process could use all the whey available and still have
the cost advantages of a large ethanol production facility. Acid or sweet whey
or their permeates can be used as the liquid portion of the corn mash. The cofer-
mentation process requires a staggered inoculation procedure. Lactose fermenta-
tion requires a high level of K. marxianus inoculum followed by the addition of
Saccharomyces cerevisiae for fermentation of the α-amylase–hydrolyzed corn
starch. S. cerevisiae is tolerant of higher alcohol concentrations and can yield a
final concentration of more than 9.5% ethanol in 72 h. The Nebraska process
trials achieved an alcohol yield 29% higher than with corn alone, or 3.3 gal per
bushel of corn.
3. Vinegar
Ethanol produced from whey can be used as a substrate for production of vinegar.
The alcoholic fermentation is terminated when formation of acetic acid starts.
Acetobacter and Gluconobacter species used to convert alcohol to acetic acid
oxidize ethanol, so there must be a plentiful supply of oxygen. There are at least
four industrial methods for conversion of ethanol to acetic acid.
4. Lactic Acid
Lactic acid from cheese whey is produced commercially in Slovakia, Italy, and
the United States. Whereas synthetic production from acetaldehyde or lactonitrile
is cheaper, the low cost of whey makes a large-scale production facility competi-
tive. The starting materials for lactic acid production include rennet and acid
wheys and their permeates. Lactic acid bacteria such as Lactococcus lactis, Lb.
delbrueckii subsp. bulgaricus, Lb. acidophilus, Lb. helveticus, Lb. casei, and
mixed cultures of these organisms have been successfully used to convert lactose
to lactic acid. Fermentation of whey or whey permeate requires enrichment with
approximately 0.5% corn steep liquor, 0.1% glucose, 0.05% beta-galactosidase,
and several other growth factors (Rosenau, 1986). The pH is maintained in the
range of 5–6 by neutralization of the lactic acid with CaCO
3
, Ca(OH)
2
, or 27%
NH
4
OH. After 85–90% of lactose is fermented, usually in 24–48 h, the pH is
adjusted to 12 with Ca(OH)
2
. The liquid is then boiled, allowed to settle, and
filtered to remove whey proteins and calcium phosphate. The pH is adjusted to
7. Calcium lactate crystallizes and is redissolved by adding H
2
SO
4
and ZnSO
4
at
about 95°C. Calcium sulfate and zinc lactate are formed after stirring for 2 h.
After sedimentation occurs, calcium sulfate is removed by centrifugation and the
zinc lactate solution is cooled to 10°C and allowed to crystallize for 48 h. Zinc
lactate crystals are harvested and treated with H
2
SO
4
. After a second filtration,
the liquid is electrodialyzed to remove heavy metals, excess sulfuric acid, and
other impurities.
Fermented By-Products 393
5. Propionate
Production of propionic acid from lactose and lactate by Propionibacterium
freundenrichii was the basis of a patent by Sherman and Shaw (1923). Whey
was fortified with pulverized limestone, which led to formation of calcium salts
of propionic and acetic acids, and then the salts are recovered. A preferred use
of calcium and sodium propionates is in bakery products. They have relatively
no effect on yeast growth, but inhibit growth of spoilage molds and Bacillus
species, which causes ropiness in bakery products.
6. Calcium Magnesium Acetate
An innovative product proposed by Yang and coworkers (1992) at Ohio State
University is production of calcium magnesium acetate (CMA) for use as a road
deicer. A sequential conversion of lactose to lactate and then to acetate with a
yield of greater than 90% acetate was developed. The fermentations are carried
out in continuous, immobilized cell bioreactors. Lc. lactis is the culture used for
the homolactic fermentation of the lactose to lactate. Clostridium formicoaceti-
cum ATCC 27076 is used for fermenting the lactate to acetate. The overall yield
of acetate from lactose in this laboratory trial was approximately 95%. This com-
pares with yields of approximately 60% conversion to acetate in the aerobic vine-
gar process. The acetate concentration obtained from permeate was approxi-
mately 4%. Therefore, recovery and concentration of acetic acid becomes a
significant portion of the process. A mixture of 50% Alamine 336, a tertiary
amine from the Cognis Corp., Tucson, AZ, in 2-octanol was the solvent selected
to extract acetic acid from the fermentation process. Acetic acid was completely
stripped from the solvent and reacted with CaO/MgO solution to form CMA
by vigorous mixing. CMA produced from lactose had deicing ability similar to
commercial CMA.
Calcium magnesium acetate has been identified by the U.S. Federal Highway
Administration as one of the most promising alternative road deicers to the currently
used salt. Salt corrodes bridge metals and concrete on highways. Also, salt is harm-
ful to vegetation and is a threat to ground water quality in some regions. However,
salt costs approximately 5% as much as currently available CMA (30 vs $650/ton).
An estimated cost of $215/ton for CMA was calculated when using a 1.5-million
lb whey permeate per day feedstock entering a facility with a $7,000,000 capital
investment. The output of CMA would be about 40 tons per year.
7. Beta-Galactosidase
Beta-galactosidase is an industrially important enzyme that has application in
producing dairy products with reduced lactose content. It has been used to prevent
sandiness in ice cream, for example. However, the most compelling reason for
394 Henning
use of lactase is to provide products for consumers with lactose malabsorption.
There are industrial applications requiring lactose hydrolysis, such as fermenta-
tion of lactose by a non–lactose-fermenting yeast.
Myers and Stimpson (1956) patented a process to produce lactase. The
process involved heat coagulation of whey proteins at pH 4.5. The clear superna-
tant liquid was fortified with 0.1% corn steep liquor and a nitrogen source. After
cooling to 30°C, the substrate was inoculated with 10% of a culture of actively
growing K. marxianus. The patent suggested both aerated and nonaerated incuba-
tion. When aerated, one volume of air per volume of medium per minute was
the rate of aeration. Yeast cells were washed to improve flavor and then dried.
Yeast was stored at 4.4°C until used in a lactose fermentation.
Several commercial companies have isolated beta-galactosidase from yeast.
Gist-brocades, Delft, the Netherlands, isolated its Maxilact from K. marxianus.
Sumitomo of Osaka, Japan, uses Aspergillus oryzae as the source of lactase.
These companies have bound these lactose-splitting enzymes to support materials
to provide immobilized enzymes for commercial applications.
8. Other Fermentation Products from Whey
Table 2 lists fermentation products that have been produced from whey, and thus
it is technically feasible to manufacture these products. In most instances, the
economic potential is poor or unknown (Hobman, 1984).
Table 2 Fermentation Products from Whey with Limited Potential
for Commercialization
Food-grade yeast/single-cell protein Amino acids
Bakers’ yeast Vitamins
Acetone/butanol Riboflavin
Methane B12
Food acids Ascorbic acid
Citric 2-Keto-L-gulonic acid
Lactobionic Antibiotics/penicillin
Itaconic Other biochemicals
Malic D(-)-3-hydroxy-butyric acid
Enzymes/β-galactosidase Gibberellic acid
Food gums 2,3,-Butylene glycol
Xanthan Hydrogen
Pullulan Diacetyl
Alginic acid Calcium gluconate
Indican Pyruvic acid
Source: Hobman, 1984.
Fermented By-Products 395
REFERENCES
Ahmed I, Morris D. Trends in Cheese Whey Production and Utilization. An Alternate
Feedstock for Alcohol Fuel Production in the United States. Washington, DC: Insti-
tute for Local Self-Reliance, 1991, pp 1–19.
Elmer RA, Clark WS Jr. A new whey of doing it. Modern Brewery Age, December,
1982.
Hobman PG. Review of processes and products for utilization of lactose. J Dairy Sci 67:
2630, 1984.
Kosikowski FV, Mistry VV. Cheese and Fermented Milk Foods. Vol 1. Stamford, CT:
Kosikowski, 1997, p 427.
Kosikowski FV, Wzorek W. Whey wine from concentrates of reconstituted acid whey
powder. J Dairy Sci 60:1982, 1986.
Larson PK, Yang HY. Some factors of clarification of whey wine. J Milk Food Technol
39:614, 1976.
Marth EH. Fermentation products from whey. In: Webb BH, Whittier EO, eds. Byproducts
from Milk. Westport, CT: AVI, 1970, pp 43–82.
Mavropoulou IP, Kosikowski FV. Free amino acids and soluble peptides of whey powders.
J Dairy Sci 56:1135, 1973.
Morris C. New plant of the year-Golden Cheese Company of California. Food Eng, March,
1986.
Myers RP, Stimpson EG. Production of lactase. U.S. patent 2,762,749, 1956.
National Agricultural Statistics Service. Dairy Products Summary. Washington, DC: U.S.
Department of Agriculture, 1999.
Ogden LV. Whey starter for commercial cottage cheese (abstr). J Dairy Sci 64(suppl 1):
53, 1981.
Rajagopalan K, Kosikowski FV. Alcohol from membrane processed concentrated cheese
whey. I&EC Product Res Dev 21:82, 1982.
Richardson GH, Cheng CT, Young R. Lactic bulk culture system utilizing a whey-based
bacteriophage inhibitory medium and pH control. I. Applicability to American style
cheese. J Dairy Sci 60:378, 1977.
Rogosa M, Browne HH, Whittier EO. Ethyl alcohol from whey. J Dairy Sci 30:263, 1947.
Rosenau JR. Lactic acid production from whey via electrodialysis. In: Le Maguer M, Jelen
P, eds. Food Engineering and Process Application. Vol 2. New York: Elsevier,
1986, pp 245–250.
Sajanschshankas PV. Dairy beverage ‘‘Bachyu’’ made from whey. Molcnaya Promysˇlen-
nost 29:12, 24–25, 1968. Cited in Dairy Sci Abstr 31:844, 1969.
Salminen, S, Gorbach, S, Salminen, K. Fermented whey drink and yogurt-type product
manufactured using Lactobacillus strain. Food Technol 45(6):112, 1991.
Sandbach DML. Production of potable grade alcohol from whey. Cultured Dairy Prod J
16(4):17–19, 22, 1981.
Sherman JM, Shaw RH. Process for the production of propionates and propionic acid.
U.S. Patent 2,826,502, 1923.
Sienkiewicz T, Riedel C-L. Whey and Whey Utilization. Gelsenkirchen-Buer, Germany:
Verlag Th Mann, 1990.
396 Henning
Susli, H. New type of whey utilization: a lactomineral table beverage. Proc 14th Int Dairy
Cong 1 (Pt.2):477, 1948.
Whitehead WE, Ayres JW, Sandine WE. Symposium: recent developments in dairy starter
cultures: microbiology and physiology. A review of starter media for cheese mak-
ing. J Dairy Sci 76:2344, 1993.
Yang S-T, Silva, EM. Novel products and new technologies for use of a familiar carbohy-
drate, milk lactose. J Dairy Sci 78:2541, 1995.
Yang S-T, Zhu H, Lewis VP, Tang I-C. Calcium magnesium acetate (CMA) production
from whey permeate: process and economic analysis. Resources Conservation and
Recycling 7:181, 1992.
Zhou KP, Yang HH, Shahani RK, Whalen PJ, Shahani KM. Producing alcohol fuel from
whey and co-products. Proceedings, Whey Products Conference, Chicago, April
29–30, 1992, pp 37–42.
13
Public Health Concerns
Elliot T. Ryser
Michigan State University
East Lansing, Michigan
I. INTRODUCTION
Milk, a highly nutritious food ideally suited for growth of both pathogenic and
spoilage organisms, is the basis for an extremely large industry in the United
States. In 1999, more than 162 billion lb of milk were produced by 9.15 million
dairy cows, with total sales exceeding $23 billion (Anonymous, 2000). Even
though dairy products are consumed daily by most individuals in the United
States, milk, ice cream, and cheese are still among the safest foods marketed and
have most recently accounted for less than 1.5% of all foodborne illness cases
reported annually (Bean et al., 1996). Dairy products manufactured in the United
States continue to be safer than those produced in many other countries with 2,
4, 6, and 8% of all foodborne outbreaks in France, Spain, Scotland, and Germany,
respectively, traced to milk products during 1987 (Notermans and Hoogenboom-
Verdegaal, 1992). However, two outbreaks in 1985—the first involving up to 85
deaths in southern California from Listeria-contaminated cheese and the second
in the Chicago area in which more than 16,000 cases of salmonellosis were traced
to one particular brand of pasteurized milk—reaffirms the need for continued
vigilance by the dairy industry to safeguard public health.
Outbreaks of milkborne illness date from the inception of the dairy industry.
Bacterial infections including diphtheria, scarlet fever, tuberculosis, and typhoid
fever predominated before World War II and were almost invariably linked to
consumption of raw milk, with the greatest public health concerns at that time
perceived to be poor sanitation, inadequate milk-handling procedures, and animal
health issues. Although reports of experimental milk pasteurization first appeared
in public health literature during the early 1900s, supporters of the certified raw
397
398 Ryser
milk movement denounced pasteurization, claiming that this practice led to nutri-
tional deficiencies and flavor defects and allowed marketing of ‘‘sterilized filth.’’
Conversely, the pasteurized milk movement maintained that certified milk was
unsafe despite adherence to strict sanitary practices. In 1923, the Public Health
Service began publishing summaries of gastrointestinal outbreaks attributed to
milk. These early surveillance efforts soon led to passage of the first Model Milk
Ordinance, which stressed nationwide pasteurization and eventual reduction in
the incidence of milkborne enteric diseases with no milkborne cases of diphtheria,
scarlet fever, tuberculosis, or typhoid fever being reported in more than 40 years.
However, interstate shipment of raw milk continued to be legal until 1973. Ban-
ning the interstate shipment of all raw milk products, both certified and noncerti-
fied, in 1986 reduced the annual number of raw milk-related outbreaks by about
half (2.7 outbreaks/yr during 1973–1986 vs 1.3 outbreaks/yr during 1987–1992)
(Headrick et al., 1998). As of May 1995, 28 states still permitted sale of raw
milk, the volume of which accounted for H110211% of all milk sold. Hence, sporadic
illnesses continue to be reported, however, particularly among farm families who
routinely consume milk from their own dairy herds and in states where raw milk
is still legally sold (Headrick et al., 1997).
The importance of various etiological agents in milkborne disease has
changed dramatically over time, with routine pasteurization of milk having a
significant impact. However, more than 90% of all reported cases of dairy-related
illness continue to be of bacterial origin with at least 21 milkborne or potentially
milkborne diseases currently being recognized (Table 1). Typhoid fever and scar-
let fever accounted for most cases of milkborne illness until the late 1930s. During
and shortly after World War II, brucellosis, salmonellosis, and staphylococcal
poisoning emerged as major public health concerns, with salmonellosis continu-
ing to be the most important dairy-related illness currently in terms of overall
numbers of cases. As reports of staphylococcal poisoning subsided during the
1970s, campylobacteriosis emerged as a major public health concern for those
individuals who still drank raw milk. From 1973 to 1992, Campylobacter, ac-
counted for 26 of 46 raw milk–associated outbreaks in the United States and
1100 of 1733 cases of illness (Headrick et al., 1998). In 1985, as many as 85
people in California died of cheeseborne listeriosis, a rare and seldom diagnosed
disease that was previously only weakly associated with consumption of raw and
pasteurized milk. More recently, Escherichia coli O157:H7 has emerged as a
serious threat to the dairy industry with several outbreaks of potentially fatal
hemolytic uremic syndrome reported in Wisconsin and Oregon. Even though they
are able to cause potentially serious health problems, the rickettsiae (i.e., Coxiella
burnetti), parasites (i.e., Cryptosporidium) and viruses (i.e., hepatitis A, Norwalk,
rotavirus) are each responsible for less than 1% of all dairy-related illnesses, with
chemical contaminants other than aflatoxin also posing minimal public health
concerns. Despite modern-day epidemiological strategies and extensive labora-
Public Health Concerns 399
tory testing, a significant number of reasonably large and noteworthy outbreak
investigations still fail to identify a specific cause of illness (Anonymous, 1984b;
Headrick et al., 1998; Maguire et al., 1991; Osterholm et al., 1986).
The types of dairy products implicated in outbreaks of disease since 1900
are listed in Table 2. Consumption of raw milk and cream was the leading cause
of dairy-related illnesses before 1950, with numerous outbreaks of typhoid and
scarlet fever being reported. Although the number and size of these outbreaks
have decreased in response to increased pasteurization, approximately one-third
of all dairy-related illnesses still involve raw milk, with most of these outbreaks
presumably confined to states where the sale of raw milk is still legal and to
small family farms (Headrick et al., 1997). Except for the unusually large 1985
salmonellosis epidemic in the Chicago area, few additional outbreaks have been
positively linked to pasteurized milk in recent years. Nonfat dry milk and butter,
which are generally far less supportive of bacterial growth, have posed relatively
few public health problems. However, numerous outbreaks have been traced to
cheese, particularly Cheddar and soft surface-ripened varieties, which support
growth and/or extended survival of such noted milkborne pathogens as Salmo-
nella, Listeria monocytogenes, Staphylococcus aureus, and certain strains of E.
coli. The number of ice cream–related outbreaks has steadily increased. From
1900 to about 1925, ice cream was most commonly associated with typhoid fever.
Thereafter, staphylococcal poisoning emerged and predominated through the
1950s. Recent popularity of homemade ice cream containing eggs has led to
a rapid increase in the number of outbreaks involving Salmonella, principally
Salmonella Enteritidis. Consequently, many individuals would consider these re-
cent outbreaks to be more closely linked to eggs than to dairy products.
Based on the Food, Drug and Cosmetic Act of 1938, pasteurized milk and
dairy products are considered adulterated and therefore unfit for human consump-
tion if they contain potentially hazardous levels of pathogenic microorganisms,
toxins, drugs, or other hazardous substances. In accordance with federal law,
the Food and Drug Administration requests that firms voluntarily recall such
adulterated products from the market. Hence, an examination of dairy product
recalls offers another means of assessing the importance of current public health
concerns.
Adoption of a ‘‘zero tolerance’’ policy for L. monocytogenes in milk and
dairy products had a profound economic impact on the dairy industry. From 1985
through 1999, 70 cheese recalls (primarily soft and surface-ripened varieties)
were issued along with 48 ice cream recalls involving more than 4 million gallons
of product (Ryser and Marth, 1999). Even though the number of Listeria-related
recalls has decreased markedly, similar product trends can be seen in the period
from 1990 to December 2000, with L. monocytogenes still being responsible for
71% of all dairy product recalls (Table 3). Other reasons for recalling dairy prod-
ucts, principally cheese, during this period have included the presence of E. coli
400
Ryser
Table 1 Percentage of Milkborne and Dairy Product–borne Outbreaks of Various Causes Reported in
the United States from 1900 to 1997
1900– 1910– 1920– 1930– 1940– 1950– 1960– 1970– 1980– 1983– 1988– 1993–
Cause 1909 1919 1929 1939 1949 1959 1969 1979 1982 1987 1992 1997
Total bacterial 100 99 96 92 71 83 67 52 92 65 74 23
Bacillus cereus poisoning — — — — — — — — 1 — — —
Botulism — 1 H110211 1— 1————— 4
Brucellosis — — — 1 8 4 9 1 — 3 H110211—
Campylobacteriosis — — — — — — — 3 40 32 14 4
Citrobacter freundii ————————————
Corynebacterium ————————————
Diphtheria 8 2 4 1 1 — — — — — — —
E. coli diarrhea — — — — — — — 1 1 8 3 —
E. coli O157:H7 — — — — — — — — — — 1 9
Haverhill fever — — H110211—————————
Johne’s and Crohn’s diseases — — — — — — — — — — — —
Listeriosis — — — — — — — — — — — 4
Paratuberculosis — — — — — — — — — — — —
Salmonellosis — 1 3 2 7 21 28 42 50 19 56 65
Scarlet fever 14 15 18 27 8 — — — — — — —
Shigellosis — — 1 2 4 3 — — — — — —
Public
Health
Concerns
401
Staphylococcal poisoning — — — 8 26 50 30 5 — — — —
Streptococcus — — — — — — — — — 3 — —
Tuberculosis H110211 H110211 H110211 H110211 H110211 H110211——————
Typhoid fever 78 80 68 50 17 3 — — — — — —
Yersiniosis — — — — — — — 1 — — — —
Total rickettsial 0 0 0 0 0 1 0 0 0 0 0 0
Q fever — — — — — 1 — — — — — —
Total parasites 0 0 0 0 0 0 0 1 0 0 0 0
Cryptosporidiosis — — — — — — — — — — — —
Tickborne encephalitis — — — — — — — — — — — —
Toxoplasmosis — — — — — — — 1 — — — —
Total viral 0 H110211 H1102110H11021202 1 10H1102110
Hepatitis — — — — H110211— 2 1 1—H110211—
Poliomyelitis — H110211 H110211—H110211———————
Total chemical 0 0 0 0 0 0 0 4 H11021111 6 0
Aflatoxin and other mycotoxins — — — — — — — — — — — —
Antibiotics — — — — — — — — — — — —
Chemicals — — — — — — — 3 H11021111 6—
Histamine poisoning — — — — — — — 1 — — — —
Unknown etiology H110211 1 3 8 26 17 31 41 6 24 18 13
Sources: Bryan (1983), Bean et al. (1996), and Olsen et al. (2000).
402
Ryser
Table 2 Percentage of Reported United States Outbreaks Involving Various Dairy Products: 1900–1997
1900– 1910– 1920– 1930– 1940– 1950– 1960– 1970– 1980– 1988– 1993–
Product 1909 1919 1929 1939 1949 1959 1969 1979 1987 1992 1997
Milk — — — — — — 36 — 62 30 34
Raw milk and cream 100 86 93 90 54 36 — 23 — — —
Certified raw milk — — 1 — — 2 — 4 — — —
Pasteurized milk — 4 3 3 16 2 — 3 — — —
Nonfat dry milk — — — — 2 2 — 4 — — —
Cheese — 1 H110211 3 9342017191414
Butter — 1 — — H110211— — 4 — — —
Ice cream H110211 8 2 4 17 24 44 44 19 56 52
Number of outbreaks 173 333 390 403 301 45 39 94 58 36 29
Sources: Bean et al. (1990), Bean et al. (1996), Bryan et al. (1983), MacDonald et al. (1986), and Olsen et al. (2000).
Public Health Concerns 403
Table 3 Number (%) of Microbiologically Related FDA Recalls Issued for Dairy
Products: 1990–December 2000
Product
Ice Cream
Fluid milk and frozen Dried milk
Agent and cream Butter yogurt and whey Cheese Total
L. monocytogenes 1 4 23 — 38 66 (71)
C. botulinum — — — — 7 7 (11)
Salmonella — — 1 2 — 3 (5)
Mold — — — — 4 4 (3)
E. coli — — — — 3 3 (3)
Aflatoxin 1 — — — — 1 (2)
Cryptosporidium — — — — 1 1 (2)
Total 2 (2) 4 (5) 24 (28) 2 (2) 53 (63) 85
Source: FDA Enforcement Reports 1990–2000.
and potentially toxigenic molds as well as presence of Cryptosporidium and
changes in cheese spread formulations that may lead to potential growth of Clos-
tridium botulinum and the accompanying threat of botulism.
In this discussion, the various public health concerns affecting the dairy
industry have been organized into three arbitrary categories. The first section of
this chapter deals with public health concerns primarily of historical interest such
as diphtheria, scarlet fever, tuberculosis, and typhoid fever. Major public health
concerns of current interest are discussed in greater detail in the following section
and include the common bacterial infections (e.g., campylobacteriosis, listeriosis,
salmonellosis) and intoxications (e.g., staphylococcal poisoning) as well as poten-
tial health concerns related to the presence of aflatoxins and drug residues in the
milk supply. Uncommon and suspected milkborne bacteria, rickettsiae, parasites,
viruses, and toxins responsible for infrequent dairy-related illnesses are briefly
reviewed in the last section; a few of these etiological agents are likely to increase
in significance within the next 10–20 years.
II. HISTORICAL CONCERNS
The presence of pathogenic bacteria in milk has been a matter of public health
concern since the early days of the dairy industry. From the turn of the century
to 1940, numerous health hazards were associated with ingesting raw milk and
dairy products prepared from raw milk. Typhoid fever, the primary milkborne
404 Ryser
disease during this period, accounted for 50–80% of all milk-related illnesses,
with scarlet fever being responsible for an additional 14–27% of milkborne infec-
tions (Bryan, 1983). Both of these diseases were frequently fatal, because suitable
treatments, such as with antibiotics, were unavailable. The high incidence of milk-
borne typhoid and scarlet fever, coupled with sporadic dairy-related outbreaks of
diphtheria, poliomyelitis, and tuberculosis, soon confirmed the need for increased
pasteurization, a process that was used only sporadically during the 1920s and
1930s. After World War II, almost universal adoption of pasteurization, coupled
with modernization of milk production practices emphasizing improved farm and
dairy factory sanitation, udder health, herd inspection, and cooling, handling, and
storage of milk have, for all practical purposes, eliminated the threat of these
diseases, with the last cases of milkborne typhoid fever, scarlet fever, and diph-
theria in the United States being reported more than 40 years ago.
A. Diphtheria
Dreaded by mothers of small children for more than 2000 years, diphtheria has
come to be one of the best understood and controlled human bacterial diseases,
with long-standing immunization programs virtually eliminating diphtheria in the
United States, Canada, and most of Europe. Corynebacterium diphtheriae, the
bacterial pathogen responsible for diphtheria, is an obligate parasite, with humans
serving as the natural host and reservoir. Morphologically, C. diphtheriae is a
gram-positive, nonmotile, non–spore-forming, club-shaped bacterium that grows
in characteristic branching Chinese ‘‘letter’’ arrangements and stains irregularly
because of intracellular metachromatic (polyphosphate) granules (Barksdale,
1986; Dixon et al., 1990). Diphtheria-producing strains of C. diphtheriae secrete
diphtheroid toxin, an extremely potent extracelluar, simple protein toxin, the pro-
duction of which is dictated by a prophage carrying the tox
H11001
gene (Barksdale,
1986).
Diphtheria is normally acquired through contact with asymptomatic carriers
harboring the organism in their nasal passages and only rarely by contact with
actual clinical cases. In classic infections, C. diphtheriae multiplies within epithe-
lial cells of the nasopharynx. Early symptoms include mild fever, sore throat,
and prostration, but continued toxin production leads to formation of a tough
grayish pseudomembrane composed of dead tissue and fibrin, which adheres to
the tonsils and the posterior pharyngeal wall (Dixon et al., 1990; McCloskey,
1986). Subsequent spreading of this membrane downward into the larynx and
trachea produces severe respiratory problems and eventual suffocation. Because
all human tissues are vulnerable to this toxin, further complications including
degeneration of the heart muscle, nervous system, and most other internal organs
result in almost certain death once the toxin enters the bloodstream (McCloskey,
1986). Hence, neutralization of the toxin with diphtheria antitoxin at the first
Public Health Concerns 405
suspicion of infection together with administration of penicillin or erythromycin
(Dixon et al., 1990) are both vital for full recovery.
Raw milk consumption was epidemiologically linked to 11 diphtheria out-
breaks in the United States between 1919 and 1948 (Bryan, 1979), with three
similar outbreaks also being reported in England (Goldie and Maddock, 1943;
Wilson, 1933) and Australia (Bryan, 1979) during this period. In most of these
outbreaks, dairy workers who either exhibited active infections or carried C.
diphtheriae asymptomatically were assumed to have contaminated milk during
milking or subsequent handling. Evidence for direct transmission of C. diphther-
iae by cows is limited to two related cases of bovine diphtheritic mastitis in a
small South African village (Pfeiffer and Viljoen, 1945) and one additional out-
break in which superficial teat and udder infections developed in cows from con-
tact with a human carrier (Henry, 1920). Several early outbreaks also were associ-
ated with consumption of ice cream (Bryan, 1979) and butter (Hammer, 1938).
More recently, 149 diphtheria cases were reported in the Arab Republic of Yemen
from August 1981 to January 1982 (Jones et al., 1985). Twenty-one children
died, giving a mortality rate of 14%. Subsequent epidemiological evidence impli-
cated one commercial brand of yogurt as a possible source of infection; however,
the product was no longer available for testing. The fact that most children
younger than 10 years of age were not fully immunized against diphtheria was
a major contributing factor in this outbreak. With the help of well-developed
immunization programs, an average of only three annual cases of diphtheria was
recorded in the United States from 1984 to 1994 (Anonymous, 1994c), with only
one case being reported in 1998 (Anonymous, 1999). Thus, the rarity of diphthe-
ria cases in highly industrialized countries coupled with routine pasteurization
has all but eliminated dairy products as a source of C. diphtheriae infections.
B. Scarlet Fever and Septic Sore Throat
Streptococcus pyogenes, a gram-positive, β-hemolytic, group A streptococcus,
causes scarlet fever, septic sore throat, pharyngitis, and tonsillitis in humans and
mastitis in dairy cattle (Bryan, 1979). Human symptoms of infection include
severe sore throat, hoarseness, headache, muscle pain, fever, prostration, weak-
ness, chills, diarrhea, nausea, and vomiting (Decker et al., 1985). Scarlet fever,
which manifests with a characteristic rash, results from infection with certain
erythrogenic toxin-producing strains of S. pyogenes. Prompt treatment with anti-
biotics greatly minimizes further complications such as rheumatic fever and ne-
phritis; however, 25% of patients who have received proper treatment can become
lingering carriers of S. pyogenes (Valkenburg, 1986).
Dairy-related outbreaks of scarlet fever and septic sore throat were common
before pasteurization became routine (Eyler, 1986), with at least 40 such out-
breaks (13,939 cases and 20 deaths) occurring between 1907 and 1927; 37 of
406 Ryser
these outbreaks presumably resulted from ingestion of raw milk (Hammer, 1938).
The largest of these outbreaks occurred in Chicago, with at least 10,000 cases
linked to faulty milk pasteurization (Capps and Miller, 1912). In most instances,
the initial source of contamination was traced to dairy farmers with scarlet fever
who either infected their cows or the milk during milking (Hammer, 1938) with
subsequent growth of S. pyogenes also possible between 20 and 37°C (Davis,
1914). Even though a few additional outbreaks have been traced to ingestion of
ice cream (Hammer, 1938), dried milk (Allen and Baer, 1944; Purvis and Morris,
1946), and most recently a processed white cheese produced in Israel (Bar-Dayan
et al., 1996), routine pasteurization has virtually eliminated milk as a vehicle for
scarlet fever in the United States.
C. Tuberculosis
Tuberculosis was one of the greatest scourges of humans and animals since antiq-
uity with detailed descriptions of this disease recorded by Hippocrates in 400 bc
(Grange, 1990). The turning point finally came in 1882 when Robert Koch iso-
lated and showed Tuberkelbacillin (bacilli of tuberculosis) to be the causative
agent of tuberculosis (Collins and Grange, 1983). Similar organisms were subse-
quently isolated from cases of tuberculosis-like disease in various animals, giving
rise to three main types of tubercle bacilli now recognized as Mycobacterium
tuberculosis (human type), M. bovis (bovine type), and M. avium (avian type).
In 1901, Koch erroneously claimed that ‘‘the human subject is immune against
infection with bovine bacilli...’’ and that ‘‘human tuberculosis differs from bo-
vine, and cannot be transmitted to cattle.’’ In 1911, the Royal Commission on
Tuberculosis concluded that cows with bovine tuberculosis indeed posed a hazard
to human health (Collins and Grange, 1983). Two years later, cattle vaccinated
with supposedly attenuated strains of M. tuberculosis were shown to shed viable
virulent organisms in their milk (Griffith, 1913). Today, tuberculosis is an infec-
tious granulomatous disease primarily acquired by inhaling M. tuberculosis.
Dairy herd immunization programs and mandatory pasteurization virtually elimi-
nated milkborne M. bovis infections in developed countries after 1960 (Habib
and Warring, 1966).
1. General Characteristics
M. bovis, the primary organism responsible for milkborne tuberculosis, is an
aerobic, nonmotile, non–spore-forming, nonencapsulated, straight to slightly
curved, slender, weakly gram-positive, acid-fast (resistant to decolorization by
acidified organic solvents after initial staining) bacillus (Nolte and Metchock,
1995). Most commonly isolated mycobacteria, including M. bovis, grow very
slowly and may require up to 8 weeks of incubation at 35°C for visible growth
Public Health Concerns 407
to appear on laboratory media. Inoculation of guinea pigs was historically used
to identify raw milk and clinical samples containing Mycobacterium spp., particu-
larly M. bovis (Wilkins et al., 1987). However, several rapid DNA-based methods
are now available to screen milk samples for M. bovis (Zanini et al., 1998). Bio-
chemically, M. bovis fails to produce niacin or reduce nitrate, with M. tuberculo-
sis giving the reverse reactions (Nolte and Metchock, 1995). High cell wall lipid
levels account for the unique resistance of the organism to drying, chemical disin-
fection, and other environmental stresses (Mitscherlich and Marth, 1984), which,
in turn, makes M. bovis difficult to eradicate from farm environments.
2. Clinical Manifestations
Nonpulmonary tuberculosis is an infectious granulomatous disease characterized
by development of lesions at the site of penetration, typically the oropharnyx and
intestinal tract in milkborne cases involving M. bovis. Spread of the organism to
the kidneys and genitourinary tract via the lymphatic system can produce addi-
tional lesions in these areas. A condition affecting bones and joints known as
kyphosis (hunchback) frequently occurs in infected older children and adults,
whereas children younger than 5 years of age are most prone to complications
of the meninges, including meningitis (Bryan, 1979; Hammer, 1938). Given such
widespread organ involvement, prognosis was poor, with 2000 of 4000 childhood
cases in Great Britain ending terminally in 1932 (Anonymous, 1932). Develop-
ment of antituberculosis drugs, including isoniazid, rifampicin, and pyrazinam-
ide, has revolutionized modern-day treatment of tuberculosis, making operative
intervention and sanatoriums part of a bygone era (Grange, 1990).
3. Outbreaks
According to Park and Krumwiede (1911), M. bovis infections were relatively
common, with this organism accounting for 7% of all tuberculosis cases observed
in New York City and 9% of all such cases reported worldwide. Reports circum-
stantially linking raw milk consumption to tuberculosis also abound in the early
literature (Bryan, 1979; Hammer, 1938); however, only three reports are sup-
ported by strong bacteriological evidence. In the first of these outbreaks (Price,
1934), M. bovis was recovered from raw milk consumed by 3 of 45 Canadian
children in whom nonpulmonary tuberculosis developed. The second outbreak
occurred in 1936 and was traced to a small Swedish village (Stahl, 1939). Milk
from a cow with active tuberculosis of the udder was reportedly consumed raw
by 29 of 32 individuals in whom tuberculosis developed even though the local
dairy farm had a rigorous tuberculosis screening program in place at the time of
the outbreak. Quinn et al. (1974) reported that a young boy living on a Michigan
farm reacted positively to a tuberculin skin test after ingesting raw milk from
his parents’ herd of 34 dairy cows, several animals of which were heavily in-
408 Ryser
fected. The last two cases of bovine tuberculosis within the United States were
diagnosed in 1976 (Passes et al., 1978), with both victims reportedly being for-
eign-born and having spent much time in India.
Changing milk consumption habits, mandatory pasteurization, and cattle
immunization programs have drastically reduced but probably not totally elimi-
nated milkborne transmission of M. bovis tuberculosis. In the United States,
M. bovis accounted for only 6 of 2086 culturally confirmed tuberculosis cases
at the Mayo Clinic from 1950 to 1958 (Steele and Ranney, 1958). However,
another survey conducted in England, Scotland, and Wales showed that 26, 22,
and 17%, respectively, of nonpulmonary tuberculosis cases were caused by M.
bovis, with many of these patients giving a history of raw milk consumption.
According to Collins and Grange (1983), M. bovis is still of concern in nonpulmo-
nary tuberculosis, with 109 cases being reported in southeast England (including
London) from 1977 to 1981, and 1–5 cases identified annually in Ireland from
1983 to 1994 (Cotter et al., 1996). Nonetheless, the last three confirmed cases
of milkborne tuberculosis in England and Wales were reported during the 1950s
(Galbraith et al., 1982), which in turn suggests that potential milkborne M. bovis
cases are being incompletely investigated or underreported (Collins and Grange,
1983).
4. Occurrence and Survival in Milk and Dairy Products
Factors influencing milkborne transmission of M. bovis include incidence of in-
fection in cows as well as incidence and level of contamination in milk. M. bovis
infections in dairy cattle are long lasting, with 1–2% of cases involving udder
lesions and excretion of M. bovis in the milk (Stiles, 1989). However, dairy cattle
also can shed M. bovis in their milk as a result of septicemic and cutaneous
infections. In both instances, sufficient levels of mycobacteria can be excreted
from a single cow to make 100 gallons of previously noncontaminated milk infec-
tious for infants (Kleeburg, 1975). Although unable to grow in refrigerated milk,
M. bovis persists in such milk during extended storage (Hammer, 1938). Before
dairy cattle were routinely screened for tuberculosis, M. bovis was commonly
found in raw milk, with 3–15% of the raw and pasteurized milk supplied at the
turn of the last century to such cities as New York, Washington, DC, Baltimore,
Philadelphia, and Chicago containing M. tuberculosis or M. bovis. During this
period, an estimated 43,750 qt of contaminated milk was being pasteurized daily
for the Chicago market (Hammer, 1938). Elsewhere, the situation was similar,
with 8.6% of 16,700 milk samples collected worldwide yielding M. tuberculosis
(Hammer, 1938). A tuberculosis infection rate of 40% for cattle slaughtered in
1932, 0.5% of which had mycobacteria in their milk, likely accounts for only
part of this contamination (Savage, 1933), with the remainder coming from direct
contact of milk with dried fecal material or the farm environment. Given the
Public Health Concerns 409
success of tuberculosis screening programs for cattle in the United States, Can-
ada, and western Europe, coupled with the systematic slaughter of all animals
testing positive from infected herds, the incidence of M. bovis in the raw milk
supply is very low. However, raw milk from northern India (Sakhre and Vyas,
1978) and other less developed areas of the world may harbor M. bovis with
greater frequency.
Although clearly present in raw milk after the turn of the last century, M.
tuberculosis (M. bovis) was seldom recovered from dairy products other than
butter, cream cheese, and occasionally cottage cheese. Early reports indicated M.
tuberculosis contamination rates of 9.5 and 13.2% for butter marketed in Boston
(Rosenau et al., 1914) and Europe (Hammer, 1938), respectively, with the organ-
ism surviving at least 153 days in butter prepared from naturally contaminated
cream (Mitscherlich and Marth, 1984). In addition, M. tuberculosis was present
in 13.7% of cream cheese and 3.2% of cottage cheese marketed in Washington,
DC (Schroeder and Brett, 1918). Although M. bovis is seldom found in other
dairy products, numerous early studies attest to the hardiness of M. bovis in other
cheeses, reportedly surviving at least 47 days in Camembert and Muenster cheese
as well as 62 days in Cheddar cheese and 232 days in Tilsit cheese (Mitscherlich
and Marth, 1984), all of which were prepared from naturally contaminated milk.
In a more recent survey, Obiger et al. (1970) failed to recover M. tuberculosis
from 51 soft French cheeses, many of which were likely prepared from raw milk.
Consequently, these latter findings combined with a complete lack of cheese-
associated cases suggest that cheese is an unlikely vehicle for M. bovis infections.
5. Prevention
Veterinary inspection of meat and tracing of infected animals back to their farm
of origin, coupled with systematic slaughter of tuberculosis-positive animals in
the herd, have greatly reduced the incidence of tuberculosis in dairy cattle. In
1979, only 0.18% of the herds in Great Britain were found to be positive for
tuberculosis (Collins and Grange, 1983). However, because certain wild animals,
including deer, racoons, badgers and opossums, are also susceptible to M. bovis
infections, total eradication of tuberculosis in dairy cattle is unlikely in the United
States and elsewhere, with dairy cows sporadically testing positive for M. bovis in
northern lower Michigan. Mandatory pasteurization, the other step in preventing
milkborne tuberculosis, has proven to be highly effective with high-temperature,
short-time (71.7°C for 15 s), and vat pasteurization (61.7°C for 30 min), both
inactivating large populations of M. bovis and M. tuberculosis in milk with a
wide margin of safety (Kells and Lear, 1960). However, as discussed earlier
(Quinn et al., 1974), bovine tuberculosis may still present an occasional health
risk, particularly for individuals consuming raw milk on farms or cheeses pre-
pared from raw milk.
410 Ryser
D. Typhoid Fever
Raw milk was first suggested as a vehicle for typhoid fever well before the etio-
logical agent was isolated and identified. In 1857, Dr. Michael Taylor of Penrith,
England, identified 13 cases of typhoid fever among seven rural families who
obtained raw milk from a family farm (Hammer, 1938). Epidemiological evi-
dence suggested that a servant girl suffering from typhoid fever was most likely
responsible for contaminating the milk in this outbreak. The causative agent of
typhoid fever, later named Salmonella Typhi, was not observed in human patients
until 1880, and the organism was isolated on culture media 4 years later (Bryan
et al., 1979; Marth, 1969). During the first half of the 20th century, consumption
of contaminated milk, cheese, and butter was responsible for numerous outbreaks
of typhoid fever and many fatalities, with the disease accounting for 50–80% of
all cases of milkborne illness reported in the United States from 1900 to 1939
(Bryan, 1983; Hammer, 1938). However, adoption of routine pasteurization of
milk after World War II and improvements in sanitation standards led to a precipi-
tous decrease in typhoid fever with no milkborne outbreaks being reported in the
United States since the 1950s. Whereas milkborne typhoid fever has been eradi-
cated in most industrialized countries, occasional milkborne outbreaks still occur
in developing countries where the disease is endemic because of contaminated
water supplies.
1. General Characteristics
S. Typhi, an important bacterium in the family Enterobacteriaceae, is short, mo-
tile, gram-negative, facultatively anaerobic and rod shaped (Kuesch, 1986). S.
Typhi readily grows on common laboratory media at 15–41°C, with optimal
growth occurring at 37°C. This serovar of Salmonella is biochemically distinct
from the more than 2300 other serovars of salmonellae that are responsible for
gastroenteritis, the most common form of Salmonella infection. Isolates of S.
Typhi do not produce gas from glucose, utilize citrate, decarboxylate ornithine,
or ferment rhamnose. In contrast to other salmonellae that are found in the gastro-
intestinal tract of many animals, humans are the only known reservoir for S.
Typhi. The closely related organism Salmonella Paratyphi, which causes paraty-
phoid fever, rarely produces mastitis in dairy cattle (George et al., 1972) and
is almost invariably confined to human carriers. However, both organisms are
extremely hardy and can survive many weeks in water, ice, feces, and dust parti-
cles (Mitscherlich and Marth, 1984), which makes their elimination from the
environment difficult.
2. Clinical Manifestations
Typhoid fever normally begins with a bacteremia-related fever that develops 1–
2 weeks after ingesting at least 10
5
S. Typhi organisms (Kuesch, 1986; Parker,
Public Health Concerns 411
1990). Various nonspecific symptoms, including anorexia,malaise, lethargy, my-
algia, and a continuous headache, frequently accompany the fever, which peaks
at 104–105°F (40–41°C) within 3–4 days. Although some patients experience
spontaneous remission of these symptoms within 1 week, sustained high fever
over the ensuing 2 weeks most often leads to frank prostration, delirium, and
abdominal pain caused by spleen or liver enlargement. A bewildering array of
typhoid-related complications ranging from encephalitis, Guillain-Barre` syn-
drome, and psychiatric disorders to myocarditis, hepatitis, nephritis, hemolytic
uremic syndrome, osteomyelitis, and septic arthritis has also been reported. Two
prominent complications during the third week of infection, namely intestinal
hemorrhage and perforation of the bowel, can lead to peritonitis, which is usually
fatal without surgical intervention. Prompt antimicrobial therapy has reduced the
mortality rate of typhoid fever in the United States and other developed countries
to less than 1%, with chloramphenicol being the antibiotic of choice. Despite
proper treatment, 90% of patients shed S. Typhi in their feces for up to 3 months.
Furthermore, approximately 3% of patients become long-term (H110221 year) ex-
creters of S. Typhi at levels of at least 10
6
organisms/g, as was true for the
infamous ‘‘Typhoid Mary,’’ with such individuals serving to spread the organism
to other humans and perpetuate the infectious cycle.
3. Outbreaks
Before 1940, S. Typhi was responsible for 50–80% of all milkborne illnesses
reported in the United States (Bryan, 1983), with a total of 848 typhoid fever
outbreaks involving more than 30,000 cases and 300 deaths being recorded (Ham-
mer, 1938). Milkborne epidemics peaked in the United States during 1911–1915
with 238 reported outbreaks, most of which involved S. Typhi. According to
Armstrong and Parran (1927), of 479 milkborne outbreaks of typhoid fever sum-
marized up to 1927, 444 (93%) and 32 (6.5%) were linked to milk (primarily
raw) and ice cream, respectively, with the three remaining outbreaks involving
butter and cheese. Only 29 outbreaks were traced to pasteurized milk or dairy
products, with S. Typhi entering the product as a postpasteurization contaminant.
Symptomatic and asymptomatic carriers of S. Typhi were identified as the con-
tamination source in 80% of these outbreaks with milk bottles coming from in-
fected households and use of polluted water to clean dairy utensils cited as addi-
tional contributing factors.
Many of these early epidemics involving milk, butter, and cheese have been
well documented. In one outbreak in 1900, 65 college students became ill after
consuming raw milk (Hammer, 1938). Investigators traced the milk to a farm
worker who had recently recovered from typhoid fever. Use of badly polluted
well water to wash dairy equipment and temperature abuse of the milk were cited
as major contributing factors. During the 1920s, one particularly large outbreak
412 Ryser
of typhoid fever was traced to pasteurized milk in Montreal, Canada. A total of
5014 cases and 488 deaths occurred primarily among institutionalized children
and adults, giving a mortality rate of nearly 10% (Lumsden et al., 1927). Faulty
pasteurization, intentional addition of raw milk to pasteurized milk, and handling
of milk by an infected worker were cited as probable causes. Butter contaminated
by a convalescent carrier of S. Typhi was responsible for 35–40 cases (including
six deaths) of typhoid fever in Minnesota during 1913 (Hammer, 1938). The
cheeseborne outbreak alluded to earlier occurred during 1923 and involved 51
cases of typhoid fever (including four deaths) in Michigan (Rich and Fellow,
1923). Raw milk used in cheese making was reportedly contaminated by a farm
worker shedding S. Typhi with the cheese being consumed shortly after manufac-
ture. During the 1940s, three additional Canadian outbreaks of typhoid fever were
traced to Cheddar cheese prepared from contaminated raw milk and consumed
before 60 days of ripening (Foley and Poisson, 1945; Gauthier and Foley, 1943;
Menzies, 1944). Colby and mold-ripened cheeses also have been implicated in
outbreaks of typhoid fever according to Marth (1969).
Routine pasteurization of milk and improved sanitary standards led to a
precipitous decrease in the number of typhoid cases and human carriers of S.
Typhi after World War II, with typhoid fever being responsible for only 17 and
3% of all dairy-related illnesses reported in the United States during 1940–1949
and 1950–1959, respectively (Bryan, 1983). As a result of these efforts, the an-
nual number of typhoid fever cases from all causes decreased from 4211 cases
in 1945 to 375 cases in 1998 (Anonymous, 1999), with no dairy-related cases
of typhoid fever being reported in the United States since the 1950s. As recently
as 1971, however, officials at the Centers for Disease Control traced 132 cases
of typhoid fever in Trinidad to commercially produced ice cream with an infected
factory worker and absence of pasteurization cited as the most likely causes (Tay-
lor et al., 1974). Hence, milkborne typhoid fever can still pose a threat in devel-
oping countries where substandard sanitation can lead to substantial numbers of
S. Typhi carriers.
4. Occurrence and Survival in Milk and Dairy Products
Contamination of raw milk, pasteurized milk, and other dairy products has been
invariably linked to symptomatic or asymptomatic carriers of S. Typhi. Scott and
Minett (1947) produced mastitis in dairy cows by injecting S. Typhi into the
udder, and the organism was subsequently shed in the milk for up to 85 days.
Given the absence of any naturally occurring cases of bovine mastitis involving
the shedding of S. Typhi in milk, however, contamination of all dairy products
is assumed to be exclusively of human origin. Even without survey data, because
there is an absence of recent milkborne cases of typhoid fever and because fewer
than 700 cases of typhoid fever from all causes have been reported in the United
Public Health Concerns 413
States since 1965 (Anonymous, 1994c), it is suggested that S. Typhi has been
eliminated from the milk supply and other dairy products.
Current vat and high-temperature, short-time pasteurization standards are
designed to destroy large populations of S. Typhi in milk with a wide margin of
safety (Evans and Litsky, 1968). However, this pathogen will readily grow as a
postpasteurization contaminant in pasteurized and sterilized milk that has been
temperature abused (Pullinger and Kemp, 1938) and persists in refrigerated milk
for 3–6 weeks (Mitscherlich and Marth, 1984). According to results from several
additional early studies summarized by Mitscherlich and Marth (1984), S. Typhi
can survive 2–4 weeks in butter prepared from contaminated cream and also
persists 12–39 days in ice cream stored at H110024toH110025°C. These findings clearly
support milk, butter, and ice cream as vehicles of infection in the aforementioned
outbreaks.
The fate of S. Typhi both on and in cheese also has attracted some attention.
Early reports indicated that S. Typhi survived approximately 2–4 and 10–15
weeks after Cheddar, Swiss, and other cheeses were surface inoculated and stored
at ambient and refrigeration temperatures, respectively (Mitscherlich and Marth,
1984). When Cheddar cheese was prepared from inoculated milk and ripened at
15 and 5°C, S. Typhi generally persisted for 3 months and at least 10 months,
respectively (Campbell and Gibbard, 1944). In addition, Wade and Shere (1928)
found that S. Typhi survived 2–3 months in Cheddar cheese prepared from natu-
rally contaminated milk that would not clot properly. Such findings led to the
present law requiring that Cheddar and other hard cheeses legally prepared from
raw or subpasteurized milk be held at greater than or equal to 1.7°C for at least
60 days to eliminate S. Typhi and other pathogenic bacteria.
5. Prevention
With modern sewage treatment plants and dairy processing facilities, milkborne
typhoid fever is no longer a threat in industrialized countries, and no such cases
have been reported in the United States or England during the past 40 years
(Galbraith et al., 1982). However, the potential for milkborne outbreaks still ex-
ists in developing countries where typhoid fever is endemic because of high hu-
man carriage rates for S. Typhi. Consequently, travelers to such areas should be
appropriately vaccinated and avoid consuming raw milk and dairy products pre-
pared under poor sanitary conditions.
III. CURRENT PUBLIC HEALTH CONCERNS
Public health concerns impacting on the dairy industry continue to change in
response to advances in sanitation, milk handling, and animal husbandry prac-
414 Ryser
tices. Common pre–World War II milkborne illnesses such as diphtheria, scarlet
fever, tuberculosis, and typhoid fever no longer pose a significant threat to con-
sumers and have been replaced by more immediate concerns. Milkborne staphy-
lococcal poisoning, a major problem during the middle of the last century, has
been superseded in importance by salmonellosis and campylobacteriosis, which
have accounted for most dairy-related illnesses reported since the early 1980s.
Although responsible for comparatively few outbreaks of illness, several recently
identified milkborne pathogens, including E. coli O157:H7 and L. monocyto-
genes, have received widespread attention because of the particularly severe or
fatal complications produced by these organisms. The potential impact of afla-
toxin—a highly potent human carcinogen sometimes found in milk—has also
received recent attention, as have the possible public health ramifications of anti-
biotic and drug residues in the milk supply. Finally, several recent reports suggest
that milkborne brucellosis is of more than passing interest, particularly in the
southwestern United States. Although definition of a ‘‘major public health con-
cern’’ is somewhat arbitrary, 12 major public health concerns impacting on the
dairy industry since World War II are discussed in this section based on their
continued high incidence of disease (e.g., campylobacteriosis, salmonellosis,
staphylococcal poisoning), recurring sporadic outbreaks (Bacillus cereus poison-
ing, brucellosis, enteropathogenic E. coli), severity of illness (botulism, E. coli
O157:H7, listeriosis, yersiniosis), and potential impact of chronic exposure (afla-
toxin, drug residues). These major public health concerns account for more than
95% of all reported milkborne illnesses.
A. Aflatoxin
The aflatoxins belong to a subset of secondary metabolites termed mycotoxins,
which are produced by certain strains of molds; namely, Aspergillus flavus, A.
parasiticus, and A. nomius. First identified in England in 1960 during an outbreak
that involved the death of more than 100,000 turkeys from liver disease (Stevens
et al., 1960), the aflatoxins have become recognized as extremely potent liver
carcinogens for both animals and humans. Four major forms of aflatoxin, desig-
nated aflatoxin B
1
(AFB
1
), B
2
(AFB
2
), G
1
(AFG
1
), and G
2
(AFG
2
), are currently
recognized, with AFB
1
being the most potent (Applebaum et al., 1982). AFB
1
is
most often found in moldy peanuts (ground nuts) and animal feeds containing
corn or other grains. When dairy cattle ingest contaminated feed, AFB
1
is metabo-
lized to aflatoxin M
1
(AFM
1
), some of which is shed in the milk (see Chap. 1).
Animal feeding studies indicate that AFM
1
is somewhat less carcinogenic than
AFB
1
. As of 1997, at least 66 countries had active or proposed legislation regard-
ing aflatoxin limits in foods (Cerutti and Campiglio 1997), with the United States
and countries of the European Union having legislated maximum acceptable
Public Health Concerns 415
AFM
1
levels of 0.5 and 0.1 ppb in fluid milk and milk destined for infant foods,
respectively (Anonymous 1999).
1. General Characteristics
Aflatoxins, named because of their production by the mold A. flavus (A. flavus
toxin), are highly substituted coumarins containing a fused dehydrofurofuran
moiety. These toxic and carcinogenic secondary metabolites form a unique group
of highly oxygenated, heterocyclic, low molecular weight compounds. Four ma-
jor aflatoxins are recognized, with AFB
1
and AFB
2
exhibiting intense blue fluo-
rescence and AFG
1
and AFG
2
exhibiting intense green fluorescence when viewed
under ultraviolet light at 425 and 450 nm, respectively (Applebaum et al., 1982).
Relatively few A. flavus and A. parasiticus isolates produce aflatoxin. However,
toxigenic strains typically synthesize two or three forms of aflatoxin, one of which
is invariably AFB
1
—the most potent toxin and carcinogen of the group. When
dairy cattle ingest aflatoxin-contaminated feed, AFB
1
and AFB
2
are metabolized
to their respective 4-hydroxy derivatives, namely, AFM
1
and AFM
2
, and excreted
with milk. AFM
1
is of primary concern to the dairy industry, whereas AFM
2
is
produced in smaller quantities and is far less toxic than AFM
1
.
Requirements for aflatoxin synthesis are relatively nonspecific, with these
secondary metabolites being produced on most foods and laboratory media that
support mold growth. A. flavus and A. parasiticus fail to produce aflatoxins when
grown at temperatures below 7.5°C or above 40°C, with 7–21 days of incubation
at 25–30°C optimal for aflatoxin synthesis (Schindler, 1977). However, aflatoxin
production is reportedly enhanced when temperatures fluctuate between 5 and
25°C (Park and Bullerman, 1981). Levels of AFM
1
in milk and dairy products
are minimally affected by pasteurization, sterilization, fermentation, cold storage,
freezing, concentrating, or drying (Aman, 1995; Yousef and Marth, 1989). How-
ever, treating milk with hydrogen peroxide, benzoyl peroxide, sulfites, bisulfites,
riboflavin, lactoperoxidase, or ultraviolet irradiation has proven to be effective
in experimentally reducing levels of AFM
1
in contaminated milk (Applebaum
and Marth, 1982a; Yousef and Marth, 1985, 1986). AFM
1
levels in milk also can
be markedly reduced by physically adsorbing the toxin onto certain particulate
materials such as bentonite (Applebaum and Marth, 1982b).
2. Detection
Several methods based on thin-layer chromatography (TLC) and more recently
high-performance liquid chromatography (HPLC) are available for detecting
AFM
1
in milk and dairy products (Scott, 1990; Stubblefield and van Egmond,
1989). Regardless of the method used, AFM
1
must first be extracted from the
sample either directly using chloroform or indirectly from columns on which
416 Ryser
AFM
1
has been adsorbed using more polar solvents such as methanol and acetoni-
trile. After further purification by solvent partition column chromatography or
dialysis (Diaz et al., 1993), the extract is analyzed by one- or two-dimensional
TLC on silica gel plates with the latter being the Association of Official Analyti-
cal Chemists (AOAC)–approved method preferred for samples likely to contain
less than 0.1 μg AFM
1
/kg. However, an alternative method using an immunoaf-
finity column clean up followed by reverse-phase HPLC is equally sensitive and
has superseded two-dimensional TLC in many laboratories (Dragacci and Fremy,
1996). After ultraviolet detection at 365 nm, positive results can be confirmed
by rechromatographing the sample after trifluroacetic acid derivitization and in-
specting the chromatogram for specific end products.
More recently, immunochemical strategies have been developed for de-
tecting AFM
1
in milk and milk products (Fremy and Chu, 1989). Polyclonal and
monoclonal antibodies produced by conjugating AFM
1
to a protein before injec-
tion into rabbits have been adapted for use in radioimmunoassays (Sun and Chu
1977) and more recently enzyme-linked immunosorbent assays (Candlish et al.,
1985; Fremy and Chu, 1984) following extraction of AFM
1
from the product in
question. Several of these newer immunochemical methods have received AOAC
approval.
3. Clinical Importance
Concern regarding human exposure to aflatoxin is based on results from animal
feeding trials. Acute toxicity of aflatoxin is well documented in laboratory ani-
mals, with 50% of 1-day-old ducklings dying after receiving single doses of
AFB
1
, AFG
1
, AFB
2
, and AFG
2
at levels of 0.73, 1.18, 1.76, and 2.83 mg/kg body
weight, respectively (Wogan et al., 1971). Gross liver failure is the normal cause
of death in animal studies involving acute oral exposure to AFB
1
. Long-term
exposure to low levels of AFB
1
(i.e., 1 ppm) in feed usually leads to terminal
liver cancer with mutagenic and teratogenic effects also being widely recognized.
Studies assessing the toxicity of AFM
1
are far fewer because of limited
availability of AFM
1
in pure form. Allcroft and Carnaghan (1963) were first to
report that milk from cows that received aflatoxin-contaminated feed produced
liver lesions and kidney damage in day-old ducklings. Pathological changes in
the liver also were similar to those produced by AFB
1
. According to Pong and
Wogan (1971). AFM
1
was lethal to laboratory rats at a dose of 1.5 mg/kg body
weight, with death again resulting from acute liver failure. Overall, the hepatotox-
icity of AFM
1
in ducklings and rats appears to be similar or slightly less than
that of AFB
1
.
Like AFB
1
, AFM
1
is also a potent liver carcinogen. In early feeding studies
using rainbow trout, Sinnhuber et al. (1974) found that 60% of fish on a continu-
ous diet of 20 μg AFM
1
/kg body weight developed liver carcinomas within 12
Public Health Concerns 417
months. In another study by Cullen et al. (1985), four groups of laboratory rats
were maintained on diets containing 0, 0.5, 5, and 50 μg AFM
1
/kg with a fifth
control group receiving 50 μg AFB
1
/kg. Hepatocarcinomas developed in only
5% of rats receiving 50 μg AFM
1
/kg, whereas liver cancers were detected in
95% of the AFB
1
control group. Thus, AFM
1
appears to possess only about 5%
of the hepatocarcinogenic potential when compared to AFB
1
. Based on studies
using rhesus monkeys (Seiber et al., 1979), the carcinogenic potential of AFM
1
in humans is likely 10- to 100-fold less than that of AFB
1
.
4. Occurrence and Fate in Dairy Products
Ingestion of aflatoxin-contaminated animal feed leads to the excretion of AFM
1
in milk within 12–24 h (van Egmond, 1989a). However, only 0.4–2.2% of in-
gested AFB
1
appeared in milk as AFM
1
(Frobish et al., 1986; Patterson et al.,
1980). Levels of AFM
1
normally peak within 3–6 days and decrease to undetect-
able levels 2–4 days after exposure to contaminated feed is stopped. Assuming
that 6 kg of feed containing 10 μg AFB
1
/kg is consumed daily, dairy cows should
produce milk containing 0.02–0.07 μg AFM
1
/L (van Egmond, 1989b). However,
AFM
1
levels in milk fluctuate daily and vary between animals (Kiermeier et al.,
1977; Patterson et al., 1980; Veldman et al., 1992).
Milk surveillance programs for AFM
1
have been conducted in the United
States and elsewhere. During the fall of 1977, 43–80% of milk samples collected
in Alabama, Georgia, North Carolina, and South Carolina contained a trace to
greater than 0.7 μg AFM
1
/L, with a heavily contaminated corn crop being largely
responsible (Stoloff, 1980). Although the AFM
1
contamination rate has since
subsided, a similar peak in AFM
1
-positive milk samples was again observed in
late 1988 and early 1989 (van Egmond, 1989b), with a midsummer drought being
blamed for high levels of AFB
1
in midwestern feed corn. More recently, high
levels of aflatoxin also forced a Georgia dairy to recall more than 24,000 gal of
pasteurized dairy products during January of 1991 (Anonymous, 1991c).
In European surveys conducted during the late 1960s and 1970s, 11–82%
of the milk samples examined contained AFM
1
at levels of 0.2–6.5 μg/kg, with
fewer positive milk samples being recorded during the summer grazing period
(van Egmond, 1989b). Legislative action regarding maximum acceptable afla-
toxin levels, typically less than 0.5 μg/kg, has led to marked reductions in AFM
1
contamination levels, with less than 25% of samples from Austria, Belgium, Fin-
land, France, Greece, Ireland, Italy, Poland, Spain and the United Kingdom nor-
mally containing AFM
1
, mostly at very low levels. (Domagala et al., 1997; Food
Surveillance Information Sheet, 1996; Galvano et al., 1998; Markaki and Melis-
sari, 1997).
Sporadic contamination of the milk supply has raised concerns regarding
the fate and stability of AFM
1
during manufacture and storage of both nonfer-
418 Ryser
mented and fermented dairy products. Despite some variability in data reviewed
by Yousef and Marth (1989), the level and activity of AFM
1
in milk does not
appear to change appreciably as a result of pasteurization, sterilization, cold stor-
age, or freezing. Although AFM
1
is concentrated in nonfat dry milk, evaporated
milk, and freeze-dried milk during manufacture, the stability and activity of
AFM
1
is again relatively unaffected during concentration and drying. Because
AFM
1
is primarily water soluble, a natural partitioning of AFM
1
also occurs dur-
ing production of cream and butter. Typically, only approximately 10 and 2%
of the AFM
1
in milk appears in cream and butter, respectively, with the remainder
being shed in the two by-products—skim milk and buttermilk.
When cheeses such as Cheddar (Brackett and Marth, 1982b), Swiss (Stub-
blefield and Shannon, 1974), Parmesan (Brackett and Marth, 1982c), and Cam-
embert (Kiermeier and Buchner, 1977) are prepared from AFM
1
-contaminated
milk, the toxin partitions almost equally between the curd and whey, with the
higher than expected levels in curd presumably resulting from selective hy-
drophobic adsorption to casein. The end result is that AFM
1
levels in soft and
hard cheese are normally 2.5- to 3.3- fold and 3.9- to 5.8-fold higher, respectively,
as compared with original levels in the cheese milk (Yousef and Marth, 1989).
Little, if any, change in AFM
1
activity has been reported during cheese making
or ripening. However, proteolysis of casein during extended storage tends to in-
crease levels of AFM
1
detected (Brackett and Marth, 1982a).
In addition to AFM
1
-contaminated milk, growth of naturally occurring
aflatoxigenic molds on the surface of cheese is also of some public health concern,
because aflatoxin-positive cheeses have been detected during surveys in the
United States, western Europe, and north Africa. (Barrios et al., 1996, 1997; Piefri
et al., 1997; Scott, 1989). In several surface mold inoculation studies, AFB
1
and
AFG
1
diffused at least 4 cm into the cheese during storage (Park and Bullerman,
1983; Shih and Marth, 1972). Hence, simply scraping the mold from the cheese
surface does not necessarily render the product safe for consumption.
5. Prevention
Minimizing the presence of AFM
1
in milk and dairy products is entirely depen-
dent on careful control and monitoring of mold growth and AFB
1
levels in animal
feed. The United States requirement of less than or equal to 20 ng total aflatoxin
per gram of animal feed, if observed, will consistently yield acceptable milk
containing less than 0.5 ng (0.5 ppb) AFM
1
/g.
B. Bacillus cereus Food Poisoning
Aerobic, spore-forming bacteria resembling B. cereus have been suspected as
being agents of foodborne disease for many years, with at least six ‘‘B. cereus–
Public Health Concerns 419
like’’ outbreaks in Europe described before 1950 (Gilbert, 1979; Kramer and
Gilbert, 1989). However, early recognition of pathogenic bacilli other than B.
anthracis—the causative agent of anthrax—was not possible because of consid-
erable taxonomic confusion in the genus Bacillus. Realization that B. cereus was
a foodborne pathogen came in the early 1950s when the Norwegian investigator
Hauge (1950, 1955) described a series of four outbreaks involving 600 cases of
diarrheal illness that were traced to consumption of vanilla sauce prepared from
corn starch heavily contaminated with B. cereus. Even though the role of B.
cereus in this outbreak was proven in human volunteer feeding studies, conclu-
sive findings concerning direct involvement of two different toxins, namely, diar-
rheal enterotoxin (Goepfert et al., 1972; Spira and Goepfert, 1972) and emetic
enterotoxin (Melling et al., 1976), in two distinct forms of B. cereus poisoning
were not reported until the 1970s.
A common contaminant of the dairy environment and raw milk supply, B.
cereus also is one of several spoilage organisms responsible for ‘‘sweet curdling’’
(Overcast and Atmaram, 1974) and ‘‘bitty cream’’ (Cox, 1975). Despite the abil-
ity of this spore-forming organism to germinate and grow in refrigerated milk,
most recent outbreaks of B. cereus food poisoning in the United States (Bean et
al., 1996) and elsewhere (Kramer and Gilbert, 1989) have involved an entirely
different product, namely, Chinese food (primarily fried rice), with fewer than
10 cases being traced to dairy products (i.e., nonfat dry milk, cream, ice cream)
consumed in the United States (Holmes et al., 1981) and England (Galbraith et
al., 1982; Sockett, 1991). However, the ability of B. cereus to persist in powdered
milk and grow in the reconstituted product, as evidenced by a large outbreak in
Chile involving newborn infants (Cohen et al., 1984), has led to establishment
of rigid international standards for B. cereus in infant formula (Becker et al.,
1994).
1. General Characteristics
A member of the genetically diverse genus Bacillus, which contains more than
60 different species of aerobic and facultatively anaerobic, gram-positive, spore-
forming rods, B. cereus is larger than most other bacilli and also normally motile
by peritrichous flagella (Drobniewski, 1993; Kramer and Gilbert, 1989; Sneath,
1986). Endospores are produced in either a central or near-central position and
do not distend the sporangium. Unlike most other organisms discussed in this
chapter, B. cereus is a psychrotroph and therefore able to grow at temperatures
of 50°C to as low as 4°C (Dufrenne et al., 1995; Jaquette and Beuchat, 1998;
van Netten et al., 1990), with growth also occurring over a pH range of 4.4–9.3
and at a water activity (a
w
) of 0.92 in the presence of 7% NaCl. Typical isolates
grow both aerobically and anaerobically, reduce nitrate to nitrite, liquify gelatin,
hydrolyze casein and starch, utilize citrate, and produce a positive Voges-
420 Ryser
Proskauer reaction, with acid also being produced from glucose, fructose, malt-
ose, sucrose, salicin, trehalose, and glycerol; however, numerous exceptions have
been noted. Lecithinase activity, coupled with the inability to utilize mannitol
and resistance to polymyxin B, is most often used to identify suspect colonies
during primary isolation.
B. cereus normally produces several types of toxins including hemolysins,
proteases, phospholipases, cytotoxins (Christiansson et al., 1989), a heat-labile
diarrheal enterotoxin, and a heat-stable emetic toxin, the last two of which are
responsible for two distinct forms of food poisoning. Despite these many charac-
teristics, B. cereus is closely related to two other prominent bacilli, namely, B.
anthracis (the causative agent of anthrax) and B. thuringiensis (a well-known
insect pathogen), as shown by DNA hybridization studies. It is therefore often
difficult positively to identify. Thus far, 23 of 42 flagellar (H) B. cereus serotypes
have been linked to illnesses, with biotyping (based on biochemical properties),
phage typing, pyrolysis mass spectroscopy, and whole-cell fatty acid analysis
profiles proving to be useful in subtyping isolates obtained during epidemiologi-
cal investigations (Drobniewski, 1993; Lin et al., 1998; Valsanen et al., 1991).
2. Analysis of Dairy Products for B. cereus and Toxin
Most outbreaks of B. cereus poisoning have been traced to foods containing at
least 10
6
organisms/g. However, products such as nonfat dry milk frequently
contain small numbers of B. cereus spores, which can germinate when the milk
is reconstituted and grow to dangerous levels during storage.
When large numbers of B. cereus are expected, the suspect food is serially
diluted and surface plated on mannitol–egg yolk–polymyxin agar (MYP). Alter-
natively, a three-tube most probable number (MPN) method using trypticase soy–
polymyxin broth can be used for samples suspected of containing low levels of B.
cereus, with tubes showing growth similarly surface plated to MYP after 48 h of
incubation at 30°C (Harmon et al., 1992; Rhodehamel and Harmon, 1995). Pre-
sumptive B. cereus isolates on MYP after 24–48 h of incubation at 30°C appear
as large, spreading, pink (mannitol-negative) colonies surrounded by an opaque
halo indicating lecithinase activity. Selected isolates are then purified and con-
firmed as B. cereus based on anaerobic production of acid from glucose, nitrate
reduction, tyrosine decomposition, resistance to lysozyme, and a positive Voges-
Proskauer reaction. Tests for motility, rhizoid growth, hemolysin production, and
intracellular toxin crystals are also useful in differentiating the various groups of
B. cereus from B. thuringiensis and B. anthracis. Confirming an outbreak of B.
cereus poisoning is also dependent on demonstrating that the suspect isolate is
toxigenic. Rapid assays for detecting the emetic toxin are not yet available, and
current methods rely on monkey feeding trials and in vitro cell culture systems
(Drobniewski et al., 1993; Wong et al., 1988). However, a serologically based
Public Health Concerns 421
microslide gel double-diffusion assay has been developed for B. cereus strains
producing the diarrheal form of enterotoxin (Bennett, 1995), with several fluores-
cent-based immunoblot (Baker and Griffiths, 1995; Granum et al., 1993), reverse
passive latex agglutination assays (Granum et al., 1993; Griffiths, 1990), and visual
immunoassays (Odumeru et al., 1997) also being available commercially.
3. Clinical Manifestations
B. cereus is responsible for two distinct clinical syndromes of long and short
onset, both of which have involved dairy products. The so-called ‘‘diarrheal syn-
drome’’ resembles Clostridium perfringens food poisoning and results from a
proteinaceous, heat-labile diarrheal enterotoxin that is presumably produced dur-
ing growth of B. cereus within the small intestine (Donta, 1986; Drobniewski,
1993; Kramer and Gilbert, 1989). However, the precise mode of action of this
enterotoxin remains unclear. Within 8–16 h after ingesting a food containing
greater than or equal to 10
6
B. cereus cells/g, patients typically have abdominal
pain and cramps followed by a profuse watery diarrhea devoid of blood or mucus
occurring at 15- to 30-min intervals. Vomiting and fever are normally absent.
The entire illness is self-limiting, usually resolving within 12–24 h without com-
plications. The second syndrome caused by B. cereus, termed ‘‘emetic syn-
drome,’’ results from ingesting a heat-stable (90 min/126°C) emetic toxin, which
is preformed in the food and resistant to proteolysis. This syndrome resembles
staphylococcal poisoning in both symptoms and incubation period. After an onset
time of 15 min to 5 hs, nausea, vomiting, abdominal cramps, and less frequently
diarrhea develop, with these symptoms resolving within 1–5 h. Because both
syndromes are, by definition, intoxications of short duration, antibiotic therapy
is contraindicated and treatment is limited to fluid replacement and, in severe
cases, administration of antiemetics.
4. Outbreaks
As discussed, few dairy-related outbreaks of B. cereus poisoning have been re-
ported. The largest known of such outbreaks occurred in the Netherlands during
the late 1980s when nausea and diarrhea developed in 280 individuals 2–14 h
after consuming pasteurized milk containing 4 H11003 10
5
enterotoxigenic B. cereus
colony-forming units per milliliter (cfu/mL) (van Netten et al., 1990). Except
for a few scattered cases traced to feta cheese in Canada (Schmitt et al., 1976),
pasteurized cream in England (Galbraith et al., 1982; Gilbert and Parry, 1977),
milk in Romania (Gilbert, 1979), and ice cream in both England (Sockett, 1991)
and the former Soviet Union (Gilbert, 1979), most of the remaining outbreaks
have been small and typically linked to contaminated nonfat dry milk used as
an ingredient. Such reported outbreaks have involved Dutch vanilla pudding (Gil-
bert and Parry, 1977), a Norwegian yellow pudding dessert (Pinegar and Buxton,
422 Ryser
1977), Hungarian cream pastries (Pinegar and Buxton, 1977), and English ‘‘va-
nilla slice’’ pastries (Pinegar and Buxton, 1977). Three additional cases of B.
cereus–like food poisoning in Canada also have been attributed to use of nonfat
dry milk and malted milk powder as ingredients in unspecified home-prepared
foods (Schmitt et al., 1976).
Only one dairy-related outbreak of B. cereus poisoning has been reported
in the United States since this illness was first discovered in the early 1950s.
According to Holmes et al. (1981), the emetic form of B. cereus poisoning devel-
oped in eight individuals in Alabama after consuming macaroni and cheese at a
cafeteria. Investigators found that some of the product not served contained 10
8
–
10
9
B. cereus cfu/g, with the organism also being identified in powdered milk,
an ingredient used in preparing the macaroni and cheese. Improper heating and
refrigeration were deemed to be responsible for growth of B. cereus in the final
product before serving. One additional unusually large outbreak occurred in Chile
during May and June of 1981 when 35 neonatal cases of B. cereus diarrheal
syndrome were traced to infant formula prepared from contaminated powdered
milk (Cohen et al., 1984). Growth of B. cereus in infant formula during 12 and
24 h of refrigerated storage was subsequently confirmed. Follow-up studies using
suckling mice demonstrated that selected isolates were enterotoxigenic. The fact
that virtually all isolates were nontypeable further supports powdered milk as
being the source of B. cereus in this outbreak.
5. Occurrence and Survival in Dairy Products
Psychrotrophic spore-forming organisms belonging to the genus Bacillus are
common contaminants of raw milk produced in the United States and elsewhere.
Spores of B. cereus most often enter milk from soil, feces, bedding, cattle feed,
milking equipment, or udder during milking (Crielly et al., 1994; Giffel and
Beumer, 1998). However, B. cereus also can be shed in cow’s milk as a result
of mastitis (Horvath et al., 1986; Logan, 1988). One survey of raw milk from
Wisconsin demonstrated that 9% of the samples contained B. cereus at levels
less than or equal to 100 cfu/g (Ahmed et al., 1983a). Working in Scotland,
Griffiths and Phillips (1990) found psychrotrophic Bacillus spp. in 58% of the
raw milk supply. In addition, 39% of the isolates were identified as being B.
cereus, most of which produced diarrheal toxin (Griffiths, 1990). During a 2-
year survey in England, Crielly et al. (1994) also noted that B. cereus was more
commonly recovered from raw milk during the summer months at levels as high
as 10
5
cfu/mL, with similar observations also being made by other investigators
(McKinnon and Pettipher, 1983). Because B. cereus spores do not germinate in
raw milk, rapid growth of vegetative cells during periods of temperature abuse
is presumably responsible for the high incidence of this organism in summer
milk (Larson and Jorgensen, 1996; Phillips and Griffiths, 1986).
Public Health Concerns 423
Given the frequency of B. cereus in raw milk and the ability of B. cereus
spores to survive pasteurization and germinate (Stadhouders et al., 1980), it is
not surprising that this organism is also a common contaminant of pasteurized
milk. According to Ahmed et al. (1983a), 35% of pasteurized milk samples sold
in Wisconsin contained B. cereus at levels less than or equal to 1000 cfu/mL.
Elsewhere, the incidence of B. cereus in pasteurized milk is reportedly 2% in
China (Wong et al., 1988), H1102110% in Canada (Lin et al., 1998), 25–40% in the
Netherlands (Giffel et al., 1996; van Netten et al., 1990), 33% in Australia (Ran-
gasamy et al., 1993), and 56% in Denmark (Larsen and Jorgensen, 1996), with
levels generally being less than 1000 cfu/mL. Pasteurized milk is an excellent
source of enterotoxigenic strains with 59, 76, and 100% of milk isolates from
Norway (Granum et al., 1993), the Netherlands (Giffel et al., 1996), and Scotland
(Griffiths, 1990), respectively, producing toxins. Furthermore, Odumeru et al.
(1996) reported that 43 of 112 (38%) retail samples of Canadian pasteurized
milk were positive for B. cereus enterotoxin after being held at 10°C until their
expiration date. However, these same samples were negative for enterotoxin
when stored at 4°C.
Growth of enterotoxigenic B. cereus strains in pasteurized milk is well
documented (Christiansson et al., 1989; Griffiths, 1990; Wong et al., 1988), with
this organism exhibiting an average generation time of 17 h at 6°C (Griffiths and
Phillips, 1990). When naturally contaminated retail pasteurized milk was stored
at 7°C, van Netten et al. (1990) found that B. cereus attained levels of 10
3
–10
5
cfu/mL in 85% of samples by the ‘‘sell by’’ date. Furthermore, selected B. cereus
isolates from these samples also grew and produced enterotoxin in pasteurized
milk after 24, 12, and 2 days of incubation at 4, 7, and 17°C, respectively. When
Griffiths (1990) inoculated sterile reconstituted skim milk to contain 10
4
B. cereus
cfu/mL, the organism grew to 10
7
cfu/mL and produced detectable levels of toxin
after only 7 days of storage. Nonetheless, enterotoxin is generally confined to
pasteurized milk containing greater than 10
7
B. cereus cfu/mL, which accounts
for the lack of milkborne cases of B. cereus poisoning, and such milk frequently
shows obvious spoilage.
Presence of B. cereus in powdered milk probably poses the greatest public
health concern, because both pasteurization and spray drying induce germination
and outgrowth of spores in the reconstituted product. According to Rodriguez
and Barrett (1986), B. cereus was identified in five of eight (62.5%) dried milk
samples analyzed in California, with most larger European surveys yielding con-
tamination rates of 27–57% (Becker et al., 1994). B. cereus was similarly present
in 13–43% of nonfat dry milk–based infant formula manufactured in former
West Germany (Becker et al., 1994), with Rowen et al. (1997) also respectively
identifying B. cereus in 17 and 63% of dried and reconstituted infant formula
marketed in the United Kingdom. However, levels of B. cereus in these products
seldom exceeded 1000 cfu/g.
424 Ryser
Growth of B. cereus to hazardous levels in reconstituted nonfat dry milk
and infant formula is well documented. Using naturally contaminated reconstitu-
ted nonfat dry milk, Rodriguez and Barrett (1986) reported B. cereus populations
of more than 10
6
cfu/mL following 12–22 and 24–56 h of incubation at 30 and
20°C, respectively, with samples not yet showing signs of spoilage. However,
growth of the organism was generally prevented when identical samples were
stored at 5°C. Similar growth of B. cereus in reconstituted infant formula during
ambient storage has been reported (Becker et al., 1994; Rowan and Anderson,
1998). Because infants are particularly susceptible to B. cereus poisoning, a pro-
posal has been introduced in Europe to limit B. cereus levels in infant formula
to less than 1000 cfu/g (Becker et al., 1994), with even stricter standards being
likely to be enforced in the future.
B. cereus contamination is not confined to the aforementioned products,
with this pathogen also having been identified in cheese and evaporated whey
(Pirttijarvi et al., 1998). According to Ahmed et al. (1983a), B. cereus was recov-
ered from 14% of Cheddar cheese samples and 48% of ice cream samples tested
in Wisconsin, with contamination levels not exceeding 200 cfu/g in Cheddar
cheese and 3800 cfu/g in ice cream. Spores of B. cereus can survive in experimen-
tally produced Cheddar cheese for at least 52 weeks (Mikolajcik et al., 1973).
However, the pH of properly prepared Cheddar cheese (i.e., pH 5) is sufficiently
low to inhibit spore germination and growth of vegetative cells (van Netten et
al., 1990). Consequently, low levels of B. cereus in properly fermented dairy
products are of minimal public health concern.
6. Prevention
Widespread occurrence of B. cereus in the natural environment ensures continued
recovery of this organism from milk and other dairy products during all stages
of production. Unlike other milkborne pathogens to be discussed, heat-resistant
B. cereus spores readily germinate as a result of pasteurization with outgrowth
and enterotoxin production occurring in products stored at temperatures near re-
frigeration. However, because B. cereus populations greater than 10
5
cfu/g
(Langeveld et al., 1996) are invariably needed to induce illness, dairy-related
outbreaks of B. cereus poisoning are readily prevented by minimizing contamina-
tion of raw milk at the farm level and storing both fluid and reconstituted milk
at temperatures less than or equal to 4°C. Active starter cultures also minimize
growth of this organism during manufacture of fermented dairy products.
C. Botulism
One of the rarest and most fatal milkborne diseases, botulism, results from ingest-
ing minute amounts of a preformed neurotoxin produced by the bacterium Clos-
Public Health Concerns 425
tridium botulinum. This toxin, termed botulinal toxin, is 100,000 times stronger
than rattlesnake venom, with the human lethal dose estimated at 0.1–1.0 H11003 10
H110026
g (Hobbs, 1986). During the early 1800s, investigators in central Europe traced
the source of this illness to liver and blood sausage from which the term botulism
(from the Latin word botulus, meaning sausage), also known as ‘‘sausage poison-
ing,’’ is derived (Hauschild, 1989). The causative organism was first isolated and
named Bacillus botulinus by van Ermengem in 1896 after a Belgian outbreak
that was traced to home-cured ham. This organism was later reclassified as C.
botulinum.
Botulism is usually associated with consumption of low-acid (pH H11022 4.6)
foods such as home-canned vegetables, canned cured meats, fermented sausage,
and cured fish, which are packaged in air-tight containers, with dairy products
seldom being implicated (Hauschild, 1989). Only 6 of 971 (0.62%) botulism
outbreaks (26 of 2430 cases, or 1.07%) reported in the United States from 1899
to 1994 (Headrick et al., 1996; Solomon et al., 1995) were linked to dairy products
(all cheeses), with the last 8 United States cases being reported in 1993 (Meyer
and Eddie, 1951; Townes et al., 1996). Worldwide, only 13 dairy-related out-
breaks of botulism involving a total of 163 cases have been documented. Recent
work on milk products has focused on different means of preventing C. botulinum
growth and toxin production in processed cheese spread, a product that was re-
sponsible for one fatality in 1951 and a small outbreak in Argentina during 1974
(Briozzo et al., 1983).
1. General Characteristics
C. botulinum is the taxonomic designation given to a group of gram-positive,
strictly anaerobic, rod-shaped, spore-forming bacteria that produce a characteris-
tic neurotoxin (Hauschild, 1989). Most strains are motile by peritrichous flagella
and produce oval spores either centrally or subterminally, which distend the cell
wall (Cato et al., 1986). Although biochemically diverse, all isolates produce gas
from glucose and hydrolyze gelatin, with most strains also exhibiting lipase activ-
ity. Growth-limiting temperatures are 3.5 and 50°C; however, considerable varia-
tion has been observed between strains (Conner et al., 1989; Hauschild, 1989).
Although growth has been demonstrated in laboratory media at pH values as low
as 4.0, growth and toxin production do not generally occur in foods having a pH
less than 4.6, with some strains failing to grow at less than pH 5.0.
By definition, all C. botulinum strains produce at least one of seven anti-
genically distinct neurotoxins, designated types A, B, C, D, E, F, and G, with
some strains producing two toxins (e.g., types A and B, A and F, B and F, C
and D) (Conner et al., 1989; Hauschild, 1989). Biochemically, these toxins are
proteins ranging in molecular weight from 150,000 to 900,000 Ds. Toxin produc-
tion occurs intracellularly, with the toxin being released into the external environ-
426 Ryser
ment during logarithmic growth and subsequent cell lysis. Unlike staphylococcal
enterotoxin, all botulinal toxins are heat labile and rapidly destroyed by boiling.
Based on proteolytic activity and type of toxin produced, all C. botulinum isolates
can be divided into the following four groups: (a) proteolytic types A, B, and
F, (b) nonproteolytic types B, E, and F, (c) proteolytic and nonproteolytic types
C and D, and (d) proteolytic type G. Thus far, only those strains producing toxin
types A and B have been associated with dairy-related outbreaks of botulism,
with growth and toxin production at refrigeration temperatures being confined
to nonproteolytic type B strains.
2. Analysis of Dairy Products for C. botulinum
and Botulinal Toxin
Upon receipt of the sample, one portion is analyzed for viable C. botulinum or-
ganisms and a different portion is examined for botulinal toxin. Recovery of the
organism from dairy products begins with primary enrichment in cooked meat
medium (CM) at 26–28°C and trypticase-peptone-glucose-yeast extract broth
(TPGYE) at 35°C (Kauter et al., 1992; Solomon et al., 1995). After 7 days and,
if necessary, up to 17 days of incubation, both broth cultures are microscopically
examined for typical tennis racket–shaped, spore-forming bacteria resembling C.
botulinum. One portion of the positive broth culture is immediately centrifuged
and analyzed for botulinal toxin. The remaining portion is ethanol treated or heat
treated to eliminate the non–spore-forming background flora and then is surface
plated on liver–veal–egg yolk agar (LVEY) or anaerobic egg yolk agar (AEY)
to obtain isolated colonies. After 48 h of anaerobic incubation at 35°C, 10 C.
botulinum–like colonies are recultured in CM or TPGYE and then restreaked to
LVEY or AEY for purification.
Toxin analysis begins by macerating and then extracting the sample with
an equal volume of gel-phosphate buffer at pH 6.2 (Kauter et al., 1992; Solomon
et al., 1995). After centrifugation of the extracted food sample or aforementioned
broth culture, one portion of the supernatant liquid is treated with trypsin to acti-
vate botulinal toxins produced by nonproteolytic strains. After diluting a portion
of the trypsin-treated and untreated supernatant liquids 1:5, 1:10, and 1:100 in
gel-phosphate buffer, 0.5 mL of each preparation is injected intraperitoneally into
pairs of white mice; a boiled untrypsinized and undiluted preparation serves as
the control. During the next 48 h, the mice are observed for symptoms of botu-
lism, which include ruffled fur, labored breathing, limb weakness, total paralysis,
and death resulting from respiratory failure. However, death alone does not pro-
vide conclusive evidence that the preparation contained botulinal toxin. Establish-
ing the amount of toxin in the sample is dependent on some of the mice surviving.
The type of toxin in the sample can be determined by first injecting the mice
with monovalent antitoxins to types A, B, E, and F. Although not yet approved
Public Health Concerns 427
for official use, several enzyme-based immunosorbent assays for toxin detection
are available; thus circumventing the problems associated with animal tests.
3. Clinical Manifestations
Dairy-related botulism outbreaks have been confined to products (primarily
cheeses) containing toxin types A and B, which, together with type E found in
fish, comprise the most lethal of the seven known toxin types. The first symptoms
of botulism normally develop within 12–36 h of ingesting the preformed toxin
and include diarrhea, nausea, and vomiting followed by persistent constipation
(Donta, 1986; Hauschild, 1989; Smith, 1990). Soon after being absorbed by the
gastrointestinal tract, the toxin enters the bloodstream and begins to shut down
the peripheral nervous system by attaching to the tips of motor nerve endings,
which in turn prevents release of acetylcholine at neuromuscular junctions. Neu-
rological symptoms associated with this classic phase of the illness include
blurred and double vision; difficulty in speaking and swallowing; a dry mouth,
throat, and tongue; fatigue; lack of muscle coordination; and, in extreme cases,
total paralysis, with death by respiratory failure within as little as 24 h from initial
onset of gastroenteritislike symptoms. Because botulism can be confused with
Guillain-Barre′ syndrome, carbon monoxide poisoning, myasthenia gravis, and
other types of food poisoning, a quick and accurate diagnosis based on the pa-
tient’s clinical symptoms and case history is essential for proper treatment and
full recovery. Eventual confirmation of suspected cases is dependent on detecting
botulinal toxin or viable C. botulinum cells in appropriate clinical specimens.
Before antitoxins and modern mechanical respirators were available, at
least half of all victims died, making botulism the gravest of the milkborne dis-
eases. However, the fatality rate has been reduced to 5–15% in the United States
and most other industrialized countries (Donta, 1986; Hauschild, 1989; Smith,
1990). Initial treatment of botulism is focused on toxin removal or inactivation
by neutralizing circulating toxin with antitoxin before the toxin irreversibly binds
to the nerve endings. Induced vomiting, gastric lavage, and enemas are also used
to help rid the body of toxin. Subsequent treatments are directed toward counter-
acting paralysis of respiratory muscles with mechanical respirators, which are
required by 80% of victims in the United States. Chemotherapy is limited to
administration of guanidine, which is sometimes helpful in restoring nerve func-
tion. However, prolonged use normally leads to serious side effects.
4. Outbreaks
Historically, dairy products have been responsible for less than 1% of all food-
borne botulism cases, with only 13 outbreaks involving a total of 163 cases re-
ported worldwide since 1899. Before 1952, only six small dairy-related outbreaks
affecting 19 people (9 of whom died) were documented in the United States,
428 Ryser
with four outbreaks reported in California (1912, 1914, 1935, and 1951) and two
outbreaks occurring in New York (1914, 1939) (Meyer and Eddie, 1951). All of
these outbreaks were cheeseborne and traced to cheeses such as cottage, Lim-
burger, and Neufcha?tel prepared at home. In the 1914 New York outbreak, Nevin
(1921) reported that three people died after eating homemade cottage cheese
stored in sealed tins, with C. botulinum growth and toxin production demonstra-
ble in inoculated cottage cheese after 72 h of incubation at 37°C. In another
anecdotal account by Meyer and Eddie (1951), three botulism cases and one
death were traced to an ethnic-type curd cheese that was ripened below ground
in a buried canvas-covered crock; C. botulinum undoubtedly entered the product
from the soil. In 1951, a 53-year-old man died within 3 days of eating several
ounces of a pasteurized process soft-ripened Limburger cheese spread that report-
edly tasted peculiar (Meyer and Eddie, 1951). Subsequent tests with mice demon-
strated type B botulinal toxin in the remaining product, with 4 of 51 additional
jars of cheese spread also reportedly being toxic. Most recently, commercially
canned cheese sauce was traced to eight cases of type A botulism, including one
fatality in southern Georgia during October of 1993 (Townes et al. 1996). Follow-
up inoculation studies confirmed that the cheese sauce could support C. botulinum
growth and toxin production after 8 days of ambient storage.
The six remaining outbreaks occurred outside of the United States since
the 1970s. During July and August of 1973, ripened Brie cheese was epidemio-
logically linked to two simultaneous outbreaks of type B botulism: one in Mar-
seilles, France (32 cases) and the other in Switzerland (42 cases) (Gilles et al.,
1974; Kauf et al., 1974; Sebald et al., 1974). Surprisingly, no fatalities were
reported among the 75 cases. Although the implicated cheese was not available
for testing, all cheeses were ripened on the same batch of unclean straw in both
Marseilles and Switzerland, thereby providing a plausible means of contamina-
tion. Toxin production in the rind of similarly ripened cheeses was later demon-
strated experimentally (Billon et al., 1980).
Early in 1974, Argentinian authorities reported that a commercially pro-
duced cheese spread containing onions was responsible for six cases of type A
botulism, including three deaths, in Buenos Aires (Briozzo et al., 1983). Investi-
gators eventually blamed the outbreak on several cheese formulation deficiencies,
including an overly high moisture content and pH, which permitted C. botulinum
growth and toxin production.
The fourth dairy-related outbreak of botulism occurred in 1989 and in-
volved 27 cases (including one death); it was unusual in several respects
(Critchley et al., 1989; O’Mahony et al., 1989). First, the outbreak originated in
the United Kingdom, a country that has seen only nine cases of foodborne botu-
lism since 1922 with no cases being traced to milk or dairy products. Second,
hazelnut yogurt, a very unusual product (i.e., pHH110214.6, refrigerated) never before
associated with botulism, was identified as the cause of this epidemic. Third,
wide sales distribution of the product led to patients seeking treatment at different
Public Health Concerns 429
hospitals. Investigators identified type B botulinal toxin and later type B C. botuli-
num in opened and unopened cartons of hazelnut yogurt as well as in one fecal
specimen and in a blown can of hazelnut conserve. All implicated lots of hazelnut
yogurt and conserve were recalled and warnings were issued to the general public.
Thermal processing of the hazelnut conserve was later shown to be inadequate
for destruction of C. botulinum spores, with C. botulinum growth and toxin pro-
duction occurring in these cans of product during long-term storage. The last
two reported outbreaks were traced to two different cheeses, an Iranian cheese
responsible for 27 cases of type A botulism, including one fatality, in northern
Iran (Pourshafie et al., 1998) and a commercially produced Mascarpone cheese
that led to a single fatal case of type A botulism in Italy (Spolaor 1996). In
a follow-up survey, 327 of 331 samples from two different production lots of
Mascarpone cheese contained C. botulinum type A, 7 samples of which also
yielded type A toxin. Other naturally contaminated cheeses containing H1102110
spores/g became toxic after 3 days of storage at 28°C. (Franciosa et al., 1999).
5. Occurrence and Survival in Dairy Products
Spores of C. botulinum are widespread in the natural environment, with soil serv-
ing as the primary reservoir (Hauschild, 1989; Smith, 1990). Consequently, vege-
tation, animal feed, and fresh produce are most frequently contaminated. Few
domestic farm animals, including dairy cattle, are fecal carriers of C. botulinum;
this organism also is not known to cause mastitis in ruminant animals.
Spore-forming bacteria, including C. botulium, are frequent contaminants
of raw and pasteurized milk. Although these spores readily survive pasteurization
as evidenced by several spore-related defects, toxin production in raw and drink-
able pasteurized milk does not occur because of the product’s short refrigerated
shelf life and the inability of this organism readily to compete with the native
psychrotrophic background flora (Glass et al., 1999). However, Kaufmann and
Brillaud (1964) found that C. botulinum types A and B did grow and produce
toxin in cans of sterilized skim milk after 46–56 days of storage at 13°C. Read
et al. (1970) also reported growth and toxin production by C. botulinum type E
in inoculated cans of commercially sterilized whole milk after 3–28 days of stor-
age at 20°C, with one sample being toxic after 70 days of incubation at 7.2°C.
However, C. botulinum type E is typically confined to fish products and has never
been associated with dairy products.
The aforementioned fatalities in 1951 and 1974 involving processed cheese
spread prompted extensive investigations into the safety of these anaerobically
packaged, long–shelf life products. In a series of three studies by Wagenaar and
Dack (1958a, 1958b, 1958c), C. botulinum growth and toxin production was
related to the pH, moisture, a
w
, and salt content of process cheese spreads prepared
from three different varieties of surface-ripened cheeses, with the toxin in these
cheeses being stable for 2–4 years (Grecz et al., 1965). Several subsequent inves-
430 Ryser
tigators (Briozzo et al., 1983; Kauter et al., 1979) reported toxin production in
inoculated samples of commercially prepared pasteurized process cheese spread
having a pH greater than or equal to 5.70 and an a
w
greater than or equal to 0.936,
suggesting that these products should be classified as low-acid foods (pH H11022 4.6,
a
w
H11022 0.85). However, when Tanaka et al. (1979) prepared pasteurized processed
cheese spread according to the United States federal standards of identity (52%
moisture, 2% sodium chloride, and 2.5% disodium phosphate), inoculated sam-
ples remained nontoxic during 11 months of storage at 30°C. Given these parame-
ters, toxin development would not be expected in such cheese spreads having an
a
w
less than 0.95 (Hauschild, 1989). The fact that the cheese spread implicated
in the Argentinian outbreak had an a
w
of 0.97 (Brizzo et al., 1983) further supports
this conclusion. However, production of nontoxic process cheese spreads con-
taining less salt or up to 60% moisture is also possible by decreasing the pH and
increasing the level of various phosphates, which in turn lowers the a
w
(Eckner
et al., 1994; Karahadian et al., 1985; Tanaka et al., 1986). Furthermore, direct
addition of nisin, a bacteriocin produced by Lactococcus lactis subsp. lactis that
prevents germination of C. botulinum spores, to process cheese spreads at levels
up to 250 ppm affords additional protection against C. botulinum growth and
allows production of reduced sodium and sodium chloride–free spreads (Somers
and Taylor, 1987). Several microbial models also have been published which
assess the impact of cheese composition on outgrowth of C. botulinum and toxin
production (Ter Steeg and Cuppers, 1995; Ter Steeg et al., 1995).
6. Prevention
The few reported botulism cases traced to dairy products have primarily involved
anaerobically packaged cheeses, with process cheese spreads being of greatest
concern. Although contamination of such products with spores of C. botulinum
cannot be prevented, the threat of toxin production can be eliminated by carefully
controlling the pH, moisture content, a
w
, phosphate level, and nisin content of the
finished product. Furthermore, most dairy-related botulism cases have involved
proteolytic strains of C. botulinum types A and B, with the implicated products
showing obvious signs of spoilage. Such products in swollen containers should
be immediately discarded and never tasted. Continued Food and Drug Adminis-
tration (FDA) enforcement of established governmental standards for preventing
C. botulinum growth and toxin production in high-risk foods also plays an impor-
tant role in preventing future dairy-related outbreaks of botulism, seven non-
complying cheese products were recalled since 1990 without incident.
D. Brucellosis
Human brucellosis, a classic zoonosis presumably prevalent in the Mediterranean
countries since antiquity (Anonymous, 1995a; Tarala, 1969), is primarily ac-
Public Health Concerns 431
quired through direct or indirect contact with infected animals harboring three
of six bacterial species belonging to the genus Brucella. Two of these species,
Brucella melitensis and B. abortus, are pathogenic to goats and sheep and to
cattle, respectively, and are consequently of major concern to the dairy industry.
The remaining species, B. suis, is primarily found in pigs and, as such, has been
only rarely associated with milkborne cases of brucellosis (Horning, 1935). In
1887, while working as a British naval surgeon on the island of Malta, Bruce
was first to isolate an organism from four fatal cases of a disease he termed
‘‘Malta fever,’’ now commonly known as undulant fever. By 1904, Maltese
goat’s milk was confirmed as the source of infection (Hammer, 1938; Rammell,
1967; Tarala, 1969), with the causative organism, B. melitensis, still recognized
as the Brucella sp. most pathogenic for goats, sheep, and humans (Hendricks and
Meyer, 1975). Although probably present since Biblical times, the second of
these two organisms was not identified until 1895 when the Danish veterinarian
Bang identified B. abortus as the causative agent of contagious abortion (Bang’s
disease), an economically devastating affliction in dairy cattle. However, the
close relationship between B. abortus and B. melitensis was not recognized until
1918, when Evans linked cow’s milk to cases of undulant fever in the United
States (Hammer, 1938; Stiles, 1989).
1. General Characteristics
All six Brucella spp. are small, nonmotile, coccobacilli or short rod-shaped,
gram-negative bacteria that are found singly, in pairs, and in short chains (Moyer
and Holcomb, 1995). Both B. melitensis and B. abortus are intracellular parasites
that localize and grow within the rough endoplasmic reticulum of nonphagocytic
host cells. Although able to grow aerobically at 10–40°C, with optimal growth
occurring at 37°C, some strains grow better in an atmosphere containing 5–10%
CO
2
. Brucellae are nutritionally fastidious and require biotin, pantothenic acid,
thiamine, nicotinamide, trace amounts of magnesium, and occasionally bovine
serum for growth. Consequently, propagation on ordinary solid media can be
difficult. Biochemically, B. melitensis and B. abortus are catalase positive, oxi-
dase positive, and metabolically oxidative (Moyer and Holcomb, 1995). Despite
some cultural, biochemical, serological, and host differences among the brucellae,
DNA-DNA hybridization and ribotype analyses (Anonymous, 1988a) indicate
that all six currently recognized Brucella spp. are closely related and comprise
only one genospecies, B. melitensis.
2. Clinical Manifestations
Human brucellosis, which ranges from a mild flu-like illness to a severe disease
(undulant fever), defies easy diagnosis because of differences in reported symp-
toms (Dalrymple-Champneys, 1960; Young, 1983). Even an increasing and de-
432 Ryser
creasing temperature, the symptom for which undulant fever is named, may not
always occur. The severity of brucellosis is partially dependent on the species
involved, with B. melitensis being most pathogenic for humans, followed by B.
suis and B. abortus. Onset of symptoms can be either abrupt or gradual following
a normal incubation period of 3–21 days. However, incubation periods of 7–10
months also have been reported (Moyer and Holcomb, 1995). Brucellosis patients
typically have multiple complaints but show few physical abnormalities. Symp-
toms associated with the sudden-onset form of brucellosis have included pyrexia,
profuse sweating, chills, weakness, malaise, various aches, chest and joint pain,
weight loss, and anorexia, with physical findings limited to disturbances of the
spleen and lymphatic system (Dalrymple-Champneys, 1960; Young, 1983). Os-
teomyelitis is the most common complication from B. melitensis infection fol-
lowed by skeletal, genitourinary, cardiovascular, and neurological complaints
(Young, 1983). Victims of the gradual-onset, chronic form of brucellosis exhibit
long histories of recurrent fever and depression, malaise, headaches, sweating,
vague pains, impotence, and insomnia, with eventual incapacitation also being
reported (Stiles, 1989).
Slow growth of brucellae on laboratory media frequently delays primary
isolation of the organism, with fewer than 20% of all cases initially being con-
firmed by recovering Brucella spp. from blood, bone marrow, or infected tissues
(Stiles, 1989). Consequently, preliminary diagnosis is normally based on serolog-
ical findings (Young, 1991a). Treating brucellosis with antibiotics is also difficult,
because the organism is localized intracellularly. Therefore, combined oral ad-
ministration of several antibiotics with high intracellular activity, such as tetracy-
cline, streptomycin, rifampin, or trimethoprim-sulfamethoxazole (Street, 1975;
Young, 1983; Young and Suvannoparrat, 1975), is the prescribed cure for typical
Brucella infections.
3. Outbreaks
Worldwide, brucellosis remains one of the most widespread and costly diseases
afflicting humans and animals, with this disease presently endemic in northern
Mexico (Salman and Meyer, 1984; Teclaw et al., 1985; Thapar and Young, 1986;
Young, 1991b) as well as many South American (Wallach et al., 1994), Latin
American (Wallach et al., 1994), Mediterranean (Anonymous, 1995a), Middle
Eastern (Anonymous, 1995a; Nour, 1982; Sabbaghian and Nadim, 1974), and
African countries (Anonymous, 1995a; Cherif et al., 1986; Fakuuzi et al., 1993).
Consumption of unpasteurized dairy products, including milk (Foley, 1970),
cream (Barrow et al., 1968), and cheese (Anonymous, 1995a; Galbraith, 1969;
Hammer, 1938; Rammell, 1967; Young and Suvannoparrat, 1975) has tradition-
ally accounted for approximately 10% of all reported brucellosis cases (Anony-
mous, 1972; Stiles, 1989), with the remainder occurring primarily among veteri-
Public Health Concerns 433
narians, farmers, and meat processors who contract the disease through direct
contact with infected livestock (Wallach et al., 1997).
Mandatory pasteurization of milk and highly effective brucellosis eradica-
tion programs for livestock have drastically reduced the number of reported cases
in the United States from more than 600 in 1945 to 119 in 1994 and 79 in 1998,
giving an annual incidence rate of one case for every 2 million people. Although
brucellosis occurs throughout the United States, this disease has a long history
in the American southwest (Anonymous, 1994c) and among Hispanic people who
become infected after consuming unpasteurized milk (Schlusser et al., 1997) and
certain types of soft unripened cheese produced in Mexico (Eckman, 1975). El
Paso, TX, was the site of three separate brucellosis outbreaks in 1968 (Seyffert
and Bernard, 1969), 1973 (Street et al., 1975; Young and Suvannoparrat, 1975),
and 1983 (Tharper and Young, 1986), all of which involved consumption of
Mexican-produced raw goat’s milk cheese. A similar outbreak involving 31 pri-
marily Hispanic patients who consumed fresh goat’s milk cheese (queso blanco)
illegally imported from Mexico occurred in Houston, TX, during 1983 (Thapar
and Young, 1986)—a year in which 84 brucellosis cases were reported to the
Texas Department of Health (Thapar and Young, 1986). Three of four Mexican
border states, namely, Texas, Arizona, and California, respectively, accounted
for 29, 17, and 36 of the 119 (69%) brucellosis cases reported nationally in 1994
(Anonymous, 1994c), with many of these ongoing sporadic cases (Schlusser et
al., 1997) presumably being linked to consumption of illegally imported raw milk
Mexican cheese.
In England and Wales, dairy-related brucellosis outbreaks have been virtu-
ally eliminated after instituting similar programs for brucellosis eradication in
livestock and mandatory pasteurization of milk (Barrett, 1989). Only 17 cases
of milkborne brucellosis were reported in England and Wales from 1950 to 1989
(Galbraith et al., 1982; Sockett, 1991), of which 10 cases were linked to raw
cow’s milk containing B. abortus and 7 cases to B. melitensis in raw pecorino
sheep cheese imported from Italy (Galbraith et al., 1969). However, at least nine
additional people also reportedly contracted brucellosis after returning from Spain
and the Middle East (Barrett, 1986; Porter and Smith, 1971), with raw sheep’s
milk, raw goat’s milk, and goat’s milk cheese being the probable vehicles of
infection. Even though the number of brucellosis cases in England and Wales
presently appears to be increasing, with 49 cases reported from 1992 to 1995, at
least 28 of these cases were acquired abroad during visits to Malta, Spain, Portu-
gal, France, Italy, Greece, Bosnia, Turkey, Egypt, Israel, Jordan, Qatar, Oman,
Pakistan, Somalia, and Tanzania (Anonymous, 1995a), with many of these cases
presumably being milkborne or cheeseborne. Two of these cases were linked to
a massive outbreak in Malta during the first half of 1995 involving 135 cases of
B. melitensis brucellosis in which soft cheese prepared from unpasteurized
sheep’s and goat’s milk was identified as the vehicle of infection (Anonymous,
434 Ryser
1995a). Sporadic dairy-related cases of brucellosis continue to occur in western
Europe (Vogt and Hasler, 1999), with one unusually large 1994–1995 outbreak
of 81 cases in Spain being traced to fresh unpasteurized cottage-type cheese that
was prepared from infected ewe’s milk (Castell et al., 1996). Consequently, trav-
elers to areas where brucellosis is endemic should consider avoiding raw milk
and cheeses prepared from raw milk.
4. Occurrence and Survival in Milk and Dairy Products
Information concerning the incidence of brucellae in the raw milk supply is gener-
ally lacking, with only one Mexican survey reporting a Brucella contamination
rate of 2.3 and 4.2% for raw cow’s and goat’s milk, respectively (Acedo et al.,
1997). However, contamination rates are presumably even lower in countries
with well-developed brucellosis eradication programs. Within infected herds,
brucellae can persist in the udders of cows for many years following an abortion
and can be intermittently shed at levels up to 15,000 organisms/mL for as long
as 5 months (Rammell, 1967). When naturally contaminated raw milk is held at
25–37°C, Brucella populations typically decrease to nondetectable levels within
2–3 days (Kuzdas and Morse, 1954; Mitscherlich and Marth, 1984). However,
brucellae survive at least 42 and 800 days when such milk is stored at 4°C
(Mitscherlich and Marth, 1984) and H1100240°C (Kuzdas and Morse, 1954), respec-
tively.
Cream and butter are unusual sources for Brucella spp., with only 5 of 916
cream samples being positive in one outbreak-related survey (Barrow et al.,
1968). However, both products can support extended survival of brucellae, with
B. melitensis and B. abortus persisting 4 and 6 weeks, respectively, in inoculated
cream stored at 4°C (Rammell, 1967). More recently, Brucella spp. reportedly
survived 94–102 days and greater than 140 days in inoculated cream that was
stored at 20–25°C and 2–4°C, respectively (Nour, 1982); this further confirms
the increased persistence of Brucella at refrigeration temperatures. According to
several reports referenced by Rammell (1967), brucellae can survive even longer
in refrigerated butter (King, 1957); persisting 6–13 months in salted and unsalted
butter, respectively (Fulton, 1941).
As is true for cream and butter, brucellae have become virtually nonexistent
in domestic and imported cheeses sold legally in the United States. This is not
true for dairy products sold in Mexico, Argentina, and many of the Mediterranean
and Middle Eastern countries, as evidenced by the many aforementioned dairy-
related brucellosis cases. One recent Mexican survey identified Brucella spp. in
25 of 335 soft white cheeses (Acedo et al., 1997), whereas another survey from
Turkey (Sancak et al., 1993) indicated that 7 of 40 raw sheep’s milk cheeses
contained B. melitensis or B. abortus.
Public Health Concerns 435
Long-term survival of Brucella in many cheese varieties has been recog-
nized since the 1940s (Rammell, 1967). B. abortus survived 6 days in Emmental
and Gruye`re, 15 days in Tilsit, and 57 days in Camembert cheese prepared from
milk inoculated to contain 10,000 brucellae/mL (Ka¨stli and Hausch, 1957). This
organism also persisted 90 days in pecorino cheese (Rammell, 1967) and up to
60 days in Roquefort cheese (King, 1957). When Cheddar cheese was prepared
from milk containing 1000 B. abortus cfu/mL and ripened at 4°C, the organism
remained viable for 6 months (Gilman et al., 1946). Most recently, traditional
manufacturing practices failed to eliminate B. abortus from Mexican white soft
cheese during 21 days of storage at 5°C (Diaz Cinco et al., 1994). Even though
these studies raise serious concerns regarding the safety of raw milk cheeses,
standard vat and high-temperature, short-time pasteurization (Bryan, 1979) both
inactivate Brucella populations in milk with a very large margin of safety.
5. Prevention
Preventing dairy-related cases of brucellosis is based on eliminating this disease
in animals through immunization programs, slaughtering of infected animals,
mandatory pasteurization of milk, and aging of cheeses that can legally be pre-
pared from raw milk for at least 60 days. Even though this disease has been
largely controlled in the United States, the recent upsurge of cases along the
United States–Mexican border, combined with increased reports of British citi-
zens acquiring this disease abroad, indicates that travelers to areas where brucel-
losis is endemic should avoid consuming raw milk as well as fresh cheeses (par-
ticularly goat’s milk cheese) prepared from unpasteurized milk.
E. Campylobacteriosis
Although recognized since 1909 as an important cause of abortion in cattle and
sheep (Stern and Kazmi, 1989), Campylobacter jejuni—the causative agent of
campylobacteriosis—remained an obscure human enteric bacterial pathogen until
the late 1970s. Improved isolation strategies (Dekeyser et al., 1972) leading to
recovery of Campylobacter from 7.1% of randomly selected patients with diar-
rhea (Skirrow, 1977) suggested that this organism was of more than passing im-
portance in human gastroenteritis. Although generally considered a sporadic ill-
ness with a propensity for children, 45 foodborne campylobacteriosis outbreaks
(1308 cases) were reported in the United States between 1978 and 1986, over
half of which involved ingestion of raw milk (Anonymous, 1998b). Similar re-
ports linking raw or inadequately pasteurized milk to 13 outbreaks in Great Brit-
ain from 1978 to 1980 (Robinson and Jones, 1981) helped to further substantiate
C. jejuni as an important milkborne pathogen. In 1998, the overall incidence rate
436 Ryser
for Campylobacter infections (19.7/100,000 population) exceeded Salmonella in-
fections (13.9/100,000 population) (FoodNet, 1998), with an estimated 2 million
annual cases of this non-notifiable disease in the United States (DeMol, 1994).
Given similar reports from Canada (Lior, 1994a), Europe (Stringer, 1994), and
developing countries (Taylor, 1992), campylobacteriosis has come to rival or
surpass salmonellosis as the leading form of human gastroenteritis worldwide.
1. General Characteristics
The genus Campylobacter (Greek for ‘‘curved rod’’) includes 18 species and
subspecies within the family Campylobacteraceae, with six of these organisms
identified as threats to human health (Hunt and Abeyta, 1995; Nachamkin, 1995).
Two seldom differentiated species, C. jejuni subsp. jejuni (hereafter C. jejuni)
and Campylobacter coli, are well-recognized causes of human foodborne gastro-
enteritis, with the former accounting for approximately 90% of such cases (Hunt
and Abeyta, 1995). Of the four remaining species, C. upsaliensis, C. lari, and
C. hypointestinalis have been only recently linked to sporadic gastrointestinal
disorders, and C. fetus subsp. fetus is primarily associated with bacteremia and
systemic infections in patients with underlying illnesses.
Morphologically, all campylobacters are small, gram-negative, curved, S-
shaped or spiral rods, which are motile by means of a single polar flagellum. All
species of the genus are oxidase-positive, urease-negative, and both methyl red-
and Voges-Proskauer–negative. Of the six aforementioned species of concern to
humans, all produce catalase (Nachamkin, 1995) and all except C. fetus grow
optimally at 42°C. However, all campylobacters are obligate microaerophiles
and, as such, require an atmosphere of 5% O
2
, 10% CO
2
, and 85% N
2
for optimal
growth.
2. Isolation and Identification
High numbers of Campylobacter are normally present in human diarrheal speci-
mens, and microaerobic incubation of such samples streaked on commonly used
selective media such as Skirrow’s medium and charcoal cefoperazone deoxycho-
late agar allows for relatively simple recovery of the organism (Nachamkin,
1995). However, isolation of Campylobacter from raw milk is far more challeng-
ing because the organism is likely to be greatly outnumbered by the normal bacte-
rial flora of the milk. Consequently, selective enrichment under microaerobic
conditions became a crucial initial step in all early procedures for recovering
Compylobacter from raw milk (Doyle and Roman, 1982a; Hunt et al., 1985;
Lovett et al., 1983). All three methods currently recommended for detecting
Campylobacter in raw milk (Flowers et al., 1992a; Hunt et al., 1998; Stern et al.,
1992) are complicated and require initial centrifugation of the raw milk sample,
selective enrichment of the pellet at 42°C under microaerobic conditions (5% O
2
,
Public Health Concerns 437
10% CO
2
, 85% N
2
), and subsequent plating on two selective media followed by
similar incubation. The FDA procedure for dairy products (Hunt et al., 1998)
also includes a 4-h microaerobic preenrichment step at 37°C, followed by 24 h of
incubation at 42°C with continuous shaking. Suspect isolates (round to irregular
spreading colonies with smooth edges) obtained using these procedures are then
examined microscopically for morphological characteristics and motility and sub-
sequently speciated using a standard series of biochemical tests in addition to
resistance to nalidixic acid and cephalothin. Alternatively, several DNA probe–
based diagnostic kits and antibody-based assays are now commercially available
for identifying positive samples (Feng, 1998).
3. Clinical Manifestations
Campylobacter enteritis affects all age groups but is particularly common among
children. Most dairy-related cases of campylobacteriosis are presumably acquired
indirectly through consumption of raw milk with person-to-person infections in-
frequent and normally limited to young children with acute diarrhea. Typical
attack rates of at least 50% in milkborne outbreaks suggest that the oral infective
dose is relatively low. Robinson (1981) and Block et al. (1978) confirmed that
ingesting as few as 500 to 800 total cells of C. jejuni can induce illness after the
normal 2- to 5-day incubation period with the infective rate, severity of illness,
and incubation period remaining unaltered as the oral infective dose increases to
as many as 2H1100310
9
organisms. However, routine consumption of raw milk lowers
the attack rate and results in partial immunity to symptomatic infections (Blaser
et al., 1987).
Flu-like symptoms develop in approximately one-third of patients suffi-
ciently ill to seek medical attention; symptoms include a mild fever that occurs
2–3 days before appearance of diarrhea, which likely represents the initial inva-
sive and sometimes septicemic stage of infection (Nachamkin, 1995). A few such
individuals may also experience severe prediarrheal appendicitis-like abdominal
pain, which can lead to unnecessary surgery. Onset of diarrhea is sudden and
can be severe, with development of profuse watery stools through action of a
heat-labile cholera-like toxin produced by most strains of C. jejuni and C. coli.
Bloody diarrhea sometimes develops, which mimics ulcerative colitis caused by
shigellae. Various extraintestinal complications including bacteremia, reactive
arthritis, bursitis, urinary tract infections, meningitis, endocarditis, peritonitis, and
pancreatitis can occur among elderly and immunocompromised adults as can
occasional fatalities. Abortion and neonatal septicemia have been cited as compli-
cations affecting pregnant women (Blaser, 1990). Two additional complications,
namely, Guillain-Barre′ syndrome (Mishu and Blaser, 1993) and acute motor axo-
nal neuropathy (McKhann et al., 1993), also were reported in Japan and China,
respectively, with a single serotype of C. jejuni appearing to be responsible.
438 Ryser
Presumptive diagnosis of Campylobacter enteritis is based on direct micro-
scopic observation of Campylobacter-like organisms in stool specimens with
campylobacteriosis being confirmed by isolating the organism on selective plat-
ing media. Although most patients spontaneously recover within 3–7 days, fluid
replacement and oral administration of erythromycin or fluoroquinolones for 7–
10 days may be needed for more severely ill patients (DeMol, 1994). Patients
typically stop shedding the organism after 1–3 months. However, a small percent-
age of individuals remain chronic fecal carriers of C. jejuni and C. coli, thereby
retaining the ability to infect others.
4. Outbreaks
Evidence for C. jejuni as a foodborne pathogen dates back to 1938 when
milk (possibly raw) was epidemiologically linked to 357 cases of gastroenteritis
among inmates of two Illinois prisons (Levey, 1947). Supporting evidence
included isolation of organisms resembling Vibrio jejuni (C. jejuni) from blood
and stool samples, appearance of symptoms compatible with present-day campy-
lobacteriosis, and the fact that the outbreak ceased after incriminated milk
was boiled. Nevertheless, poor isolation techniques during these early days de-
layed identifying C. jejuni as a prominent foodborne pathogen for more than 40
years.
The foodborne route for Campylobacter infection was not suggested again
until 1976 when Taylor et al. (1979) identified four Los Angeles residents who
presumably acquired campylobacteriosis after consuming certified raw milk. Be-
ginning in 1978, raw milk–related outbreaks were recorded in the United States,
with many more accounts being documented up to 1985 (Table 4). Raw milk
consumption was implicated in 14 of 23 outbreaks (621, or 83% of 748 cases)
reported from 1980 to 1982, with four of these outbreaks involving children
(Finch and Blake, 1985). Fourteen of 20 raw milk–related outbreaks documented
from 1981 to 1990 (Wood et al., 1992) were traced to children in kindergarten
through third grade who became ill after returning from spring and fall field trips
to dairy farms. Although sporadic outbreaks still occur, the incidence of milk-
borne campylobacteriosis in the United States has decreased as a result of the
1987 ban on interstate sale of raw milk and decreasing sales of raw milk intrastate
(Headrick et al., 1998).
Campylobacteriosis simultaneously emerged with similar force in Great
Britain, with 27 outbreaks from 1978 to 1984 and 5 outbreaks from 1992 to 1996
(Djuretic et al. 1997) linked to consumption of raw or inadequately pasteurized
milk (Hutchinson et al., 1985b; Robinson and Jones, 1981). Two additional out-
breaks also were recorded in Switzerland (Stadler et al., 1983) and New Zealand
(Brieseman, 1984) during the early 1980s, the former of which involved more
than 500 joggers running a race.
Public Health Concerns 439
Table 4 Campylobacteriosis Outbreaks Resulting from Ingestion of Raw Milk in the
United States, Canada, and Britain
Number
Location Year of cases Reference
United States
California 1976 4 Taylor et al. (1979)
Colorado 1978 3 Anonymous (1978)
Oregon 1980–1981 77 Terhune et al. (1981)
Minnesota 1981 25 Korlath et al. (1985)
Arizona 1981 200 Taylor et al. (1982a)
Kansas 1981 264 Kornblatt et al. (1985)
Georgia 1981 50 Potter et al. (1983)
Wisconsin 1982 15 Klein et al. (1986)
Oregon 1982 22 Blaser et al. (1987)
Vermont 1982 15 Vogt et al. (1984)
Pennsylvania 1983 26 Anonymous (1983)
Pennsylvania 1983 57 Anonymous (1983)
Vermont 1983 5 Hudson et al. (1984)
California 1984 12 Anonymous (1984a)
California 1985 23 Anonymous (1986)
Vermont 1986 28 Birkhead et al. (1988)
Canada
Ontario 1980 14 McNaughton et al. (1982)
Great Britain
England 1978 63 Robinson et al. (1979)
England 1978 22 Robinson et al. (1979)
England 1979 2500 Jones et al. (1981)
Scotland 1979 148 Porter and Reid (1980)
England 1981 46 Wright and Tillett (1983)
England 1981 22 Wright and Tillett (1983)
England 1985 75 Hutchinson et al. (1985a, 1985b)
England 1992 72 Morgan et al. (1994b)
England 1994 23 Evans et al. (1996)
Despite the many aforementioned outbreaks, confirmation of raw milk as
the source of infection has remained difficult. Only three reports have appeared
in which the epidemic strain was recovered from a portion of the lot of milk that
was consumed (Bradbury et al., 1984; Patton et al., 1991; Salama et al., 1990);
such strains were more commonly identified in fecal samples from incriminated
dairy herds (Hutchinson et al., 1985b; Kornblatt et al., 1985; Potter et al., 1983;
Stadler et al., 1983; Vogt et al., 1984), thus suggesting that milk was contaminated
during or after milking. However, at least four campylobacteriosis outbreaks in
440 Ryser
England were traced to glass-bottled pasteurized milk that was pecked by birds
(Hudson et al., 1990; Riordan et al., 1993; Southern et al., 1990; Stewart et al.
1997), with magpies and jackdaws identified as probable carriers of C. jejuni.
Milkborne campylobacteriosis outbreaks have been almost invariably asso-
ciated with consumption of raw or inadequately pasteurized cow’s milk. How-
ever, a few cases of C. jejuni and C. coli enteritis have been traced to ingestion
of raw goat’s milk in the United States (Harris et al., 1987), Great Britain (Hutch-
inson et al., 1985a), and Australia (Gilbert et al., 1981), with the epidemic strain
identified in fecal samples from incriminated goats. Other than one additional
outbreak in Great Britain in which 37 cases were linked to consumption of milk
shakes, no other fluid or fermented dairy products, including yogurt and cheese,
have been associated with campylobacteriosis.
5. Occurrence and Survival in Dairy Products
Experimentally induced mastitis in dairy cows has led to excretion of up to 10
5
C. jejuni cfu/mL in milk over 7 days (Lander and Gill, 1980). However, evidence
supporting such shedding by naturally infected cows is relatively limited (De
Boer et al., 1984; Hutchinson et al., 1985b; Logan et al., 1982). The bovine
intestinal tract remains the primary reservoir for C. jejuni with 19% to 64% of
fecal samples being positive (DeBoer, 1984). Consequently, heavy shedding of
Campylobacter in feces followed by fecal contamination of the milk during or
after milking has come to be regarded as the primary route of contamination.
The incidence of Campylobacter spp. in the raw milk supply is reportedly
quite low, with C. jejuni being recovered from only 0.4 to 1.5% (Doyle and
Roman, 1982b; Lovett et al., 1983; McManus and Lanier, 1987) and 0.5% (Steele
et al., 1997) of raw milk bulk tank samples examined in the United States and
Canada, respectively. However, Rohrbach et al. (1992) detected C. jejuni in
12.3% of farm milk bulk tanks supplying eastern Tennessee, thus suggesting a
markedly higher incidence of Campylobacter contamination. In a similar Euro-
pean survey, C. jejuni was recovered from 5.9% of raw milk bulk tank samples
examined in England (Humphrey and Hart, 1988) with a strong correlation ob-
served between C. jejuni and E. coli contamination.
The extent to which Campylobacter persists in milk is related to strain of
C. jejuni, type of milk (i.e., raw, pasteurized, sterilized) and storage temperature.
When raw milk was inoculated to contain 10
7
C. jejuni cfu/mL and stored at
4°C, the organism survived 6–21 days (Christopher et al., 1982; Doyle and Ro-
man, 1982a; Wyatt and Timm, 1982). However, when this work was repeated
using more realistic levels of 1–10 C. jejuni cfu/mL, the organism survived less
than 4 days (DeBoer et al., 1984), which emphasizes the difficulty in recovering
Campylobacter from raw milk. In similar studies using pasteurized milk, C. jejuni
Public Health Concerns 441
persisted somewhat longer because there was less microbial competition and
slower acid development (Blaser et al., 1980; Christopher et al., 1982; Doyle and
Roman, 1982b). However, Campylobacter viability decreased rapidly at higher
storage temperatures with this pathogen no longer being detected in pasteurized
or sterilized milk after 3 days of storage at 20–25°C. Similar survival has been
reported for C. jejuni in raw and pasteurized goat’s milk (Simms and MacRae,
1989).
Campylobacter is far more sensitive to heat, acid (pH H11349 5), oxygen, ambi-
ent temperatures, dehydration, chlorine- and iodine-based sanitizers, and the raw
milk environment than most other milkborne pathogens (Koidis and Doyle, 1984;
Wyatt and Timm, 1982). Consequently, C. jejuni is rapidly inactivated during
the cooking step in cottage cheese (Ehlers et al., 1982) and Swiss cheese (Bach-
mann and Spahr, 1995) manufacture. Furthermore, when Cheddar cheese was
prepared from pasteurized milk inoculated to contain 10
2
–10
6
C. jejuni cfu/mL,
the organism was no longer recoverable from the cheese (pH 5) beyond 15 days
of curing (Ehlers et al., 1982). Limited survival of Campylobacter in Cheddar
cheese is also supported by an earlier survey in which 127 samples of 60-day-
old Cheddar cheese (Brodsky, 1984b) and 140 samples of French raw milk cheese
(Federighi et al., 1999) tested negative for C. jejuni. The only evidence of cheese
contamination comes from Wegmuller et al. (1993), who detected DNA from C.
jejuni in three raw milk cheeses using a polymerase chain reaction method. How-
ever, inability to culture C. jejuni from these cheeses suggests that the organisms
were no longer viable. Given these findings along with absence of any reported
cheese-associated cases of campylobacteriosis and lack of any supportive epide-
miological evidence (Harris et al., 1986), cheese appears to be a highly improba-
ble vehicle for Campylobacter enteritis.
6. Prevention
Proper vat (61.7°C/30 min) and high-temperature, short-time pasteurization
(71.7°C/15 s) offer complete protection against spread of milkborne campylo-
bacteriosis even if impossibly high populations of C. jejuni were present in raw
milk to be pasteurized (D’Aoust et al., 1988; Gill et al., 1981; Waterman, 1982).
Even though Campylobacter spp. are unable to grow in refrigerated raw milk,
the organism can persist for several days or more at levels sufficient to induce
illness. Because most milkborne campylobacteriosis outbreaks have been linked
to consumption of raw milk, milkborne Campylobacter enteritis can be easily
avoided by consuming only pasteurized milk. However, since many of the re-
ported campylobacteriosis cases are among children, individuals involved in
youth activities and school field trips must be alert to the danger of raw milk if
free samples are offered.
442 Ryser
F. Drug Residues
Emphasis on increased milk production over the past 50 years has fostered the
use of many antibiotics including the β-lactams, tetracyclines, and sulfonamides
for treating mastitis and other diseases in dairy cattle. As of May 1992, at least
60 different animal drugs were approved for use (Anonymous, 1992). However,
at the same time, 52 non–FDA approved, residue-producing drugs were also
suspected of being used illegally. Regardless of the route of administration (i.e.,
oral, injection, infusion), these antibiotics enter the bloodstream to produce their
desired effect at the point of infection and are then metabolized and excreted by
the animal at various rates. The FDA has established legally binding limits for
at least 16 animal-approved drugs and has also set drug withdrawal periods rang-
ing from a few hours to several weeks, during which time, milk from treated
cows must be discarded. Shortened milk withdrawal or discard periods can lead
to potentially unsafe drug residue levels in milk. Because milk from various farms
is typically commingled, unsafe or illegal animal drug residues can contaminate
large volumes of milk, with the FDA estimating that milk from a single sulfa-
methazine-treated cow can contaminate milk from 70,000 cows when pooled
(Anonymous, 1992). Two widely publicized 1989 surveys published in The Wall
Street Journal highlighted the scope of this problem with 20 and 38% of the
retail milk samples tested containing animal drug residues and other nonapproved
drugs (Place, 1990).
1. General Characteristics
Testing milk for presence of antibiotic residues in the United States began in
1953 after a revision of the Pasteurized Milk Ordinance to prohibit sale of milk
containing antibiotics (Anonymous, 1990). Since those early days, β-lactam anti-
biotics have been the traditional target of state and federally regulated fluid milk
testing programs. However, results from a widely publicized 1988 survey raised
concerns regarding numerous other drugs and drug residues in the milk supply,
with sulfonamides and tetracyclines also attracting considerable attention.
The β-lactam antibiotics include penicillins and cephalosporins, both of
which consist of a thiazolidine and β-lactam ring with the latter containing vari-
ous side chains. Penicillin G has traditionally been the most common drug residue
found in milk owing to the popularity of use of this drug on the farm. The level
and duration of β-lactam residues in milk are affected by both route of administra-
tion and number of antibiotics administered (Oliver et al., 1990). When injected,
less than 0.3% of the drug appears in milk. However, treatment of mastitis by
intramammary infusion leads to almost total excretion in milk. Most reports sug-
gest that penicillin G and its derivatives are relatively resistant to heat with vat
and high-temperature, short-time pasteurization reducing antimicrobial activity
in milk less than 10% (Moats, 1988). Penicillin also has the distinction of being
Public Health Concerns 443
the most allergenic drug known, with approximately 10% of the human popula-
tion reportedly being sensitive (Olson and Sanders, 1975). Because several early
reports traced allergic dermatitis to tainted milk (Erskine, 1958), a maximum
legal limit of 0.01 ppm has been established for penicillin in fluid milk (Anony-
mous, 1990).
The sulfonamides, another important group of antimicrobials, have been
used to treat systemic and cutaneous infections in farm animals for more than
50 years. All sulfonamides are derivatives of sulfanilamide and ultimately inhibit
nucleic acid synthesis. Although available without prescription, the sulfonamides,
except sulfadimethoxine, sulfabromomethiazine, and sulfaethoxypyridazine, can-
not be used to treat disease in lactating animals (Charm et al., 1988). The latter
antimicrobial has a zero tolerance in milk and the former two have a 10-ppb
tolerance. Like penicillins, sulfonamides are also resistant to most food pro-
cessing conditions, with activity being retained during prolonged heating (Moats,
1988). Sulfonamides are somewhat less allergenic than penicillin, with approxi-
mately 3.4% of the population being sensitive (Bigby et al., 1986). However,
one particular sulfonamide banned for use in lactating dairy cattle, namely, sulfa-
methazine, is a suspected human carcinogen based on animal studies (Anony-
mous, 1990). Considerable public concern was raised in 1988 when trace levels
of sulfamethazine were detected in the United States milk supply (Anonymous,
1990). The estimated maximum allowable level of 1–5 ppb sulfamethazine in
milk will likely preclude any practical use of this drug in dairy cattle.
In the United States, a highly diverse group of at least 60 FDA-approved
and 52 non–FDA-approved drugs were being administered, often illegally, to
dairy herds, with 64 of these drugs leaving residues of concern in milk (Anony-
mous, 1990). Other antibiotics commonly encountered in the United States milk
supply include tetracycline, aminoglycosides, cephalosporins, and chlorampheni-
col (Brady and Katz, 1988; Kaneene and Miller, 1992). Penicillins remain the
drug of choice in treating bovine mastitis followed by cephalosporin, aminogly-
cosides, novobiocin, and erythromycin, with these five antibiotics accounting
for greater than 90% of all drug residues detected in milk. Less frequently
encountered antibiotic residues in milk include chlorotetracycline, tetracycline,
oxytetracycline, gentamicin, dihydrostreptomycin, and chloramphenicol (Anony-
mous, 1990). Consumer-safe levels for most of these antibiotics have not yet
been established, with the United States generally advocating a policy of zero
tolerance.
2. Detection Methods
Current strategies for detecting antibiotic residues in milk have evolved over the
last 50 years; the earliest methods were based on the inability of test bacteria to
produce acid, reduce dyes, or grow on solid media in the presence of antibiotics
444 Ryser
(Bishop and White, 1984). These time-consuming assays, which required over-
night incubation, were eventually replaced by the qualitative and quantitative
Bacillus stearothermophilus disc assays for penicillin and other inhibitors. Both
of these AOAC-approved tests are based on measurable inhibition zones that
develop around filter paper discs impregnated with the test sample within 3 h of
incubation at 64°C (Bishop et al., 1992; Richardson, 1990). A variation of this
assay known as the Delvotest-P (Bishop et al., 1992; Bishop and White, 1984)
is even more sensitive for penicillin and uses the pH indicator bromcresol purple
to assess acid production by B. stearothermophilus. The widely acclaimed and
AOAC-approved Charm test, first introduced in 1978, is based on competitive
binding of radioactively labeled penicillin (and later tetracycline, erythromycin,
streptomycin, novobiocin, sulfamethazine, and chloramphenicol) to vegetative
cells of B. stearothermophilus. At least seven different versions of this assay are
known, three of which have been simplified for on-farm testing (Bishop et al.,
1992). In addition, at least six different enzyme-linked immunosorbent assays
covering most other antibiotics of interest are available (Bishop et al., 1992).
However, these newly developed rapid methods and several others based on ag-
glutination of antibiotic-coated latex beads, high-performance liquid chromatog-
raphy, and reduction of brilliant black dye have not yet received AOAC approval.
Consequently, the aforementioned qualitative and quantitative B. stearother-
mophilus disc assay and Charm tests remain the methods of choice for most
commonly encountered antibiotics.
3. Risks of Drug Residues
The public health significance of barely detectable levels of animal drug residues
in the milk supply is still somewhat controversial. Several international studies
have concluded that small amounts of drug residues in milk are not likely to pose
a significant human health hazard, with bacterial pathogens clearly constituting
a far more serious threat (Anonymous, 1990). However, as previously discussed,
ingesting antimicrobials such as penicillin, streptomycin, tetracycline, aminogly-
cosides, and sulfonamides in food can produce life-threatening allergic reactions,
including anaphylactic shock in susceptible individuals (Anonymous, 1990).
Given the current long life expectancy of humans, increased suppression of the
human immune system through long-term exposure to low levels of antibiotics
in the milk supply is also a growing concern. At least two drugs used in treating
dairy cattle, namely, sulfamethazine and nitrofurazone, also can produce cancer
in laboratory animals and, as such, are potential human carcinogens (Anonymous,
1990). Other commonly used drugs, including chloramphenicol and ivermectin
(an antiworming agent), have been associated with aplastic anemia (an irrevers-
ible and potentially fatal bone marrow disease) and various neurological disor-
ders.
Public Health Concerns 445
A separate rapidly emerging public health issue relates to development of
new antibiotic-resistant bacterial pathogens such as Salmonella and Campylo-
bacter as a result of long-term exposure to low levels of antibiotics in milk
through subtherapeutic doses in animal feed. In 1985, the second largest known
foodborne outbreak involving more than 16,000 cases of salmonellosis in the
Chicago area was traced to pasteurized milk that contained a very rare multi–
antibiotic-resistant strain of S. Typhimurium (Ryan et al., 1987). The fact that
this organism also contained several plasmids encoding resistance to 14 different
antibiotics (Schuman et al., 1989), eight of which were commonly encountered
as drug residues in milk (Anonymous, 1992a), highlights the potential danger of
antibiotic misuse on the farm.
Contamination of milk with even minute levels of antibiotics also has cre-
ated several potential safety-related problems for manufacturers of fermented
dairy products, including inadequate milk clotting and improper cheese ripening,
inadequate acid and flavor development in buttermilk, invalid results from certain
quality control tests, and, most importantly, diminished starter culture growth
and acid production during cheese making, which can allow pathogens such as
Salmonella and Staphylococcus aureus to grow (Park and Marth, 1972b). Starter
culture failure remains a major cause of disease outbreaks involving cheese and
other fermented dairy products.
4. Occurrence
Antibiotic residues were relatively common in the United States milk supply as
recently as the late 1980s. In a nationwide survey, Collins-Thompson et al. (1988)
detected sulfamethazine and tetracyline in 47 and 28%, respectively, of samples
tested from 16 states, with penicillin, erythromycin, chloramphenicol, and novob-
iocin found in less than or equal to 5% of samples. Furthermore, each state yielded
samples containing one or more antibiotic residues, with similar findings obtained
from 40 retail milk samples collected in four Canadian provinces.
When 64 retail milk samples from eastern Pennsylvania, central New Jer-
sey, and the New York City area were screened, Brady and Katz (1988) found
antibiotics in 63% of the samples with 43 and 17% of positive samples containing
residues of two and four or more antibiotics, respectively. Sulfonamides and tetra-
cyclines were the most prevalent residues with each present in nearly 40% of
the samples tested. Thirty-eight percent of samples contained both sulfonamide
and tetracycline with 16% containing both sulfonamides and streptomycin. Chlor-
amphenicol, erythromycin, and β-lactams were identified in 10, 5, and 2%, re-
spectively, of the samples.
According to Charm et al. (1988), 71% of retail and tanker truck milk
samples tested in the northeast United States were contaminated with sulfon-
amides at levels of at least 5 ppb. Half of the positive samples contained greater
446 Ryser
than 25 ppb sulfonamide, with one sample having 15,000–20,000 ppb. Sulfa-
methazine was the dominant sulfonamide detected and was sometimes present
at levels as high as 40 ppb, which is eight times higher than the maximum allow-
able level suggested by the FDA. In another survey involving retail milk from
10 major United States cities, sulfonamides were detected in 36 of 49 samples,
with most positive findings coming from the northwest and northeast (Charm et
al., 1988). However, in Prince Edward Island, Canada, where sulfonamides are
not sold over the counter, 1000 tanker truck samples tested negative for these
drugs.
Much of the controversy concerning the public health significance of antibi-
otic residues in milk is based on wide disparities between results from regulatory
and nonregulatory surveys and a lack of firmly established tolerance levels for
many antibiotics. In 1990, the FDA compiled test results from more than 1.4
million bulk tank samples representing 43% of the United States milk supply
and reported that only 0.27 and 0.09% of these samples contained unsafe levels
of β-lactam antibiotics and sulfamethazine, respectively (Anonymous, 1990).
These low contamination rates decreased even further during 1994 and 1995 with
illegal levels of β-lactam antibiotics, sulfonamides, sulfamethazine, and tetracy-
cline, present in only 0.15, 0.13, 0.007, and 0.12%, respectively, of the milk
supply (Anonymous, 1996). In tests conducted during fiscal 1997–1998 (Anony-
mous, 1999), over 4.6 million samples of fluid milk (raw and pasteurized) and
other dairy products were examined for 18 different drugs. Overall, 0.10% of
these samples were positive for drug residues compared to 0.11 and 0.12% during
fiscal 1996–1997 and 1995–1996, respectively. Of the 4511 positive samples
identified during 1997–1998, only 3 (0.06%) samples were classified as pasteur-
ized fluid milk or dairy products. Among positive raw milk samples, two-thirds
of which originated from bulk milk pickup tankers, 96.7% contained β-lactams
with 1.75 and 0.88% positive for tetracyclines and sulfonamides, respectively.
However, when compared with bacterial pathogens, these low background antibi-
otic residue levels pose a negligible public health risk to consumers.
5. Prevention
During the 1980s, faulty dairy herd management practices, including insufficient
knowledge concerning milk withdrawal periods, inadequate record keeping on
mastitic cows, and inappropriate use of antibiotics, were cited as being primarily
responsible for the high incidence of antibiotic residues in the milk supply (Ka-
neene and Ahl, 1987). In response to these findings, the FDA and the dairy indus-
try adopted a joint three-point program to (a) reevaluate antibiotic detection meth-
ods for adequacy and efficiency, (b) implement a public awareness program to
accurately inform consumers about the safety of the milk supply, and (c) develop
a 10-point Hazard Analysis Critical Control Point (HACCP)–based animal drug
Public Health Concerns 447
education program for dairy farmers (Adams, 1994). The latter program focuses
on proper use of FDA-approved drugs under a veterinarian’s supervision, animal
treatment records, employee education, and ongoing drug residue screening pro-
grams (Adams, 1994). These efforts appear to have been highly successful given
the recent sharp decrease in antibiotic-positive milk samples.
G. Enteropathogenic E. coli
Bacterium coli commune, known as Escherichia coli, was first described by
Theodor Escherich in 1885. Most E. coli strains are harmless commensals com-
mon to the intestinal tract of humans and animals. Some milkborne strains of E.
coli were thought to be responsible for summer diarrhea in children as early as
1900 (James, 1973). However, bacteriological confirmation of such strains did
not come until the 1940s when Bray (1945), Bray and Beavan (1948), and later
Brown and Bailey (1958) identified several serologically distinct ‘‘enteropatho-
genic’’ E. coli strains responsible for infant diarrhea. Based on distinct virulence
properties, different interactions with the intestinal mucosa, distinct clinical
symptoms, differences in epidemiology, and variations in O (somatic) and H
(flagellar) antigens, more than 60 distinct strains causing different forms of
diarrhea in humans have been identified (Hitchens et al., 1995). These strains
are grouped into the following five categories: classic entropathogenic E. coli
(EPEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), entero-
hemorrhagic E. coli (EHEC), and, most recently enteroadherent, E. coli (EAEC).
Both EIEC and ETEC have been linked to major cheese-related outbreaks in the
United States and Europe (MacDonald et al., 1985; Marier et al., 1973), and both
are discussed in this section as is EPEC, which is a major problem in less devel-
oped countries., EAEC is a newly developed and consequently poorly understood
category. EHEC, which has recently emerged as a particularly hazardous food-
borne pathogen of major public health concern, is discussed separately.
1. General Characteristics
A species in the family Enterobacteriaceae, E. coli is a short, gram-negative,
facultatively anaerobic, rod-shaped bacterium that may be nonmotile or motile
by peritrichous flagella. Most isolates grow optimally at or near 37°C, with
growth ceasing at a
w
values less than 0.95. Identification of E. coli is based on
fermentation of glucose and other carbohydrates to acid (lactic, acetic, formic)
and gas (CO
2
,H
2
). Whereas most E. coli isolates ferment lactose to acid and gas
within 48 h, some strains (particularly those of EIEC) are weakly lactose positive
or lactose negative (Hitchins et al., 1998). Important biochemical tests for routine
confirmation of E. coli include production of indole (usually indole [I] positive),
production of stable acid endproducts from glucose (methyl red [M] positive),
448 Ryser
production of acetoin from glucose (Voges-Proskauer [Vi] negative), and use of
citrate (citrate [C] positive). About 95% of all E. coli are IMViC
H11001H11001H11002H11002
, with the
remaining 5% of strains being IMViC
H11002H11001H11002H11002
(Doyle and Padhye, 1989). Further
characterization and identification of potentially pathogenic strains is partially
based on serology with 173 O (somatic) 56 H (flagellar), and 80 K (capsular)
antigens yielding an estimated 50,000–75,000 serotypes of E. coli (Orskov and
Orskov, 1992).
ETEC produces a heat-labile enterotoxin (LT) which is immunologically
related to cholera toxin and sometimes a second heat-stable enterotoxin (ST) of
low molecular weight (Doyle and Padhye, 1989; Gyles, 1992). The ETEC strains
also produce membrane-bound colonization factors that mediate attachment of
the organism to the intestinal wall. Sixteen ETEC serotypes comprising 14 differ-
ent O serogroups are presently known (Hitchins et al., 1998).
EIEC are Shigella-like organisms capable of invading and proliferating in
the intestinal epithelium, with such invasive ability being plasmid mediated
(Doyle and Padhye, 1989). Eleven serotypes comprising eight different O sero-
groups are presently recognized (Hitchins et al., 1998).
EPEC are defined as diarrheagenic strains belonging to serogroups epide-
miologically incriminated as pathogens but whose pathogenicity has not been
positively linked to production of heat-labile enterotoxins, heat-stable enterotox-
ins, Shigella-like invasiveness (Edelman and Levine, 1983), or verocytotoxin pro-
duction (Doyle and Padhye, 1989), the last of which is characteristic of EHEC.
Twenty-nine serotypes of EPEC comprising 15 different O serogroups are recog-
nized with some EPEC serotypes being mainly associated with infant diarrhea.
2. Isolation and Detection Methods
Procedures for detecting diarrhea-causing strains of E. coli in dairy products gen-
erally begin with a 3-h/35°C preennrichment in brain heart infusion broth to
resuscitate injured cells (Hitchins et al., 1998). This step is followed by 20 addi-
tional hours of incubation at 44°C, which selects for fecal coliforms, including
E. coli. Thereafter, plates of several standard plating media (i.e., eosin–methylene
blue agar and MacConkey agar) are streaked, incubated, and examined for typical
and atypical (non–lactose fermenting) E. coli. Following standard biochemical
confirmation, commercially available antisera that react with many pathogenic
serogroups of E. coli can be used to screen for the most common, potentially
pathogenic strains. However, because pathogenicity cannot be completely corre-
lated with specific O antigens, actual proof of the pathogenicity of the strain is
required.
Production of LT and ST toxins by ETEC can be demonstrated using the
Y-1 mouse adrenal cell test and the infant mouse test (Doyle and Padhye, 1989;
Hutchins et al., 1995), respectively, or by using one of several immunological
Public Health Concerns 449
or DNA probe-based assays (Doyle and Padhye, 1989; Hill et al., 1998; Tsen et
al., 1996). Invasiveness of EIEC isolates is typically shown using HeLa cell cul-
tures or the guinea pig–based Sereny test. Virulent E. coli strains not conforming
to ETEC, EIEC, or EHEC are likely EPEC. However, because no standard patho-
genicity tests for such strains are available, confirmation of most suspect EPEC
isolates requires complete serotyping by a qualified E. coli reference laboratory.
3. Clinical Manifestations
EPEC is principally responsible for infantile diarrhea, a clinically severe illness
in children younger than 2 years of age which is characterized by fever, vomiting,
abdominal pain, and a persistent diarrhea that may last for several weeks (Eschev-
erria et al., 1987; Levine, 1987). In adults, EPEC foodborne infections are typi-
cally far less severe. Symptoms begin 17–72 h after exposure and include a severe
watery diarrhea with mucus, which is frequently accompanied by nausea, vom-
iting, abdominal cramps, headache, fever, and chills (Doyle and Padhye, 1989).
Unlike infantile diarrhea, this illness is of far shorter duration in adults, with
spontaneous recovery occurring within 6–72 h.
Widely known as traveler’s diarrhea, ETEC gastroenteritis may vary from
a mild, 1-day illness consisting of loose stools, abdominal cramps, vomiting, and
low-grade fever to a severe cholera-like illness lasting several weeks in which
profuse rice water–like stools can lead to serious dehydration (Kantor, 1986).
Human volunteer studies (DuPont et al., 1971; Levine et al., 1977) demonstrated
an unusually high infectious dose with ingestion of 10
8
–10
10
ETEC cells required
to produce symptoms within 8–44 h. Most individuals stop shedding ETEC 4–
5 days after cessation of diarrhea. Traveler’s diarrhea is typically mild and self-
limiting. However, in severe cases of ETEC gastroenteritis resembling cholera,
fluids are normally given either orally or intravenously to prevent dehydration
(Kantor, 1986). Antibiotic therapy is inappropriate and can even be harmful.
EIEC penetrates and destroys the mucosal tissue of the colon to produce
an illness indistinguishable from shigellosis (bacillary dysentery) (Gray, 1995).
Symptoms typically develop 8–24 h after receiving a minimum oral infectious
dose of at least 10
6
EIEC cells (DuPont et al., 1971) and include severe diarrhea
accompanied by chills, fever, headache, muscle pain, and abdominal cramps.
Unlike profuse watery stools observed in ETEC traveler’s diarrhea, stools pro-
duced by EIEC are less frequent but typically contain blood, mucus, and leuko-
cytes. However, as in traveler’s diarrhea, EIEC infections are normally acquired
abroad by adults who recover spontaneously without medical intervention.
4. Outbreaks
Global importance of E. coli as a cause of diarrheal illness has decreased mark-
edly over the past 50 years following implementation of improved sanitary prac-
450 Ryser
tices. Although still a major cause of waterborne diarrhea in less-developed coun-
tries, dairy-related cases of E. coli enteritis are uncommon in industrialized
countries, with only two outbreaks and two additional cases thus far reported.
Evidence for possible involvement of EPEC in milkborne enteritis is lim-
ited to one report from England (Anonymous, 1976) in which two 6-month-old
infants developed EPEC infantile diarrhea after ingesting raw milk from their
father’s farm. EPEC O26 was detected in both stool samples and in milk from
one mastitic cow supplying the family. After both infants began drinking bottled
pasteurized milk, the illness reportedly disappeared.
In the first of two multistate cheese-related outbreaks (Francis and Davis,
1984; Levy, 1983; MacDonald et al., 1985), symptoms of ETEC gastroenteritis
developed in 45 individuals in Washington, DC, 1–6 days after ingesting im-
ported French Brie cheese. Investigators eventually isolated ETEC O27:H20 (an
ST-producing strain) from stool samples and the incriminated cheese. After much
publicity, 124 additional cheese-related cases were soon confirmed in Colorado,
Georgia, Illinois, and Wisconsin, after which the implicated cheese was recalled
nationwide. Identical outbreaks involving the same brand of cheese were simulta-
neously reported in Denmark, Sweden, and the Netherlands. Although the source
of contamination at the cheese factory was never found, illness caused by this
epidemic strain was linked to two different cheese lots manufactured 46 days
apart, thus suggesting a recurrent contamination problem.
During 1971, imported French Brie cheese was identified as the vehicle of
infection in a second multistate outbreak of EIEC gastroenteritis, which also be-
gan in Washington, DC (Barnard et al., 1971; Marier et al., 1973; Schnurren-
berger and Pate, 1971; Tulloch et al., 1973). A total of 347 cases of diarrhea
in Washington, DC, were eventually linked to ingesting imported French Brie,
Camembert, and Coulommiers cheese containing high coliform populations and
EIEC O124:B17 at a level of 10
5
–10
7
organisms/g, with growth of the organism
during cheese ripening being suspected (Fantasia et al., 1975). Twelve people
required hospitalization and were later released. As in the previous outbreak, the
epidemic strain was recovered from both stool and cheese samples. The importer
subsequently recalled all lots (1200 lb) of cheese that were distributed. EIEC
O124:B17 was later recovered from samples of partially consumed cheese that
were originally manufactured over a 13-day period, thus suggesting an ongoing
contamination problem that was likely related to inadequate filtration of river
water used in factory cleaning operations.
5. Occurrence and Survival in Dairy Products
EPEC, ETEC, and EIEC are classified as fecal coliforms with their presumed
primary reservoir being the intestinal tract of humans and animals. However,
these organisms are occasionally found in raw milk from normal and mastitic
Public Health Concerns 451
cows. In early eastern European surveys, pathogenic E. coli serotypes were identi-
fied in less than 2% of the raw milk supply (Bryan, 1983). More recently, 3 of
47 raw milk samples tested in Iowa harbored EPEC serotypes (Glatz and Brudvig,
1980). Pathogenic serotypes of E. coli have been seldom identified in pasteurized
milk and cream (Jones et al., 1967); however, ETEC can grow in inoculated
sterile milk at ambient temperatures and produce small amounts of LT (Olsvik
and Kapperud, 1982).
Despite two large cheese-related outbreaks of gastroenteritis, pathogenic
serotypes of E. coli are rarely found in cheese marketed in the United States
with only one documented report involving Mexican-style fresh white cheese
contaminated with ETEC, which was detected during a routine surveillance pro-
gram and recalled without incident (Anonymous, 1991a). According to Frank
and Marth (1978), 106 samples of Camembert, Brie, brick, Muenster, and Colby
cheese purchased in Wisconsin tested negative for common EPEC serotypes.
Whereas 78 cheese samples tested in Iowa were also negative for ETEC (Glatz
and Brudvig, 1980), contamination rates are considerably higher in less devel-
oped countries such as Iraq, Abbar, and Kaddar (1991), as well as India (Singh
and Ranganathan, 1974), where acute E. coli gastroenteritis is common in chil-
dren.
The fate of any organism in cheese is dictated by many interacting factors,
including type of cheese, initial populations in milk, strain differences, amount
and type of starter culture, cheese-making procedures (e.g., cooking, washing),
pH, salt content, and location of the organism in cheese as well as temperature
and length of ripening and storage. Frank and Marth (1977a, 1977b) examined
the fate of ETEC and EIEC in skim milk that was fermented with 0.25–2.0%
lactic starter culture at 21 and 32°C for 15 h and then refrigerated at 7°C. Growth
of ETEC and EIEC generally ceased at pH 4.8–5.2, with the combination of low
incubation temperature and highest starter inoculum being most detrimental to
growth and survival. ETEC and EIEC survival was also influenced by type of
starter culture with Lc. lactis subsp. lactis being least inhibitory followed by Lc.
lactis subsp. cremoris and a mixture of both organisms.
The 1971 outbreak involving Brie cheese prompted several studies that
examined the fate of EIEC and ETEC in various cheeses prepared from pasteur-
ized milk inoculated to contain 100–1000 organisms/mL. When Camembert
cheese was manufactured (Frank et al., 1977), EIEC and ETEC populations in-
creased approximately 100-fold during the first 6 h of cheese making until the
curd attained a pH less than or equal to 5. Both types of E. coli were slowly
inactivated in the cheese during ripening at 12 and later 7°C, with EIEC and
ETEC surviving 1 week and 1–6 weeks, respectively. However, rapid growth of
EIEC and ETEC to levels of 10
5
organisms/g was observed when cheeses were
surface inoculated 5 days after manufacture and similarly ripened, with both or-
ganisms persisting well beyond the normal shelf life of the cheese. In Colby-like
452 Ryser
cheese (Kornacki and Marth, 1982), E. coli populations increased 100- to 1000-
fold during the first 4 h of cheese making, with EIEC and ETEC persisting 4
and greater than 12 weeks, respectively, in finished cheese ripened at 4–10°C.
These E. coli strains behaved similarly during manufacture of brick cheese (Frank
et al., 1978), with ETEC again proving to be hardier than EIEC in 7-week-old
brick cheese.
To simulate postmanufacturing contamination, Sims et al. (1989) inocu-
lated commercially prepared cottage cheese (pH 4.7–4.9) to contain 10
4
ETEC/
EIEC cfu/g and incubated the product at 7–25°C. Regardless of storage tempera-
ture, E. coli levels decreased only slightly during the 14-day shelf life of the
product.
6. Prevention
Human carriers are presumed to be the primary reservoir and source of ETEC,
EIEC, and EPEC. Because E. coli is readily destroyed by pasteurization with a
wide margin of safety, the organism typically enters the product as a postpasteur-
ization contaminant. Dairy products are most often contaminated by infected food
handlers who practice poor personal hygiene or by contact with water containing
human sewage. Consequently, food workers must be educated in safe food-han-
dling techniques and proper personal hygiene practices including hand washing
after using the lavatory.
H. Enterohemorrhagic E. coli O157:H7
In 1982, outbreaks of hemorrhagic colitis in Oregon and Michigan drew attention
to an unusual clinical syndrome of gastroenteritis caused by a little known enteric
bacterial pathogen, namely, enterohemorrhagic E. coli (EHEC) O157:H7—a ser-
otype identified only once 7 years earlier at the Centers for Disease Control from
a single case of human diarrheal illness (Riley et al., 1983; Wells et al., 1983).
A total of 47 cases of hemorrhagic colitis were identified in these two outbreaks,
with undercooked hamburgers subsequently identified as the vehicle of infection.
Numerous outbreaks of E. coli O157:H7 infection were later linked to consump-
tion of such products as undercooked ground beef (Hancock et al., 1994), apple
cider (Besser et al., 1993; Steele et al., 1982), and mayonnaise (Borczyk et al.,
1987; Neill, 1989), and this pathogen once again gained considerable notoriety
in 1993 after more than 500 hamburger-related cases of illness and the deaths of
four children were reported (Conner and Kotrola, 1995; Knight, 1994; Wuethrich,
1994) in Washington, Idaho, California, and Nevada (Anonymous, 1993b; Anon-
ymous, 1994a; Hancock et al., 1994). The seriousness of these aforementioned
outbreaks, combined with an estimated 62,000 cases and 50 deaths occurring
annually in the United States (Mead et al., 1999) along with additional sporadic
Public Health Concerns 453
cases reported in Canada (Lior, 1994b) and elsewhere (Griffin and Tauxe, 1991)
have raised E. coli O157:H7 to a foodborne pathogen of international impor-
tance (Knight, 1993). Of concern to the dairy industry are the presence of E. coli
O157:H7 in 2–5% of the raw milk supply (D’Aoust, 1989; Wells et al., 1991)
and reports of over 60 cases of raw milk–associated illness.
1. General Characteristics
Verotoxigenic E. coli, or EHEC, produces one or two verotoxins, designated
VT-1 and VT-2, which are toxic to Vero (African green monkey kidney) and
HeLa cells, as first reported by Konowalchuk et al. (1977). VT-1 is a relatively
heat-stable, high molecular weight, Shiga-like toxin, whereas VT-2 is immuno-
logically distinct (Doyle, 1991).
Six EHEC serogroups, O26, O48, O111, O113, O145, and O157, have been
linked to human illness (Goldwater and Bettelheim, 1995; Hitchins et al., 1998),
with additional verotoxigenic serogroups detected in both healthy cattle (Monte-
negro et al., 1990; Wells et al., 1991) and cattle with diarrhea (Mohammad et
al., 1986). In all, more than 80 serotypes of EHEC are recognized (Griffin and
Tauxe, 1991), with O157:H7 being dominant in the United States and Canada
(Lior, 1994b) and O111:H
H11002
being particularly common in Australia (Goldwater
and Bettelheim, 1995). However, because E. coli O157:H7 is the best established
foodborne pathogen among the EHEC, this discussion will be confined to E. coli
O157:H7.
E. coli O157:H7 is similar to most other E. coli with a few important
exceptions (Doyle, 1991; Gray, 1995). Whereas E. coli O157:H7 grows opti-
mally at 30–42°C, this serotype grows poorly, if at all, at 44–45.5°C (Buchanan
and Klawitter, 1992; Doyle and Schoeni, 1984) and is therefore unlikely to be
recovered when samples are analyzed for fecal coliforms. Growth of E. coli
O157:H7 has been reported in milk at temperatures as low as 5.5°C, with the
growth rate being inversely related to numbers of background organisms (Kauppi
et al., 1996; Massa et al., 1999; Palumbo et al., 1997; Wong et al., 1997). How-
ever, addition of 4% sodium lactate to tryptic soy broth permits growth at 4°C
to levels of 10
8
organisms/mL after a lag period of 4 weeks (Conner and Hall,
1996). Biochemically, E. coli O157:H7 generally lacks the enzyme glucuroni-
dase, which is possessed by 92–96% of all other E. coli strains, and, unlike 80–
93% of other E. coli strains, is unable to ferment d-sorbitol within 24 h. Both
of these biochemical differences are of major importance in screening samples
for E. coli O157:H7.
2. Isolation and Detection Methods
Selective recovery of E. coli O157:H7 from food samples is based on inability
of typical isolates to ferment sorbitol and hydrolyze 4-methyl-umbelliferyl β-d-
454 Ryser
glucuronide (MUG) to a fluorogenic product. However, a few strains are positive
for sorbitol and MUG (Gunzer et al., 1992). Direct plating media commonly
used at 37°C include sorbitol MacConkey agar (SMAC) with and without MUG
(Hitchins et al., 1998; McCleery and Rowe, 1995) and hemorrhagic colitis agar,
which contains both sorbitol and MUG (Hitchins et al., 1998). Several selective
enrichment broths containing novobiocin or other antibiotics also can be used to
enhance recovery (Padhye and Doyle, 1992). In one recently reported FDA proce-
dure (Hitchins et al., 1998; Weagant et al., 1998), samples were enriched at 37°C
for 7 h in tryptic soy broth containing vancomycin, cefsulodin, and cefixime and
then plated on SMAC supplemented with tellurite and cefixime. Presumptive E.
coli O157:H7 isolates must be serologically confirmed using either commercially
available antisera or a serotype-specific DNA probe in a colony hybridization
assay (Hill et al., 1998). Verotoxin production by non–E. coli O157:H7 strains
can be confirmed using traditional cell culture techniques or the newly developed
DNA probe and polymerase chain reaction assays for VT-1. However, identifica-
tion of other verotoxin-producing strains is infrequent because most such isolates
are positive for both sorbitol and MUG (Wells et al., 1991).
3. Clinical Manifestations
Compared to most other foodborne illnesses, infections involving E. coli
O157:H7 or other EHEC strains are particularly serious, with manifestations
ranging from a mild, nonbloody diarrhea to hemorrhagic colitis, hemolytic uremic
syndrome, and thrombotic thrombocytopenic purpura, all of which are related to
adherence of the pathogen to the intestinal tract lining followed by production
of one or more verotoxins (Gray, 1995; Griffin and Tauxe, 1991; Griffin et al.,
1988; Padhye and Doyle, 1992; Riley et al., 1983). Furthermore, the oral infec-
tious dose may be relatively low, with fewer than 1000 organisms inducing ill-
ness.
Hemorrhagic colitis is characterized by sudden onset of severe appendici-
tis-like abdominal pain followed by watery and eventually grossly bloody diar-
rhea described as ‘‘all blood and no stool.’’ Vomiting may occur but, unlike in
EIEC infections, fever is typically mild or absent. The incubation period ranges
from 3 to 5 days, with symptoms generally persisting 2–9 days. However, fecal
shedding of the organisms has been reported for up to 4 weeks. This type of
infection is typically self-limiting in adults, with antibiotic therapy being of lim-
ited value in shortening the duration of bloody diarrhea.
The second manifestation, hemolytic uremic syndrome, develops in 2–7%
of patients with hemorrhagic colitis and is the leading cause of acute renal failure
in children (Karmali et al., 1983). This condition is characterized by hemolytic
anemia (intravascular coagulation of erythrocytes), thrombocytopenia (low levels
of circulating blood platelets), and kidney failure, which occurs in otherwise
Public Health Concerns 455
healthy individuals. Patients frequently require kidney dialysis and blood transfu-
sions and a number of complications may develop including heart failure, seizures,
and a prolonged coma, which can be terminal in 3–10% of cases (Gray, 1995).
The third manifestation, thrombotic thrombocytopenic purpura, which usu-
ally occurs in adults, is similar to hemolytic uremic syndrome except for develop-
ment of fever. Central nervous system disorders typically dominate, with devel-
opment of terminal blood clots in the brain also being reported. Hence, unlike
many other foodborne illnesses, infections with E. coli O157:H7 can be particu-
larly devastating.
4. Outbreaks
Consumption of undercooked ground beef has been the traditional mode for E.
coli O157:H7 infections; however, illnesses from ingestion of raw milk have
been reported, with the number of such cases continuing to increase. In April
1986, a group of 60 kindergarten children visited a dairy farm in Ontario, Canada,
and were given raw milk to drink (Borczyk et al., 1987). Subsequently, E. coli
O157:H7 infections developed in 46 children, three of whom also contracted
hemolytic uremic syndrome. E. coli O157:H7 was later isolated from 1 of 67
fecal samples collected from healthy calves and cows on the same farm.
Several months later, consumption of raw milk on two Wisconsin farms
was linked to separate cases of hemolytic uremic syndrome involving a 13-
month-old boy and a 5-month-old girl (Martin et al., 1986). Follow-up screening
of fecal samples from dairy cattle on both farms yielded E. coli O157:H7 in both
herds.
Two separate raw milk–related outbreaks also occurred in Oregon during
1992 and 1993. In the first of these outbreaks (Bleem, 1994), E. coli O157:H7
infections developed in nine individuals aged 9 months to 73 years after consum-
ing raw milk. Testing the entire herd of 132 animals revealed four cattle as being
positive for E. coli O157:H7, including two 15-month-old heifers, one dry cow,
and one milking cow. Furthermore, strain-specific typing demonstrated that six
of the nine human isolates were identical to the four bovine strains. In the second
raw milk–related outbreak (Bleem, 1994), five cases of E. coli O157:H7 infec-
tion were identified, including two cases of hemolytic uremic syndrome. Subse-
quent fecal sampling of the entire herd of 60 animals revealed E. coli in four
postweaned heifers. Subtyping again demonstrated that cattle and human isolates
were identical. In addition to these milk-related cases, evidence also exists for
direct transmission of E. coli O157:H7 between fecal-positive dairy calves and
a 13-month-old Canadian boy in whom hemolytic uremic syndrome developed
after he was playing in straw bedding near the calves (Renwick et al., 1993).
The risk of acquiring E. coli O157:H7 infections through ingestion of raw
milk is well documented. Additional cases of illness have been linked to farm-
456 Ryser
manufactured yogurt and pasteurized milk involving a verotoxigenic strain of E.
coli that is closely related to E. coli O157:H7. Sixteen cases of E. coli O157:H7
infection that occurred in northwest England during 1991 were epidemiologically
linked to consumption of farm-produced yogurt (Anonymous, 1991b; Morgan et
al., 1993). Eleven of these cases involved children 10 years old and younger; in
five of these children hemolytic uremic syndrome developed. Thirteen individuals
required hospitalization and all patients eventually recovered. Although the epi-
demic strain was never isolated from the implicated yogurt or ingredients ob-
tained from the dairy farm, subsequent inspections yielded strong evidence for
postpasteurization contamination. During February and March of 1994, acute
bloody diarrhea and abdominal cramps developed in 18 individuals from Helena,
MT, from infection with a supposedly rare, but closely related (to other EHEC
strains) verotoxigenic strain of E. coli; namely, E. coli O104:H21 (Moore et
al., 1995). Epidemiological evidence strongly supported one particular brand of
pasteurized milk as the source of infection. Furthermore, company records indi-
cated that coliform counts for at least one of the finished milk products sold
during the outbreak exceeded the state allowable maximum level of 10 coliforms
per 100 mL of milk. E. coli O104:H21 was never recovered from incriminated
milk, the factory environment, or its supposed farm source during subsequent
investigations. Because the techniques available for identifying non-O157:H7
verotoxigenic strains of E. coli are ill defined and not available to most labora-
tories, these results are not surprising. However, this outbreak does raise serious
new public health concerns regarding possible presence of verotoxigenic strains
of E. coli in factory environments and their entry into finished products as post-
processing contaminants.
5. Occurrence and Survival in Dairy Products
The environmental niches for E. coli O157:H7 have not yet been clearly estab-
lished; however, beef and dairy cattle appear to be emerging as a major reservoir
for this pathogen. Although an early survey indicated that 2–6% of dairy cows
shed E. coli O157:H7 in feces (Wells et al., 1991) (also see Chap. 1), the actual
shedding rate is now believed to be considerably higher, particularly during the
summer months. Although not currently recognized as a cause of mastitis in
dairy cattle, E. coli O157:H7 can readily contaminate milk on the farm, with
contamination rates of 4.2 and 2.0% being reported for raw milk produced in the
United States and Canada, respectively (D’Aoust, 1989). However, Padhye and
Doyle (1991) found somewhat higher contamination rates, with E. coli O157:H7
being present in 10% of raw milk bulk tank samples collected from 69 different
Wisconsin farms. Substantial growth of E. coli O157:H7 can occur in tempera-
ture-abused milk, with this pathogen exhibiting generation times of 7.2 and 1.5 h
at 12 and 20°C, respectively.
Public Health Concerns 457
Current evidence indicates that E. coli O157:H7 is not unduly heat resistant
and, like most salmonellae, is readily destroyed in milk by minimum pasteuriza-
tion (71.7°C/15 s) (D’Aoust et al., 1988). One study (Conner and Kotrola, 1995)
showed the ability of E. coli O157:H7 populations to remain relatively constant
in laboratory media acidified to pH 4.7 with lactic acid during 56 days of storage
at 4 and 10°C with E. coli O157:H7 levels increasing nearly 100-fold in the
same medium after 7 days of storage at 25°C. Boor and Dineen et al. (1998)
subsequently assessed the ability of E. coli O157:H7 to compete with commonly
used lactic acid bacteria starter cultures. When pasteurized milk samples were
inoculated to contain 10
3
E. coli cfu/mL and fermented with Lc. lactis ssp. lactis
or Lactobacillus delbru¨kii ssp. bulgaricus, the pathogen was completely inacti-
vated within 96 h and was unable to survive a typical yogurt fermentation. How-
ever, Massa et al. (1997) reported that E. coli O157:H7 survived at least 7 days
in similarly prepared yogurt. In contrast, E. coli O157:H7 remained viable for
40 days when similar milks were fermented with Streptococcus thermophilus and
Lc. lactis ssp. cremoris.
In response to these findings, several studies were also conducted to deter-
mine the fate of this pathogen during manufacture and storage of various fer-
mented dairy products. According to Arocha et al. (1992) and Hudson et al.
(1997), E. coli O157:H7 was completely destroyed during normal cooking of
cottage cheese curd at 57°C. However, when Cheddar cheese was prepared from
pasteurized milk inoculated to contain 1 E. coli O157:H7 cfu/mL, Reitsma and
Henning (1996) reported that the pathogen survived cheese making and persisted
for 138 days in finished cheese ripened at 6–7°C, well beyond the minimum 60-
day curing period at greater than or equal to 1.7°C required by the FDA for
Cheddar cheese prepared from raw or heat-treated milk. In another study, Ram-
saran et al. (1998) reported limited growth and survival of E. coli O157:H7 in
both feta and Camembert cheese during 65 and 70 days of ripening, respectively.
Looking at E. coli O157:H7 as a postmanufacturing contaminant, Kasrazadeh
and Genigeorgis (1995) found this organism unable to grow in Hispanic cheese
(pH 6.6) during 2 months of storage at 8°C. Whereas growth was observed in
temperature-abused cheeses, with E. coli O157:H7 exhibiting generation times
of 23 and 2.5 h at 10 and 20°C, respectively, such growth could be delayed or
prevented by incorporating 0.3% sodium benzoate or potassium sorbate into the
cheese. According to Dineen et al. (1998), E. coli O157:H7 survived H1102235, 7–
35, and 6–14 days when retail samples of buttermilk, sour cream, and yogurt
were inoculated to contain 10
2
–10
3
E. coli O157:H7 cfu/g or mL and subse-
quently stored at 4°C. Given these findings, E. coli O157:H7 is likely to persist
in other cheeses and fermented dairy products for various times depending on
storage conditions. However, in the only survey thus far reported (Bowen and
Henning, 1994), 50 retail samples of natural American and non–American-type
cheeses purchased in South Dakota failed to yield E. coli O157:H7.
458 Ryser
6. Prevention
Unlike ETEC, EIEC, and EPEC, which reside in symptomatic and asympto-
matic human carriers, E. coli O157:H7 is apparently confined to the intestinal
tract of cattle and perhaps other animals. Given the probability for contamination
of milk during milking, consumption of raw milk should be avoided. If good
manufacturing practices are followed, consumption of pasteurized milk poses
little risk because E. coli O157:H7 is readily inactivated during high-temperature,
short-time pasteurization (D’Aoust et al., 1988). However, because this organism
is reasonably acid tolerant, raw milk cheeses and soft-ripened cheeses such as
Brie and Camembert could pose public health concerns if prepared or aged im-
properly.
I. Listeriosis
Listeria monocytogenes, the causative agent of listeriosis in humans and animals,
was first isolated nearly 75 years ago from blood of infected rabbits exhibiting a
typical monocytosis (Murray et al., 1926). However, this bacterium only recently
emerged as a serious foodborne pathogen that can cause abortion in pregnant
women and meningitis, encephalitis, and septicemia in newborn infants and im-
munocompromised adults. Unlike most other foodborne illnesses, the outcome
of listeric infections can be particularly devastating, with a mortality rate of 20–
30%. During the 1980s three major dairy-related outbreaks of listeriosis—two
in the United States and one in Switzerland—were linked to consumption of
pasteurized milk, Mexican-style cheese, and Vacherin Mont d’Or soft-ripened
cheese and resulted in more than 100 deaths (Farber and Peterkin, 1991; Ryser,
1999a). These outbreaks, combined with a presumably low oral infectious dose,
prompted the United States to institute a policy of ‘‘zero tolerance’’ for L. mono-
cytogenes in all cooked and ready-to-eat foods, including dairy products. Since
1985, more than 115 class I recalls have been issued for Listeria-contaminated
dairy products, principally ice cream and cheese, with current financial losses in
excess of $120 million. L. monocytogenes accounted for 13 of 18 (72%) dairy-
related class I recalls issued during 1994 and 1995, and all 8 dairy-related recalls
issued during 1999; thus indicating that Listeria contamination within dairy pro-
cessing facilities has not yet been fully controlled.
1. General Characteristics
The genus Listeria, which is included among the coryneform bacteria, contains
six species. Although three of these species, L. monocytogenes, L. ivanovii, and
L. seeligeri, can cause human or animal infections, only L. monocytogenes is
important as a foodborne pathogen. L. monocytogenes is a gram-positive, non–
spore-forming, facultatively anaerobic, short diphtheroid-like, rod-shaped bacte-
Public Health Concerns 459
rium that occurs singly or in short chains. The organism is psychrotrophic, grow-
ing in common laboratory media at temperatures between 1 and 45°C (optimal
growth between 30 and 37°C), with growth being enhanced under reduced
oxygen conditions (Farber and Peterkin, 1991; Ryser and Marth, 1991; Swamina-
than et al., 1995). Characteristic tumbling motility is visible microscopically
in broth cultures incubated at room temperature. Colonies on clear media are
small, smooth, and blue-gray when examined under obliquely transmitted light.
Biochemically, all listeriae produce catalase, ferment glucose to acid without
gas, and hydrolyze esculin. Typical L. monocytogenes isolates ferment rhamnose
but not xylose and are weakly β-hemolytic. L. monocytogenes is unusually
tolerant of environmental extremes, being able to grow at pH 4.3–10.0, grow
in the presence of up to 10% NaCl (a
w
0.92), and survive in refrigerated
25.5% NaCl brine solutions for 4 months (Shahamat et al., 1980). Based on so-
matic (O) and flagellar (H) antigens, 13 different L. monocytogenes serotypes
have been identified, with most human illnesses being caused by serotypes 1/2a,
1/2b, and 4b.
2. Isolation and Detection Methods
In the standard FDA protocol (Hitchins 1998), recovery of Listeria from dairy
products begins with enrichment of the sample in Listeria enrichment broth, a
buffered medium to which acriflavin, nalidixic acid, and cycloheximide are added
later as selective agents. After 24 and 48 h of incubation at 30°C, the enrichment
culture is streaked to two different Listeria selective plating media including
Oxford medium (OXA) and either PALCAM Listeria selective agar, which con-
tains polymyxin B, acriflavin, and ceftazidime, or lithium chloride–phenyletha-
nol–moxalactam medium with or without esculin and ferric ammonium citrate
(LPM). After 24–48 h of incubation at 30–35°C, suspect colonies on OXA,
PALCAM, and LPM are black with a black halo resulting from esculin hydroly-
sis, whereas colonies on LPM without esculin appear blue-green under oblique
lighting. Presumptive Listeria isolates are speciated based on a standard series
of biochemical tests that can take up to 7 days to complete. However, the time
required for biochemical confirmation can be shortened using commercially
available test kits (i.e., API 20 S, API-ZYM, API Listeria, Micro-ID). Typical
L. monocytogenes isolates are rhamnose positive, xylose negative, and CAMP
test positive with β-hemolysis enhanced in the vicinity of S. aureus. Alterna-
tively, several DNA hybridization (Accuprobe, GeneTrak) and enzyme-linked
immunosorbent assays (VIDAS) can be used to screen enrichment broths for
Listeria spp., including L. monocytogenes (Hill et al., 1998). Positive test results
must be culturally confirmed. Complete serotyping is normally confined to se-
lected isolates of epidemiological importance and conducted by a few select refer-
ence laboratories.
460 Ryser
3. Clinical Manifestations
Three segments of the population, namely, pregnant women, newborn infants,
and immunocompromised adults, are at primary risk of contracting listeriosis,
with the latter group including the elderly and other people with predisposing
conditions such as cancer, organ transplants, cirrhosis of the liver, human immu-
nodeficiency virus (HIV) infections, or acquired immunodeficiency syndrome
(AIDS) (Slutsker and Schuchat, 1999; Swaminathan et al., 1995). In addition to
host susceptibility, development of listeriosis in humans is also affected by gastric
acidity, inoculum size, strain of L. monocytogenes, and various virulence factors
of the organism. Whereas the oral infective dose varies widely with healthy indi-
viduals rarely being infected, ingestion of foods containing greater than or equal
to 10
3
organisms/g poses a significant health risk for susceptible individuals.
Listeric infections in immunocompromised adults typically lead to menin-
gitis, encephalitis, or septicemia (Slutsker and Schuchat, 1999; Swaminathan et
al., 1995). Symptoms that develop suddenly after an initial incubation period
of 2 days to 3 months include severe headache, dizziness, stiff neck or back,
incoordination, and other disturbances of the central nervous system. Without
proper antibiotic therapy, 20–30% of those infected will die, with some survivors
developing permanent neurlogic complications. However, several large food-
borne outbreaks of noninvasive gastroenteritis characterized by fever and diarrhea
have been documented (Aureli et al., 2000; Dalton et al., 1997). In pregnant
women, L. monocytogenes produces a mild flu-like illness characterized by sud-
den chills, fever, sore throat, headache, dizziness, lower back pain, discolored
urine, and occasionally diarrhea. Even though expectant mothers almost invari-
ably recover without complications, infection of the fetus can result in abortion,
stillbirth, or premature delivery of an infant with perinatal septicemia—a severe
infection of the respiratory, circulatory, and central nervous systems that can
either terminate fatally or lead to permanent mental retardation.
Two factors, namely, growth of L. monocytogenes as an intracellular patho-
gen within macrophage cells of the spleen and liver and inability of many antibi-
otics to effectively penetrate the blood-brain barrier, complicate treatment of list-
eric infections (Slutsker and Schuchat, 1999; Swaminathan et al., 1995). Hence,
a favorable prognosis depends on rapid diagnosis and appropriate antibiotic ther-
apy, with oral administration of large doses of ampicillin or penicillin together
with an aminoglycoside for 2–4 weeks being the currently recommended treat-
ment.
4. Outbreaks
Early animal feeding studies supported the likely importance of food in dissemi-
nating listeriosis (Murray et al., 1926). However, this disease was not linked to
consumption of a food product until the early 1950s (Gray and Killinger, 1966;
Public Health Concerns 461
Ryser, 1999a), with dairy products thus far being responsible for five major out-
breaks of listeriosis (Table 5). In the first of these outbreaks, a sharp increase in
stillbirths was observed among pregnant women in post–World War II Germany
who consumed raw milk, sour milk, cream cheese, and cottage cheese, with ap-
proximately 100 Listeria-like infections being reported. The eventual isolation
of identical L. monocytogenes serotypes from a mastitic cow and stillborn twins
whose mother consumed the same raw milk before delivery confirmed raw milk
as the vehicle of infection (Potel, 1953, 1954). Despite the presence of L. monocy-
togenes in 2–4% of the raw milk supply, only two additional listeriosis cases
have been linked to ingestion of raw milk (Ryser, 1999a).
During the summer of 1983, the status of L. monocytogenes as a foodborne
pathogen began to change when consumption of one particular brand of pasteur-
ized milk was epidemiologically linked to 42 adult and seven infant cases of
listeriosis in Massachusetts (Fleming et al., 1985; Ryser, 1999a). Fourteen pa-
tients died, giving a mortality rate of 29%. Inspection of the milk processing
facility failed to uncover any evidence of improper pasteurization or postpasteur-
ization contamination. Although the dairy factory received milk from several
farms on which veterinarians diagnosed listeriosis in dairy cows during the out-
break, L. monocytogenes was never recovered from the incriminated milk, which
in turn raises serious questions concerning the role of pasteurized milk in this
outbreak. During July of 1994, Dalton et al. (1997) reported that 54 previously
healthy individuals developed listeriosis 9–32 h after drinking pasteurized choco-
late milk at a picnic in Illinois, with 12 additional cases also documented in
Illinois, Wisconsin, and Michigan (Proctor et al., 1995). Unlike the aforemen-
tioned outbreaks, gastrointestinal symptoms (diarrhea, fever, chills, nausea, and
vomiting) predominated. Additionally, only four victims required short hospital-
ization, with one pregnant woman delivering a healthy baby 5 days after experi-
encing a 6-h bout of diarrhea. The epidemic strain of L. monocytogenes serotype
1/2b was recovered from unopened containers of chocolate milk at levels of 10
8
–
10
9
CFU/mL, with the product’s taste and quality reportedly being poor. This
outbreak was attributed to postpasteurization contamination of the milk from the
factory environment followed by inadequate and/or nonexistent refrigeration dur-
ing packaging and transit with probable growth of Listeria during this period.
Despite numerous product recalls, repeated attempts have generally failed to cul-
turally confirm other nonfermented dairy products, including ice cream and but-
ter, as vehicles of listeric infection.
Ingestion of Listeria-contaminated cheese has been more commonly linked
to listeriosis, with four major outbreaks, several smaller outbreaks and at least
10 sporadic cases thus far reported. The first and largest of these outbreaks oc-
curred in the Los Angeles area during the first half of 1985 and involved an
estimated 300 cases (Ryser 1999a). Consumption of California-made Jalisco-
brand Mexican-style cheese contaminated with L. monocytogenes serotype 4b
462
Ryser
Table 5 Major Listeriosis Outbreaks Involving Milk and Dairy Products
Number of
Location Year Product cases Reference
Halle, former East 1949–1957 Raw milk, sour milk, cream, Approx. 100 Gray and Killinger (1966)
Germany cottage cheese Ryser (1999a)
Massachusetts 1983 Pasteurized milk 49 Fleming et al. (1985)
Ryser (1999a)
Los Angeles 1985 Mexican-style cheese Approx. 300 Linnan et al. (1988)
Ryser (1999a)
Vaud, Switzerland 1983–1987 Vacherin Mont d’Or, soft-ripened 122 Bula et al. (1995)
cheese Ryser (1999a)
Illinois, Michigan, 1994 Pasteurized chocolate milk 54
a
Dalton et al. (1997)
Wisconsin Ryser (1999a)
France 1995 Brie cheese 20 Goulet et al. (1995)
France 1997 Pont l’E
′
ve?que cheese 20 Ryser (1999a)
a
Gastroenteritis.
Public Health Concerns 463
was linked to 142 listeriosis cases in Los Angeles County, resulting in 48 deaths
(mortality rate of 34%) (Linnan et al., 1988). The contaminated cheese was subse-
quently recalled nationwide. Factory records suggested that raw milk might have
been added to pasteurized milk used in cheese making. Although not isolated
from the incoming raw milk supply, the epidemic strain was ubiquitous in the
factory environment, which suggests ample opportunity for postpasteurization
contamination.
In the second of these outbreaks, consumption of Vacherin Mont d’Or—
a soft, surface-ripened, cheese—contaminated with L. monocytogenes serotype
4b was linked to 122 listeriosis cases in Switzerland from 1983 to 1987 (Bula
et al., 1995; Ryser 1999a). Thirty-four patients died, giving a mortality rate of
28%. Two different epidemic-associated strains of L. monocytogenes serotype
4b were isolated from patients, incriminated cheese, and wooden shelves and
brushes used in 40 different cheese-ripening cellars. Detection of the epidemic
strain at levels of 10
4
–10
6
cfu/g in surface samples of cheese supported both
contamination and growth of L. monocytogenes on the cheese during ripening.
The outbreak ceased after installation of metal ripening shelves and thorough
cleaning and sanitizing of the ripening rooms.
In addition to the aforementioned outbreaks, several smaller outbreaks in
France have been linked to surface-ripened cheese (Ryser 1999a). In one of the
outbreaks, 20 listeriosis cases were traced to consumption of Brie cheese prepared
from raw milk (Goulet et al., 1995). Eleven of these cases occurred in pregnant
women with the remaining nine cases involving elderly or immunocompromised
adults. Unlike previous outbreaks, no geographical clustering was observed, with
cases reported in 8 of 22 French regions. The same epidemic strain was recovered
from these patients and the cheese, with this organism likely being present in
raw milk used for cheese making. Remaining reports of cheeseborne listeriosis
are confined to a series of isolated cases reviewed by Ryser (1999a), only one
case of which was well documented and positively linked to consumption of raw
goat’s milk cheese (McLauchlin et al., 1990).
5. Occurrence and Survival in Dairy Products
Dairy cattle, sheep, and goats can intermittently shed L. monocytogenes in their
milk at levels up to 10
4
cfu/mL as a result of listeric mastitis, encephalitis, or a
Listeria-related abortion. Whereas milk from obviously infected cows is unlikely
to reach consumers, mildly infected and apparently healthy animals can shed L.
monocytogenes in their milk for many months and are thus of greater public
health concern. Composite results from numerous bulk tank surveys conducted
since 1983 indicate that 3.2, 2.3, and 3.8% of all raw milk processed in the United
States, Canada, and western Europe, respectively, will likely contain low levels
(i.e., H11021 10 cfu/mL) of L. monocytogenes at any given time (Ryser 1999b). How-
464 Ryser
ever, L. monocytogenes populations in naturally contaminated raw milk can in-
crease 1000-fold after 4 and 10 days of storage at 10° and 4°C, respectively
(Farber et al., 1990).
L. monocytogenes is more heat tolerant than most other non–spore-forming
pathogens (Doyle et al., 1987). However, current vat and high-temperature, short-
time pasteurization practices ensure total destruction of L. monocytogenes as long
as the raw milk is properly handled and refrigerated at 4°C to minimize growth.
Despite the ability of L. monocytogenes to attain populations of 10
6
cfu/mL in
skim milk, whole milk, chocolate milk, and whipping cream after 8 days of stor-
age at 8°C (a common temperature of home refrigerators), this organism has been
rarely detected in pasteurized fluid milk products (Rosenow and Marth, 1987).
Although L. monocytogenes has been occasionally recovered from commercially
produced butter, with survival up to 70 days also being reported in butter prepared
from inoculated cream (Olsen et al., 1988), this pathogen is a far more frequent
postpasteurization contaminant of ice cream. Since May 1986, over 54 Listeria-
related class I recalls were issued for unfermented dairy products, approximately
85% of which involved ice cream, ice cream novelties, and related frozen desserts
contaminated with very low levels of L. monocytogenes (Ryser, 1999b). In-
creased prevalence of this pathogen in frozen rather than fluid dairy products
coincides with the relatively complex handling of such products, particularly ice
cream novelties, during manufacture and packaging. Given presumed low levels
of contamination, inability of Listeria to grow in frozen dairy products and recall
of more than 3 million gallons of ice cream without incident, consumption of
such products does not appear to pose a major public health threat.
As can be surmised from the previous discussion of outbreaks, L. monocy-
togenes is a frequent contaminant of cheese, most notably soft, surface-ripened
varieties such as Brie and Camembert, which support growth of the organism
during cheese ripening. Since 1986, over 35 class I recalls were issued for domes-
tically produced cheese, principally Mexican-style cheese contaminated with L.
monocytogenes (Ryser, 1999c). During this same period, at least 28 imported
cheeses, including French Brie, Danish Esrom, and Anari goat’s milk cheese
from Cyprus, were similarly recalled. According to Ryser (1999c), approximately
4% of European-produced cheeses, primarily soft and semisoft varieties, can be
expected to harbor L. monocytogenes.
Considerable work has been done to define the behavior of L. monocyto-
genes during manufacture and storage of yogurt, buttermilk, and a wide variety
of cheeses, with most of these studies describing what happens if the product is
prepared from artificially contaminated pasteurized milk (Ryser, 1999c). In one
of several studies assessing postpasteurization contamination, L. monocytogenes
persisted an average of 3 weeks in refrigerated cultured buttermilk and yogurt
inoculated to contain 10
3
and 10
4
L. monocytogenes cfu/g (Choi et al., 1988).
Listeria populations generally increase as much as 10-fold when milk is fer-
Public Health Concerns 465
mented using a 1% inoculum of a traditional mesophilic or thermophilic lactic
acid bacteria starter culture, with growth ceasing at pH less than or equal to 5.2
(Schaack and Marth, 1988a, 1988b). However, physical entrapment of Listeria
in curd during cheese making results in a 10-fold increase in numbers. Growth
of Listeria in cheese is primarily confined to soft and semisoft varieties such as
blue, brick, Camembert, and goat cheese, with populations increasing to at least
10
6
cfu/g as the cheese attains a pH greater than 6 during ripening (Table 6).
Although generally unable to grow in fermented dairy products having a pH less
than 5.5, L. monocytogenes can survive in many such cheeses for weeks or
months, with this pathogen even being recovered from 434-day old Cheddar
cheese (Ryser and Marth, 1987a). These findings raise serious concerns regarding
the adequacy of the mandatory 60-day holding period at greater than or equal to
1.7°C for complete inactivation of L. monocytogenes (and other pathogens) in
Cheddar and certain other hard cheese that can be legally prepared from raw
milk. However, barring contamination during packaging, cheeses such as cottage
and mozzarella, which undergo severe heat treatments during manufacture,
should be Listeria free (Buazzi et al., 1992; Ryser et al., 1985).
6. Prevention
Although L. monocytogenes is more heat resistant than most other foodborne
pathogens, current vat and high-temperature, short-time pasteurization practices
inactivate expected levels of L. monocytogenes in raw milk. Thus, barring post-
pasteurization contamination, pasteurized fluid milk products pose a minimal
public health risk. Given the many gallons of ice cream recalled in the United
States, low-level contamination in frozen desserts also appears to be of little
health concern. However, certain low-acid, soft, and surface-ripened cheeses such
as Mexican-style and Brie cheese can support growth of L. monocytogenes to
dangerous levels during ripening, as evidenced by three major outbreaks of listeri-
osis involving numerous fatalities. Consequently, individuals at highest risk (i.e.,
pregnant women, elderly people, and immunocompromised adults) may want to
refrain from eating such cheeses.
J. Salmonellosis
Nontyphoid salmonellae were first recognized as foodborne pathogens in the
1880s when acute gastroenteritis developed in 57 people after consuming beef
that was contaminated with Bacterium enteritidis, which was renamed Salmo-
nella Enteritidis in 1900 in honor of the American bacteriologist D. E. Salmon
(Marth, 1969). From the turn of the century to about 1940, typhoid fever was
commonly associated with consumption of raw milk, as described earlier. How-
ever, the gastroenteritic form of nontyphoid salmonellosis (hereafter salmo-
466
Ryser
Table 6 Fate of L. monocytogenes in Various Cheeses During Ripening and Storage
L. monocytogenes
(log
10
cfu/g or mL)
Ripening
pH Cheese
temp Survival
Cheese Initial Final (°C) Milk Maximum Final (Days) Reference
Blue 4.6 6.3 9–12/4 3.0 4.0–5.0 1.0–2.3 H11022120 Papageorgiou and Marth (1989a)
Brick 5.3 7.3 15/10 2.5–3.0 4.6–6.7 2.7–6.1 H11022168 Ryser and Marth (1988b)
Camembert 4.6 7.5 15/6 2.5–3.0 6.7–7.5 6.7–7.5 H1102265 Ryser and Marth (1987b)
Cheddar 5.1 5.1 13 2.5–3.0 2.6–3.8 H110211.0 70–224 Ryser and Marth (1987a)
Cheddar 5.1 5.1 13 2.5–3.0 3.0–3.7 H110211.0–1.5 70–H11022434 Ryser and Marth (1987a)
Colby 5.1 5.1 4 2.5–3.0 3.6–4.6 2.3–4.1 H11022140 Yousef and Marth (1988)
Cold-pack 5.3 5.1 4 2.4–2.8 2.4–2.8 1.1–2.0 H11022180 Ryser and Marth (1988a)
Cottage 5.4 5.2 3 4.0–5.0 1.3–2.8 H110211.0–2.4 17–28 Ryser et al. (1985)
Feta 4.7 4.4 22/4 3.7 5.7–6.2 2.8–4.6 H1102290 Papageorgiou and Marth (1989b)
Goat 5.5 6.2 12 5.0–6.0 6.9 6.2 H11022126 Tham (1988)
Gouda 5.5 5.5 13 2.5 4.2 3.2 H1102242 Northolt et al. (1988)
Mozzarella 5.2 5.2 5 4.0–5.0 H1102110 H1102110 H110211 Buazzi et al. (1992)
Parmesan 5.1 5.1 13 4.0–5.0 3.3–4.3 H1102110 14–112 Yousef and Marth (1990)
Public Health Concerns 467
nellosis) was not clearly linked to raw milk consumption until the mid-1940s.
Interest in milkborne salmonellosis has peaked twice since the 1940s, first in
1966 when several large outbreaks were traced to nonfat dry milk and again in
1985 when one of the largest recorded outbreaks of foodborne salmonellosis
involving more than 180,000 cases was traced to consumption of a particular
brand of pasteurized milk in the Chicago area (El-Gazzar and Marth, 1992). Three
years before the Chicago outbreak, milk and dairy products were responsible for
5 of 55 (9%) outbreaks of foodborne illness in the United States (MacDonald
and Griffin, 1983). Today, Salmonella and Campylobacter are generally recog-
nized as the two leading causes of dairy-related illness in the United States and
western Europe, with rates of infection being particularly high in regions of the
world where raw milk is neither pasteurized nor boiled.
1. General Characteristics
All salmonellae are of public health concern given their ability to produce infec-
tions ranging from a mild self-limiting form of gastroenteritis associated with
consumption of contaminated dairy products to septicemia and life-threatening
typhoid fever produced by S. Typhi, as discussed previously. A prominent group
of the family Enterobacteriaceae, salmonellae are short, gram-negative, faculta-
tively anaerobic, rod-shaped bacteria (El-Gazzar and Marth, 1992; Kantor, 1986).
These organisms grow on common laboratory media at temperatures between 5
and 45°C (optimum 35–37°C) and at a
w
values greater than or equal to 0.95
(Bryan et al., 1979). However, a few strains can multiply in both laboratory media
and certain foods at refrigeration temperatures (Matches and Liston, 1968). Bio-
chemically, salmonellae produce gas from glucose, reduce nitrate to nitrite, and
can utilize citrate as a sole carbon source (Flowers et al., 1992). Most strains are
lysine decarboxylase positive, hydrogen sulfide positive, and motile by peritri-
chous flagella, but important exceptions have been noted. Further classification
of the genus Salmonella is still a source of confusion, because there are three
different classification schemes. Using the classic and still popular Kauffmann-
White scheme, which is based on somatic (O), flagellar (H), and capsular (Vi)
antigens, more than 2300 Salmonella serovars (distinct antigenic profiles) are
recognized (D’Aoust, 1994). These serovars can be grouped into five different
subgenera. In this classification scheme, each serovar has a descriptive and geo-
graphical ‘‘species’’ or ‘‘popular’’ name such as Salmonella Typhimurium or
Salmonella Heidelberg, with these names still being widely used. The Edwards
and Ewing scheme, another antigenically based classification system currently
decreasing in popularity, recognizes three major species or groups—S. Typhi,
Salmonella Choleraesuis, and S. Enteritidis with the last species comprising
nearly all of the 2300 aforementioned Salmonella serovars. Based on DNA hy-
bridization studies, the genus Salmonella also can be divided into seven widely
468 Ryser
accepted subgroups (Flowers et al., 1992), each with its own phenotypic charac-
teristics.
2. Isolation and Detection Methods
Examination of dairy products for Salmonella (Andrews et al., 1998; Flowers et
al., 1992a, 1992b) begins with preenrichment of the sample in a nonselective
medium, most often lactose broth, for resuscitation of injured or debilitated cells.
Following 18–24 h of incubation at 35°C, two different selective enrichment
media—selenite cystine and tetrathionate broth—are inoculated from the preen-
richment broth and similarly incubated. Thereafter, plates of Hektoen enteric,
xylose lysine desoxycholate, and bismuth sulfite agar are streaked from both se-
lective enrichment broths and incubated 24–48 h at 35°C for selective isolation
of salmonellae. Alternatively, several rapid methods using fluorescent antibodies,
hydrophobic grid membrane filtration, enzyme immunoassays, DNA hybridiza-
tion, immunodiffusion, and conductivity are commercially available for detecting
salmonellae in enriched samples. All positive findings must be culturally con-
firmed. Presumptive isolates are confirmed as Salmonella using a standard series
of 16 biochemical tests in combination with serological screening tests that use
polyvalent O antisera and either polyvalent H or Spicer-Edwards antisera. Five
commercially available biochemical test kits (i.e., API 20E, Enterotube II, Entero-
bacteriaceae II, MICRO-ID, and Vitek GNI) are approved alternatives to tradi-
tional biochemical confirmation. Biochemically presumptive salmonellae must
still be subjected to serological confirmation with complete serotyping of epide-
miologically important strains confined to qualified reference laboratories.
3. Clinical Manifestations
Although commonly referred to as Salmonella ‘‘food poisoning,’’ gastroenteri-
tis—the first of three clinical manifestations produced by nontyphoid salmonel-
lae—is an infection (not an intoxication or ‘‘poisoning’’) of the small intestine
and less commonly the colon, with no involvement of preformed toxins (D’Aoust,
1994; El-Gazzar and Marth, 1992; Kantor, 1986). The first symptoms to appear
after an initial incubation period of 12–36 h include nausea and vomiting, both
of which subside within a few hours. Development of mild fever, chills, and
abdominal pain sometimes resembling acute appendicitis is soon followed by
diarrhea, the most prominent symptom, which can range from a few loose stools
to overtly bloody and rice water cholera-like stools in more severe cases. During
this period, all infected individuals excrete Salmonella in their feces with samples
from acute cases often containing 10
6
–10
9
salmonellae/g. Although this self-lim-
iting illness typically subsides within 5 days without intervention, symptoms can
persist up to several weeks with 10% of fully recovered patients excreting salmo-
nellae for at least 2 months.
Public Health Concerns 469
Septicemia, the second manifestation of salmonellosis (D’Aoust, 1994; El-
Gazzar and Marth, 1992; Kantor, 1986), occurs as a complication of gastroenteri-
tis in less than 4% of adult patients with fever being the primary symptom. Even
though salmonellosis is generally considered to be among the less serious types of
blood infections, fatalities have been reported in 13% of individuals with serious
underlying illnesses such as cancer and liver disease.
Localized tissue infections, the third manifestation of salmonellosis
(D’Aoust, 1994; El-Gazzar and Marth, 1992; Kantor, 1986), occur as a complica-
tion in 8–25% of patients with prolonged or untreated septicemic infections. Al-
though any part of the body may become infected, lesions and abscesses are most
frequently associated with previously damaged or diseased organs and tissues.
Infections most commonly include osteomyelitis, meningitis, and pneumonia fol-
lowed by pyelonephritis, endocarditis, and suppurative arthritis.
Salmonellosis can only be clinically confirmed by isolating salmonellae
from stool, blood, or other specimens. Because this disease is most often mild
and self-limiting, treatment is usually aimed at preventing dehydration through
fluid replacement (Kantor, 1986). As in other types of gastroenteritis, administra-
tion of antibiotics is contraindicated and limited to patients who either have septi-
cemic or localized tissue infections or are at high risk of development of such
complications. When necessary, the drug of choice is chloramphenicol given only
intravenously.
4. Outbreaks
Dairy-related outbreaks of nontyphoid salmonellosis were first recognized in the
1940s, with raw milk being most commonly identified as the source of infection.
At least four notable outbreaks involving raw milk consumption occurred in the
United States since 1967, with S. Typhimurium and S. Dublin identified as the
causative serovars (Table 7). Although certified raw milk legally sold in Califor-
nia was responsible for one of these outbreaks involving S. Dublin, similar out-
breaks have been documented as far back as 1958 (Anonymous, 1981). Findings
from one epidemiological case-control study (Richwald et al., 1988) suggest that
one-third of all S. Dublin infections in California are raw milk related, with the
incidence of infection being highest among immunocompromised adults.
In England and Wales where records are more complete, raw milk con-
sumption was responsible for 132 of 148 predominantly small, dairy-related out-
breaks (2369 of 2466 cases) from 1951 to 1980 (Galbraith et al., 1982). As in
the United States, the predominant Salmonella serovars again included S. Typhi-
murium (88 outbreaks) and S. Dublin (14 outbreaks), both of which are frequently
recovered from raw milk, dairy cattle, and farm environments (Marth, 1969).
During the 1980s, raw milk consumption was linked to at least 58 outbreaks
involving 1088 cases in England and Wales, with the size of these outbreaks
470
Ryser
Table 7 Major Salmonellosis Outbreaks Associated with Milk and Milk Products from 1965 to 1994
Number
Location Year Product Salmonella Serovar of cases Reference
United States
Nationwide 1965–1966 Nonfat dry milk Newbrunswick 29 Collins et al. (1968)
New York 1967 Ice cream Typhimurium 1790 Armstrong et al. (1970)
Washington 1967 Raw milk Typhimurium 40 Francis and Allard (1967)
California 1971–1975 Raw milk Dublin 44 Werner et al. (1979)
Maine 1973 Eggnog Typhimurium 32 Steere et al. (1975)
Louisiana 1975 Pasteurized Newport 43 Blouse et al. (1975)
milk
Colorado 1976 Cheddar Heidelberg 339 Fontaine et al. (1980)
Arizona 1978 Pasteurized Typhimurium 23 Dominguez et al. (1979)
milk
Washington 1980–1981 Raw milk Dublin 125 Nolan et al. (1981)
Montana 1981 Raw milk Typhimurium 59 Day et al. (1981)
Kentucky 1984 Pasteurized Typhimurium 16 Adams et al. (1984)
milk
Illinois 1985 Pasteurized Typhimurium 16,000 Ryan et al. (1987)
milk
Nationwide 1989 Mozzarella Javiana/Oranienburg 164 Hedberg et al. (1992)
Kansas 1992 Ice cream Enteritidis 15 Anonymous (1992a)
Kansas 1992 Ice cream Enteritidis 31 Anonymous (1992a)
Florida 1993 Ice cream Enteritidis 14 Buckner et al. (1994)
Public
Health
Concerns
471
Nationwide 1994 Ice cream Enteritidis 224,000 Anonymous (1994), Hennessy et al. (1996)
Washington 1997 Mexican-style Typhimurium 17 Villar et al. (1999)
cheese DT104
Canada
Ontario 1980–1983 Cheddar Muenster 33 Styliadis and Barnum (1984)
5 Provinces 1984 Cheddar Typhimurium 2,000 Bezanson et al. (1985)
Ontario 1994 Raw milk soft Berta 82 Ellis et al. (1998)
cheese
Europe
England 1972–1973 Raw milk Typhimurium 316 MacLachlan (1974)
Scotland 1976 Raw milk Dublin 700 Small and Sharp (1979)
England 1977 Raw milk Typhimurium 334 Anonymous (1977)
Poland 1978 Pasteurized Enteritidis 890 Suchowiak and Haiat (1980)
milk
Scotland 1981 Raw milk Typhimurium 654 Cohen et al. (1993)
Poland 1981 Ice cream Typhimurium 881 Polewska-Jeske et al. (1984)
Italy 1981 Mozzarella Typhimurium 100 Felip and Toti (1984)
Sweden 1985 Pasteurized Saintpaul 153 Anderson et al. (1986)
milk
Switzerland 1985 Vacherin Mont Typhimurium 40 Sharp (1987)
d’Or
England/Wales 1989 Irish soft cheese Dublin 42 Maguire et al. (1992)
France 1993 Goat’s milk Enterica 273 Desenclos et al. (1996)
cheese
472 Ryser
increasing because of commercial distribution of raw milk (Barrett, 1986, 1989;
Sockett, 1991). This problem is particularly evident in Scotland where 21 out-
breaks (1090 cases) were reported between 1980 and 1982 (Reilly et al., 1983).
One of these outbreaks sickened 654 people and cost an estimated $120,000
(Cohen et al., 1983).
American interest in milkborne salmonellosis first peaked in 1966 when
29 cases of gastroenteritis diagnosed in 17 states over a 10-month period were
linked to nonfat dry milk containing S. Newbrunswick, a serovar rarely encoun-
tered in the United States (Collins et al., 1968). Of the 29 victims, more than
half were infants or children younger than 5 years of age. The contaminated
product was recalled from sale and soon traced to a single midwest factory pro-
ducing approximately 11 million lb of nonfat dry milk annually (Marth, 1969).
Although the source of contamination was never identified, incomplete pasteur-
ization before spray drying was suspected as one likely cause, with post-pro-
cessing contamination cited as a contributing factor. Two additional noteworthy
outbreaks also have been traced to nonfat dry milk produced in other countries.
During 1973, more than 3000 cases of gastroenteritis on the island of Trinidad
occurred primarily among infants and young children and were traced to con-
sumption of nonfat dry milk contaminated with S. Derby (Weissman et al., 1977).
Although faulty packaging equipment may have contributed to this outbreak, the
source of contamination was never identified. During 1985, consumption of one
particular brand of an infant dried milk product was also responsible for at least
46 cases of S. Ealing gastroenteritis in England; the source of infection was traced
to a malfunctioning spray dryer (Rowe et al., 1987).
Pasteurized milk can also serve as a vehicle for salmonellosis. Three small
pre-1985 outbreaks were linked to ingestion of inadequately pasteurized milk in
Louisiana, Arizona, and Kentucky. Such outbreaks did not attract widespread
attention until 1985 when more than 16,000 culture-confirmed cases of Salmo-
nella gastroenteritis in the Chicago area were traced to consumption of 2% pas-
teurized milk contaminated with a rare multi–antibiotic-resistant, plasmid-con-
taining strain of S. Typhimurium (Ryan et al., 1987; Schuman et al., 1989). One
follow-up survey placed the number of people affected at nearly 200,000, making
this the second largest outbreak of foodborne salmonellosis ever recorded. (The
largest outbreak occurred in 1994, involving approximately 240,000 persons, and
was associated with nationally distributed ice cream made in Minnesota [Hen-
nessy et al., 1996]). Although the milk outbreak affected an estimated 3 of every
1000 residents in the Chicago area, with the highest attack rate being observed
in children, illness was particularly common among individuals who were taking
antibiotics to which this particular strain of S. Typhimurium was resistant, with
2500 such hospitalized cases being reported. Further complications developed in
16 of these patients, including osteomyelitis, brain abscesses, and meningitis, or
Public Health Concerns 473
they had unnecessary appendectomies. Eighteen fatalities were reported with the
epidemic strain cited as either the primary or contributing cause of death. The
implicated milk containing the epidemic strain was traced to a northern Illinois
dairy processing facility and was immediately recalled from the market. Microbi-
ological studies indicated that the outbreak-related strain was heat sensitive and
would not be expected to survive pasteurization, but inspection of the dairy plant
revealed a potential cross connection between several holding tanks that would
have allowed raw milk to contaminate pasteurized skim milk, condensed milk,
and cream. The factory ceased operations when the outbreak occurred and has
not reopened.
During 1992 and 1993, homemade ice cream was linked to three small
outbreaks of S. Enteritidis gastroenteritis in Florida and Kansas, with a similar
family outbreak also recently reported in England (Morgan et al., 1994a). The
source of contamination in all of these outbreaks was traced to raw eggs, an
ingredient of homemade ice cream particularly noted for harboring S. Enteritidis.
One year later, commercially produced ice cream was responsible for 2000 (final
estimate 240,000 cases) cases of S. Enteritidis gastroenteritis in Minnesota, Wis-
consin, South Dakota, and elsewhere with the tainted product eventually recalled
nationwide. The ice cream contained less than one organism per gram with an
estimated infectious dose of no more than 28 cells in a single serving (Vought
and Tatini, 1998). Tankers used to haul liquid raw eggs also were used to haul
pasteurized ice cream mix to the ice cream factory where the mix was not repas-
teurized. The tankers were the likely source of S. Enteritidis (Hennessy et al.,
1996).
Salmonellosis outbreaks involving fermented dairy products have been pri-
marily confined to cheese, with six notable outbreaks being reported since 1976.
In the first of these outbreaks, 339 cases of S. Heidelberg gastroenteritis were
identified in Colorado and traced to Cheddar cheese prepared in Kansas from
pasteurized milk (Fontaine et al., 1980). The incriminated cheese contained less
than one organism per 100 g, thus suggesting a low oral infectious dose, with
prompt recall of the product possibly averting up to 25,000 additional cases.
Cheddar cheese was again identified as the vehicle of infection in two Canadian
outbreaks reported during the 1980s. In the first outbreak, S. Muenster was recov-
ered from aged raw milk Cheddar cheese and was traced to an infected dairy
herd with one mastitic cow shedding 2000 S. Muenster/per mL of milk. Few
serovars other than S. Muenster and S. Dublin can reportedly infect the bovine
mammary gland and contaminate milk in this manner. The second and largest
cheeseborne salmonellosis outbreak occurred in Ontario and the four maritime
provinces with more than 2000 culture-confirmed cases in 1984 linked to Cheddar
cheese prepared from heat-treated or pasteurized milk (Bezanson et al., 1985;
D’Aoust et al., 1985; Ratnam and March, 1986). Two distinct strains of S. Typhi-
474 Ryser
murium were implicated in this outbreak. Both strains were recovered from
cheese at levels of less than 10 organisms per 100 g, which again suggests a low
oral infectious dose.
Seven outbreaks have been traced to cheeses other than Cheddar, with one
of these outbreaks responsible for 164 cases of salmonellosis in Minnesota, Wis-
consin, Michigan, and New York during 1989. Mozzarella cheese containing two
epidemic strains, S. Javiana and S. Oranienburg, was the vehicle of infection.
Inadequate factory sanitation practices and contamination of the cheese by in-
fected production workers were suggested as probable causes. Another North
American outbreak in Ontario was linked to farmstead soft cheese with S. Berta
isolated from chickens on the farm (Ellis et al., 1998). During the first half of
1997, at least 17 cases of salmonellosis in Washington state were epidemiologi-
cally linked to Mexican-style cheese prepared from raw milk (Villar et al., 1999).
Unlike previous outbreaks, this cheese, which was consumed primarily by His-
panic children, contained S. Typhimurium DT104—a rapidly emerging multi–
antibiotic-resistant strain that currently comprises about one-tenth of all S. Typhi-
murium isolates examined at the Centers for Disease Control and Prevention.
This strain of Salmonella was eventually traced to several nearby dairy herds.
The four remaining cheese-associated outbreaks occurred in Europe, one of which
involved a soft raw milk Irish-type cheese prepared on a family farm in England.
Contamination was traced to four family-owned cows that were asymptomati-
cally excreting S. Dublin, the epidemic strain in this outbreak. The remaining
milkborne cases of salmonellosis have almost invariably involved milk from
dairy cows, with a few small outbreaks and two large outbreaks outside the
United States being linked to goat’s milk (Sharp, 1987) and goat’s milk cheese
(Desenclos et al., 1996).
5. Occurrence and Survival in Dairy Products
Numerous Salmonella infections have been reported in dairy cattle and other
ruminant animals with symptomatic and asymptomatic shedding of the organism
in feces (Marth, 1969; Styliades and Barnum, 1984). Although salmonellae are
seldom associated with mastitis, S. Dublin and S. Muenster can colonize the udder
and be shed in milk at levels up to 2000 organisms/mL (Fontaine et al., 1980).
According to McManus and Lanier (1987), raw milk is a good source of salmo-
nellae, with 32 of 678 (4.7%) raw milk bulk tank samples testing positive in
Wisconsin, Michigan, and Illinois. Five years later, Rohrbach et al. (1992) identi-
fied Salmonella in 26 of 292 (8.9%) farm bulk tank samples collected from east-
ern Tennessee and southwest Virginia. However, lower contamination rates have
been reported elsewhere. Following the 1980 to 1983 cheeseborne outbreak in
Ontario, Canada, McEwen et al. (1988) detected salmonellae, including S. Muen-
ster (the epidemic serovar), in raw milk bulk tanks from 9 of 759 (1.2%) dairy
Public Health Concerns 475
farms participating in this year-long study, with most positive samples being
observed during autumn. More recently, milk from only 3 of 1720 (0.17%) farm
bulk tanks in Ontario tested positive for Salmonella (Steele et al., 1997). In En-
gland, 2 of 1138 (0.2%) raw milk samples on sale to the public harbored salmo-
nellae (Humphrey and Hart, 1988), thereby reaffirming the potential hazard of
raw milk consumption.
Standard vat and high-temperature, short-time pasteurization destroys ex-
pected levels of salmonellae (i.e., H11021100 cfu/mL), including S. Senftenberg 775W
(the most heat-resistant serovar) with a wide margin of safety (D’Aoust et al.,
1987). Inadequate pasteurization and postprocessing contamination have occa-
sionally resulted in milk and cream that tested positive for Salmonella as evi-
denced from the aforementioned outbreaks. Unlike Listeria and Yersinia, which
can grow during refrigeration, numbers of salmonellae decrease in fluid milk
products and butter prepared from inoculated cream during extended storage at
less than or equal to 7°C (Kasrazadeh and Genigeorgis, 1994; Sims et al., 1970;
Wundt and Schnittenhelm, 1965). However, at 12 and 20°C, Salmonella popula-
tions double every 20 and 8.8 h, respectively, which reinforces the need for con-
stant refrigeration.
Nonfat dried milk also can occasionally harbor salmonellae as demon-
strated by a highly publicized 1966 outbreak in the United States. Surveys con-
ducted on nonfat dried milk over the following 2 years showed that 0.2% of all
samples contained salmonellae (Marth, 1969), and another study (LiCari and Pot-
ter, 1970a) showed that commercial spray drying conditions killed more than
99.9% of salmonellae in inoculated skim milk but did not yield Salmonella-free
nonfat dry milk at the inoculum levels used. In a follow-up study (Licari and
Potter, 1970b), Salmonella populations in heavily inoculated nonfat dried milk
decreased sharply when the product was held at 25°Cto55°C. However, persis-
tence of salmonellae in some samples for at least 8 weeks indicates that such
storage cannot be used as a substitute for good manufacturing practices.
Ice cream and related frozen desserts can become contaminated before
freezing and give rise to outbreaks of salmonellosis. Except for the aforemen-
tioned 1994 outbreak involving approximately 240,000 cases in the United States,
such contamination has been primarily confined to homemade ice cream with
raw eggs being the invariable source of S. Enteritidis. Contamination rates are
very low in commercially produced ice cream, with two recent European surveys
identifying salmonellae in 0 of 157 (Massa et al., 1989) and 1 of 67 (Rodriguez-
Alvarez et al., 1994) samples sold in Italy and Spain, respectively. However,
higher Salmonella contamination rates have been reported in less developed
countries such as Iraq (Al-Rajab et al., 1986) where 12 of 110 (10.9%) locally
produced ice cream samples tested positive.
Despite the recent cheese-related salmonellosis outbreaks, salmonellae are
rarely isolated from commercially produced cheeses including Cheddar. In sur-
476 Ryser
veys responding to the 1980–1983 outbreak in Ontario, Canada, Brodsky (1984a,
1984b) failed to recover Salmonella from 250 samples of freshly prepared Ched-
dar cheese or 127 samples of 60-day-old Cheddar cheese prepared from raw milk.
According to Mor-Mur et al. (1992), 42 samples of 60-day-old farm-produced
goat’s cheese in Spain were also free of salmonellae. However, presence of sal-
monellae in 8 of 142 (5.6%) locally produced Iranian cheeses (Farkhondeh et
al., 1974) again raises concerns regarding safety of dairy products manufactured
in less developed countries where salmonellosis is endemic.
The fate of salmonellae has been assessed during the manufacture and rip-
ening of many different cheeses (Table 8). Modest growth of salmonellae occurs
during Cheddar cheese making, as predicted by Park and Marth (1972a), with
populations increasing 10- to 100-fold beyond the expected 10-fold increase,
which results from physical entrapment of the organism during curd formation.
Furthermore, when cheeses from the same lot were ripened at 0–13°C, salmonellae
survived 84–300 days, with the pathogen always persisting longer in cheese rip-
ened at the lower temperature. White and Custer (1976) subsequently reported that
16 of 48 (33%) and 6 of 48 (12.5%) lots of Cheddar cheese similarly prepared
from milk containing 10
5
salmonellae cfu/mL were still positive after 9 months
of ripening at 4.5 and 10°C, respectively. Most important, when naturally contami-
nated Cheddar cheese from the two Canadian outbreaks was stored at 5°C, salmo-
nellae persisted up to 125 days (Styliades and Barnum, 1984; Wood et al., 1984)
and 240 days (D’Aoust, 1985), well beyond the required 60-day holding period at
greater than or equal to 1.7°C for such cheeses prepared from raw or heat-treated
milk. Using Cheddar cheese samples from the outbreak, D’Aoust (1985) estimated
the oral infective dose at one to six total cells of Salmonella, which suggests that
even very low levels of contamination can pose serious health risks.
Additional cheese varieties studied have included mozzarella following the
1985 outbreak in the United States as well as cottage and Brie cheeses. According
to Eckner et al. (1990), Salmonella was completely inactivated during molding
and stretching of mozzarella cheese curd at 60°C. However, contamination of
mozzarella cheese during shredding or packaging can lead to extended survival
of salmonellae and possible health risks as evidenced from the aforementioned
outbreak. Cottage cheese would appear to be of minimal public health concern,
with large populations of salmonellae completely inactivated after cooking the
curd and whey mixture at 125°F (52°C) for 20 min (McDonough et al., 1967).
However, salmonellae also can persist in cottage cheese as postpasteurization
contaminants throughout the normal shelf life of the product (Sims et al., 1989).
Soft surface-ripened cheeses such as Brie and Vacherin Mont d’Or have been
implicated in major outbreaks involving other pathogenic organisms, including
E. coli and L. monocytogenes, which can attain high levels on the surface of
these cheeses during ripening. Although growth of salmonellae on the surface
of such cheeses is prevented during ripening at 4–20°C (Little and Knochel,
Public
Health
Concerns
477
Table 8 Fate of Salmonellae in Various Cheeses During Ripening and Storage
Salmonella
(log 10 cfu/g or ml)
pH Cheese
Ripening Survival
Cheese Initial Final temp (°C) Milk Maximum Final (Days) Reference
Cheddar 5.52 5.22 0 3.14 5.78 1.00 180 Hargrove et al. (1969)
Cheddar 5.52 5.15 4 3.14 5.78 0.30 150 Hargrove et al. (1969)
Cheddar 5.70 5.40 7 2.00 4.10 1.30 210 Park et al. (1970a)
Cheddar 5.80 5.60 13 2.00 5.30 1.00 H11022210 Park et al. (1970a)
Cheddar 5.10 — 7.5 1.90 5.00 H110211.00 112 Goepfert et al. (1968)
Cheddar 5.10 — 13 1.90 5.00 H110211.00 84 Goepfert et al. (1968)
Mozzarella — — — 6.00 6.00 H110211.00 H110211 Eckner et al. (1990)
Monterey Jack — — 4.5 6.50 9.00 4.50 H11022183 Eckner and Zottola (1991)
Montasio 5.30 5.60 12 6.80 5.80 0.80 90 Stecchini et al. (1991)
Feta (pasteurized cow’s milk) 5.10 5.69 4 3.40 6.20 1.90 H1102275 Erkmen and Bozoglu (1995)
Feta (raw ewe’s milk) 4.80 4.40 4 7.30 8.90 1.00 20 Papadopoulou et al. (1993)
Cold-pack 5.10 4.70 12.8 — 2.70 1.00 H11022188 Park et al. (1970b)
Cold-pack 5.10 5.05 4.4 — 2.70 1.70 H11022188 Park et al. (1970b)
478 Ryser
1994), continued survival of the organism during ripening may again pose a po-
tential health hazard.
6. Prevention
Historically, salmonellosis has been most commonly traced to raw milk, and
consumption of such milk is best avoided. Despite several outbreaks and reports
of extended survival of salmonellae in cheese, most cheeses—including those
legally prepared from raw or heat-treated milk and then properly aged—appear
to pose a minimal health risk. All salmonellae are readily destroyed by pasteuriza-
tion. Hence, if postpasteurization contamination is prevented, all pasteurized
dairy products will be free of salmonellae. However, use of raw eggs (a potential
source of S. Enteritidis) in homemade ice cream is strongly discouraged as evi-
denced from a series of recent outbreaks.
K. Staphylococcal Poisoning
A classic foodborne intoxication, staphylococcal poisoning results from ingesting
a preformed, heat-stable toxin (termed enterotoxin) produced by the bacterium
Staphylococcus aureus. Although reports of cases resembling present-day staphy-
lococcal poisoning date back to 1830, the organism was not observed microscopi-
cally until the 1870s (Bergdoll, 1979). Ogston coined the term staphylococcus
(from the Greek words staphyle, bunch of grapes, and coccus, a grain or berry)
to describe this organism in 1881, with Rosenbach proposing the genus Staphylo-
coccus and the species S. aureus 3 years later. Known during the 1870s to cause
skin infections, staphylococci were not associated with foodborne illness until
1884 when Vaughan and Sternberg recovered the organism from Cheddar cheese
linked to approximately 300 cases of food poisoning in Michigan (Hendricks et
al., 1959). In 1914, the relationship between staphylococcal food poisoning and
the toxin produced by S. aureus was established by Barber using human volun-
teers during a milkborne outbreak in the Phillipines. These findings were later
confirmed by Dack et al. (1930) using sterile culture filtrates, with the first of 10
known enterotoxins being purified during the late 1950s (Bergdoll et al., 1959).
Dairy products are well-known vehicles of staphylococcal poisoning, with
cheese and raw milk being linked to outbreaks before the turn of the last century
(Bergdoll, 1979). Following a marked decrease in incidence of milkborne typhoid
and scarlet fever, staphylococcal poisoning emerged as the major milkborne ill-
ness by the late 1930s, accounting for 26, 50, and 30% of all milkborne diseases
reported in the United States during the 1940s, 1950s, and 1960s, respectively
(Bryan, 1983). These cases of staphylococcal poisoning involved various dairy
products including raw milk, pasteurized milk, cheese, ice cream, butter, and
nonfat dry milk. Staphylococcal poisoning has been most commonly traced to
Public Health Concerns 479
nondairy foods (e.g., ham, cream-filled pastries), with improvements in milk pas-
teurization and dairy sanitation standards now making dairy-related outbreaks
rare in the United States (Headrick et al., 1996), England (Galbraith et al., 1982)
and most other industrialized countries.
1. General Characteristics
In the family Micrococcaceae, the genus Staphylococcus includes 32 species of
facultatively anaerobic, nonmotile, small gram-positive cocci, most of which are
catalase positive and oxidase negative (Kloos and Bannerman, 1995; Kloos and
Schleifer, 1986). When viewed microscopically, the staphylococci appear in
pairs, short chains, tetrads, and grape-like clusters, with the latter arrangement
being most evident in cultures grown on solid media. Although 15 Staphylococ-
cus spp. are of varying clinical importance in humans, S. aureus clearly dominates
as the primary human pathogen, being responsible for a wide range of cutaneous
and life-threatening systemic infections in addition to toxic shock syndrome and
staphylococcal food poisoning.
On nonselective media more than 90% of S. aureus (aureus: Latin for
golden) strains produce pigmented colonies ranging from cream yellow to orange
(Kloos and Bannerman, 1995; Kloos and Schleifer, 1986). All isolates grow in
common laboratory media at 10–45°C (optimum: 30–37°C) and at pH 4.2–9.3
(optimum: pH 7.0–7.5). Although a few strains can grow at temperatures as low
as 6.7°C (Angelotti et al., 1961), production of enterotoxin is typically limited
to temperatures above 15°C and pH values above 5. S. aureus growth and toxin
production are generally poor in the presence of competing microflora. Unlike
most other foodborne pathogens, S. aureus grows at a
w
0.84 (Lee et al., 1981) and
in the presence of up to 15% NaCl (Bergdoll, 1989), with enterotoxin produced at
a
w
values greater than 0.86. Production of several key enzymes, including coagu-
lase, thermonuclease, and β-hemolysin, is used almost universally to differentiate
S. aureus from other staphylococci, with sensitivity to lysostaphin and anaerobic
utilization of glucose and mannitol also being helpful. However, attempts to asso-
ciate enterotoxin production in S. aureus with specific biochemical properties
and phage types have generally failed. Consequently, confirmation of the toxin
by serological or other means provides the only proof that the particular strain
is enterotoxigenic.
Ten serologically distinct, enterotoxigenic proteins known as enterotoxin
types A, B, C
1
,C
2
,C
3
, D, E, F, G, and H are recognized in S. aureus (Bergdoll,
1989; Pereira et al., 1996; Su and Wong, 1995), with some strains producing two
or three types of enterotoxin (Lopes et al., 1993). Classified as relatively low
molecular weight, single-chain polypeptides, these plasmid or chromosomally
linked extracellular enterotoxins are resistant to most proteolytic enzymes and a
pH of 2, which allows their passage into the gastrointestinal tract without loss
480 Ryser
of activity. Although S. aureus is readily destroyed in milk during pasteurization,
the staphylococcal enterotoxins are relatively heat stable and are not easily inacti-
vated in foods during cooking. Enterotoxin production is not limited to S. aureus,
with 10 coagulase-negative and 2 coagulase-positive species of staphylococci (S.
hyicus and S. intermedius) also being known to contain enterotoxigenic strains
(Bergdoll, 1989). However, other than one recent butter-related outbreak traced
to an enterotoxigenic strain of S. intermedius, all remaining reports of staphylo-
coccal food poisoning have been confined to S. aureus (Khambaty et al., 1994).
2. Isolation and Detection Methods
The significance of finding S. aureus in foods suspected of causing staphylococcal
poisoning should be interpreted with caution. Although foods must typically con-
tain at least 10
6
enterotoxigenic S. aureus cfu/g to induce illness, small numbers
of S. aureus present in thermally processed foods may represent the survivors of
very large populations. Consequently, staphylococcal poisoning can only be veri-
fied by isolating enterotoxigenic staphylococci from the food or demonstrating
the presence of enterotoxin in the food.
In dairy-related outbreaks of staphylococcal poisoning, samples are nor-
mally surface plated on Baird-Parker agar (BPA) (Bennett and Lancette, 1998;
Flowers et al., 1992a; Lancette and Tatini, 1992). Following 48 h of incubation
at 35°C, presumptive S. aureus colonies appear gray to black from reduction of
tellurite, with lipolytic strains surrounded by an opaque halo from hydrolysis of
egg yolk. A three-tube most probable number method using trypticase soy broth
containing 10% NaCl is recommended for samples likely to contain either low
numbers of S. aureus or high levels of competing background flora. After 48 h
of incubation at 35°C, tubes showing growth are streaked to plates of BPA, which
are incubated and examined as just described. Presumptive S. aureus isolates on
BPA are then tested for coagulase activity using either the standard rabbit plasma
test or a rapid latex agglutination assay kit. Coagulase-positive strains should be
confirmed as S. aureus based on results from one of the commercially available
rapid test kits or a series of standard biochemical tests, which includes catalase
and thermonuclease production, sensitivity to lysostaphin, and anaerobic utiliza-
tion of glucose and mannitol. Because multiple enterotoxigenic strains of S.
aureus are frequently encountered in foods, specialized strain-specific typing
techniques such as phage typing, plasmid analysis, antibiotic susceptibility pat-
tern, restriction enzyme analysis, and pulsed-field gel electrophoresis are often
necessary to clearly identify the source of intoxication (Khambaty et al., 1994).
Identifying enterotoxigenic strains of S. aureus in foods has traditionally
involved use of specific monoclonal or polyclonal antibodies, which react with
antigenically distinct antigens. Isolates are specially cultured for enterotoxin pro-
duction using either the membrane-over agar, sac culture, or semisolid agar method,
Public Health Concerns 481
the last of which is AOAC approved and recommended by the FDA (Bennett and
Lancette, 1998; Flowers et al., 1992a; Lancette and Tatini, 1992). Two traditional
serological methods, namely, the AOAC-approved microslide method (the standard
method) and the optimum sensitivity plate, can be used to detect enterotoxin. How-
ever, several highly sensitive and rapid methods including latex agglutination, en-
zyme-linked immunosorbent assays, and DNA hybridization assays are also com-
mercially available for identifying enterotoxins in culture fluids.
Detecting enterotoxin in suspect foods is complicated by the minute
amounts of toxin that may be present (Bennett and Lancette, 1998; Flowers et
al., 1992a; Lancette and Tatini, 1992). If the standard microslide method is to
be used, the toxin must first be extracted from 100 g of food and then concentrated
to 0.2 mL in a long and complicated procedure. However, use of the aforemen-
tioned rapid assays, which possess greater enterotoxin sensitivity, greatly shortens
and simplifies sample preparation.
3. Clinical Manifestations
Staphylococcal food poisoning is a severe foodborne intoxication of short dura-
tion. Symptoms normally develop 1–6 h after ingestion of food containing entero-
toxin, with nausea, vomiting, diarrhea, abdominal cramps, and mild leg cramps
occurring most commonly (Bergdoll, 1989). During the acute stage of illness,
individuals may also experience brief headaches, cold sweats, rapid pulse, slight
fluctuations in body temperature, and various degrees of prostration and dehydra-
tion, all of which depend on sensitivity of the individual and amount of toxin
ingested. Early studies with human volunteers and results from a recent outbreak
involving chocolate milk have both confirmed that ingesting as little as 1 H11003 10
H110027
g of enterotoxin is sufficient to induce aforementioned symptoms in susceptible
individuals (Evenson et al., 1988). Acute symptoms typically last only 1–8 h,
with the patient fully recovering within 1–2 days. Consequently, most outbreaks
are never reported or investigated. Hospitalization is seldom required. However,
intravenous therapy and fluid replacement may be necessary in severe cases of
dehydration and collapse. Complications from staphylococcal poisoning are sel-
dom encountered and are limited to a few reports of acute gastritis and pseudo-
membranous enterocolitis. Although highly unusual, several fatalities have been
recorded in the early literature.
4. Outbreaks
Milk and dairy products have been associated with staphylococcal poisoning in
the United States for more than 100 years, with numerous accounts of illness
documented before 1950. According to Stone (1943), at least 23 outbreaks of
staphylococcal poisoning (H113501332 cases) were traced to dairy products during the
28-year period from 1914 to 1942. Raw milk was most frequently implicated (7
482 Ryser
outbreaks/500 cases) followed by ice cream (5 outbreaks/360 cases), hollandaise
sauce (5 outbreaks/90 cases), butter (2 outbreaks/150 cases), evaporated milk (1
outbreak/90 cases), pasteurized milk (1 outbreak/29 cases), and Jack cheese (1
outbreak/5 cases). Such epidemics were particularly common during the 1940s
when staphylococcal poisoning was responsible for 22 of 49 (44.9%) milkborne
outbreaks reported during 1945, 1946, and 1947. Although staphylococcal poi-
soning is not generally considered a fatal illness, several deaths did occur among
individuals who had consumed raw goat’s milk (Weed et al., 1943) and butter
(Fanning, 1935). Most of the raw milk outbreaks were traced to staphylococcal
mastitis in dairy cows, with temperature abuse of milk cited as a contributing
factor (Stone, 1943). Postpasteurization contamination, poor product handling,
and transmission by human carriers were most often responsible for outbreaks
involving ice cream (Geiger et al., 1935), butter (Stone, 1943), and pasteurized
milk (Caudil and Meyer, 1943; Hackler, 1939).
Cheese and nonfat dry milk emerged as major vehicles for staphylococcal
poisoning after World War II. According to Hendricks et al. (1959), 18 outbreaks
involving at least 475 cases of illness were traced to cheese from 1944 to 1958.
The three largest outbreaks were linked to Cheddar cheese (200 cases), cheese
sauce (80 cases), and Colby cheese (60 cases) (Allen and Stovall, 1960). In the
latter two outbreaks, the cheese was prepared from raw milk containing S. aureus
and the identical phage type was identified in raw milk from dairy herds supplying
the cheese factory. According to Bryan (1983), nonfat dry milk caused 27 out-
breaks of staphylococcal poisoning in 1956; 19 of these outbreaks affected 775
school children in Puerto Rico (Armijo et al., 1957). Although the incriminated
milk was free of S. aureus, toxin was demonstrated using human volunteers,
thereby suggesting that the organism grew and produced enterotoxin in the milk
before spray drying.
During the 1960s, staphylococcal poisoning accounted for 30% of all dairy-
related illnesses in the United States (Bryan, 1983; Woodward et al., 1970). The
largest documented outbreak during this period involved 42 cases and was traced
to Cheddar and Monterey cheese prepared with a contaminated starter culture
(D’Aoust, 1989; Zehren and Zehren, 1968a, 1968b). Using the aforementioned micro-
slide method, which was developed in response to this outbreak, cheese from 59 of
2112 vats was shown to contain an average of 12 μg of enterotoxin A/100 g.
Given increased monitoring programs for mastitis in dairy cattle coupled
with routine milk pasteurization and heightened attention to dairy sanitation, en-
terotoxigenic staphylococci are now responsible for no more than 5% of all milk-
borne disease outbreaks (Bryan, 1983; Holmberg and Blake, 1984), with only
four major outbreaks reported in the United States since 1970. Even though it is
an unusual vehicle for any foodborne illness because of the small amounts typi-
cally consumed, butter products were responsible for three of these outbreaks
(Table 9), with an enterotoxigenic strain of S. intermedius identified as the caus-
Public
Health
Concerns
483
Table 9 Outbreaks of Dairy-Related Staphylococcal Poisoning Reported Worldwide Since 1970
Number
Location Year Product of cases Toxin type Reference
United States
Alabama 1970 Whipped butter H1102226 A Wolf et al. (1970)
Midwest 1977 Whipped butter H11022100 A Francis et al. (1977)
Kentucky 1985 Chocolate milk H11022860 NR Lecos (1986)
Southwest 1991 Butter-blend spread H11022265 A
a
Khambaty et al. (1994)
Foreign
Canada 1977 Emmental cheese 15 B Todd et al. (1981)
England 1983 Unspecified cheese 30 NR Barrett (1986)
France 1983 Sheep’s milk cheese 20 NR Sharp (1987)
Scotland 1984/1985 Sheep’s milk cheese 28 A Bone et al. (1989)
Czechoslovakia 1986 Ice cream H1102216 A Kristufkova and Simkovicova (1988)
Egypt 1986 Nonfat dry milk H1102221 A, B El-Dairouty (1989)
Israel 1987 Goat’s milk 3 B Gross et al. (1988)
Brazil 1987 Minas-type cheese NR A, B, D, E Sabioni et al. (1988)
Brazil 1994 Minas-type cheese 7 H Pereira et al. (1996)
Japan 2000 Milk H1101113,400 NR
NR, not reported.
a
S. intermedius.
484 Ryser
ative agent in the most recent outbreak. In the remaining epidemic (Evenson et
al., 1988), more than 850 school children in Kentucky became ill after consuming
half pints of pasteurized 2% chocolate milk containing extremely low levels of
enterotoxin A.
Reports of dairy-related staphylococcal poisoning are not limited to the
United States. Between 1951 and 1970, a total of 30 dairy-related outbreaks in-
volving raw milk (20 outbreaks/590 cases/2 deaths), dried milk (2 outbreaks/
1100 cases), canned milk (1 outbreak/70 cases), cream (6 outbreaks/131 cases),
and ice cream (1 outbreak/8 cases) were documented in England and Wales, with
an additional 23 milk- and 5 cheese-related outbreaks identified between 1969
and 1990 (Galbraith et al., 1982; Parry, 1966; Steede and Smith, 1954; Wieneke
et al., 1993). According to Maguire (1993), 18 of 31 cheese-related outbreaks of
illness reported in England and Wales from 1951 to 1989 were the result of
staphylococcal poisoning. Although now an unusual occurrence in most industri-
alized countries, the largest dairy-related outbreak of staphylococcal food poison-
ing reported to date occurred during the spring of 2000 when H1101113,400 cases in
Japan were traced to consumption of powdered skim milk that became contami-
nated with raw milk during a 3-h power outage.
5. Occurrence and Survival in Dairy Products
Staphylococci are frequent contaminants of raw milk, with S. aureus being widely
recognized as a common cause of clinical and subclinical mastitis in dairy cattle,
sheep, and goats. The mammary gland represents an important reservoir for S.
aureus, with up to 15 and 83% of raw milk samples from mastitic dairy cattle
(Garcia et al., 1980; Olson et al., 1970) and sheep (Guitierrez et al., 1982), respec-
tively, harboring enterotoxigenic strains. According to surveys conducted in Bra-
zil (dos Santos et al., 1981) and Trinidad (Adesiyun, 1994), S. aureus was present
in 47 and 94%, respectively, of the raw milk samples at populations typically
ranging between 10
5
and 10
6
cfu/mL. In the latter study, 9 of 117 S. aureus
isolates produced enterotoxins A, B, or D. Growth and enterotoxin production by
S. aureus in fluid milk are strain dependent and strongly influenced by incubation
temperature and initial microbial load. Although S. aureus is unable to multiply
in naturally contaminated raw milk during refrigerated storage, Clark and Nelson
(1961) reported that S. aureus populations increased as much as 1000-fold when
raw milk was held at 10°C for 7 days. Even though it is readily inactivated during
high-temperature, short-time and vat pasteurization (Zottola et al., 1969), S.
aureus can enter such products as a postpasteurization contaminant as evidenced
by the aforementioned outbreaks and a survey from Brazil (dos Santos et al.,
1981) in which 6% of pasteurized milk samples harbored S. aureus at levels of
10
2
–10
4
cfu/mL. In the absence of a large background flora, S. aureus growth
is enhanced with enterotoxin detectable in inoculated samples of pasteurized
whole milk, skim milk, half and half, and cream after 18–24 h of incubation at
Public Health Concerns 485
37°C (Halpin-Dohnalek and Marth, 1989b, 1989c; Ikram and Luedecke, 1977;
Minor and Marth, 1972; Varadaraj and Nambudripad, 1983). Decreasing the stor-
age temperature to 22–25°C decreased S. aureus growth with all four products
being nontoxic after 16–24 h. More than 2 days of incubation were required to
detect enterotoxin in half and half and in cream.
Large numbers of S. aureus are seldom found in ice cream (Massa et al.,
1989), nonfat dry milk (Chopin et al., 1978), or butter (Minor and Marth, 1972),
because product composition and storage conditions severely limit growth. How-
ever, enterotoxin can persist for several years in nonfat dry milk prepared from
contaminated fluid milk (Chopin et al., 1978), with staphylococcal enterotoxin
also remaining fully active in ice cream during 7 months of frozen storage (Gogov
et al., 1984). In butter prepared from inoculated cream (Minor and Marth, 1972)
and whey cream (Halpin-Dohnalek and Marth, 1989a), S. aureus populations
seldom increased more than 100-fold, with numbers more often remaining stable
or decreasing during 2 weeks of storage at temperatures ranging from 4 to 30°C.
Whereas enterotoxin production is clearly minimal under these conditions, Minor
and Marth (1972) reported that when cream was inoculated with S. aureus, incu-
bated at 37°C for 24 h, and then churned into butter, the finished product con-
tained at least 1 μg of enterotoxin/100 g or approximately 10% of the enterotoxin
originally present in the cream. Because 0.1 μg of enterotoxin can reportedly
induce symptoms of staphylococcal poisoning (Eversen et al., 1988), ingesting
such butter does pose a potential health risk as demonstrated by the recent butter-
related outbreaks.
Enterotoxigenic staphylococci are occasionally found in cheese, as evi-
denced by the aforementioned outbreaks. In several early surveys, 12–20% of
Cheddar cheese sold in the United States contained potential enterotoxigenic
strains of S. aureus, sometimes at levels exceeding 200,000 cfu/g, with raw milk
cheeses being contaminated most often (Donnelly et al., 1964; Mickelsen et al.,
1962). However, stricter measures for controlling and preventing staphylococcal
mastitis in dairy cattle have sharply reduced these contamination rates over the
past 20 years, with less than or equal to 2% of samples tested in the United States
(Bowen and Henning, 1994; Khayat et al., 1988) and Canada (Brodsky, 1984a,
1984b; Warburton et al., 1986) containing S. aureus populations exceeding the
maximum allowable level (Canadian) of 1000 cfu/g. However, this pathogen is
still commonly found in certain raw milk cheeses manufactured abroad (Abbar
and Mohammed, 1986; Ocando et al., 1991; Sanchez-Rey, 1993).
Starter culture growth and activity have a pronounced inhibitory effect on
proliferation of S. aureus during cheese making. When Cheddar cheese was pre-
pared from pasteurized milk inoculated to contain less than 1000 enterotoxigenic
S. aureus cfu/mL, Koenig and Marth (1982) found that populations increased
approximately 1000- and 10,000-fold using a 1.0% and 0.5% starter culture inoc-
ulum, respectively. An initial 10-fold increase resulted from physical entrapment
of S. aureus in the curd with subsequent growth generally ceasing within 8 h at
486 Ryser
a pH less than or equal to 5.3. During 8 weeks of ripening at 4°C, S. aureus levels
decreased 100- to 1000-fold in cheese prepared without salt; whereas populations
remained relatively stable in cheese containing 1–2% NaCl because of the ad-
verse effects of salt on less salt-tolerant background flora. Nevertheless, virtually
all 8-week-old cheeses were positive for enterotoxin, with the highest toxin levels
being recorded in high-salt cheeses ripened at 10°C. These findings are consistent
with those of Ibrahim et al. (1981a, 1981b), who also reported that, in the event
of starter culture failure, S. aureus growth and enterotoxin production can be
minimized by eliminating salt and limiting exposure of the cheese to ambient
temperatures during pressing. Similar behavior of S. aureus has been reported
during manufacture and storage of a wide variety of experimentally produced
cheeses, including Monterey (Eckner et al., 1991), brick (Tatini et al., 1973),
Swiss (Tatini et al., 1973), Gouda (Stadhouders et al., 1978), Camembert (Mey-
rand et al., 1998), Feta (Erkmen, 1995), Brazilian Minas (dos Santos and
Genigeorgis, 1981), Sudanese soft-brined cheese (Khalid and Harrigan, 1984),
Spanish Burgos (Nunez et al., 1986; Otero et al., 1988), Spanish Manchego
(Gomez-Lucia et al., 1986, 1992), Spanish goat (Mor-Mur et al., 1992), Egyptian
Ras (Naguib et al., 1979), and Egyptian Domiati cheese (Ahmed et al., 1983b;
Helmy et al., 1975). However, in several other studies involving mozzarella (Ta-
tini et al., 1973), blue (Tatini et al., 1973) and Italian Montasio (Stecchini et al.,
1991), no enterotoxins were detected even though S. aureus grew to populations
of more than 10
7
cfu/g during cheese making.
6. Prevention
Given that S. aureus is ubiquitous within the farm environment and carried by
approximately half of the human population, many dairy products contain low
levels of enterotoxigenic staphylococci. However, growth and enterotoxin pro-
duction are both easily prevented by proper refrigeration, with temperature abuse
above 10°C and poor starter culture activity during fermentation being most often
cited as contributing factors in dairy-related outbreaks of staphylococcal poison-
ing. Increased recognition of staphylococcal mastitis in dairy cattle, coupled with
improvements in milk handling, cooling, and pasteurization practices, has made
dairy-related outbreaks of staphylococcal food poisoning an uncommon occur-
rence in the United States and most other industrialized countries. However, such
outbreaks have been observed in less developed countries, with raw milk cheeses
being implicated most often. Hence, consumption of raw milk dairy products
should be avoided.
L. Yersiniosis
The genus Yersinia, formed in 1944 and named after the French bacteriologist
Yersin, who isolated the plague bacillus in 1894, contains 11 different species,
Public Health Concerns 487
3 of which are unquestionably human pathogens (Gray, 1995; Scheimann, 1989).
Y. pestis, the causative agent of bubonic plague (The Black Death), is spread by
the bite of infected rat fleas and has ravaged mankind throughout recorded his-
tory. First identified in 1883, Y. pseudotuberculosis is biochemically similar to
Y. pestis. Most commonly found in rats and birds, Y. pseudotuberculosis occa-
sionally infects humans, causing septicemia, acute gastroenteritis and ‘‘pseudoap-
pendicitis,’’ with internal lesions resembling those observed during intestinal tu-
berculosis (Christie and Corbel, 1990). However, supporting evidence for Y.
pseudotuberculosis as a foodborne pathogen is limited to two reports (Jones et
al., 1982; Prober et al., 1979) in which the organism was detected in milk from
mastitic goats. Y. enterocolitica, the primary cause of Yersinia-related foodborne
gastroenteritis, hereafter termed yersiniosis, was first identified in a human facial
lesion in the United States by Schleifstein and Coleman (1939). The name of the
organism changed from Bacterium enterocolitica to Pasteurella X and finally to
Y. enterocolitica in 1964. However, this pathogen was not widely recognized as
a common cause of foodborne gastroenteritis until the 1970s (Schiemann, 1989),
with most cases being linked to pork, because hogs are the major reservoir for
human pathogenic strains. Since 1972, three outbreaks in the United States and
one outbreak in Canada were traced to consumption of milk products with more
than 500 people being affected. Although readily capable of growing at refrigera-
tion temperatures, Y. enterocolitica is generally regarded as an unusual cause of
milkborne illness because of the low incidence of human pathogenic strains in
the raw milk supply and the high susceptibility of the organism to pasteurization.
1. General Characteristics
A species in the family Enterobacteriaceae, Y. enterocolitica is a gram-negative,
non–spore-forming, sometimes encapsulated, facultatively anaerobic, rod-shaped
bacterium that is motile at 25 but not at 37°C and moves by means of peritrichous
flagella (Christie and Corbel, 1990; Farrag and Marth, 1992; Schiemann, 1989).
This organism grows at 0–45°C, with best growth at 30–37°C. However, multi-
plication in this latter temperature range is slower than for other enteric patho-
gens, including E. coli and Salmonella. Like L. monocytogenes, the ability of Y.
enterocolitica to grow in pasteurized whole milk stored at 3°C (Stern et al., 1980)
makes this organism a potential health threat in refrigerated dairy products. In
addition, Y. enterocolitica also grows or survives at pH 4.6–9.6, with optimal
growth occurring at pH 7.0–8.0. Both of these growth characteristics have been
used to selectively isolate this organism from food samples. Fermentation of su-
crose, cellobiose, and sorbose can be used to biochemically differentiate Y.
enterocolitica from Y. pestis and Y. pseudotuberculosis.
Many Y. enterocolitica isolates recovered from food samples are avirulent
and of no clinical importance. These nonpathogenic strains, which typically lack
488 Ryser
a virulence-carrying plasmid and two chromosomal genes encoding for cell inva-
sion factors, abound in raw milk and must be differentiated from strains capable
of causing disease (Schiemann, 1987). Eight additional biochemical tests can be
used to subdivide Y. enterocolitica isolates into seven distinct biochemical types
(biotypes), with biotypes 1B, 2, 3, 4, and 5 containing human pathogenic strains
(Weagant et al., 1998). Alternatively, the presence or absence of somatic (O)
antigens can be used to separate Y. enterocolitica isolates into 54 serotypes (Wea-
gant et al., 1998), 12 serotypes of which contain human pathogenic strains. Sero-
types most frequently encountered in human infections include O:3, O:5,27, O:
8 and O:9.
2. Isolation and Detection Methods
Several different procedures can be used to recover yersiniae from dairy products
(Schiemann and Wauters, 1992), with most of these methods exploiting the abil-
ity of the organism to grow at reduced temperatures and survive in an alkaline
environment. In the standard procedure for dairy products (Flowers et al., 1992a;
Weagant et al., 1995), the sample is enriched in peptone sorbitol bile broth. After
10 days of incubation at 10°C, a portion of the enrichment is treated with 0.5%
potassium hydroxide to reduce the background flora and then is surface plated on
two selective plating media—MacConkey agar (MAC) and Cefsulodin-Irgasan-
Novobiocin agar (CIN). However, when high levels of yersiniae are expected,
it is recommended that samples be plated before beginning the 10-day enrichment
step. All plates are examined for suspect colonies after 48 h of incubation at 22–
26°C. Presumptive Yersinia colonies on MAC and CIN are confirmed as Yersinia
spp. based on reactions in lysine arginine iron agar, urea agar, and bile esculin
agar. Results from six additional biochemical tests are required to identify Y.
enterocolitica, with eight further biochemical tests required to separate isolates
into six different biotypes. Potentially virulent strains belonging to biotypes 1B,
2, 3, 4, and 5 need to be confirmed as pathogenic through either dye binding,
specific gene probe, cell culture, or mouse inoculation assays. Serotyping is nor-
mally confined to isolates of epidemiological importance and conducted by only
qualified reference laboratories.
3. Clinical Manifestations
Yersiniosis, the disease caused by infection with Y. enterocolitica, can assume
many different forms depending on strain and dose of the organism as well as
age and physical condition of the person infected (Christie and Corbel, 1990;
Gray, 1995; Schiemann, 1989). The most frequent manifestation of yersiniosis
is gastroenteritis, which primarily affects children younger than 7 years of
age; infants in their first year of life are most susceptible. Symptoms that de-
velop 12–72 h after ingesting more than 10
9
organisms (D’Aoust, 1989) typi-
Public Health Concerns 489
cally include a low fever, diarrhea, severe abdominal pain, and cramps, with
nausea and vomiting being reported less frequently. Although this illness is
normally self-limiting and of short duration, with symptoms subsiding after
1–3 days, intestinal complications have been reported. Severe abdominal pain
in older children is often mistaken for appendicitis, and a normal or only mildly
inflamed appendix is sometimes removed. Such individuals also normally exhibit
enlarged mesenteric lymph nodes and acute terminal ileitis, sometimes with
involvement of the colon. Although relatively rare, intestinal obstruction, gan-
grene of the small intestine, and peritonitis have been reported as additional com-
plications.
Acute generalized septicemia, the second major manifestation of yersin-
iosis, occurs far less frequently and is most often seen in elderly patients suffering
from severe underlying illnesses such as alcoholism, liver disease, hemolytic ane-
mia, leukemia, and other immunosuppressive disorders (Christie and Corbel,
1990; Schiemann, 1989). However, several reports of septicemic infection also
have involved healthy infants. Despite proper antibiotic therapy, the mortality
rate for such infections is still more than 50%.
Secondary complications develop in approximately 5% of all yersiniosis
patients with reactive arthritis and skin infections being reported most frequently
(Christie and Corbel, 1990; Schiemann, 1989). Other complications include endo-
carditis, thyroid disorders, eye infections, glomerulonephritis, liver disease, respi-
ratory infections, muscle abscesses, and osteomyelitis.
Isolation of Y. enterocolitica from stool samples or from normally sterile
materials such as blood and various organ tissues provides definitive diagnosis,
with serological tests offering another alternative (Christie and Corbel, 1990;
Gray, 1995; Schiemann, 1989). Administration of antibiotics is contraindicated
for uncomplicated cases of gastroenteritis. However, prompt and sustained antibi-
otic therapy with chloramphenicol or tetracyclines is essential if patients with
septicemia and severe localized infections are to fully recover.
4. Outbreaks
Evidence supporting Y. enterocolitica as a potential milkborne pathogen dates
back to 1975 (Table 10) when raw milk was epidemiologically linked to 138
cases of yersiniosis in Canadian school children after a class field trip (deGrace
et al., 1976). However, because clinical and milk isolates belonged to serotypes
O:5,27 and O:6,30, respectively, the incriminated raw milk could not be posi-
tively identified as the vehicle of infection (Kasatiya, 1976).
Any doubt regarding Y. enterocolitica as a milkborne pathogen ended in
autumn of 1975 when chocolate milk from a school cafeteria was linked to 217
cases of yersiniosis in upper New York state (Black et al., 1978). Sixteen of 36
children who required hospitalization had unnecessary appendectomies. Recov-
490
Ryser
Table 10 Major Outbreaks of Milkborne Yersiniosis
Number
Location Year Product of cases Serotype Reference
Montreal, Canada 1975 Raw milk 58 O:5,27 de Grace et al. (1976)
New York 1976 Chocolate milk 36 O:8 Black et al. (1978)
New York 1981 Powdered milk 239 O:8 Shayegani et al. (1983)
Tennessee, Arkansas, Mississippi 1982 Pasteurized milk 172 O:13 Tacket et al. (1984)
Vermont, New Hampshire 1995 Pasteurized milk 10 O:8 Ackers (1995)
England 1985 Pasteurized milk 36 O:10K and O:6,30 Greenwood and Hooper (1990)
Public Health Concerns 491
ery of Y. enterocolitica O:8 from numerous patients and unopened containers of
the incriminated milk confirmed pasteurized chocolate milk as the vehicle of
infection. Subsequent investigation of the dairy factory suggested that the epi-
demic strain most likely entered the product when chocolate syrup was added to
previously pasteurized milk and mixed by hand in an open vat.
Six years later, another large milk-related outbreak occurred at a New York
state summer camp with gastroenteritis developing in 239 of 455 campers and
staff members (Shayegani et al., 1983). Five of seven victims requiring hospital-
ization had appendectomies before this epidemic was diagnosed as yersiniosis.
Epidemiological findings suggested a common source for this outbreak, with Y.
enterocolitica O:8 being recovered from more than half of the patients and even-
tually found in reconstituted powdered milk, a milk dispenser, and turkey chow
mein. These findings and additional results from pathogenicity studies both sup-
ported the aforementioned foods as potential vehicles of infection in this out-
break, with isolation of the epidemic strain from 4 of 11 food handlers suggesting
contamination during food preparation.
The largest and most unusual outbreak of milkborne yersiniosis occurred
during the summer of 1982 in Tennessee, Arkansas, and Mississippi (Tacket et
al., 1984). According to the report, 172 cases of Y. enterocolitica infection were
culturally confirmed, with the total number of cases estimated at several thousand.
Unlike the aforementioned outbreaks, infections in 14 individuals were confined
to a sore throat and fever with no symptoms of gastroenteritis (Tacket et al.,
1983). In addition, the epidemic strain belonged to serotype O:13, an unusual
serotype previously recognized only in monkeys, and was resistant to many anti-
biotics. No yersiniae were found in the incriminated milk, which was properly
pasteurized. However, after learning that the factory delivered unsold milk to a
farm for feeding pigs, investigators recovered the epidemic strain from the bottom
of several returned milk crates (Auliso et al., 1982). As a result of inadequate
crate washing procedures, the tops of the milk bottles likely became contaminated
when the crates were stacked. Given that Y. enterocolitica can survive on the
outside of refrigerated milk cartons for at least 21 days (Stanfield et al., 1985),
the organism likely entered the product during consumer handling and then grew
to infectious levels during refrigerated storage.
During October 1995, pasteurized milk was also epidemiologically linked
to 10 cases of yersiniosis in Vermont and New Hampshire, with the epidemic
strain identified as Y. enterocolitica O:8 (Ackers, 1995). Investigators traced the
milk to a single dairy processing facility in New Hampshire but were unable to
recover the organism from pasteurized milk. Although the milk was packaged
in bulk containers and glass bottles, only the latter milk was associated with
illness. Given factory records indicating proper pasteurization, Y. enterocolitica
presumably entered milk during bottling, with the epidemic strain possibly com-
ing from a dairy farm on which pigs were also raised.
492 Ryser
Additional outbreaks of milkborne yersiniosis are limited to three reports
from England and Wales, two of which involved a total of five cases and were
linked to pasteurized milk (Barrett, 1986; Barrett, 1989). In the remaining out-
break, gastroenteritis developed in 36 hospitalized children after they consumed
pasteurized milk contaminated with Y. enterocolitica O:10K and O:6,30 (Green-
wood and Hooper, 1990). The incriminated milk was delivered to the hospital
in glass bottles from a single supplier. Although both epidemic strains were de-
tected in the incoming raw milk supply, the milk was properly pasteurized, with
additional thermal inactivation studies demonstrating complete destruction of
yersiniae (Greenwood et al., 1990). After finding the bottle-washing procedure
to be unsatisfactory, investigators concluded that the epidemic strain most likely
entered milk as a postpasteurization contaminant.
5. Occurrence and Survival in Dairy Products
Domestic animals are widely recognized as fecal carriers of yersiniae, with pigs
being identified as the primary reservoir for pathogenic strains of Y. enterocolitica
(Schiemann, 1989). According to Davey et al. (1983), 62 of 124 (50%) healthy
dairy cows in Scotland were fecal shedders of yersiniae. However, only 3 of 74
(4%) Y. enterocolitica isolates belonged to serotypes associated with the afore-
mentioned outbreaks of milkborne yersiniosis.
Yersiniae are frequent contaminants of raw milk. Because this organism
is not known to cause mastitis in dairy cattle, most contamination is thought to
occur through contact with feces or polluted water (Schiemann, 1989). In two
surveys from Wisconsin, Michigan, and Illinois (McManus and Lanier, 1987;
Moustafa et al., 1983b). Y. enterocolitica was demonstrated in 12 and 48% of
the raw milk supply. However, none of the isolates was virulent. Working in
Canada, Schiemann and Toma (1978) detected Y. enterocolitica in 29 of 131
(22%) raw milk samples. In contrast to the American surveys, seven different
serotypes were recovered, all of which were previously associated with cases of
human yersiniosis in Canada. Elsewhere, Y. enterocolitica has been identified in
5.5–36.6% of raw milk samples analyzed in Brazil (dos Reis Tassinari, 1994;
Tibana et al., 1987), Northern Ireland (Walker and Gilmour, 1986), and Morocco
(Hamama et al., 1992), with this organism also being recovered from 36–81.4%
of raw milk samples tested in France (Desmasures et al., 1997; Vidon and Del-
mas, 1981). In addition, 5% of Spanish (Tornadijo et al., 1993) and 12.8% of
Australian (Hughes and Jensen, 1980) raw goat’s milk samples also harbored Y.
enterocolitica. Even though very few raw milk samples from these surveys con-
tained human pathogenic strains, Y. enterocolitica is still one of the most frequent
raw milk contaminants of public health concern.
Compared with other milkborne pathogens, Y. enterocolitica is relatively
heat sensitive with current minimum high-temperature, short-time and vat pas-
Public Health Concerns 493
teurization standards being sufficient to inactivate unusually high populations of
clinically important strains in milk (D’Aoust et al., 1988; Francis et al., 1980;
Hanna et al., 1977; Lovett et al., 1982; Toora et al., 1992). Consequently, the
occasional presence of yersiniae in properly pasteurized dairy products is indica-
tive of postpasteurization contamination. According to Archer (1988), Yersinia
spp. were recovered from 10 of 351 (2.9%) pasteurized milk, 5 of 80 (6.3%)
chocolate milk, and 1 of 232 (0.4%) ice cream samples, with these organisms
being absent from butter, cottage cheese, and nonfat dry milk. Although similar
findings have been reported from Canada (Schiemann, 1978) with only 1 of 265
(0.4%) pasteurized dairy product samples positive for Y. enterocolitica, contami-
nation rates as high as 6% have been reported from Northern Ireland (Walker
and Gilmour, 1986) and Brazil (Tibana et al., 1987). Many of these isolates pre-
sumably were nonpathogenic serotypes.
As was true for L. monocytogenes, Y. enterocolitica also can grow in milk
during refrigeration and thus pose a potential health hazard. When pasteurized
milk was inoculated to contain 10 Y. enterocolitica cfu/mL and refrigerated at
4°C, Amin and Draughon (1987) found that the population doubled every 19 h
and reached 10
6
cfu/mL after 14 days of storage. Furthermore, Y. enterocolitica
was able to readily compete with the natural background flora. Given these find-
ings and an additional report indicating that Y. enterocolitica was present in 4.9–
19.9% of environmental samples collected from dairy factory floors and coolers
(Pritchard et al., 1995), special precautions are needed to minimize contamination
and subsequent growth of this organism to potentially hazardous levels in fluid
dairy products.
Yersiniae are seldom recovered from fermented dairy products. According
to Brodsky (1984a), only 1 of 127 (0.8%) 60-day-old samples of Canadian raw
milk Cheddar cheese harbored Y. enterocolitica, with the isolate being nonpatho-
genic. In addition, Schiemann (1978) failed to recover Y. enterocolitica from 49
samples of Canadian-produced Cheddar and Italian cheese. These findings, along
with a lack of reported outbreaks, suggest that fermented dairy products manufac-
tured under good sanitary conditions are generally safe. However, the risk of
yersiniosis may be somewhat higher in less developed countries, with 4–5% of
traditional Moroccan fermented milk products and raw milk cheeses (Hamama
et al., 1992) as well as 28.8% of feta-type cheeses produced in Turkey (Aytac
and Ozbas, 1992) containing Y. enterocolitica.
Pathogenic strains of Y. enterocolitica can persist in fermented dairy prod-
ucts for various lengths of time depending on initial inoculum level, starter culture
level, storage temperature, pH, salt content, and environmental conditions. When
pasteurized milk for Colby cheese manufacture was inoculated to contain 10
2
–
10
3
Y. enterocolitica cfu/mL, populations increased 1000-fold during cheese
making, with one strain surviving at least 8 weeks in cheese ripened at 3°C
(Moustafa et al., 1983a). This organism also can proliferate on the surface of
494 Ryser
ripened Brie cheese during storage at 4–20°C (Little and Knochel, 1994). Al-
though Y. enterocolitica is unable to survive the cooking step in cottage cheese
manufacture (Golden and Hou, 1996), contamination during packaging can lead
to substantial growth, with yersiniae persisting throughout the normal shelf life
of the product (Sims et al., 1989). However, survival of Y. enterocolitica in yogurt
prepared from inoculated milk is limited to 6 days or less depending on rate of
acid development, final pH, and type of starter culture used (Bodnaruk, 1998;
Mantis et al., 1982; Williams et al., 1996).
6. Prevention
Pasteurization readily destroys both pathogenic and nonpathogenic strains of yer-
siniae and, as such, provides the primary means of defense against milkborne
yersiniosis. However, given the high incidence of yersiniae in dairy processing
facilities and the ability of Y. enterocolitica to reach hazardous levels in fluid
dairy products during refrigerated storage, it is imperative that postpasteurization
contamination be minimized. Whereas consumption of raw milk should again be
avoided, any risks associated with fermented dairy products appear to be minimal.
IV. UNCOMMON AND SUSPECTED CONCERNS
During the early 1900s, reported milkborne illnesses were confined to a small
number of classic diseases, principally diphtheria, scarlet fever, tuberculosis, and
typhoid fever, with the importance of other milkborne pathogens such as Salmo-
nella and S. aureus not being fully realized until the late 1940s. Subsequent im-
provements in microbial isolation and detection techniques coupled with refine-
ments in investigative strategies for foodborne outbreaks during the 1980s led
to identification of such organisms as E. coli O157:H7, L. monocytogenes, and
Y. enterocolitica as important milkborne pathogens. Although major public health
concerns discussed in the preceding section easily account for more than 95%
of all dairy-related illnesses of known cause, the list of ‘‘new’’ and ‘‘emerging’’
milkborne pathogens continues to evolve. Consequently, this section briefly dis-
cusses 14 additional uncommon or suspected concerns of potential public health
significance which represent milkborne pathogens and toxins (e.g., Citrobacter
freundii, Corynebacterium ulcerans, Johne’s and Crohn’s diseases, mycotoxins,
toxoplasmosis), long-known disease agents of infrequent illness (e.g., Haverhill
fever, Q fever, shigellosis), emerging agents of milkborne disease (e.g., histamine
poisoning, Streptococcus zooepidemicus), and disease agents for which milk and
dairy products can serve as potential vehicles of infection (e.g., Creutzfeldt-Jakob
disease, cryptosporidiosis, infectious hepatitis, tickborne encephalitis).
Public Health Concerns 495
A. Citrobacter freundii
Classified among the gram-negative enterics, C. freundii is a well-recognized
opportunistic pathogen that normally inhabits the gastrointestinal tract of both
humans and animals (Stiles, 1989). However, gastroenteritis caused by C. freun-
dii is typically confined to those strains that have acquired plasmids for entero-
toxin and verotoxin production (Tschape et al., 1995), colonization factors, or
other pathogenic mechanisms. Following an incubation period of 12–48 h, symp-
toms of C. freundii gastroenteritis, in descending order of frequency, include
diarrhea, abdominal pain, fever, chills, headache, vomiting, and nausea (Bryan,
1979), with spontaneous recovery occurring within 7 days (Stiles, 1989). Spo-
radic cases of milkborne C. freundii gastroenteritis were first suspected during
the 1940s (Edwards et al., 1948), with a subsequent outbreak involving 14 adults
eventually being traced to milk (Sedlak, 1973). In 1983, three separate outbreaks
of gastroenteritis affecting 45 people in Washington, DC, were linked to one
particular brand of imported French Brie cheese (Levy et al., 1983). Despite
extensive testing for routine foodborne pathogens, C. freundii was the only organ-
ism common to both the cheese and three victims, thus supporting possible
involvement of C. freundii in this outbreak.
B. Corynebacterium ulcerans
First isolated from human throat lesions in 1927 (Hart, 1984), C. ulcerans is
considered a variant of C. diphtheriae and is able to produce several toxins associ-
ated with C. diphtheriae and C. pseudotuberculosis (Stiles, 1989). Cases of hu-
man illness have been reported only occasionally, with C. ulcerans producing
pharyngitis of varying severity and, in a few instances, an illness that mimics
diphtheria (Hart, 1984). Even though it is considered a highly unusual cause of
mastitis in dairy cattle, C. ulcerans has been recovered from raw milk (Wilson
and Richards, 1980), with ingestion of such milk accounting for most human
infections (Hart, 1984; Meers, 1979). Hence, this illness can be classified as a
zoonosis.
C. Creutzfeldt-Jakob Disease
The principal form of human spongiform encephalopathy is Creutzfeldt-Jakob
disease (CJD), an extremely rare neurodegenerative disorder characterized by
rapidly progressive dementia and movement disorder followed by death within
4 months of onset. Unlike other diseases discussed thus far, the causative agent
of CJD is an infectious proteinaceous particle known as a ‘‘prion’’ rather than
a bacterium, parasite, or virus. Recognized worldwide, the annual incidence in
496 Ryser
the United Kingdom is 0.5–1.0 case per million population. Most cases are of
unknown origin and observed most frequently in individuals 55–75 years of age
(Patterson and Painter, 1999).
In 1996, 10 cases of a somewhat different form of CJD, termed new variant
Creutzfeldt-Jakob disease (nv-CJD), were reported in the United Kingdom. Given
the absence of other predisposing factors for CJD (i.e., heredity, hormonal ther-
apy, surgical grafts) and appearance of bovine spongiform encephalopathy (BSE)
in British cattle 10 years earlier, a link between BSE and nv-CJD could not be
excluded. In 1997, the first results were published from strain-typing experiments
initiated in mice 1 year earlier (Bruce et al., 1997). Case profiles of nv-CJD in
terms of incubation period and lesion type were identical to those from BSE,
indicating that nv-CJD can be regarded as a human form of BSE. Confirmation
of 700 BSE cases in the United Kingdom during 1985–1988 prompted a ban on
certain ruminant feed. Nevertheless, the number of BSE cases continued to in-
crease, peaking at over 36,000 in 1992 before declining to about 4000 in 1997
for a total of 170,000 cases reported during this 13-year period. Since 1995, at
least 36 cases (over 80 cases by early 2001) of human nv-CJD have been con-
firmed in the United Kingdom with several additional cases being diagnosed in
France (Pattison, 1999).
These reports from the mid 1990s regarding human cases of nv-CJD in
England and France and the link to the agent that causes bovine spongiform
encephalopathy have raised many questions regarding the safety of animal-de-
rived products and by-products that enter the food chain. Given the theory that
transmission of nv-CJD could result from consuming animal tissues containing
high levels of the infectious prion, a series of economically devastating laws were
adopted by the European Union that forbid and/or severely restrict exportation
of British cattle, beef, and related animal by-products. Thus far, it should be
emphasized that no single case of nv-CJD has been directly linked to consumption
of beef or animal by-products in the United Kingdom or elsewhere. Although
the safety of the milk supply also has been questioned (Collee and Bradly, 1997),
as of February 2001, no cases of nv-CJD have been associated with consumption
of milk or dairy products. Furthermore, no evidence exists for shedding of the
infectious prion in milk. Consequently, the risk of contracting nv-CJD in the
United States from milk and dairy products appears to be minuscule given
the current absence of BSE in United States cattle along with import regulations
that restrict movement and sale of potentially contaminated animal feed and
animal products (Tan et al., 1999).
D. Cryptosporidiosis
Protozoan parasites in the genus Cryptosporidium are responsible for one of the
most common, acute, self-limiting gastrointestinal infections in healthy individu-
Public Health Concerns 497
als, with 30–35% of the United States population being seropositive for this
organism (Smith, 1993). Wild and domestic animals, including cows, sheep, and
goats, are also highly susceptible to such infections (Tzipori, 1983). The entire
life cycle of Cryptosporidium occurs within a single host with greater than 10
8
infectious oocysts eventually shed in feces and deposited in the environment to
infect the next host by inhalation or ingestion. Infectivity of Cryptosporidium
oocysts is best maintained under cool moist conditions (Smith, 1993). Exposure
to temperatures less than 0°C or greater than 65°C inactivates the organism. Even
though pasteurization of milk (71.7°C/15s) results in lost infectivity (Harp et al.,
1996), an extremely thick outer wall makes cryptosporidia oocysts highly resis-
tant to most commonly used sanitizers, including chlorine.
After ingesting as few as 10 cryptosporidia oocysts, a short-term gastroin-
testinal illness characterized by profuse watery diarrhea, abdominal cramps, vom-
iting, mild fever, and headache typically develops in infants and immunocompe-
tent adults and symptoms resolve spontaneously within 1–2 weeks (Jokippi and
Jokippi, 1986; Smith, 1993). However, a persistent cholera-like diarrhea and
other potentially life-threatening complications frequently develop in elderly
and immunocompromised patients.
Evidence for cryptosporidiosis as a milkborne disease is growing, with at
least three outbreaks (43 cases) outside of the United States being epidemiologi-
cally linked to consumption of raw milk from cows (Casemore et al., 1986; Elsser
et al., 1986) and goats (Anonymous, 1984c). More recently, 50 cases of crypto-
sporidiosis in British children were epidemiologically linked to school milk that
was improperly pasteurized at the farm (Gelletlie et al., 1997). Ingestion of kefir
(a fluid milk product prepared using a mixed lactic acid and alcoholic fermenta-
tion) was responsible for 13 cases of infant cryptosporidiosis, with Cryptospori-
dium oocysts detected in filtered milk samples from the factory (Romonova et
al., 1992). Thus far, dairy products have not been positively linked to any cases
of cryptosporidiosis in the United States. However, in conjunction with a massive
outbreak involving approximately 500,000 waterborne cases of cryptosporidiosis
in Milwaukee, WI, several precautionary recalls were issued for cottage and other
cheeses that may have been prepared using Cryptosporidium-contaminated water
(Anonymous, 1993a).
E. Haverhill Fever
Streptobacillus moniliformis, the etiological agent of both Haverhill and rat-bite
fever, is a gram-negative, facultatively anaerobic, highly pleomorphic, rod-
shaped bacterium (Ryan, 1986). This organism and the disease were first de-
scribed in 1926 after 89 cases of febrile illness in Haverhill, MA, were attributed
to raw milk consumption (Parker and Hudson, 1926). However, foodborne infec-
tions involving S. moniliformis remain rare, with most cases acquired from the
498 Ryser
bite of infected rats and termed rat-bite fever rather than Haverhill fever, which
is foodborne (Stiles, 1989).
The onset of Haverhill fever is abrupt, with chills, headache, rash, and
severe back and joint pain occurring 2–10 days after initial exposure (Ryan, 1986;
Stiles, 1989). Various complications, including arthritis in 50% of patients as
well as endocarditis, pneumonia, brain abscesses, anemia, severe dehydration,
and severe weight loss, have been reported, particularly in children. Whereas
administration of penicillin generally leads to full recovery, some of the afore-
mentioned complications have been fatal.
Only one additional epidemic of milkborne Haverhill fever has been re-
ported since 1926. In this outbreak, as many as 130 children attending an English
boarding school became ill in February 1983 after consuming raw milk from a
local farm (Shanson et al., 1983). However, as in 1926, investigators were again
unable to recover S. moniliformis from incriminated milk. Because S. monili-
formis grows poorly in milk (Parker and Hudson, 1926) and is readily inactivated
during pasteurization (Stiles, 1989), milkborne cases of Haverhill fever are likely
to remain rare.
F. Histamine Poisoning
Certain strains of lactobacilli and lactococci found in raw milk and many
cheeses possess the enzyme histidine carboxylase, which can convert unbound
histidine to potentially toxic levels of histamine (Stratton et al., 1991). Whereas
levels of free histidine are usually very low in fresh milk, histidine concentra-
tions in aged cheeses such as Cheddar and Swiss are often much higher from
proteolysis of milk proteins during ripening (Hinz et al., 1956). Cheeses in
which free histidine has been converted by certain lactic acid bacteria to greater
than or equal to 100 mg histamine/100 g of cheese have been most frequently
associated with histamine poisoning. However, histamine levels as low as 30
mg/100 g also have induced illness, with histamine toxicity being enhanced by
several biogenic amines (e.g., tyramine, tryptamine) that potentiate histamine ac-
tivity (Edwards and Sandine, 1981) and certain drugs (e.g., antihistamines, iso-
niazid) that inhibit histamine-metabolizing enzymes (Hui and Taylor, 1985;
Stratton et al., 1991).
Biologically, histamine acts to contract smooth muscle within the intestine
(Taylor, 1986) and dilate blood vessels (Stratton et al., 1991). Symptoms of hista-
mine poisoning generally develop 30 min to 2 h after ingesting cheese containing
greater than or equal to 100 mg histamine/100 g and include abdominal cramps,
diarrhea, nausea, and vomiting as well as hypotension, headache, palpitations,
tingling, flushing, and burning sensations in the mouth (Stratton et al., 1991).
Medical intervention is usually unnecessary, with most symptoms disappearing
a few hours after onset.
Public Health Concerns 499
Dairy-related outbreaks of histamine poisoning have been confined to aged
cheeses, with over 50 cases thus far reported worldwide (Stratton et al., 1991).
The first of these cases occurred in 1967 in the Netherlands and was traced to
2-year-old Gouda cheese containing 85 mg of histamine/100 g (Doeglas et al.,
1967). In the United States, three separate outbreaks in Washington (38 cases)
(Taylor, 1985), California (1 case) (Taylor, 1985), and New Hampshire (6 cases)
(Taylor et al., 1982b) were documented from 1976 to 1980, with all cases linked
to Swiss cheese containing more than 100 mg of histamine/100 g. Sumner et al.
(1985) subsequently recovered a histamine-producing strain of Lb. buchneri from
Swiss cheese implicated in the New Hampshire outbreak. The remaining six cases
of histamine poisoning involved Canadian Cheddar (Kahana and Todd, 1981),
French Cheshire (Uragoda and Lodha, 1979), and French Gruye`re cheese (Taylor,
1985) consumed in the country of origin.
Lactic acid bacteria responsible for histamine production include various
strains of Lb. acidophilus, Lb. delbrueckii ssp. bulgaricus, Lb. helveticus, Lc.
lactis ssp. lactis and propionibacteria (Stratton et al., 1991), all of which could
potentially be used as cheese starter cultures, with such use being of obvious
public health concern. These strains are assumed to be present in milk at the
time of cheese making, with few such organisms thought to be postprocessing
contaminants (Sumner et al., 1990). Consequently, aged cheeses prepared from
raw or heat-treated milk typically contain higher levels of histamine and pose a
greater public health threat than cheeses prepared from pasteurized milk (Ordonez
et al., 1997).
G. Infectious Hepatitis
Hepatitis A, or infectious hepatitis, is a common infectious disease worldwide
and the best known of the milk-related viral diseases, with sporadic outbreaks
recorded in the United States since the 1940s (Bryan, 1983). Common-source
outbreaks are most often recognized in industrialized countries where this illness
is rare because of natural immunity. Typical symptoms appearing 15–50 days
after exposure via the fecal-oral route include jaundice, anorexia, and extreme
malaise, with some individuals also experiencing abdominal pain, nausea, fever,
and chills (Hirschmann, 1986). Infectious hepatitis is usually a mild illness with
bed rest leading to complete recovery within a few weeks. Despite the general
lack of serious complications, some individuals with more pronounced cases may
complain of fatigue for several months. According to Cliver (1979), milk and
dairy products were implicated in five outbreaks (599 cases) of infectious hepatitis,
with one of these reports traced to the use of fecally contaminated water in a
Czechoslovakian dairy processing facility (Raska et al., 1966). Two additional out-
breaks involving ice cream (MacDonald and Griffin, 1983) and cheese (Bean et al.,
1996) were also recorded in the United States during 1982 and 1990, respectively.
500 Ryser
Whereas the virus is only partially inactivated by pasteurization, complete destruc-
tion of the virus is ensured by normal chlorination (Hirschman, 1986).
H. Johne’s and Crohn’s Diseases
Mycobacterium paratuberculosis, a gram-positive, acid-fast bacillus, is the etio-
logical agent of Johne’s disease in dairy cattle, goats, and other ruminant animals
(Collins et al., 1984; van den Heever, 1984). This economically devastating dis-
ease is characterized by a chronic granulomatous ileocolitis that eventually leads
to diarrhea, weight loss, debilitation, and death (Benedictus et al., 1987; Chiodini
et al., 1984). Fecal shedding of the organism at levels approaching 10
8
cfu/g
leads to heavy contamination of the environment, which, in turn, helps perpetuate
this disease. Although control programs have traditionally focused on minimizing
consumption of contaminated feed by young calves, M. pseudotuberculosis is
also shed in body fluids, including milk and colostrum, with as many as 35% of
clinically infected cattle (Taylor et al., 1981) and 12% of asymptomatic carriers
(Sweeny et al., 1992) yielding positive milk samples. Consequently, transmission
of Johne’s disease to calves via contaminated milk cannot be ignored.
Considerable interest has been generated concerning the possible associa-
tion between Johne’s disease in ruminant animals and human Crohn’s disease,
a nearly identical form of granulomatous ileocolitis often requiring surgical inter-
vention (Graadal and Nygaard, 1994; Pounder, 1994). Strains of M. paratubercu-
losis similar to those identified in dairy cattle have been isolated from 20–38%
of Crohn’s disease patients (Chiodini and Hermon-Taylor, 1993), with the DNA
of the organism also being detected in 6 and 12.5% of tissue samples obtained
from patients with and without confirmed Crohn’s disease, respectively (Sand-
erson et al., 1992). Several laboratory studies prompted by possible milkborne
transmission of Crohn’s disease have concluded that heat treatments simulating
vat and high-temperature, short-time pasteurization do not completely inactivate
M. paratuberculosis in milk inoculated to contain more than 10 cfu/mL (Chiodini
and Herman-Taylor, 1993; Grant et al., 1996; Sung and Collins, 1998). However,
Keswani and Frank (1998) subsequently reported that M. paratuberculosis is un-
likely to survive HTST pasteurization. The public health significance of these
findings and two additional reports attesting to the presence of M. paratuberculo-
sis DNA in up to 7% of retail pasteurized milk samples collected in England and
Wales (Grant et al., 1996; Millar et al., 1996) will not be completely understood
until the relationship between M. paratuberculosis and certain genetic and envi-
ronmental factors is fully clarified.
I. Mycotoxins
Aflatoxin, a highly potent carcinogen produced by certain strains of Aspergillus
flavus, A. parasiticus and A. nemius, is the primary mycotoxin of public health
Public Health Concerns 501
concern, as discussed previously. However, mycotoxin production is not limited
to aflatoxigenic molds, with certain strains of Alternaria, Aspergillus, Cladospo-
rium, Fusarium, Geotrichum, Mucor, and Penicillum isolated from cheese also
being capable of synthesizing toxins (Scott, 1989). Several early studies demon-
strated that 30 and 35% of Penicillium isolates from Cheddar (Bullerman and
Olivigni, 1974) and Swiss cheese (Bullerman, 1976), respectively, were toxic to
chicken embryos, with strains from cheese and dairy factories now known to
produce a wide range of mycotoxins, including cyclopiazonic acid, citrinin, och-
ratoxin A, patulin, penicillic acid, and penitrem A, (Vazquez et al., 1995; Vazquez
et al., 1997), all of which are either nephrotoxic, neurotoxic, teratogenic, or car-
cinogenic to laboratory animals (Scott, 1989). Cyclopiazonic acid is normally
produced by P. camemberti during ripening of Camembert cheese, and patulin,
penicillic acid, mycophenolic acid, and roquefortine are synthesized by certain
strains of P. roqueforti used in manufacturing Roquefort cheese (Engel and
Teuber, 1989; Lopez-Diaz et al., 1996). Although Bullerman and Olivigni (1974)
identified only 6.6% of Cheddar cheese molds as Aspergillus spp., nearly half
of these strains were toxic to chick embryos. Certain cheese isolates of Asper-
gillus have come to be recognized producers of aflatoxin as well as cyclopia-
zonic acid, β-nitropropionic acid, kojic acid, and sterigmatocystin (Metwally
et al., 1997; Vazquez, 1995), the last of which is carcinogenic and structurally
related to aflatoxin (Scott, 1989). In addition, Fusarium spp. are well-known
producers of trichothecenes, zearalenone, and moniliformin (Ueno, 1985), with
a few cheese strains of Geotrichum also producing ergot alkaloids (El-Refai et
al., 1970).
As was true for aflatoxins, the direct impact of these remaining toxins on
human health is unknown. However, because many of these mycotoxins are mar-
ginally toxic and relatively unstable in cheese (Scott, 1989), any potential public
health impact is presumed to be minimal.
J. Q Fever
Coxiella burnetti, a rickettsia-like obligate intracellular parasite that localizes and
proliferates within cell vacuoles, is the etiological agent of Q (Query) fever in
humans (Baca and Paretsky, 1983). First observed in Australia in 1935, Q fever
is now known to occur worldwide. Ticks and ruminant animals, including dairy
cattle, sheep, and goats, are common asymptomatic carriers of C. burnetti, with
most human cases being traced to dairy workers, farmers, and meat factory em-
ployees who work in close contact with animals (Serbezov et al., 1999; Wisniew-
ski and Krumbiegel, 1970b).
Clinical symptoms of Q fever, which mimic viral influenza, generally occur
2–4 weeks after ingesting or inhaling C. burnetti and include an abrupt fever
followed by malaise, anorexia, muscle pain, and intense headache (Turck, 1986).
Even though many serious complications affecting the central nervous system,
502 Ryser
lungs, liver, and other internal organs have been reported, most patients fully
recover in 2–4 weeks when given tetracycline or chloramphenicol.
Concern regarding Q fever as a milkborne illness comes from the demon-
stratable presence of C. burnetti in milk from infected cows (Biberstein et al.,
1974; Evans, 1956; Huebner and Bell, 1951; Paiba et al., 1999; Wisniewski and
Krumbiegel, 1979a) and goats (Fishbein and Raoult, 1992), with regular consum-
ers of raw milk often displaying high antibody titers to C. burnetti (Stiles, 1989).
Ingestion of raw milk has been directly linked to Q fever in the United States
(Bryan, 1983) and England (Brown et al., 1968), with the latter outbreak involv-
ing 23 cases at a detention center. More recently, a series of Q fever outbreaks
were epidemiologically linked to consumption of unpasteurized goat’s milk prod-
ucts in Bulgaria, Slovakia (Serbezov et al., 1999), and France (Fishbein and
Raoult, 1992). However, given the volume of raw milk consumed worldwide,
reports of milkborne Q fever are far fewer than would be expected. Furthermore,
in one study in which contaminated raw milk was ingested by human volunteers,
illness did not occur (Krumbiegel and Wisniewski, 1970). Several early studies
also attest to the high thermal resistance of C. burnetti in milk, with the organism
surviving 30 min of heating at 61.7°C (Huebner et al., 1949; Lennette et al.,
1952). However, heating raw milk at 62.8°C for 30 min or 71.1°C for 15 s is
sufficient to completely destroy C. burnetti, with these time-temperature pasteur-
ization standards currently being required by law to prevent milkborne Q fever.
K. Shigellosis
Outbreaks of bacillary dysentery, which resemble present-day shigellosis, date
back to the time of Hippocrates (Wachsmuth and Morris, 1989). However, Shi-
gella spp. were not recognized as the cause of this disease until the late 1800s.
In the family Enterobacteriaceae, the genus Shigella contains four species—S.
dysenteriae, S. flexnori, S. boydii, and S. sonnei—all of which are highly infec-
tious and closely related to enterohemorrhagic strains of E. coli. These organisms,
which also produce a vero cytotoxin that is immunologically indistinguishable
from E. coli O157:H7 Shiga-like toxin, are host adapted to humans and other
primates. However, shigellae are relatively fragile and unable to compete readily
with other enteric flora. This disease is usually transmitted either person-to-per-
son or by the fecal-oral route, with food and water often serving as vectors.
Shigellosis is normally an acute, self-limiting infection of the intestinal
tract. Symptoms appearing 1–7 days after ingesting up to 100 organisms
(D’Aoust, 1989) typically include fever, abdominal pain, and watery diarrhea,
which can develop into a fulminating dysentery characterized by grossly bloody
diarrhea, dehydration, chills, and toxemia (Kantor, 1986; Wachsmuth and Morris,
1989). Children and elderly patients may go into shock from excessive dehydra-
tion, and further complications including seizures, pneumonia, hemolytic uremic
Public Health Concerns 503
syndrome, bacteremia, peripheral neuropathy, and Reiter’s syndrome (urethritis,
conjunctivitis, and arthritis) may develop. Most individuals recover spontane-
ously within 2 weeks. Medical intervention is usually confined to replacement
of fluids, with antibiotic therapy being reserved for severe cases.
A few small sporadic outbreaks of milkborne shigellosis were documented
in the United States between 1920 and 1960, with this disease accounting for
less than or equal to 4% of all reported milkborne illnesses (Bryan, 1979, 1983).
These outbreaks generally involved raw milk that was contaminated with S. dy-
senteriae by a human carrier and then held without refrigeration for several hours.
However, in 1952, improperly pasteurized milk containing S. sonnei was linked
to one particularly large outbreak in Tennessee involving 639 school children
(Tucker et al., 1954). No additional cases of milkborne shigellosis have been
reported in the United States since the 1950s (Bryan, 1983), but one recent dairy-
related outbreak in the former Soviet Union was traced to a milk processor’s
water supply that was contaminated with S. sonnei (Solodovnikov and Aleksan-
drovskaia, 1992). Other dairy products, including sour milk and white cheese,
have been only rarely implicated in shigellosis. One notable outbreak did occur
in 1982 in which French cheeses purchased at a Paris airport were responsible
for at least 50 cases of S. sonnei infection subsequently reported in Scandinavia
(Sharp, 1987); however, improved personal hygiene standards, pasteurization
practices, and cold storage conditions serve to keep dairy-related shigellosis out-
breaks as relatively rare.
L. Streptococcus zooepidemicus
Human infections caused by S. zooepidemicus,aβ-hemolytic streptococcus be-
longing to Lancefield Group C, are generally uncommon (Stiles, 1989), with this
pathogen being a more frequent cause of animal infections and subacute or
chronic mastitis in dairy cattle. Because most cases of human illness have been
acquired through consumption of raw milk or contact with horses (Francis et al.,
1993), S. zooepidemicus infections can be classified as another zoonosis. In hu-
mans, S. zooepidemicus produces mild flulike upper respiratory symptoms as well
as more serious manifestations including glomerulonephritis, cervical lymph-ade-
nitis, pneumonia, septicemia, endocarditis, meningitis, septic arthritis, and celluli-
tis (Francis et al., 1993). Even though such infections are usually treatable with
penicillin, some fatalities have been reported, particularly among elderly patients.
Since the 1960s, five S. zooepidemicus outbreaks involving more than 100
cases of illness have been linked to raw milk. In the first and largest of these
outbreaks, 85 individuals in a small Romanian town became ill after ingesting
improperly pasteurized milk, with S. zooepidemicus eventually being isolated
from the incriminated milk and several asymptomatic workers at the dairy pro-
cessing facility (Duca et al., 1969). Three subsequent outbreaks attributed to raw
504 Ryser
milk were reported in England. Two of these outbreaks were small and confined
to family farms (Barnham et al., 1983; Ghoneim and Cook, 1980). The remaining
outbreak, which involved 12 cases, including eight fatalities, was directly linked
to retail raw milk, with S. zooepidemicus eventually traced to subclinical mastitis
in the incriminated dairy herd (Edwards et al., 1988). Most recently, Francis et
al. (1993) reported that three family members in Australia became ill shortly after
ingesting milk from their own dairy herd. S. zooepidemicus isolates from family
members and cow’s milk were later proven identical by molecular subtyping,
thereby confirming raw milk as the vehicle of infection. In 1983, 16 cases of S.
zooepidemicus infection, including one fatality, also occurred among primarily
elderly Hispanics living in New Mexico (Espinosa et al., 1983). However, unlike
the previous outbreaks, illness was directly linked to fresh ‘‘queso blanco’’
cheese, which was illegally prepared from raw cow’s milk on a small family
farm and consumed without aging.
M. Tickborne Encephalitis
Tickborne encephalitis is the primary zoonotic viral disease acquired through
milk. Dairy animals in central and eastern Europe can become infected through
tick bites and later shed the virus in their milk (Cliver, 1979). Although readily
destroyed by pasteurization, the tickborne encephalitis virus can remain infec-
tious for many months in heat-treated milk and fermented dairy products, includ-
ing cheese. In humans, a moderate fever and symptoms of encephalitis typically
develop 7–14 days after ingesting the virus. During the mid-1970s, at least 17
cases of tickborne encephalitis, including one fatality, were traced to raw milk
consumed in the former Soviet Union (Vasenin et al., 1975) and Poland (Jezyna
et al., 1976), with fresh sheep’s milk cheese (Gresikova et al., 1975) and unboiled
goat’s milk responsible for three additional outbreaks in Poland (Matuszczyk et
al., 1997) and Slovakia (Kohl et al., 1996).
N. Toxoplasmosis
A worldwide disease of humans and livestock, toxoplasmosis results from infec-
tion with the intracellular protozoan Toxoplasma gondii (Remington and
McLeod, 1986). Ingesting T. gondii cysts or oocysts gives rise to rapid multiplica-
tion, with the organism eventually transported via the lymphatic and blood system
to all body organs and tissues. Major sites of infection include the lymph nodes
(lymphadenopathy), eyes (choreoretinitis), central nervous system (meningoen-
cephalitis), lungs (pneumonia), heart (myocarditis), and kidneys (nephritis).
Complications including mental retardation, blindness, and deafness have been
reported, particularly in infants. The duration of treatment is determined by clini-
cal severity of the illness, with 4–6 weeks of drug therapy being typically re-
Public Health Concerns 505
quired. Given that milk from infected animals can harbor T. gondii and transmit
this disease to their offspring, ingestion of raw milk also can potentially spread
toxoplasmosis to humans, as evidenced by two incidents traced to raw goat’s
milk (Riemann et al., 1975; Sacks et al., 1982), with the latter involving a family
cluster of 10 cases in northern California.
REFERENCES
Abbar F, Kaddar HKh. Bacteriological studies on Iraqi milk products. J Appl Bacteriol
71:497, 1991.
Abbar FM, Mohammed MT. Identification of some enterotoxigenic strains of staphylo-
cocci from locally processed cheese. Food Microbiol 3:33, 1986.
Acedo E, Diaz ME, Leon AB. Incidence of Brucella spp. in raw milk and fresh cheese.
Alimentaria 35:57, 1997.
Ackers M. Summary report: outbreak of Yersinia enterocolitica infections in the Up-
per Valley of Vermont and New Hampshire (letter). Atlanta, GA: Foodborne
and Diarrheal Diseases Branch, Centers for Disease Control and Prevention,
1995.
Adams D, Well S, Brown EF, Gregorio S, Townsend L, Skaggs JW, Hinds MW. Salmo-
nellosis from inadequately pasteurized milk—Kentucky. Morbid Mortal Weekly
Rep 33:505, 1984.
Adams JB. Symposium: impact of drug control measures—results of drug screening from
a producer’s view. J Dairy Sci 77:1933, 1994.
Adesiyun AA. Bacteriological quality and associated public health risk of pre-processed
bovine milk in Trinidad. Intern J Food Microbiol 21:253, 1994.
Ahmed AA-H, Moustafa MK, Marth EH. Incidence of Bacillus cereus in milk and some
milk products. J Food Prot 46:126, 1983a.
Ahmed AA-H, Moustafa MK, Marth EH. Growth and survival of Staphylococcus aureus
in Egyptian Domiati cheese. J Food Prot 46:412, 1983b.
Allcroft R, Carnaghan RBA. Groundnut toxicity: an examination for toxin in human food
products from animals fed toxic groundnut meal. Vet Rec 75:259, 1963.
Allen RF, Baer LS. Outbreak of septic sore throat due to reconstituted powdered milk.
JAMA 124:1191, 1944.
Allen VD, Stovall WD. Laboratory aspects of staphylococcal food poisoning from Colby
cheese. J Milk Food Technol 23:271, 1960.
Al-Rajab WA, Al-Dabbagh WY, Al-Zahawi SM. Occurrence of Salmonella in Iraqi milk
products. J Food Prot 49:282, 1986.
Aman IM. Stability of aflatoxin in milk samples. Chem Mikrobiol Technol Lebensmittel.
17:161, 1995.
Amin MK, Draughon FA. Growth characteristics of Yersinia enterocolitica in pasteurized
milk. J Food Prot 50:849, 1987.
Andersson Y, Genback H, Lindh A. A milkborne outbreak in Sweden in the summer of
1985. In: Proceedings of the 2nd World Congress Foodborne Infections and Intoxi-
cations. Berlin, 1986, pp 290–293.
506 Ryser
Andrews WH, June GA, Sherrod PA, Hammack TS, Amaguana RM. Salmonella. In: FDA
Bacteriological Analytical Manual. 8th ed. Gaithersburg, MD: AOAC International,
1998, p 24.01.
Angelotti R, Foster MJ, Lewis KH. Time-temperature effects on salmonellae and staphylo-
cocci in foods. Am J Pub Health 51:76, 1961.
Anonymous. Tuberculosis of bovine origin in Great Britain. BMJ 1:618, 1932.
Anonymous. Brucellosis 1971 annual summary. Atlanta, GA: Centers for Disease Control,
1972.
Anonymous. E. coli gastroenteritis from food. BMJ 1:911, 1976.
Anonymous. Milk-borne outbreaks of Salmonella typhimurium. BMJ 1:1606, 1977.
Anonymous. Campylobacter enteritis—Colorado. Morbid Mortal Weekly Rep 27:226,
1978.
Anonymous. Raw-milk-associated illness-Oregon, California. Morbid Mortal Weekly Rep
30:90, 1981.
Anonymous. Campylobacteriosis associated with raw milk consumption—Pennsylvania.
Morbid Mortal Weekly Rep 32:337, 1983.
Anonymous. Campylobacter outbreak associated with certified raw milk products—Cali-
fornia. Morbid Mortal Weekly Rep 33:562, 1984a.
Anonymous. Chronic diarrhea associated with raw milk consumption—Minnesota. Mor-
bid Mortal Weekly Rep 33:521, 1984b.
Anonymous. Cryptosporidiosis surveillance. Weekly Epidemiol Rec 50(10):72, 1984c.
Anonymous. Campylobacter outbreak associated with raw milk provided on a dairy tour—
California. Morbid Mortal Weekly Rep 35:311, 1986.
Anonymous. International Committee on Systematic Bacteriology: Subcommittee on Tax-
onomy of Brucella. Minutes of the meeting—September 5, 1986. Int J Syst Bacte-
riol 38:450, 1988a.
Anonymous. Campylobacter isolates in the United States, 1982–1986. Morbid Mortal
Weekly Rep 37(SS-2):1, 1988b.
Anonymous. FDA’s Regulation of Animal Drug Residues in Milk—Hearing Before the
Human Resources and Intergovernmental Relations Subcommittee of the Commit-
tee on Government Operations, House of Representatives 101st Congress, 2nd Ses-
sion, February 6, 1990. Washington, DC: U.S. Government Printing Office, 1990.
Anonymous. Class II recall issued for Queso Fresco Margarita Mexican style fresh white
cheese. FDA Enforcement Rep Nov 13, 1991a.
Anonymous. Escherichia coli O157:H7 illness associated with consumption of farm-man-
ufactured yogurt. Commun Dis Rep 1:47, 1991b.
Anonymous. Milk and milk products recalled. FDA Enforcement Rep Feb 20, 1991c.
Anonymous. Salmonellosis associated with homemade ice cream in Kansas, 1992. Kansas
Med 90:287, 1992b.
Anonymous. Cottage and other cheeses recalled due to Cryptosporidium. FDA Enforce-
ment Rep June 9, 1993a.
Anonymous. Update: multistate outbreak of Escherichia coli O157:H7 infections from
hamburgers—western United States, 1992–1993. Morbid Mortal Weekly Rep 42:
258, 1993b.
Anonymous. Escherichia coli O157:H7 outbreak linked to home-cooked hamburger—
California, July 1993. Morbid Mortal Weekly Rep 43:213, 1994a.
Public Health Concerns 507
Anonymous. Outbreak of Salmonella enteritis associated with nationally distributed ice
cream products—Minnesota, South Dakota and Wisconsin, 1994. Morbid Mortal
Weekly Rep 43:740, 1994b.
Anonymous. Summary of notifiable diseases, United States 1994. Morbid Mortal Weekly
Rep 43(53):1, 1994c.
Anonymous. Brucellosis associated with unpasteurized milk products abroad. Commun
Dis Rep 5(32):1, 1995a.
Anonymous. National milk drug residue data base fiscal year 1995 annual report: October
1, 1994-September 30, 1995. Arlington, VA: GLH, 1996.
Anonymous. Number of bulk milk samples testing positive for drug residues declines.
Cheese Reporter 121:3:3, 1999a.
Anonymous. Summary of notifiable diseases, United States, 1998. Morbid Mortal Weekly
Rep 47(53):1, 1999b.
Anonymous. Looking back on the aflatoxin situation in 1998: milk from Baden-Wu¨rttem-
berg can be used as baby food. Lebensmittelindustrie Milchwirtschaft 120:573,
1999c.
Anonymous. Milk Production: National Agricultural Statistics Service–United States De-
partment of Agriculture. January 18, 2000.
Applebaum RS, Marth EH. Inactivation of aflatoxin M
1
in milk using hydrogen peroxide
and hydrogen peroxide plus riboflavin or lactoperoxidase. J Food Prot 45:557,
1982a.
Applebaum RS, Marth EH. Use of sulfite or bentonite to eliminate aflatoxin M
1
from
naturally contaminated raw whole milk. Z Lebensm Unters Forsch 174:303,
1982b.
Applebaum RS, Brackett RE, Wiseman DW, Marth EH. Aflatoxin: toxicity to dairy cattle
and occurrence in milk and milk products—a review. J Food Prot 45:752, 1982.
Archer DL. Review of the Latest FDA Information on the Presence of Listeria in Foods.
Geneva, Switzerland: WHO Working Group on Foodborne Listeriosis, Feb 15–19,
1988.
Armijo R, Henderson DA, Tinothee R, Robinson HB. Food poisoning outbreaks associated
with spray-dried milk—an epidemiologic study. Am J Pub Health 47:1093, 1957.
Armstrong C, Parran T. Milk-borne typhoid fever—a review of cases. Public Health Rep
Suppl 62, 1927.
Armstrong RW, Fodor T, Curlin GT, Cohen AB, Morris GK, Martin WT, Feldman J.
Epidemic Salmonella gastroenteritis due to contaminated imitation ice cream. Am
J Epidemiol 91:300, 1970.
Arocha MM, McVey M, Loder SD, Rupnow JH, Bullerman L. Behavior of hemorrhagic
Escherichia coli O157:H7 during the manufacture of cottage cheese. J Food Prot
55:379, 1992.
Aulisio CCG, Lanier JM, Chappel MA. Yersinia enterocolitica associated with outbreaks
in three southern states. J Food Prot 45:1263, 1982.
Aureli P, Fiorucci GC, Caroli D, Marchiaro G, Novara O, Leone L, Salmaso S. An out-
break of febrile gastroenteritis associated with corn contaminated by Listeria mono-
cytogenes. N Engl J Med 342:1236, 2000.
Aytac SA, Ozbas ZY. Isolation of Yersinia enterocolitica from Turkish pickled white
cheese. Austral J Dairy Technol 47:60, 1992.
508 Ryser
Baca OG, Paretsky D. Q fever and Coxiella burnetti: a model for host-parasite interactions.
Microbiol Rev 47:127, 1983.
Bachmann HP, Spahr U. The fate of potentially pathogenic bacteria in Swiss hard and
semihard cheeses made from raw milk. J Dairy Sci 78:476, 1995.
Baker JM, Griffiths MW. Evidence for increased thermostability of Bacillus cereus entero-
toxin in milk. J Food Prot 58:443, 1995.
Bar Dayon Y, Klainbaum Y, Shemer J. Food-borne outbreak of streptococcal pharyngitis
in an Israeli airforce base. Scand J Infect Dis 28:563, 1996.
Barksdale L. Diphtheria bacilli and other corynebacteria. In: Braude AI, Davis CE, Fierer
J, eds. Infectious Diseases and Medical Microbiology. Philadelphia: WB Saunders,
1986, p 254.
Barnard R, Callahan W. Follow-up on gastroenteritis attributed to imported French
cheese—United States. Morbid Mortal Weekly Rep 20:445, 1971.
Barnham M, Thornton TJ, Lange K. Nephritis caused by Streptococcus zooepidemicus
(Lancefield Group C). Lancet 1:945, 1983.
Barrett NJ. Communicable disease associated with milk and dairy products in England
and Wales: 1983–1984. J Infect 12:265, 1986.
Barrett NJ. Milkborne disease in England and Wales in the 1980s. J Soc Dairy Technol
42:4, 1989.
Barrios MJ, Gualda MJ, Cabanas JM, Medina M, Jordano R. Occurrence of aflatoxin M
1
in cheeses from the South of Spain. J Food Prot 59:898, 1996.
Barrios MJ, Medina LM, Cordoba MG, Jordano R. Aflatoxin-producing strains of Asper-
gillus flavus isolated from cheese. J Food Prot 60:192, 1997.
Barrow GI, Miller DC, Johnson DL, Hingston CWJ. Brucella abortus in fresh cream and
cream products. BMJ 2:596, 1968.
Bean NH, Goulding JS, Lao C, Angulo FJ. Surveillance of foodborne disease outbreaks—
United States, 1988–1992. Morbid Mortal Weekly Rep 45(SS-5):1, 1996.
Bean NH, Griffin PM, Goulding JS, Ivey CB. Foodborne disease outbreaks, 5-year sum-
mary, 1983–1987. Morbid Mortal Weekly Rep 39(SS-1):15, 1990.
Becker H, Schaller G, von Wiese W, Terplan G. Bacillus cereus in infant foods and dried
milk products. Intern J Food Microbiol 23:1, 1994.
Benedictus G, Dijkhuizen AA, Stelwagen J. Economic losses due to paratuberculosis in
dairy cattle. Vet Rec 121:142, 1987.
Bennett RW. Bacillus cereus diarrheagenic enterotoxin. In: FDA Bacteriological Analyti-
cal Manual. 8th ed. Gaithersburg, MD: AOAC International, 1998. p 15.01.
Bennett RW, Lancette GA. Staphylococcus aureus. In: FDA Bacteriological Analytical
Manual. 8th ed. Gaithersburg, MD: AOAC International, 1998. p 12.01.
Bergdoll MS. Staphylococcal intoxications. In: Riemann H, Bryan FL, eds. Food-Borne
Infections and Intoxications. 2nd ed. New York: Academic Press, 1979, p. 443.
Bergdoll MS. Staphylococcus aureus. In: Doyle MP, ed. Foodborne Bacterial Pathogens.
New York: Marcel Dekker, 1989, p 463.
Bergdoll MS, Sugiyama H, Dack GM. Staphylococcal enterotoxin. I. Purification. Arch
Biochem Biophys 85:62, 1959.
Besser RE, Lett SM, Weber JT, Doyle MP, Barrett TJ, Wells JG, Griffin PM. An outbreak
of diarrhea and hemolytic uremic syndrome from Escherichia coli O157:H7 in
fresh-pressed apple cider. JAMA 269:2217, 1993.
Public Health Concerns 509
Bezanson GS, Khakhria R, Duck D, Lior H. Molecular analysis confirms food source
and simultaneous involvement of two distinct but related subgroups of Salmonella
typhimurium bacteriophage type 10 in major interprovincial Salmonella outbreak.
Appl Environ Microbiol 50:1279, 1985.
Biberstein EL, Behymer DE, Bushnell R, Crenshaw G, Riemann HP, Franti CE. A survey
of Q fever (Coxiella burnetti) in California dairy cows. Am J Vet Res 35:1577,
1974.
Bigby M, Jick S, Arndt K. Drug-induced cutaneous lesion reactions. A report from the
Boston Collaborative Drug Surveillance Program on 15,438 consecutive inpatients
1975–1982. JAMA 256:3358, 1986.
Billon J, Guerin J, Sebald M. Studies on toxinogenesis of Clostridium botulinum type B
during maturation of soft cheese. Le Lait 60:343, 1980.
Birkhead G, Vogt RL, Heun E, Evelti CM, Patton CM. A multiple-strain outbreak of
Campylobacter enteritis due to consumption of inadequately pasteurized milk. J
Infect Dis 157:1095, 1988.
Bishop JR, White CH. Antibiotic residue detection in milk—a review. J Food Prot 47:
647, 1984.
Bishop JR, Senyk GF, Duncan SE, Case RA. Detection of antibiotic/drug residues in milk
and dairy products. In: Marshall RT, ed. Standard Methods for the Examination of
Dairy Products. 16th ed. Washington, DC: American Public Health Association,
1992, p 347.
Black RE, Jackson RJ, Tsai T, Medvesky M, Shayegani M, Feeley JC, MacLeod KIE,
Wakelee AM. Epidemic Yersinia enterocolitica infection due to contaminated choc-
olate milk. N Engl J Med 298:76, 1978.
Blaser MJ. Campylobacter species. In: Mandell GL, Douglas RG, Bennet JE, eds. Princi-
ples and Practice of Infectious Diseases. New York: Churchill Livingstone, 1990,
p 1649.
Blaser MJ, Sazie E, Williams LP Jr. The influence of immunity on raw milk-associated
Campylobacter infection. JAMA 257:43, 1987.
Blaser MJ, Hardesty HL, Powers B, Wang W-LL. Survival of Campylobacter fetus subsp.
jejuni in biological milieus. J Clin Microbiol 11:309, 1980.
Blaser MJ, Cravens J, Powers BW, Laforce FM, Wang W-LL. Campylobacter enteritis
associated with unpasteurized milk. Am J Med 67:715, 1979.
Bleem A. Escherichia coli O157:H7 in raw milk—a review. In: Animal Health Insight,
Spring/Summer 1994. Fort Collins, CO: USDA:APHIS:VS Centers for Epidemiol-
ogy and Animal Health, 1994.
Block RE, Levine MM, Clements ML, Hughes TP, Blaser MJ. Experimental Campylo-
bacter jejuni infection in humans. J Infect Dis 157:142, 1988.
Blouse J, Genglei LE, Lathrop GD, Hodder RA, Nowosiwski T, Caraway CT. A common-
source outbreak of Salmonella newport—Louisiana. Morbid Mortal Weekly Rep
24:413, 1975.
Bodnaruk PW, Williams RC, Golden DA. Survival of Yersinia enterocolitica during fer-
mentation and storage of yoghurt. J Food Sci 63:535, 1998.
Bone FJ, Bogie D, Morgan-Jones SC. Staphylococcal poisoning from sheep milk cheese.
Epidemiol Infect 103:449, 1989.
Boor KJ. Survival of Escherichia coli O157:H7 in fermented dairy products. Seattle, WA:
510 Ryser
Abstracts Annual Meeting of the International Association of Milk, Food, and Envi-
ronmental Sanitarians, July 2, 1996.
Borcyzk AA, Karmali MA, Lior H, Duncan LMC. Bovine reservoir for verotoxin-produc-
ing Escherichia coli O157:H7. Lancet i:98, 1987.
Bowen DA. Henning DR. Coliform bacteria and Staphylococcus aureus in retail natural
cheeses. J Food Prot 57:253, 1994.
Brackett RE, Marth EH. Association of aflatoxin M
1
with casein. Z Lebensm Unters Forsch
174:439, 1982a.
Brackett RE, Marth EH. Fate of aflatoxin M
1
in cheddar cheese and in process cheese
spread. J Food Prot 45:549, 1982b.
Brackett RE, Marth EH. Fate of aflatoxin M
1
in Parmesan and mozzarella cheese. J Food
Prot 45:597, 1982c.
Bradbury WC, Pearson AD, Marko MA, Congi RV, Penner JL. Investigation of a Campy-
lobacter jejuni outbreak by serotyping and chromosomal restriction endonuclease
analysis. J Clin Microbiol 19:342, 1984.
Brady MS, Katz SE. Antibiotic/antimicrobial residues in milk. J Food Prot 51:8, 1988.
Bray J. Isolation of antigenically homogeneous strains of Bact. coli neapolitanum in sum-
mer diarrhea. J Pathol Bacteriol 57:239, 1945.
Bray J, Beavan TED. Slide agglutination of Bacterium coli var. neapolitanum in summer
diarrhea. J Pathol Bacteriol 60:395, 1948.
Brieseman MA. Raw milk consumption as a probable cause of two outbreaks of Campylo-
bacter infection. N Z Med J 97:411, 1984.
Briozzo J, de Lagarde EM, Chirife J, Parada JL. Clostridium botulinum type A growth
and toxin production in media and process cheese spread. Appl Environ Microbiol
45:1150, 1983.
Brodsky MH. Evaluation of the bacteriological health risk of 60-day aged raw milk ched-
dar cheese. J Food Prot 47:530, 1984a.
Brodsky MH. Bacteriological survey of freshly formed cheddar cheese. J Food Prot 47:
546, 1984b.
Brown EH, Bailey EH. Acute hemolytic anaemia in a case of infantile gastro-enteritis
treated with oxytetracycline. BMJ 2:1204, 1958.
Brown GL, Colwell DC, Hooper WL. An outbreak of Q fever in Staffordshire. J Hyg
Camb 66:649, 1968.
Bruce ME, Will RG, Ironside JW, McConnell I, Drummond D, Suttie A. Transmissions
to mice indicate that ‘‘new variant’’ CJD is caused by the BSE agent. Nature 389:
498, 1997.
Bryan FL. Infections and intoxications caused by other bacteria. In: Riemann H, Bryan
FL, eds. Food-Borne Infections and Intoxications. 2nd ed. New York: Academic
Press, 1979, p 211.
Bryan FL. Epidemiology of milk-borne disease. J Food Prot 46:637, 1983.
Bryan FL, Fanelli MJ, Riemann H. Salmonella infections. In: Riemann H, Bryan FL, eds.
Food-borne Infections and Intoxications. 2nd ed. New York: Academic Press, 1979,
p. 73.
Buazzi MM, Johnson ME, Marth EH. Fate of Listeria monocytogenes during the manufac-
ture of mozzarella cheese. J Food Prot 55:80, 1992.
Buchanan RL, Klawitter LA. The effect of incubation temperature, initial pH and sodium
Public Health Concerns 511
chloride on the growth kinetics of Escherichia coli O157:H7. Food Microbiol 9:
185, 1992.
Buckner P, Ferguson D, Anzalone F, Anzalone D, Taylor J, Hlady WG, Hopkins RS.
Outbreak of Salmonella enteritidis associated with homemade ice cream—Florida,
1993. Morbid Mortal Weekly Rep 43:669, 1994.
Bula CJ, Bille J, Glauser MP. An epidemic of food-borne listeriosis in western Switzer-
land: description of 57 cases involving adults. Clin Infect Dis 20:66, 1995.
Bullerman LB. Examination of Swiss cheese for incidence of mycotoxin producing molds.
J Food Sci 41:26, 1976.
Bullerman LB, Olivigni FJ. Mycotoxin producing-potential of molds isolated from ched-
dar cheese. J Food Sci 39:1166, 1974.
Campbell AG, Gibbard J. The survival of E. typhosa in cheddar cheese manufactured
from infected raw milk. Can J Public Health 35:158, 1944.
Candlish AAG, Stimson WH, Smith JE. A monoclonal antibody to aflatoxin B
1
: detection
of the mycotoxin by enzyme immunoassay. Lett Appl Microbiol 1:57, 1985.
Capps JA, Miller JL. The Chicago epidemic of streptococcus sore throat and its relation
to the milk supply. JAMA 58:1848, 1912.
Casemore DP, Jessop EC, Douce D, Jackson FB. Cryptosporidium plus Campylobacter:
an outbreak in a semi-rural population. J Hyg Camb 96:95, 1986.
Castell Monsalve J, Rullan JV, Peiro Callizo EF, Nieto Sandoval Alcolea A, Monsalve JC,
Callizo EFP, Alcolea ANS. Study of an epidemic of 81 cases of brucellosis after con-
sumption of unpasteurized fresh cheese. Rev Espanola Salud Pub 70:303, 1996.
Cato EP, George WL, Finegold SM. Genus Clostridium. In: Sneath PH, Mair NS, Sharpe
ME, Holt JG, eds. Bergy’s Manual of Systematic Bacteriology. Vol 2. Baltimore:
Williams & Wilkins, 1986, p 1141.
Caudill FW, Meyer MA. An epidemic of food poisoning due to pasteurized milk. J Milk
Technol 6:73, 1943.
Cerutti G, Campiglio A. Aflatoxins in foods: maximum permitted levels, with particular
reference to milk and its derivatives. Latte 22:42, 1997.
Charm SE, Zomer E, Salter R. Confirmation of widespread sulfonamide contamination
in northeast U.S. milk market. J Food Prot 51:920, 1988.
Cherif A, Benelmouffok A, Doudou A. Consumption of goat cheese and human brucellosis
at Ghardaia (Algeria). Arch Inst Pasteur Algerie 55:9, 1986.
Chiodini RJ, Hermon-Taylor J. The thermal resistance of Mycobacterium paratuberculosis
in raw milk under conditions simulating pasteurization. J Vet Diagn Invest 5:629,
1993.
Chiodini RJ, Kruiningen HJV, Merkal RS. Ruminant paratuberculosis (Johne’s disease):
the current status and future prospects. Cornell Vet 74:218, 1984.
Choi HK, Schaack MM, Marth EH. Survival of Listeria monocytogenes in cultured butter-
milk and yogurt. Milchwissenschaft 43:790, 1988.
Chopin A, Tesone S, Vila J-P, Le Graet Y, Mocquot G. Survie de Staphylococcus aureus
au cours de la preparation et de la conservation de lait ecreme en poudre. Problemes
poses par le denombrement des survivants. Can J Microbiol 24:1371, 1978.
Christiansson A, Naidu AS, Nilsson I, Wadstrom T, Pettersson H-E. Toxin production by
Bacillus cereus dairy isolates in milk at low temperatures. Appl Environ Microbiol
55:2595, 1989.
512 Ryser
Christie AB, Corbel MJ. Plague and other yersinial diseases. In: Smith GR, Easmon CSF,
eds. Topley and Wilson’s Principles of Bacteriology, Virology and Immunity. 8th
ed. Vol 3—Bacterial Diseases. Philadelphia: BC Decker, 1990 p 399.
Christopher FM, Smith GC, Vanderzant C. Effect of temperature and pH on the survival
of Campylobacter fetus. J Food Prot 45:253, 1982.
Clark WS, Nelson FE. Multiplication of coagulase-positive staphylococci in grade A raw
milk samples. J Dairy Sci 44:232, 1961.
Cliver DO. Viral infections. In: Riemann H, Bryan FL, eds. Food-Borne Infections and
Intoxications. 2nd ed. New York: Academic Press, 1979, p 299.
Cohen J, Marambio E, Lynch B, Moreno A. Bacillus cereus food poisoning amid new-
borns. Rev Chilean Pediat 55:20, 1984.
Cohen DR, Porter IA, Reid TMS, Sharp JCM, Forbes GI, Paterson GM. A cost benefit
study of milk-borne salmonellosis. J Hyg Camb 91:17, 1983.
Collee JG, Bradley R. BSE: a decade on, Part 2. Lancet 349:715, 1997.
Collins CH, Grange JM. A review—the bovine tubercle bacillus. J Appl Bacteriol 55:13,
1983.
Collins MT. Mycobacterium paratuberculosis: a potential foodborne pathogen? J Dairy
Sci 80:3445, 1997.
Collins P, Davies DC, Matthews PRJ. Mycobacterial infection in goats: diagnosis and
pathogenicity of the organism. BVJ 140:196, 1984.
Collins RN, Treger MD, Goldsby JB, Boring JR III, Coohon DB, Barr RN. Interstate
outbreak of Salmonella newbrunswick infection traced to powdered milk. JAMA
203:838, 1968.
Collins-Thompson DL, Wood DS, Thomson IQ. Detection of antibiotic residues in con-
sumer milk supplies in North America using the Charm II test procedure. J Food
Prot 51:632, 1988.
Conner DE, Hall GS. Temperature and food additives affect growth and survival of Esche-
richia coli in poultry meat. Dairy Food Environ Sanitat 16:150, 1996.
Conner DE, Kotrola JS. Growth and survival of Escherichia coli under acidic conditions.
Appl Environ Microbiol 61:382, 1995.
Conner DE, Scott VN, Bernard DT. Potential Clostridium botulinum hazards associ-
ated with extended shelf-life refrigerated foods: a review. J Food Safety 10:131,
1989.
Cotter TP, Sheehan S, Cryan B, O’Shaughnessy E, Cumins H, Bredin CP. Tuberculosis
due to Mycobacterium bovis in humans in the South-West region of Ireland: is there
a relationship with infection prevalence in cattle? Tubercle Lung Dis 77:545, 1996.
Cox WA. Problems associated with bacterial spores in heat-treated milk and milk products.
J Soc Dairy Technol 28:59, 1975.
Crielly EM, Logan NA, Anderton A. Studies on the Bacillus flora of milk and milk prod-
ucts. J Appl Bacteriol 77:256, 1994.
Critchley EMR, Hayes PJ, Isaacs PET. Outbreak of botulism in northwest England and
Wales, June, 1989. Lancet 2:849, 1989.
Cullen JM, Ruebner BH, Hsieh DSP. Comparative hepatocarcinogenicity of aflatoxins B
1
and M
1
in the rat. Food Chem Toxicol 22:1027, 1985.
Dack GM, Cary WE, Woolport WE, Wiggers H. Outbreak of food poisoning proved to
be due to yellow hemolytic Staphylococcus. J Prevent Med 4:167, 1930.
Public Health Concerns 513
Dalrymple-Champneys W. Brucella Infection and Undulant Fever in Man. London: Ox-
ford University Press, 1960.
Dalton CB, Austin CC, Sobel J, Hayes PS, Bibb WF, Graves LM, Swaminathan B, Proctor
ME, Griffin PM. An outbreak of gastroenteritis and fever due to Listeria monocyto-
genes in milk. N Engl J Med 336:100, 1997.
D’Aoust J-Y. Infective dose of Salmonella typhimurium in cheddar cheese. Am J Epide-
miol 122:717, 1985.
D’Aoust J-Y. Manufacture of dairy products from unpasteurized milk: a safety assessment,
J Food Prot 52:906, 1989.
D’Aoust J-Y. Salmonella and the international food trade. Int J Food Microbiol 24:11,
1994.
D’Aoust J-Y, Warburton DW, Sewell AM. Salmonella typhimurium phage-type 10 from
cheddar cheese implicated in a major Canadian foodborne outbreak. J Food Prot
48:1062, 1985.
D’Aoust J-Y, Park CE, Szabo RA, Todd ECD, Emmons DB, McKellar RC. Thermal
inactivation of Campylobacter species, Yersinia enterocolitica, and hemorrhagic
Escherichia coli O157:H7 in fluid milk. J Dairy Sci 71:3230, 1988.
D’Aoust J-Y, Emmons DB, McKellar R, Timbers GE, Todd ECD, Sewell AM, Warburton
DW. Thermal inactivation of Salmonella species in fluid milk. J Food Prot 50:494,
1987.
Davey GM, Bruce J, Drysdale EM. Isolation of Yersinia enterocolitica and related species
from the faeces of cows. J Appl Bacteriol 55:439, 1983.
Davis J. The growth and viability of streptococci of bovine and human origin in milk and
milk products. J Infect Dis 15:378, 1914.
Day C, DeCov WR, Feffer D, Glosser J, Desonia B, Abbott B, Skinner M, Andersen JS.
Salmonellosis associated with raw milk—Montana. Morbid Mortal Weekly Rep
30:211, 1981.
DeBoer E, Hartog BJ, Borst GHA. Milk as a source of Campylobacter jejuni. Neth Milk
Dairy J 38:183, 1984.
Decker MD, Lavely GB, Hutcheson RH, Schaffner W. Food-borne streptococcal pharyn-
gitis in a hospital pediatrics clinic. JAMA 253:679, 1985.
DeGrace M, Laurin MF, Belanger C, Rolland PE, Blais R, Breton JP, Martineau G. Yer-
sinia enterocolitica gastroenteritis outbreak—Montreal. Can Dis Weekly Rep 2:
41, 1976.
Dekeyser P, Gossuin-Detrain M, Butzler JP, Sternon J. Acute enteritis due to related Vib-
rio: first positive stool cultures. J Infect Dis 125:390, 1972.
DeMol P. Human campylobacteriosis: clinical and epidemiological aspects. Dairy Food
Environ Sanitat 14:314–316, 1994.
Desenclos JC, Bouvet P, Benz-Lemoine E, Grimont F, Desqueyroux H, Rebiere I, Grimont
PA. Large outbreak of Salmonella enterica paratyphi B infection caused by a goats’
milk cheese, France, 1993: a case finding and epidemiological study. Br Med J Clin
Res 312:91, 1996.
Desmasures N, Bazin F, Gueguen M. Microbiological composition of raw milk selected
from farms in the Camembert region of Normandy. J Appl Microbiol 83:53, 1997.
Diaz Cinco ME, Acedo F, Evelia LD, Alma B. Survival of Brucella abortus in the Mexican
white cheese processing. Dairy Food Environ Sanitat 14:608, 1994.
514 Ryser
Diaz S, Moreno MA, Dominguez L, Suarez G, Blanco JL. Application of a diphasic dial-
ysis technique to the extraction of aflatoxins in dairy products. J Dairy Sci 76:1845,
1993.
Dineen SS, Takeuchi K, Soudah JE, Boor KJ. Persistence of Escherichia coli O157:H7
in dairy fermentation systems. J Food Prot 61:1602, 1998.
Dixon JMS, Noble WC, Smith GR. Diphtheria: other corynebacterial and coryneform
infections. In: Smith GR, Easmon CSF, eds. Topley and Wilson’s Principles of
Bacteriology, Virology and Immunity. 8th ed. Vol. 3—Bacterial Diseases. Philadel-
phia: BC Decker, 1990, p 55.
Djuretic T, Wall PG, Nichols G. General outbreaks of infectious intestinal disease associ-
ated with milk and dairy products in England and Wales: 1992 to 1996. Commun
Dis Rep CDR Rev 7:R41, 1997.
Doeglas HMG, Huisman J, Nater JP. Histamine intoxication after cheese. Lancet 2:1361,
1967.
Domagala J, Kisza J, Bluthgren A, Heeschen W. Contamination of milk with aflatoxin
M
1
in Poland. Milchwissenschaft 52:631, 1997.
Dominguez LB, Relter A, Marks FJ, Press WB, Starko KM. Salmonella gastroenteritis
associated with milk—Arizona. Morbid Mortal Weekly Rep 28:117, 1979.
Donnelly CB, Black LA, Lewis KH. Occurrence of coagulase-positive staphylococci in
cheddar cheese. Appl Microbiol 12:311, 1964.
Donta ST. Food poisoning. In: Braude AI, Davis CE, Fierer J, eds. Infectious Diseases
and Medical Microbiology, 2nd ed. Philadelphia: WB Saunders, 1986, p 892.
dos Reis Tassinari A, de Melo Franco BDG, Landgraf M. Incidence of Yersinia spp. in
food in Sao Paulo, Brazil. Int J Food Microbiol 21:263, 1994.
dos Santos EC, Genigeorgis C. Survival and growth of Staphylococcus aureus in commer-
cially manufactured Brazilian Minas cheese. J Food Prot 44:177, 1981.
dos Santos EC, Genigeorgis C, Farver TB. Prevalence of Staphylococcus aureus in raw
and pasteurized milk used for commercial manufacturing of Brazilian Minas cheese.
J Food Prot 44:172, 1981.
Doyle MP. Escherichia coli O157:H7 and its significance in foods. Int J Food Microbiol
12:289, 1991.
Doyle MP, Padhye NV. Escherichia coli. In: Doyle MP, ed. Foodborne Bacterial Patho-
gens. New York: Marcel Dekker, 1989, p 71.
Doyle MP, Roman DJ. Prevalence and survival of Campylobacter jejuni in unpasteurized
milk. Appl Environ Microbiol 44:1154, 1982a.
Doyle MP, Roman DJ. Recovery of Campylobacter jejuni and Campylobacter coli
from inoculated foods by selective enrichment. Appl Environ Microbiol 43:1343,
1982b.
Doyle MP, Schoeni JL. Survival and growth characteristics of Escherichia coli associated
with hemorrhagic colitis. Appl Environ Microbiol 48:855, 1984.
Doyle MP, Glass KA, Berry JT, Garcia GA, Pollard DJ, Schultz RD. Survival of Listeria
monocytogenes in milk during high-temperature, short-time pasteurization. Appl
Environ Microbiol 53:1433, 1987.
Dragacci S, Femy JM. Application of immunoaffinity column cleanup to aflatoxin M
1
determination and survey in cheese. J Food Prot 59:1011, 1996.
Drobniewski FA. Bacillus cereus and related species. Clin Microbiol Rev 6:324, 1993.
Public Health Concerns 515
Duca E, Teodorovici G, Radu C, Vita A, Talasman-Niculescu P, Bernescu E, Feldi C,
Rosca V. A new nephritogenic streptococci. J Hyg Camb 67:691, 1969.
Dufrenne J, Bijwaard M, te Giffel M, Beumer R, Notermans S. Characteristics of some
psychrotrophic Bacillus cereus isolates. Intern J Food Microbiol 27:175, 1995.
DuPont HL, Formal SB, Hornick RB, Synder MJ, Libonati JP, Sheahan DG, LaBrec
EH, Kalas JP. Pathogenesis of Escherichia coli diarrhea. N Engl J Med 285:1,
1971.
Echeverria P, Taylor DN, Bettelheim KA, Chatkaeomorakot A, Changchawalit S, Thong-
charoen A, Leksomboon U. HeLa cell-adherent enteropathogenic Escherichia coli
in children under 1 year of age in Thailand. J Clin Microbiol 25:1472, 1987.
Eckman MR. Brucellosis linked to Mexican cheese. JAMA 232:636, 1975.
Eckner KF, Zottola EA. The behavior of selected microorganisms during manufacture of
high moisture Jack cheeses from ultrafiltered milk. J Dairy Sci 74:2820, 1991.
Eckner KF, Dustman WA, Rys-Rodriguez AA. Contribution of composition, physico-
chemical characteristics and polyphosphates to the microbial safety of pasteurized
cheese spreads. J Food Prot 57:295, 1994.
Eckner KF, Roberts RF, Strantz AA, Zottola EA. Characterization and behavior of Salmo-
nella javiana during manufacture of mozzarella-type cheese. J Food Prot 53:461,
1990.
Edelman R, Levine MM. From the National Institute of Allergy and Infectious Diseases—
Summary of a workshop on enteropathogenic Escherichia coli. J Infect Dis 147:
1108, 1983.
Edwards AT, Roulson M, Ironside MJ. A milk-borne outbreak of serious infection due
to Streptococcus zooepidemicus (Lancefield Group C). Epidem Infect 101:43, 1988.
Edwards PR, West MG, Bruner DW. Antigenic studies of a group of paracolon bacteria
(Bethesda group). J Bacteriol 55:711, 1948.
Edwards ST, Sandine WE. Public health significance of amines in cheese. J Dairy Sci 64:
2431, 1981.
Ehlers JG, Chapparo-Serrano M, Richter RL, Vanderzant C. Survival of Campylobacter
fetus subsp. jejuni in cheddar and cottage cheese. J Food Prot 45:1018, 1982.
El-Dairouty KF. Staphylococcal intoxication traced to non-fat dried milk. J Food Prot 12:
901, 1989.
El-Gazzar FE, Marth EH. Samonellae, salmonellosis, and dairy foods: a review. J Dairy
Sci 75:2327, 1992.
Ellis A, Preston M, Borczyk A, Miller B, Stone P, Hatton B, Chagla A, Hockin J. A
community outbreak of Salmonella Berta associated with a soft cheese product.
Epidem Infect 120:29, 1998.
El-Refai A-MH, Sallam LAR, Naim N. The alkaloids of fungi. I. The formation of ergoline
alkaloids by representative mold fungi. Jpn J Microbiol 14:91, 1970.
Elsser KAA, Moricz M, Procter EM. Cryptosporidium infections: a laboratory survey.
Can Med Assoc J 135:211, 1986.
Engel G, Teuber M. Toxic metabolites from fungal cheese starter cultures (Penicillium
camemberti and Penicillium roqueforti). In: van Egmond HP, ed. Mycotoxins in
Dairy Products. London: Elsevier Applied Science, 1989, p 163.
Erkmen O. Behavior of Staphylococcus aureus in Turkish Feta cheese during manufacture
and ripening. J Food Prot 58:1201, 1995.
516 Ryser
Erkmen O, Bozoglu TF. Behaviour of Salmonella typhimurium in feta cheese during man-
ufacture and ripening. Food Sci Technol 32:480, 1995.
Erksine D. Dermatitis caused by penicillin in milk. Lancet 1:431, 1958.
Espinosa FH, Ryan WM, Vigil PL, Gregory DF, Hilley RB, Romig DA, Stamm RB, Suhre
ED, Taulbee PS, Zucal LH, Honsinger RW Jr, Lindberg PJ, Barcheck M, Miller
JA, Mitzelfelt R, Montes JM, Nims LJ, Rollag OJ, Weber N, Mann JM. Group C
streptococcal infections associated with eating homemade cheese—New Mexico.
Morbid Mortal Weekly Rep 32:510, 1983.
Evans AD. ‘‘Q’’ fever in South Wales. Mon Bull Minist Health 21:215, 1956.
Evans DA, Litsky W. Thermal inactivation studies on certain pathogenic organisms in
milk. Bacteriol Proc 19:10, 1968.
Evans MR, Roberts RJ, Riberio CD, Gardner D, Kembrey D. A milk-borne Campylobacter
outbreak following an educational farm visit. Epidem Infect 117:457, 1996.
Evenson ML, Hinds MW, Bernstein RS, Bergdoll MS. Estimation of human dose of staph-
ylococcal enterotoxin A from a large outbreak of staphylococcal food poisoning
involving chocolate milk. Int J Food Microbiol 7:311, 1988.
Eyler JM. The epidemiology of milk-borne scarlet fever: the case of Edwardian Brighton.
Am J Public Health 76:573, 1986.
Fakuuzi FR, Zyambo GCN, Morris SD. A serological survey of bovine brucellosis in the
Melopo District of Bophuthatswanta. J South Afr Vet Assoc 64:154, 1993.
Fanning J. An unusual outbreak of gastroenteritis. BMJ 1:583, 1935.
Fantasia LD, Mestrandrea L, Schrade JP, Yager J. Detection and growth of enteropatho-
genic Escherichia coli in soft ripened cheese. Appl Microbiol 29:179, 1975.
Farber JM, Peterkin PI. Listeria monocytogenes, a food-borne pathogen. Microbiol Rev
55:476, 1991.
Farber JM, Sanders GW, Speirs JI. Growth of Listeria monocytogenes in naturally-contam-
inated raw milk. Lebensm Wiss Technol 23:252, 1990.
Farkhondeh A, Ghazvinian R, Lavhal Ph. Contamination par les Salmonella du fromage
iranien frais, non sale, mis en vente dans la region de Teheran. Le Lait 535/536:
302, 1974.
Farrag SA, Marth EH. Escherichia coli O157:H7, Yersinia enterocolitica and their control
in milk by the lactoperoxidase system: a review. Lebensm Wiss Technol 25:201,
1992.
Federighi M, Magras C, Pilet MF, Woodward D, Johnson W, Jugiau F, Jouve JL. Incidence
of thermotolerant Campylobacter in foods assessed by NF ISO 10272 standard:
results of a two-year study. Food Microbiol. 16:195, 1999.
Felip G, Toti L. Foodborne diseases caused by gram-negative microorganisms in milk
products. Microbiol Aliments Nutr 2:251, 1984.
Feng P. Appendix 1-Rapid methods for detecting foodborne pathogens In: FDA Bacterio-
logical Analytical Manual. 8
th
ed., AOAC International, Gaithersburg, MD, 1998.
Finch MJ, Blake PA. Foodborne outbreaks of campylobacteriosis: the United States expe-
rience, 1980–1982. Am J Epidemiol 122:262, 1985.
Fishbein DB, Raoult D. A cluster of Coxiella burnetii infections associated with exposure
to vaccinated goats and their unpasteurized dairy products. Am J Trop Med Hyg
47:35, 1992.
Fleming DW, Cochi SL, MacDonald KL, Brondum J, Hayes PS, Plikaytis BD, Homes
Public Health Concerns 517
MB, Audurier A, Broome CV, Reingold AL. Pasteurized milk as vehicle of infec-
tion in an outbreak of listeriosis. N Engl J Med 312:404, 1985.
Flowers RS, Andrews W, Donnelly CW, Koenig E. Pathogens in milk and milk products.
In: Marshall RT, ed. Standard Methods for the Examination of Dairy Products. 16th
ed. Washington, DC: American Public Health Association, 1992, p 103.
Flowers RS, D’Aoust J-Y, Andrews WH, Bailey JS. Salmonella. In: Vanderzant C, Split-
tsoesser DF, eds. Compendium of Methods for the Microbiological Examination
of Foods, 3rd ed. Washington, DC: American Public Health Association, 1992b, p
371.
Foley AR, Poisson E. A cheese-borne outbreak of typhoid fever. Can J Public Health 36:
116, 1945.
Foley BV, Clay MM, O’Sullivan DJ. A study of a brucellosis epidemic. Irish J Med Sci
3:457, 1970.
Fontaine RE, Cohen ML, Martin WT, Vernon TM. Epidemic salmonellosis from cheddar
cheese—surveillance and prevention. Am J Epidemiol 111:247, 1980.
Food Surveillance Information Sheet. Survey of aflatoxin M
1
in farm gate milk-UK Minis-
try of Agriculture, Fisheries and Food, Food Safety Directorate, HMSO Publica-
tions Center, London, no. 78, 1996.
FoodNet. CDC/FSIS/FDA Foodborne Diseases Active Surveillance Network—CDC’s
Emerging Infections Program 1998 Surveillance Results Preliminary Report. http://
www.cdc.gov/ncidod/dbmd/foodnet/98surv.htm.
Franciosa G, Pourshaban M, Gianfranceschi M, Gattuso A, Fenicia L, Ferrini AM, Man-
noni V, DeLuca G, Aureli P. Clostridium botulinum spores and toxin in Mascarpone
cheese and other milk products. J Food Prot 62:867, 1999.
Francis AJ, Nimmo GR, Efstratiou A, Galanis V, Nuttall N. Investigation of milk-borne
Streptococcus zooepidemicus infection associated glomerulonephritis in Australia.
J Infect 27:317, 1993.
Francis BJ, Allard J. Salmonella typhimurium—Yakima County, Washington. Morbid
Mortal Weekly Rep 16:178, 1967.
Francis BJ, Davis JP. Update: gastrointestinal illness associated with imported semi-soft
cheese. Morbid Mortal Weekly Rep 33:16, 1984.
Francis BJ, Langkop C, Mitchel H, Donnell HD Jr, Hernandez C, Telle RD, Halpin TJ.
Presumed staphylococcal food poisoning associated with whipped butter. Morbid
Mortal Weekly Rep 26:268, 1977.
Francis DW, Spaulding PL, Lovett J. Enterotoxin production and thermal resistance of
Yersinia enterocolitica in milk. Appl Environ Microbiol 40:174, 1980.
Frank JF, Marth EH. Inhibition of enteropathogenic Escherichia coli by homofermentative
lactic acid bacteria in milk—I. Comparison of strains of Escherichia coli. J Food
Prot 40:749, 1977a.
Frank JF, Marth EH. Inhibition of enteropathogenic Escherichia coli by homofermentative
lactic acid bacteria in milk—II. Comparison of lactic acid bacteria and enumeration
methods. J Food Prot 40:754, 1977b.
Frank JF, Marth EH. Survey of soft and semisoft cheese for presence of fecal coli-
forms and serotypes of enteropathogenic Escherichia coli. J Food Prot 41:198,
1978.
Frank JF, Marth EH, Olson NF. Survival of enteropathogenic and non-enteropathogenic
518 Ryser
Escherichia coli during the manufacture of Camembert cheese. J Food Prot 40:835,
1977.
Frank JF, Marth EH, Olson NF. Behavior of enteropathogenic Escherichia coli during
manufacture and ripening of brick cheese. J Food Prot 41:111, 1978.
Fremy JM, Chu FS. Direct ELISA for determining AFM
1
at picogram levels in dairy
products. JAOAC 67:1098, 1984.
Fremy JM, Chu FS. Immunochemical methods of analysis for aflatoxin M
1
, In: van Eg-
mond HP, ed. Mycotoxins in Dairy Products. London: Elsevier Applied Science,
1989, p 97.
Frobish RA, Bradley BD, Wagner DD, Long-Bradley PE, Hairston H. Aflatoxin residues
in milk of dairy cows after ingestion of naturally contaminated grain. J Food Prot
49:781, 1986.
Fulton JS. Contagious abortion of cattle and undulant fever in man. Med Officer 65:201,
1941.
Galbraith NS, Forbes P, Clifford C. Communicable disease associated with milk and dairy
products in England and Wales 1951–1980. BMJ 284:1761, 1982.
Galbraith NS, Ross MS, de Mowbray RR, Payne DJH. Outbreak of Brucella melitensis
type 2 infection in London. BMJ 1:612, 1969.
Galvano F, Galofaro V, De Angelis A, Galvano M, Bognanno M, Galvano G. Survey of
the occurrence of aflatoxin M
1
in dairy products marketed in Italy. J Food Prot 61:
738, 1998.
Garcia ML, Moreno B, Bergdoll MS. Characterization of staphylococci isolated from mas-
titic cows in Spain. Appl Environ Microbiol 39:548, 1980.
Gauthier J, Foley AR. A cheese-borne outbreak of typhoid fever. Can J Public Health 34:
543, 1943.
Geiger JC, Crowley AB, Gray JP. Food poisoning from ice cream on ships. JAMA 105:
1980, 1935.
Gelletlie R, Stuart J, Soltanpoor N, Armstrong R, Nichols G. Cryptosporidiosis associated
with school milk. Lancet 350:1005, 1997.
George JTA, Wallace JG, Morrison HR, Harbourne JF. Paratyphoid in man and cattle.
BMJ 3:208, 1972.
Ghoneim A, Cooke EM. Serious infection caused by group C streptococci. J Clin Pathol
33:188, 1980.
Giffel MC, Beumer RR. Isolation, identification and characterization of Bacillus cereus
from the dairy environment. Tijdschrift Diergeneeskunde 123:628, 1998.
Giffel MC, Beumer RR, Graanum PE, Rombouts FM. Isolation and characterization of
Bacillus cereus from pasteurized milk in household refrigerators in the Netherlands.
Intern J Food Microbiol 34:307, 1996.
Gilbert GL, Davoren RA, Cole ME. Mid-trimester abortion associated with septicaemia
caused by Campylobacter jejuni. Med J Aust 1:585, 1981.
Gilbert RJ. Bacillus cereus gastroenteritis. In: Riemann H, Bryan FL, eds. Foodborne
Infections and Intoxications. 2nd ed. New York: Academic Press, 1979, p 495.
Gilbert RJ, Parry JM. Serotypes of Bacillus cereus from outbreaks of food poisoning and
from routine foods. J Hyg Camb 78:69, 1977.
Gill KPW, Bates PG. Lander KP. The effect of pasteurization on the survival of Campylo-
bacter species in milk. BVJ 137:578, 1981.
Public Health Concerns 519
Gilles G, Jouglard J, Sebald M, Jacquet MJ. Sur une epidemie de botulisme humain en-
quete et hyptheses etiologiques: role possible du fromage et des paillons. Rec Med
Vet 47:165, 1974.
Gilman HL, Dahlberg AC, Marquardt JC. The occurrence and survival of Brucella abortus
in cheddar and Limburger cheese. J Dairy Sci 29:71, 1946.
Glass KA, Kaufman KM, Smith AL, Johnson EA, Chen JH, Hotchkiss J. Toxin production
by Clostridium botulinum in pasteurized milk treated with carbon dioxide. J Food
Prot 62:872, 1999.
Glatz BA, Brudvig SA. Survey of commercially available cheese for enterotoxigenic Esch-
erichia coli. J Food Prot 43:395, 1980.
Goepfert JM, Olson NF, Marth EH. Behavior of Salmonella typhimurium during manufac-
ture and curing of cheddar cheese. Appl Microbiol 16:862, 1968.
Goepfert JM, Spira WM, Kim HU. Bacillus cereus: food poisoning organism. A review.
J Milk Food Technol 35:213, 1972.
Gogov Y, Slavchev G, Peeva T. Cold resistance of S. aureus and A and C
2
staphylocccus
enterotoxins in ice cream. Vet Sci (Sofia) 21:46, 1984.
Golden DA, Hou JJ. Survival of Yersinia enterocolitica during manufacture and storage
of short- and long-set cottage cheese (abstr). New Orleans, LA: Annual Meeting
of the Institute of Food Technologists. June 22–25, 1996.
Goldie W, Maddock ECG. A milk-borne outbreak of diphtheria. Lancet 1:285, 1943.
Goldwater PN, Bettelheim KA. Hemolytic uremic syndrome due to Shiga-like toxin
producing Escherichia coli O48:H21 in South Australia. Emerg Infect Dis 1:132,
1995.
Gomez-Lucia E, Blanco JL, Goyache J, de La Fuente R, Vazquez JA, Ferri EFR, Suarez
G. Growth and enterotoxin A production by Staphylococcus aureus S6 in Man-
chego-type cheese. J Appl Bacteriol 61:499, 1986.
Gomez-Lucia E, Goyache J, Orden JA, Domenech A, Hernandez FJ, Quiteria JAR-S,
Lopez B, Blanco JL, Suarez G. Growth of Staphylococcus aureus and synthesis of
enterotoxin during ripening of experimental Manchego-type cheese. J Dairy Sci 75:
19, 1992.
Goulet V, Jacquet C, Vaillant V, Rebiere I, Mouret E, Lorente C, Maillot E, Stainer F,
Rocourt J. Listeriosis from consumption of raw-milk cheese. Lancet 345:1581,
1995.
Graadl O, Nygaard K. Crohn’s disease: long term effects of surgical treatment. Tidssk
Norske Laegeforen 114:1603, 1994.
Grange JM. Tuberculosis. In: Smith GR, Easmon CSF, eds. Topley and Wilson’s Princi-
ples of Bacteriology, Virology and Immunity. 8th ed. Vol. 3—Bacterial Diseases.
Philadelphia: BC Decker, 1990, p 55.
Grant IR, Ball HJ, Neill SD, Rowe MT. Inactivation of Mycobacterium paratuberculosis
in cows’ milk at pasteurization temperatures. Appl Environ Microbiol 62:631, 1996.
Granum PE, Brynestad S, Kramer JM. Analysis of enterotoxin production by Bacillus
cereus from dairy products, food poisoning incidents and non-gastrointestinal infec-
tions. Intern J Food Microbiol 17:269, 1993.
Gray LD. Escherichia, Salmonella, Shigella and Yersinia. In: Murray PR, Baron EJ,
Pfaller MA, Tenover FC, Yolken RH, eds. Manual of Clinical Microbiology. 6th
ed. Washington, DC: ASM Press, 1995, p 450.
520 Ryser
Gray ML, Killinger AH. Listeria monocytogenes and listeric infections. Bacteriol Rev 30:
309, 1966.
Grecz N, Wagenaar RO, Dack GM. Storage stability of Clostridium botulinum toxin and
spores in processed cheese. Appl Microbiol 13:1014, 1965.
Greenwood MH, Hooper WL. Excretion of Yersinia spp. associated with consumption of
pasteurized milk. Epidemiol Infect 104:345, 1990.
Greenwood MH, Hooper WL, Rodhouse JC. The source of Yersinia spp. in pasteurized
milk: an investigation at a dairy. Epidemiol Infect 104:351, 1990.
Gresikova M, Sekeyova M, Stupalova S, Necas S. Sheep milk-borne epidemic of tick-
borne encephalitis in Slovakia. Intervirol 5:57, 1975.
Griffin PM, Tauxe RV. The epidemiology of infections caused by Escherichia coli O157:
H7, other enterohemorrhagic E. coli and the associated hemolytic uremic syndrome.
Epidemiol Rev 13:60, 1991.
Griffin PM, Ostroff SM, Tauxe RV, Greene KD, Wells JG, Lewis JH, Blake PA. Illness
associated with Escherichia coli O157:H7 infections. Ann Intern Med 109:705,
1988.
Griffith AS. Human tubercle bacilli in the milk of a vaccinated cow. J Pathol Bacteriol
17:323, 1913.
Griffiths MW. Toxin production by psychrotrophic Bacillus spp. present in milk. J Food
Prot 53:790, 1990.
Griffiths MW, Phillips JD. Incidence, source and some properties of psychrotrophic Bacil-
lus found in raw and pasteurized milk. J Soc Dairy Technol 43:62, 1990.
Gross EM, Weizman Z, Picard E, Mates A, Sheinman R, Platzner N, Wolff A. Milkborne
gastroenteritis due to Staphylococcus aureus enterotoxin B from a goat with masti-
tis. Am J Trop Med Hyg 39:103, 1988.
Guitierrez LM, Menes I, Garcia ML, Moreno B, Bergdoll MS. Characterization and enter-
otoxigenicity of staphylococci isolated from mastitic ovine milk in Spain. J Food
Prot 45:1282, 1982.
Gunzer F, Bohm H, Russman H, Bitzan M, Aleksic S, Karch H. Molecular detection
of sorbitol fermenting Escherichia coli O157 in patients with hemolytic uremic
syndrome. J Clin Microbiol 30:1807, 1992.
Gyles CL. Escherichia coli cytotoxins and enterotoxins. Can J Microbiol 38:734,
1992.
Habib N, Warring FC. A fatal case of infection due to Mycobacterium bovis. Am Rev
Respir Dis 93:804, 1966.
Hackler JF. Outbreak of Staphylococcus milk poisoning in pasteurized milk. Am J Public
Health 29:1247, 1939.
Halpin-Dohnalek MI, Marth EH. Fate of Staphylococcus aureus in whey, whey cream,
and whey cream butter. J Dairy Sci 72:3149, 1989a.
Halpin-Dohnalek MI, Marth EH. Growth and production of enterotoxin A by Staphylococ-
cus aureus in cream. J Dairy Sci 72:2266, 1989b.
Halpin-Dohnalek MI, Marth EH. Growth of Staphylococcus aureus in milks and creams
with various amounts of milk fat. J Food Prot 52:540, 1989c.
Hamama A, El Marrakchi A, El Othmani F. Occurrence of Yersinia enterocolitica in milk
and dairy products in Morocco. Int J Food Microbiol 16:69, 1992.
Hammer BW. Dairy Bacteriology. 2nd ed. New York: John Wiley & Sons, 1938, p 150.
Public Health Concerns 521
Hancock DD, Besser TE, Kinsel ML, Tarr PI, Rice DH, Paros MG. The prevalence of
Escherichia coli O157:H7 in dairy and beef cattle in Washington State. Epidemiol
Infect 113:199, 1994.
Hanna MO, Stewart JC, Carpenter ZL, Vanderzant C. Heat resistance of Yersinia entero-
colitica in skim milk. J Food Prot 40:689, 1977.
Hargrove RE, McDonough FE, Mattingly WA. Factors affecting survival of Salmonella
in cheddar and Colby cheese. J Milk Food Technol 32:480, 1969.
Harmon SM, Goepfert JM, Bennett RW. Bacillus cereus. In: Marshall RT, ed. Standard
Methods for the Examination of Dairy Products. Washington, DC: Am Public
Health Assoc. 1992, p 593.
Harp JA, Fayer R, Pesch BA, Jackson GJ. Effect of pasteurization on infectivity of Crypt-
osporidium parvum oocysts in water and milk. Appl Environ Microbiol 62:2866,
1996.
Harris NV, Kimball T, Weiss NS, Nolan C. Dairy products and other non-meat foods as
possible sources of Campylobacter jejuni and Campylobacter coli enteritis. J Food
Prot 49:347, 1986.
Harris NV, Kimball TJ, Bennett P, Johnson Y, Wakely D, Nolan CM. Campylobacter
jejuni enteritis associated with raw goat’s milk. Am J Epidemiol 126:179, 1987.
Hart RJC. Corynebacterium ulcerans in humans and cattle in North Devon. J Hyg Camb
92:161, 1984.
Hauge S. Food poisoning due to Bacillus cereus: a preliminary report. Nord Hyg Tigskr
31:189, 1950.
Hauge S. Food poisoning caused by aerobic sporeforming bacteria. J Appl Bacteriol 18:
591, 1955.
Hauschild AHW. Clostridium botulinum. In: Doyle MP, ed. Foodborne Bacterial Patho-
gens. New York: Marcel Dekker, 1989, p 111.
Headrick ML, Korangy S, Bean NH, Klontz KC, Angulo FJ, Altekruse SF, Potter ME.
Epidemiology of Milk-Associated Foodborne Disease Outbreaks Reported in the
United States, 1973–1993. The Continued Risk of Raw Milk Consumption. Atlanta,
GA: Centers for Disease Control and Prevention, 1996.
Headrick ML, Timbo B, Klontz KC, Werner SB. Profile of raw milk consumers in Califor-
nia. Pub Health Rep 112:418, 1997.
Headrick ML, Korangy S, Bean N, Angulo FJ, Alterkruse SF, Potter ME, Klontz C. The
epidemiology of raw milk-associated foodborne disease outbreaks reported in the
United States, 1973 through 1992. Am J Pub Health 88:1219, 1998.
Hedberg CW, Korlath JA, D’Aoust J-Y, White KE, Schell WL, Miller MR, Cameron DN,
MacDonald KL, Osterholm MT. A multistate outbreak of Salmonella javiana and
Salmonella oranienburg infections due to consumption of contaminated cheese.
JAMA 268:3203, 1992.
Helmy ZA, Abd-el-Malek Y, Mahmoud AA. Growth of Staphylococcus aureus, experi-
mentally inoculated in Damietta cheese. Zbl Bakteriol Abt II, 130:468, 1975.
Hendricks SL, Meyer ME. Brucellosis. In: Hubbert WT, McCulloch WF, Schurrenburger
PR, eds. Diseases Transmitted from Animals to Man. 6th ed. Springfield, IL:
Charles C Thomas, 1975, p 10.
Hendricks SL, Belknap RA, Hausler WJ Jr. Staphylococcal food intoxication due to ched-
dar cheese. I. Epidemiology. J Milk Food Technol 22:313, 1959.
522 Ryser
Hennessy TW, Hedberg CW, Slutsker L, White KE, Besset-Wiek JM, Moen ME, Feldman
J, Coleman WW, Edmonson LM, MacDonald KL, Osterholm MT, the Investigation
Team. A national outbreak of Salmonella enteritidis infections from ice cream. N
Engl J Med 334:1281, 1996.
Henry JE. Milk-borne diphtheria. An outbreak traced to infection of a milk handler’s finger
with B. diphtheriae. JAMA 75:1715, 1920.
Heuvelink AE, Bleumink B, van den Biggelaar FLAM, te Giffel MC, Beumer RR, de
Boer E. Occurrence and survival of verocytoxin-producing Escherichia coli O157
in raw cow’s milk in the Netherlands. J Food Prot 61:1597, 1998.
Hill WE, Datta AR, Feng P, Lampel KA, Payne WL. Identification of foodborne bacterial
pathogens by gene probes. In: FDA Bacteriological Analytical Manual. 8th ed.
Gaithersburg, MD: AOAC International, 1995, p 24.01.
Hinz PC, Slatter WL, Harper WJ. A survey of various free amino and fatty acids in domes-
tic Swiss cheese. J Dairy Sci 39:235, 1956.
Hirschmann SZ. Viral hepatitis. In: Braude AI, Davis CE, Fierer J, eds. Infectious Dis-
eases and Medical Microbiology. 2nd ed. Philadelphia: WB Saunders, 1986,
p 989.
Hitchins AD. Listeria monocytogenes. Identification of foodborne bacterial pathogens by
gene probes. In: FDA Bacteriological Analytical Manual. 8th ed. Gaithersburg, MD:
AOAC International, 1998, p 10.01.
Hitchins AD, Feng P, Watkins WD, Rippey SR, Chandler LA. Escherichia coli and the
coliform bacteria. In: FDA Bacteriological Analytical Manual. 8th ed. Gaithersburg,
MD: AOAC International, 1998, p 4.01.
Hobbs BC. The clostridia. In: Braude AI, Davis CE, Fierer J, eds. Infectious Diseases
and Medical Microbiology. 2nd ed. Philadelphia: WB Saunders, 1986, p 407.
Holmberg SD, Blake PA. Staphylococcal food poisoning in the United States: new facts
and old misconceptions. JAMA 251:487, 1984.
Holmes JR, Plunkett T, Pate P, Roper WL, Alexander WJ. Emetic food poisoning caused
by Bacillus cereus. Arch Intern Med 141:766, 1981.
Horning BG. Outbreak of undulant fever due to Brucella suis. JAMA 24:1978, 1935.
Hosek G, Leschinsky D, Irons S, Safranek TJ. Multidrug-resistant Salmonella serotype
Typhimurium—United States, 1996. Morbid Mortal Wkly Rep 46:308, 1996.
Horvath G, Toth-Marton E, Meszaros JM, Quarini L. Experimental Bacillus cereus masti-
tis in cows. Acta Vet Hung 34:29, 1986.
Hudson LM, Chen J, Hill AR, Griffiths MW. Bioluminescence: a rapid indicator of Esche-
richia coli O157:H7 in selected yogurt and cheese varieties. J Food Prot 60:891,
1997.
Hudson PJ, Vogt RL, Brondum J, Patton CM. Isolation of Campylobacter jejuni from
milk during an outbreak of campylobacteriosis. J Infect Dis 150:789, 1984.
Hudson SJ, Sobo AO, Russel K, Lightfoot NF. Jackdaws as potential source of milk-
borne Campylobacter jejuni infection. Lancet 336:1160, 1990.
Huebner RJ, Bell JA. ‘‘Q’’ fever studies in southern California—summary of current
results and a discussion of possible control measures. JAMA 145:301, 1951.
Huebner RJ, Jellison WL, Beck MD, Wilcox FP. Q fever studies in southern California—
effects of pasteurization on survival of C. burnetii in naturally infected milk. Public
Health Rep 64:499, 1949.
Public Health Concerns 523
Hughes D, Jensen N. Yersinia enterocolitica in raw goat’s milk. Appl Environ Microbiol
41:309, 1981.
Hui JY, Taylor SL. Inhibition of in vivo histamine metabolism in rats by foodborne and
pharmacologic inhibitors of diamine oxidase, histamine N-methyl transferase, and
monoamine oxidase. Toxicol Appl Pharmacol 8:241, 1985.
Humphrey TJ, Hart RJC. Campylobacter and Salmonella contamination of unpasteurized
cow’s milk on sale to the public. J Appl Bacteriol 65:463, 1988.
Hunt J, Abeyta C, Tran C. Campylobacter. In: FDA Bacteriological Analytical Manual.
8th ed. Gaithersburg, MD: AOAC International, 1998, p 7.01.
Hunt JM, Francis DW, Peeler JT, Lovett J. Comparison of methods for isolating Campylo-
bacter jejuni from raw milk. Appl Environ Microbiol 50:535, 1985.
Hutchinson DN, Bolton FJ, Jelley WCN, Mathews WG, Telford DR, Counter DE, Jessop
EG, Horsley SD. Campylobacter enteritis associated with consumption of raw
goat’s milk. Lancet 1:1037, 1985a.
Hutchinson DN, Bolton FJ, Hinchliffe PM, Dawkins HC, Horsley SD, Jessop EG, Robert-
shaw PA, Counter DE. Evidence of udder excretion of Campylobacter jejuni as the
cause of a milk-borne Campylobacter outbreak. J Hyg Camb 94:205, 1985b.
Ibrahim GF, Radford DR, Baldock AK, Ireland LB. Inhibition of growth of Staphylococ-
cus aureus and enterotoxin-A production in cheddar cheese produced by induced
starter failure. J Food Prot 44:189, 1981a.
Ibrahim GF, Radford DR, Baldock AK, Ireland LB. Inhibition of Staphylococcus aureus
growth and enterotoxin-A production in cheddar cheese produced with variable
starter activity. J Food Prot 44:263, 1981b.
Ikram M, Luedecke LO. Growth and enterotoxin A production by Staphylococcus aureus
in fluid dairy products. J Food Prot 40:769, 1977.
James T. The story of the enteropathogenic Escherichia coli. S Afr Med J 47:1476,
1973.
Jaquette CB, Beuchat LR. Combined effects of pH, nisin, and temperature on growth and
survival of psychrotrophic Bacillus cereus. J Food Prot 61:563, 1998.
Jezyna Cz, Weglinska T, Nawrocka E, Falecka W, Wieliczko-gebska L, Rodkiewicz T,
Piesiak Z, Ciesielski T. A milk-borne outbreak of tick-borne encephalitis in the
Olsztyn Province. Przeg Epidemiol 30:480, 1976.
Jokippi L, Jokippi AMM. Cryptosporidiosis. In: Braude AI, Davis CE, Fierer J, eds. Infec-
tious Disease and Medical Microbiology. 2nd ed. Philadelphia: WB Saunders 1986,
p 931.
Jones EE, Kim-Farley RJ, Algunaid M, Parvez MA, Ballad YA, Hightower AW, Orenstein
WA, Broome CV. Diphtheria: a possible foodborne outbreak in Hodeida, Yemen
Arab Republic. Bull WHO 63:287, 1985.
Jones GA, Gibson DL, Cheng K-J. Coliform bacteria in Canadian pasteurized dairy prod-
ucts. Can J Public Health 58:257, 1967.
Jones PH, Willis AT, Robinson DA, Skirrow MB, Josephs DS. Campylobacter enteritis
associated with the consumption of free school milk. J Hyg Camb 87:155, 1981.
Jones TO. Caprine mastitis associated with Yersinia pseudotuberculosis infection. Vet Rec
110:231, 1982.
Kahana LM, Todd E. Histamine intoxication in a tuberculosis patient on isoniazid. Can
Dis Weekly Rep 7:79, 1981.
524 Ryser
Kaneene JB, Ahl AS. Drug residues in dairy cattle industry: epidemiological evaluation
of factors influencing their occurrence. J Dairy Sci 70:2176, 1987.
Kaneene JB, Miller R. Description and evaluation of the influence of veterinary presence
on the use of antibiotics and sulfonamides in dairy herds. J Am Vet Med Assoc
201:68, 1992.
Kantor HS. Bacterial enteritis. In: Braude AI, Davis CE, Fierer J, eds. Infectious Diseases
and Medical Microbiology. 2nd ed. Philadelphia: WB Saunders, 1986, p 897.
Karahadian C, Lindsay RC, Dillman LL, Deibel RH. Evaluation of the potential for botuli-
nal toxigenesis in reduced-sodium processed American cheese foods and spreads.
J Food Prot 48:63, 1985.
Karmali MA, Steele BT, Petric M, Lim C. Sporadic cases of haemolytic uremic syndrome
associated with faecal cytotoxin and cytotoxin-producing Escherichia coli in stools.
Lancet 1:619, 1983.
Kasatiya SS. Yersinia enterocolitica gastroenteritis outbreak—Montreal. Can Dis Weekly
Rep 2:73, 1976.
Kasrazadeh M, Genigeorgis C. Potential growth and control of Salmonella in Hispanic
type soft cheese. Int J Food Microbiol 22:127, 1994.
Kasrazadeh M, Genigeorgis C. Potential growth and control of Escherichia coli O157:
H7 in soft Hispanic type cheese. Int J Food Microbiol 25:289, 1995.
Ka¨stli P, Hausch R. The viability of Br. abortus in different cheese varieties. Schweiz
Arch Tierheilk 99:638, 1957.
Kauf C, Lorent JP, Mosimann J, Schlatter I, Somaini B, Velvart J. Botulismusepidemie
vom Typ B. Schweiz med Wschr 104:677, 1974.
Kaufmann OW, Brillaud AR. Development of Clostridium botulinum in experimentally
inoculated sterile skim milk held at low temperatures. Am J Public Health 54:1514,
1964.
Kauppi KL, Tatini SR, Harrell F, Feng P. Influence of substrate and low temperature
on growth and survival of verotoxigenic Escherichia coli. Food Microbiol 13:397,
1996.
Kautter DA, Lilly T Jr, Lynt RK, Solomon HM. Toxin production by Clostridium
botulinum in shelf-stable pasteurized process cheese spreads. J Food Prot 42:784,
1979.
Kautter DA, Solomon HM, Lake DE, Bernard DT, Mills DC. Clostridium botulinum and
its toxins. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, eds.
Manual of Clinical Microbiology. 6th ed. Washington, DC: ASM Press, 1992, p
605.
Kells HR, Lear SA. Thermal death time curve of Mycobacterium tuberculosis var. bovis
in artificially infected milk. Appl Microbiol 8:234, 1960.
Keswani J, Frank JF. Thermal inactivation of Mycobacterium paratuberculosis in milk.
J Food Prot 61:974, 1998.
Khalid AS, Harrigan WF. Investigation into the effect of salt level on growth of, and toxin
production by, Staphylococcus aureus in Sudanese cheese. Lebensm Wiss Technol
17:99, 1984.
Khambaty FM, Bennett RW, Shah DB. Application of pulsed-field gel electrophoresis to
the epidemiological characterization of Staphylococcus intermedius implicated in
a food-related outbreak. Epidemiol Infect 113:75, 1994.
Public Health Concerns 525
Khayat FA, Bruhn JC, Richardson GH. A survey of coliforms and Staphylococcus aureus
in cheese using impedimetric and plate count methods. J Food Prot 51:53, 1988.
Kiermeier F, Buchner M. Distribution of aflatoxin M
1
in whey and curd during cheese
processing. Z Lebensm Unters Forsch 164:82, 1977.
Kiermeier F, Weiss G, Behringer G, Miller M, Ranfft K. Presence and content of aflatoxin
M
1
in milk supplied to a dairy. Z Lebensm Unters Forsch 163:71, 1977.
King NB. The survival of Brucella abortus (USDA strain 2308) in manure. J Am Vet
Med Assoc 31:349, 1957.
Kleeburg HH, Tuberculosis and other mycobacteriosis. In: Hubbert WT, McCullock WF,
Schnurrenberger PR, eds. Diseases Transmitted from Animals to Man. 6th ed.
Springfield, IL: Charles C Thomas, 1975, p 315.
Klein BS, Vergeront JM, Blaser MJ, Edmonds P, Brenner DJ, Janssen D, Davis JP.
Campylobacter infection associated with raw milk—an outbreak of gastroenteritis
due to Campylobacter jejuni and thermotolerant Campylobacter fetus subsp. fetus.
JAMA 255:361, 1986.
Kloos WE, Bannerman TL. Staphylococcus and Micrococcus. In: Murray PR, Baron EJ,
Pfaller MA, Tenover FC, Yolken RH, eds. Manual of Clinical Microbiology. 6th
ed. Washington, DC: ASM Press, 1995, p 282.
Kloos WE, Schliefer KH. Genus IV Staphylococcus. In: Sneath PH, Mair NS, Sharpe
ME, Holt JG, eds. Bergy’s Manual of Systematic Bacteriology. Vol 2. Baltimore:
Williams & Wilkins, 1986, p 1013.
Knight P. Hemorrhagic E. coli: the danger increases—disease outbreaks and several
deaths from contaminated meat products have officials scrambling to change out-
moded rules. ASM News, 59:247, 1993.
Koenig S, Marth EH. Behavior of Staphylococcus aureus in cheddar cheese made with
sodium chloride or a mixture of sodium chloride and potassium chloride. J Food
Prot 45:996, 1982.
Kohl I, Kozuch O, Eleckova, E, Labuda M, Zaludko J. Family outbreak of alimentary
tick-borne encephalitis in Slovakia associated with a natural focus of infection. Eur
J Epidemiol 12:373, 1996.
Koidis P, Doyle MP. Procedure for recovery of Campylobacter jejuni from inoculated
unpasteurized milk. Appl Environ Microbiol 47:455, 1984.
Konowalchuk J, Speirs JI, Stavric S. Vero response to a cytotoxin in Escherichia coli.
Infect Immunol 18:775, 1977.
Korlath JA, Osterholm MT, Judy LA, Forfang JC, Robinson RA. A point-source outbreak
of campylobacteriosis associated with consumption of raw milk. J Infect Dis 152:
592, 1985.
Kornacki JL, Marth EH. Fate of nonpathogenic and enteropathogenic Escherichia coli
during the manufacture of Colby-like cheese. J Food Prot 45:310, 1982.
Kornblatt AN, Barrett T, Morris GK, Tosh FE. Epidemiologic and laboratory investigation
of an outbreak of Campylobacter enteritis associated with raw milk. Am J Epide-
miol 122:884, 1985.
Kramer JM, Gilbert RJ. Bacillus cereus and other Bacillus species. In: Doyle MP, ed.
Foodborne Bacterial Pathogens. New York: Marcel Dekker, 1989, p 22.
Kristufkova Z, Simkovicova M. Epidemic of enterotoxicosis from ice cream caused by
staphylococcal TSST-1. Czech Epidem Mikrobiol Imunol 37:36, 1988.
526 Ryser
Krumbiegel ER, Wisniewski HJ. Q fever in the Milwaukee area. II. Consumption of in-
fected raw milk by human volunteers. Arch Environ Health 21:63, 1970.
Kuesch GT. Typhoid fever. In: Braude AI, Davis CE, Fierer C, eds. Infectious Diseases
and Medical Microbiology. 2nd ed. Philadelphia: WB Saunders, 1986, p 1189.
Kuzdas CD, Morse EV. The survival of Brucella abortus, USDA strain 2308, under con-
trolled conditions in nature. Cornell Vet 44:216, 1954.
Lancette GA, Tatini SR. Staphylococcus aureus. In: Vanderzant C, Splittstoesser DF, eds.
Compendium of Methods for the Microbiological Examination of Foods. Washing-
ton, DC: American Public Health Association, 1992, p 533.
Lander KP, Gill KPW. Experimental infection of the bovine udder with Campylobacter
coli/jejuni. J Hyg Camb 84:421, 1980.
Langeveld LPM, van Spronsen WA, van Beresteijn CH, Notermans SHW. Consumption
by healthy adults of pasteurized milk with a high concentration of Bacillus cereus:
a double blind study. J Food Prot 59:723, 1996.
Larsen HD, Jorgensen K. The occurrence of Bacillus cereus in Danish pasteurized milk.
Intern J Food Microbiol 34:179, 1996.
Lecos CW. A closer look at dairy safety. Dairy Food Environ Sanitat 6:240, 1986.
Lee RY, Silverman GJ, Munsey DT. Growth and enterotoxin A production by Staphylo-
coccus aureus in precooked bacon in the intermediate moisture range. J Food Sci
46:1687, 1981.
Lennette EH, Clark WH, Abinanti MA, Brunetti O, Covent JM. Q fever studies—effect
of pasteurization on Coxiella burnetti in naturally infected milk. Am J Hyg 55:246,
1952.
Levine MM. Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic,
enteroinvasive, enterohemorrhagic, and enteroadherent. J Infect Dis 155:377,
1987.
Levine MM, Caplan ES, Waterman D, Cash RA, Hornick RB, Snyder MJ. Diarrhea caused
by Escherichia coli that produce only heat stable enterotoxin. Infect Immun 17:78,
1977.
Levy AJ. A gastro-enteritis outbreak probably due to a bovine strain of Vibrio. Yale J
Biol Med 20:243, 1947.
Levy ME. Gastrointestinal illness associated with imported Brie cheese—District of Co-
lumbia. Morbid Mortal Weekly Rep 32:533, 1983.
LiCari JJ, Potter NN. Salmonella survival during spray drying and subsequent handling
of skim milk powder. II. Effects of drying conditions. J Dairy Sci 52:871, 1970a.
LiCari JJ, Potter NN. Salmonella survival during spray drying and subsequent handling
of skim milk powder. III. Effects of storage temperature on Salmonella and dried
milk products. J Dairy Sci 53:877, 1970b.
Lin S, Schraft H, Odumeru JA, Griffiths MW. Identification of contamination sources of
Bacillus cereus in pasteurized milk. Intern J Food Microbiol 43:159, 1998.
Linnan MJ, Mascola L, Lou XD, Goulet V, May S, Salminen C, Hird DW, Yonkura ML,
Hayes P, Weaver R, Audurier A, Plikaytis BD, Fannin SL, Kleks A, Broome CV.
Epidemic listeriosis associated with Mexican-style cheese. N Engl J Med 319:823,
1988.
Lior H. Campylobacters—epidemiological markers. Dairy Food Environ Sanitat 14:317,
1994a.
Public Health Concerns 527
Lior H. Escherichia coli O157:H7 and verotoxigenic Escherichia coli (VTEC). Dairy Food
Environ Sanitat 14:378, 1994b.
Little CL, Knochel S. Growth and survival of Yersinia enterocolitica, Samonella and Ba-
cillus cereus in Brie stored at 4, 8 and 20°C. Int J Food Microbiol 24:137, 1994.
Logan EF, Neill SD, Mackie DP. Mastitis in dairy cows associated with an aerotolerant
campylobacter. Vet Rec 110:229, 1982.
Logan NA. Bacillus species of medical and veterinary importance. J Med Microbiol 25:
157, 1988.
Lopes HR, Solino Noleto AR, de Las Heras MD, Bergdoll MS. Selective enterotoxin
production in foods by Staphylococcus aureus strains that produce more than one
enterotoxin. J Food Prot 56:538, 1993.
Lopez-Diaz TM, Roman-Blanco C, Garcia-Arias MT, Garcia-Fernandez MC, Garcia-
Lopez ML. Mycotoxins in two Spanish cheese varieties. Intern J Food Microbiol
30:391, 1996.
Lovett J, Francis DW, Hunt JM. Isolation of Campylobacter jejuni from raw milk. Appl
Environ Microbiol 46:459, 1983.
Lovett J, Bradshaw JG, Peeler JT. Thermal inactivation of Yersinia enterocolitica in milk.
Appl Environ Microbiol 44:517, 1982.
Lumsden LL, Leahe JP, Crohurst HR, Waller CE. The Montreal typhoid fever situation—
report of a special board of the U.S. Public Health Service. Am J Public Health
17:783, 1927.
MacDonald KL, Eidson M, Strohmeyer C, Levy ME, Wells JG, Puhr ND, Wachsmuth
K, Hargett NT, Cohen ML. A multistate outbreak of gastrointestinal illness caused
by enterotoxigenic Escherichia coli in imported semisoft cheese. J Infect Dis 151:
716, 1985.
MacDonald KL, Griffin PM. Food-borne disease outbreaks, annual summary, 1982. Mor-
bid Mortal Weekly Rep 35:7ss, 1983.
MacDonald KL, Griffin PM. Foodborne disease outbreaks, annual summary, 1982. Morbid
Mortal Weekly Rep 35(SS-1):7SS, 1986.
MacLachlan J. Salmonellosis in Midlothian and Peeblesshire. Public Health Lond 88:79,
1974.
Maguire H. Continuing hazards from unpasteurized milk products in England and Wales.
Int Food Safety News 2(2):22, 1993.
Maguire H, Cowden J, Jacob M, Rowe B, Roberts D, Bruce J, Mitchell E. An outbreak
of Salmonella dublin infection in England and Wales associated with a soft unpas-
teurized cow’s milk cheese. Epidemiol Infect 109:389, 1992.
Maguire HCF, Boyle M, Lewis MJ, Pankhurst J, Wieneke AA, Jacob M, Bruce J, O’Ma-
hony M. A large outbreak of food poisoning of unknown aetiology associated with
Stilton cheese. Epidemiol Infect 106:497, 1991.
Mantis A, Koidis P, Karaioannoglou P. Survival of Yersinia enterocolitica in yogurt.
Milchwissenschaft 37:654, 1982.
Marier R, Wells JG, Swanson RC, Callahan W, Mehlman IJ. An outbreak of enteropatho-
genic Escherichia coli foodborne disease traced to imported French cheese. Lancet
2:1376, 1973.
Markaki P, Melissari E. Occurrence of aflatoxin M
1
in commercial pasteurized milk deter-
mined with ELISA and HPLC. Food Add Contam 14:451, 1997.
528 Ryser
Marth EH. Salmonellae and salmonellosis associated with milk and milk products: a re-
view. J Dairy Sci 52:283, 1969.
Martin ML, Shipman LD, Wells JG, Potter ME, Hedberg K, Wachsmuth IK, Tauxe RV,
Davis JP, Arnoldi J, Tilleli J. Isolation of Escherichia coli O157:H7 from dairy
cattle associated with two cases of haemolytic uremic syndrome. Lancet 2:1043,
1986.
Massa S, Poda G, Cesaroni D, Trovatelli LD. A bacteriological survey of retail ice cream.
Food Microbiol 6:129, 1989.
Massa S, Altieri C, Quaranta V, Pace R. Survival of Escherichia coli O157:H7 in yogurt
during preparation and storage at 4°C. Lett Appl Microbiol 24:347, 1997.
Massa S, Goffredo E, Altieri C, Natola K. Fate of Escherichia coli O157:H7 in unpasteur-
ized milk stored at 8°C. Lett Appl Microbiol 28:89, 1999.
Matches JR, Liston J. Low temperature growth of Salmonella. J Food Sci 33:641, 1968.
Matuszczyk I, Tarnowska H, Zabicka J, Gut W. An outbreak of milky epidemic of enceph-
alitis caused by tick-borne encephalitis virus in Kielce Province. Prezglad Epide-
miol 51:381, 1997.
McCleery DR, Rowe MT. Development of a selective plating technique for recovery of
Escherichia coli O157:H7 after heat stress. Lett Appl Microbiol 21:252, 1995.
McCloskey RV. Diphtheria. In: Braude AI, Davis CE, Fierer J, eds. Infectious Diseases
and Medical Microbiology, Philadelphia: WB Saunders, p 718, 1986.
McDonough FE, Hargrove RE, Tittsler RP. The fate of salmonellae in the manufacture
of cottage cheese. J Milk Food Technol 30:354, 1967.
McEwen SA, Martin SW, Clarke RC, Tamblyn SE. A prevalence survey of Salmonella
in raw milk in Ontario, 1986–1987. J Food Prot 51:963, 1988.
McKhann GM, Cornblath DR, Griffin JW, Ho TW, Li CY, Jiang Z, Wu HS, Zhaori G,
Liu Y, Jou LP, Liu TC, Gao CY, Mao JY, Blaser MJ, Mishu B, Asbury AK. Acute
motor axonal neuropathy: a frequent cause of acute flaccid paralysis in China. Ann
Neurol 33:333, 1993.
McKinnon CH, Pettipher GL. A survey of sources of heat-resistant bacteria in milk with
particular reference to psychrotrophic spore-forming bacteria. J Dairy Res 50:163,
1983.
McLauchlin JM, Greenwood H, Pini PN. The occurrence of Listeria monocytogenes in
cheese from a manufacturer associated with a case of listeriosis. Int J Food Micro-
biol 3/4:255, 1990.
McManus C, Lanier JM. Salmonella, Campylobacter jejuni, and Yersinia enterocolitica
in raw milk. J Food Prot 50:51, 1987.
McNaughton RD, Leyland R, Mueller L. Outbreak of Campylobacter enteritis due to con-
sumption of raw milk. Can Med Assoc J 126:657, 1982.
Mead PS, Slutsker L, Dietz V, McCaig LF, Bresee JS, Shapiro C, Griffin PM, Tauxe RV.
Food-related illness and death in the United States. Emerg Infect Dis 5:607, 1999.
Meers PD. A case of classical diphtheria and other infections due to Corynebacterium
ulcerans. J Infect 1:139, 1979.
Melling J, Capel BJ, Turnbull PCB, Gilbert RJ. Identification of a novel enterotoxigenic
activity associated with Bacillus cereus. J Clin Pathol 29:938, 1976.
Menzies DB. An outbreak of typhoid fever in Alberta traceable to infected cheddar cheese.
Can J Public Health 35:431, 1944.
Public Health Concerns 529
Metwally MM, El-Sayed AMAA, Mehriz AM, Abu-Sree YH. Sterigmatocystin—inci-
dence, fate and production by A. versicolor in Ras cheese. Mycotoxin Res 13:61,
1997.
Meyer KF, Eddie B. Perspectives concerning botulism. Z Hyg Infektionskr 133:255, 1951.
Meyrand A, Boutrand-Loei S, Ray-Gueniot S, Mazuy C, Gaspard CE, Jaubert G, Perrin
G, Lapeyre C, Vernozy-Rozand C. Growth and enterotoxin production of Staphylo-
coccus aureus during the manufacture and ripening of Camembert-type cheeses
from raw goats’ milk. J Appl Microbiol 85:537, 1998.
Mickelson R, Foltz VD, Martin WH, Hunter CA. The incidence of potentially pathogenic
staphylococci in dairy products at the consumer level. II. Cheese. J Milk Food Tech-
nol 24:342, 1962.
Mikolajcik EM, Kearney JW, Kristoffersen T. Fate of Bacillus cereus in cultured and
direct acidified skim milk and cheddar cheese. J Milk Food Technol 36:317, 1973.
Millar D, Ford J, Sanderson J, Withey S, Tizard M, Doran T, Herman Taylor J. IS900
PCR to detect Mycobacterium paratuberculosis in retail supplies of whole pasteur-
ized cow’s milk in England and Wales. Appl Environ Microbiol 62:3446, 1996.
Minor TE, Marth EH. Staphylococcus aureus and enterotoxin A in cream and butter. J
Dairy Sci 55:1410, 1972.
Mishu B, Blaser MJ. Role of infection due to Campylobacter jejuni in the initiation of
Guillain-Barre′ syndrome. Clin Infect Dis 17:104, 1993.
Mitscherlich E, Marth EH. Microbial Survival in the Environment—Bacteria and Ricket-
tsiae Important in Human and Animal Health. Berlin: Springer-Verlag, 1984.
Moats WA. Inactivation of antibiotics by heating in foods and other substrates—a review.
J Food Prot 51:491, 1988.
Mohammad A, Peiris JSM, Wijewanta EA. Serotypes of verocytotoxigenic Escherichia
coli isolated from cattle and buffalo calf diarrhea. FEMS Microbiol Lett 35:261,
1986.
Montenegro MA, Bulte M, Trumpf T, Aleksic S, Reuter G, Bulling E, Helmuth R. Detec-
tion and characterization of fecal verotoxin-producing Escherichia coli from
healthy cattle. J Clin Microbiol 28:1417, 1990.
Moore K, Damrow T, Abott DO, Jankowski S. Outbreak of acute gastroenteritis attribut-
able to Escherichia coli serotype O104:H21—Helena, Montana, 1994. JAMA 274:
529, 1995.
Morgan D, Gunneberg C, Gunnell D, Healing TD, Lamerton S, Soltanpoor N, Lewis DA,
White DG. An outbreak of Campylobacter infection associated with consumption
of unpasteurized milk at a large festival in England. Eur J Epidemiol 10:581, 1994b.
Morgan D, Mawer SL, Harman PL. The role of home-made ice cream as a vehicle of
Salmonella enteritidis phage type 4 infection from fresh shell eggs. Epidemiol Infect
113:21, 1994a.
Morgan D, Newman CP, Hutchinson DN, Walker AM, Rowe B, Majid F. Verotoxin pro-
ducing Escherichia coli O157 infections associated with consumption of yoghurt.
Epidemiol Infect 111:181, 1993.
Mor-Mur M, Carretero C, Pla R, Guamis B. A survey on the microbiological quality of
a semi-soft on-farm manufactured goat cheese. Food Microbiol 9:345, 1992.
Moustafa MK, Ahmed AA-H, Marth EH. Behavior of virulent Yersinia enterocolitica
during manufacture and storage of Colby-like cheese. J Food Prot 46:318, 1983a.
530 Ryser
Moustafa MK, Ahmed AA-H, Marth EH. Occurrence of Yersinia enterocolitica in raw
and pasteurized milk. J Food Prot 46:276, 1983b.
Moyer NP, Holcomb LA. Brucella. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC,
Yolken RH, eds. Manual of Clinical Microbiology. 6th ed. Washington, DC:ASM
Press, 1995, p 549.
Murray EGD, Webb RA, Swann MBR. A disease of rabbits characterized by a large mono-
nuclear leucocytosis caused by a hitherto undescribed bacillus Bacterium monocyto-
genes (n. sp.). J Pathol Bacteriol 29:407, 1926.
Nachamkin I. Campylobacter and Arcobacter. In: Murray PR, Baron EJ, Pfaller MA,
Tenover FC, Yolken RH, eds. Manual of Clinical Microbiology. 6th ed. Washing-
ton, DC: ASM Press, 1995, p 483.
Naguib MN, Nour MA, Noaman AA. Survival of Staphylococcus aureus in Ras cheese.
Arch Lebensmittelhyg 30:197, 1979.
Neill MA. E. coli O157:H7—current concepts and future prospects. J Food Safety 10:
99, 1989.
Nevin M. Botulism from cheese. J Infect Dis 28:226, 1921.
Nolan CM, Anderson HW, Hoyt DET. Salmonella surveillance pays off. Epilog July/
August 1981. Seattle, WA: Seattle King County Department of Public Health, 1981.
Nolte FS, Metchock B. Mycobacterium. In: Murray PR, Baron EJ, Pfaller MA, Tenover
FC, Yolken RH, eds. Manual of Clinical Microbiology. 6th ed. Washington, DC:
ASM Press, 1995, p 400.
Northolt MD, Beckers HJ, Vecht U, Toepoel L, Soentoro PSS, Wisselink HJ. Listeria
monocytogenes: heat resistance and behavior during storage of milk and whey and
making of Dutch types of cheese. Neth Milk Dairy J 42:207, 1988.
Notermans S, Hoogenboom-Verdegaal A. Existing and emerging foodborne diseases. Int
J Food Microbiol 15:197, 1992.
Nour MA. Survival of Brucella organisms in artificially contaminated cream. Egypt J
Food Sci 10:67, 1982.
Nunez M, Chavarri FJ, Garcia BE, Gaytan LE. The effect of lactic starter inoculation and
storage temperature on the behavior of Staphylococcus aureus and Enterobacter
cloacae in Burgos cheese. Food Microbiol 3:235, 1986.
Obiger G von, Neuschulz J, Schonberg A. Tests made on French cream cheese for possible
exciters of brucellosis and tuberculosis. Ber Mu¨nch tiera¨rzt. Wochenschr 16:318,
1970.
Ocando AJF, Gutierrez DU, Apalmo ZR, Salas LTC, Basanta Y. Microflora isolated from
Venezuelan ‘‘Palmita-type’’ cheese. J Food Prot 54:856, 1991.
Odumeru JA, Toner AK, Muckle CA, Griffiths MW, Lynch JA. Detection of Bacillus
cereus diarrheal enterotoxin in raw and pasteurized milk. J Food Prot 60:1391,
1997.
Oliver SP, Maki JL, Dowlen HH. Antibiotic residues in milk following antimicrobial ther-
apy during lactation. J Food Prot 53:693, 1990.
Olsen JA, Yousef AE, Marth EH. Growth and survival of Listeria monocytogenes during
making and storage of butter. Milchwissenschaft 43:487, 1988.
Olsen SJ, MacKinon CL, Goulding JS, Bean NH, Slutsker L. Surveillance for Food-
borne Disease Outbreaks—United States, 1993–1997. Morbid Mortal Wkly Rep
49(SS01):1, 2000.
Public Health Concerns 531
Olson JC Jr, Sanders AC. Penicillin in milk and milk products: some regulatory and public
health considerations. J Milk Food Technol 38:630, 1975.
Olson JC Jr, Casman EP, Baer EF, Stone JE. Enterotoxigenicity of Staphylococcus aureus
cultures isolated from acute cases of bovine mastitis. Appl Microbiol 20:605, 1970.
Olsvik O, Kapperud G. Enterotoxin production in milk at 22 and 4°CbyEscherichia coli
and Yersinia enterocolitica. Appl Environ Microbiol 43:997, 1982.
O’Mahony M, Mitchell E, Gilbert RJ, Hutchinson DN, Begg NT, Roadhouse JC, Morris
JE. An outbreak of foodborne botulism associated with contaminated hazelnut yo-
gurt. Epidemiol Infect 104:389, 1990.
Orddonez AI, Ibanez FC, Toore P, Barcina Y. Formation of biogenic amines in Idiazabal
ewe’s milk cheese: effect of ripening, pasteurization and starter. J Food Prot 60:
1371, 1997.
Orskov F, Orskov I. Escherichia coli serotyping and disease in man and animals. Can J
Microbiol 38:699, 1992.
Osterholm MT, MacDonald KL, White KE, Wells JG, Spika JS, Potter ME, Forfang JC,
Sorenson RM, Milloy PT, Blake PA. An outbreak of a newly recognized chronic
diarrhea syndrome associated with raw milk consumption. JAMA 256:484, 1986.
Otero A, Garcia MC, Garcia ML, Prieto M, Moreno B. Behavior of Staphylococcus aureus
strains, producers of enterotoxins C
1
or C
2
during the manufacture and storage of
Burgos cheese. J Appl Microbiol 64:117, 1988.
Overcast WW, Atmaram K. The role of Bacillus cereus in sweet curdling of fluid milk.
J Milk Food Technol 37:233, 1974.
Padhye NV, Doyle MP. Rapid procedure for detecting enterohemorrhagic Escherichia
coli O157:H7 in food. Appl Environ Microbiol 57:2693, 1991.
Padhye NV, Doyle MP. Escherichia coli O157:H7 epidemiology, pathogenesis and meth-
ods for detection in food. J Food Prot 55:555, 1992.
Paiba GA, Green LE, Lloyd G, Patel D, Morgan KL. Prevalence of antibodies to Coxiella
burnetii (Q fever) in bulk tank milk in England and Wales. Vet Rec 144:519, 1999.
Papadopoulou C, Maipa V, Dimitriou D, Pappas C, Voutsinas L, Malatou H. Behavior
of Salmonella enteritidis during the manufacture, ripening, and storage of feta
cheese made from unpasteurized ewe’s milk. J Food Prot 56:25, 1993.
Papageorgiou DK, Marth EH. Fate of Listeria monocytogenes during the manufacture and
ripening of blue cheese. J Food Prot 52:459, 1989a.
Papageorgiou DK, Marth EH. Fate of Listeria monocytogenes during the manufacture,
ripening and storage of feta cheese. J Food Prot 52:82, 1989b.
Park, HS and Marth EH. Behavior of Salmonella typhimurium in skimmilk during fermen-
tation by lactic acid bacteria. J Milk Food Technol 35:482, 1972a.
Park HS, Marth EH. Growth of salmonellae in skimmilk which contains antibiotics. J
Milk Food Technol 35:7, 1972b.
Park HS, Marth EH, Goepfert JM, Olson NF. The fate of Salmonella typhimurium in the
manufacture and ripening of low-acid cheddar cheese. J Milk Food Technol 33:
280, 1970a.
Park HS, Marth EH, Olson NF. Survival of Salmonella typhimurium in cold-pack cheese
food during refrigerated storage. J Milk Food Technol 33:383, 1970b.
Park K-Y, Bullerman LB. Increased aflatoxin production by Aspergillus parasiticus under
conditions of cycling temperature. J Food Sci 46:1147, 1981.
532 Ryser
Park K-Y, Bullerman LB. Effects of substrate and temperature on aflatoxin produc-
tion by Aspergillus parasiticus and Aspergillus flavus. J Food Prot 46:178,
1983.
Park WH, Krumwiede C Jr. The relative importance of the bovine and human types of
tubercle bacilli in the different forms of human tuberculosis. J Med Res 25:313,
1911.
Parker F, Hudson NP. The etiology of Haverhill fever (erythema arthriticum epidemicum).
Am J Pathol ii:357, 1926.
Parker MT. Enteric infections: typhoid and paratyphoid fever. In: Smith GR, Easmon CSF,
eds. Topley and Wilson’s Principles of Bacteriology, Virology and Immunity. 8th
ed. Vol 3—Bacterial Diseases. Philadelphia: BC Decker, 1990, p 423.
Parry WH. Milk-borne diseases: an epidemiological review. Lancet i:216, 1966.
Passes H, Glasser D, Flynn J, Acree KH. Bovine tuberculosis—Maryland. Morbid Mortal
Weekly Rep 27:108, 1978.
Patterson DSP, Glancy EM, Roberts BA. The carry-over of aflatoxin M
1
into the milk of
cows fed rations containing a low concentration of aflatoxin B
1
. Food Cosmet Tox-
icol 18:35, 1980.
Patterson WJ, Painter MJ. Bovine spongiform encephalopathy and new variant Creutz-
feldt-Jakob disease: an overview. Comm Dis Pub Health 2:5, 1999.
Pattison J. The emergence of bovine spongiform encephalopathy and related diseases.
Emerg Infect Dis 4:390, 1998.
Patton CM, Wachsmuth IK, Evins GM, Kiehlbauch JA, Plikaytis BD, Troup N, Tompkins
L, Lior H. Evaluation of 10 methods to distinguish epidemic-associated Campylo-
bacter strains. J Clin Microbiol 29:680, 1991.
Pereira ML, Do Carmo LS, Dos Santos EJ, Pereira JL, Bergdoll MS Enterotoxin H in
staphylococcal food poisoning. J Food Prot 59:559, 1996.
Pfeiffer DH, Viljoen NF. Diphtheria and mastitis. J South Afr Vet Med Assoc 16:148,
1945.
Phillips JD, Griffiths MW. Factors contributing to the seasonal variation of Bacillus spp.
in pasteurized dairy products. J Appl Bacteriol 61:275, 1986.
Pietri A, Bertuzzi T, Bertuzzi P, Piva G. Aflatoxin M
1
occurs in samples of Grana padano
cheese. Food Add Contam 14:341, 1997.
Pinegar JA, Buxton JD. An investigation of the bacteriological quality of retail vanilla
slices. J Hyg Camb 78:387, 1977.
Pirttijarvi TSM, Ahonen LM, Maunuksela LM, Salkinoja-Salonen MS. Bacillus cereus
in a whey process. Intern J Food Microbiol 44:31, 1998.
Place AR. Animal drug residues in milk—the problem and the response. Dairy Food
Environ Sanitat 10:662, 1990.
Polewska-Jeske A, Szulc M, Waluszkiewicz H. An epidemic of alimentary poisoning with
ice cream in Szczecin caused by Salmonella typhimurium. Przeg Epidemiol 38:61,
1984.
Pong RS, Wogan GN. Toxicity and biochemical and fine structural effects of synthetic
aflatoxins M
1
and B
1
in rat liver. J Nat Cancer Inst 47:585, 1971.
Porter AMW, Smith EL. Brucellosis and goat’s cheese? BMJ 3:580, 1971.
Porter IA, Reid TMS. A milk-borne outbreak of Campylobacter infection. J Hyg Camb
84:415, 1980.
Public Health Concerns 533
Potel J. Aetilogie der Granulomatosis Infantiseptica. Wiss Z Martin Luther Univ 2:15,
1953/1954.
Potter ME, Blaser MJ, Sikes RK, Kaufmann AF, Wells JG. Human Campylobacter infec-
tion associated with certified raw milk. Am J Epidemiol 117:475, 1983.
Pounder RE. The pathogenesis of Crohn’s disease. Gastroenterology 29(suppl 7):11,
1994.
Pourshafie MR, Saifie M, Shafiee A, Vahdani P, Aslani M, Salemian J. An outbreak of
food-borne botulism associated with contaminated locally made cheese in Iran.
Scand J Infect Dis 30:92, 98.
Price RM. Milk and its relation to tuberculosis. Can Public Health J 25:13, 1934.
Pritchard TJ, Beliveau CM, Flanders KJ, Donnelly CW. Environmental surveillance of
dairy processing plants for the presence of Yersinia species. J Food Prot 58:395,
1995.
Prober CG, Tune B, Hoder L. Yersinia pseudotuberculosis septicemia. Am J Dis Child
133:623, 1979.
Procter ME, Brosch R, Mellen JW, Garrett LA, Kasper CW, Luchansky JB. Use of pulsed-
field gel electrophoresis to link sporadic cases of invasive listeriosis with recalled
chocolate milk. Appl Environ Microbiol 61:3177, 1995.
Pullinger EJ, Kemp AE. Growth of Salmonella typhi and certain other members of the
Salmonella group in milk and butter stored at atmospheric temperatures. J Hyg 38:
587, 1938.
Purvis JD, Morris GC. Report of a food-borne streptococcus outbreak. US Naval Bull 46:
613, 1946.
Quinn J, Keon N, Coohon DB, Scott RM. Bovine tuberculosis—Michigan. Morbid Mortal
Weekly Rep 23:166, 1974.
Raamsaran H, Chen J, Brunke B, Hill A, Griffiths MW. Survival of bioluminescent Liste-
ria monocytogenes and Escherichia coli O157:H7 in soft cheeses. J Dairy Sci 81:
1810, 1998.
Rammel CG. Brucella in dairy products: a review. Austral J Dairy Technol 22:40, 1967.
Rangasamy PN, Iyer M, Roginski H. Isolation and characterization of Bacillus cereus in
milk and dairy products manufactured in Victoria. Austral. J Dairy Technol 48:93,
1993.
Raska K, Helcl J, Jezek J, Kubelka Z, Litov M, Novak K, Radkovsky J, Sery V, Zejdl J,
Zikmund V. A milk-borne infectious hepatitis epidemic. J Hyg Epidemiol Microbiol
Immunol 10:413, 1966.
Ratnam S, March SB. Laboratory studies on Salmonella-contaminated cheese involved
in a major outbreak of gastroenteritis. J Appl Bacteriol 61:51, 1986.
Read RB Jr, Bradshaw JG, Francis DW. Growth and toxin production of Clostridium
botulinum type E in milk. J Dairy Sci 53:1183, 1970.
Reilly WJ, Sharp JCM, Forbes GI, Paterson GM. Milkborne salmonellosis in Scotland
1980 to 1982. Vet Rec 112:578, 1983.
Reitsma CJ, Henning DR. Survival of enteropathogenic Escherichia coli O157:H7 during
the manufacture and curing of cheddar cheese. J Food Prot 59:460, 1996.
Remington JS, McLeod R. Toxoplasmosis. In: Braude AI, Davis CE, Fierer J, eds. Infec-
tious Diseases and Medical Microbiology. 2nd ed. Philadelphia: WB Saunders,
1986, p 1521.
534 Ryser
Renwick SA, Wilson JB, Clark RC, Lior H, Borczyk AA, Spika J, Rahn JK, McFadden
K, Bouwer A, Copps A, Anderson NG, Alves D, Karmali MA. Evidence for direct
transmission of Escherichia coli O157:H7 infection between calves and a human.
J Infect Dis 168:792, 1993.
Rhodehamel EJ, Harmon SM. Bacillus cereus. In: FDA Bacteriological Analytical Man-
ual. 8th ed. Gaithersburg, MD: AOAC International, 1995, p 14.01.
Rich ED, Fellow CE. A typhoid epidemic traced to cheese. Am J Public Health 13:210,
1923.
Richardson GH. Dairy products. In: Helrich K, ed. Official Methods of Analysis of the
Association of Official Analytical Chemists. 15th ed. Arlington, VA: AOAC, 1990,
p 802.
Richwald GA, Greenland S, Johnson BJ, Fruedland JM, Goldstein EJC, Plichta DT. As-
sessment of the excess risk of Salmonella dublin infection associated with the use
of certified raw milk. Public Health Rep 103:489, 1988.
Riemann HP, Meyer ME, Theis JH, Kelso G, Beymer DE. Toxoplasmosis in an infant
fed unpasteurized goat milk. J Pediatr 87:573, 1975.
Riley LW, Remis RS, Helgerson SD, McGee HB, Wells JG, Davis BR, Herbert RJ, Olcott
ES, Johnson LM, Hargrett NT, Blake PA, Cohen ML. Hemorrhagic colitis associ-
ated with a rare Escherichia coli serotype. N Engl J Med 308:681, 1983.
Riordan T, Humphrey TJ, Fowles A. A point source outbreak of Campylobacter infection
related to bird-pecked milk. Epidemiol Infect 110:261, 1993.
Robinson DA. Infectious dose of Campylobacter jejuni in milk. BMJ 282:1584, 1981.
Robinson DA, Jones DM. Milk-borne Campylobacter infection. BMJ 282:1374, 1981.
Robinson DA, Edgar WM, Gibson GL, Matchett AA, Robertson L. Campylobacter
enteritis associated with consumption of unpasteurized milk. Br J Med 1:1171,
1979.
Rodriguez MH, Barrett EL. Changes in microbial population and growth of Bacillus cereus
during storage of reconstituted dry milk. J Food Prot 49:680, 1986.
Rodriguez-Alvarez C, Hardisson A, Alvarez R, Arias A, Sierra A. Enterobacteriaceae in
ice cream sold at retail in Tenerife, Spain. J Food Quality 17:423, 1994.
Rohrbach BW, Draughon FA, Davidson MP, Oliver SP. Prevalence of Listeria monocyto-
genes, Campylobacter jejuni, Yersinia enterocolitica, and Salmonella in bulk tank
milk: risk factors and risk of human exposure. J Food Prot 55:93, 1992.
Romanova TV, Shkarin VV, Khazenson LB. Group cryptosporidiosis morbidity in chil-
dren. Meditsink Parazit Parazitar Bolezni 3:50, 1992.
Rosenau MJ, Frost WD, Bryant R. A study of the butter market of Boston. J Med Res
25:69, 1914.
Rosenow EM, Marth EH. Growth of Listeria monocytogenes in skim, whole and chocolate
milk, and in whipping cream during incubation at 4, 8, 13, 21 and 35°C. J Food
Prot 50:452, 1987.
Rowan, NJ, Anderson JG. Diarrhoeal enterotoxin production by psychrotrophic Bacillus
cereus present in reconstituted milk-based infant formulae (MIF). Lett Appl Micro-
biol 26:161, 1998.
Rowan, NJ, Anderson JG, Anderton A. Bacteriological quality of infant milk formulae
examined under a variety of preparation and storage conditions. J Food Prot 60:
1089, 1997.
Public Health Concerns 535
Rowe B, Begg NT, Hutchinson DN, Dawkins HC, Gilbert RJ, Jacob M, Hales BH, Rae
FA, Jepson M. Salmonella ealing infections associated with consumption of infant
dried milk. Lancet 2:900, 1987.
Ryan CA, Nickels MK, Hargrett-Bean NT, Potter ME, Endo T, Mayer L, Langkop CW,
Gibson C, McDonald RC, Kenney RT, Puhr ND, McDonnell PJ, Martin RJ, Cohen
ML, Blake PA. Massive outbreak of antimicrobial resistant salmonellosis traced to
pasteurized milk. JAMA 258:3269, 1987.
Ryan JL. Bites: P. multocida, DF-2, S. moniliformis, and S. minor. In: Braude Al, Davis
CE, Fierer J, eds. Infectious Diseases and Medical Microbiology. 2nd ed. Philadel-
phia: WB Saunders, 1986, p 1499.
Ryser ET. Incidence and behavior of Listeria in fermented dairy products. In: Ryser ET,
Marth EH, eds. Listeria, Listeriosis and Food Safety. 2nd ed. New York: Marcel
Dekker, 1999c, p 411.
Ryser ET. Incidence and behavior of Listeria in unfermented dairy products. In: Ryser
ET, Marth EH, eds. Listeria, Listeriosis and Food Safety. 2nd ed. New York: Marcel
Dekker, 1999b, p 359.
Ryser ET. Foodborne listeriosis. In: Ryser ET, Marth EH, eds. Listeria, Listeriosis and
Food Safety, 2nd ed. New York: Marcel Dekker, 1999a, p 299.
Ryser ET, Doyle MP, Marth EH. Survival of Listeria monocytogenes during manufacture
and storage of cottage cheese. J Food Prot 48:746, 1985.
Ryser ET, Marth EH. Behavior of Listeria monocytogenes during the manufacture and
ripening of cheddar cheese. J Food Prot 50:7, 1987a.
Ryser ET, Marth EH. Fate of Listeria monocytogenes during manufacture and ripening
of Camembert cheese. J Food Prot 50:372, 1987b.
Ryser ET, Marth EH. Survival of Listeria monocytogenes in cold-pack cheese food during
refrigerated storage. J Food Prot 51:615, 1988a.
Ryser ET, Marth EH. Behavior of Listeria monocytogenes during manufacture and ripen-
ing of brick cheese. J Dairy Sci 72:838, 1988b.
Ryser ET, Marth EH. Listeria, Listeriosis and Food Safety. New York: Marcel Dekker,
1991.
Ryser ET, Marth EH, eds. Listeria, Listeriosis and Food Safety. 2nd ed. New York: Marcel
Dekker, 1999.
Sabbaghian H, Nadim M. Epidemiology of human brucellosis in Isfahan, Iran. J Hyg 73:
221, 1974.
Sabioni JG, Hirooka EY, de Souza MLR. Food poisoning from Minas-type cheese contam-
inated with Staphylococcus aureus. Rev Saude Publ S Paulo 22:458, 1988.
Sacks JJ, Roberto RR, Brooks NF. Toxoplasmosis infection associated with raw goat’s
milk. JAMA 128:1728, 1982.
Sakhre PG, Vyas SH. The incidence of Mycobacterium tuberculosis in milk from clinically
healthy udders of tuberculin positive Kankrej cows. Food Farming Agric 11:260,
1978.
Salama SM, Bolton FJ, Hutchinson DN. Application of a new phage typing scheme to
campylobacters isolated during outbreaks. Epidemiol Infect 104:405, 1990.
Salman MD, Meyer ME. Epidemiology of bovine brucellosis in the Mexicalli Valley,
Mexico: literature review of disease-associated factors. Am J Vet Res 45:1557,
1984.
536 Ryser
Sancak YC, Boynukara B, Yardimci H. The occurrence and survival of Brucella spp. in
Van Herby cheese. Veterinarium 4:1, 1993.
Sanchez-Rey R, Poulett B, Caceres P, Larriba G. Microbiological quality and incidence
of some pathogenic microorganisms in La Serena cheese throughout ripening. J
Food Prot 56:879, 1993.
Sanderson JD, Moss MT, Tizard ML, Hermon-Taylor J. Mycobacterium paratuberculosis
DNA in Crohn’s disease tissue. Gut 33:890, 1992.
Savage WG. Mitchel lecture on human tuberculosis of bovine origin. BMJ 2:905, 1933.
Schaack MM, Marth EH. Behavior of Listeria monocytogenes in skim milk during fermen-
tation with mesophilic lactic acid bacteria starter cultures. J Food Prot 51:600,
1988a.
Schaack MM, Marth EH. Behavior of Listeria monocytogenes in skim milk and in yogurt
mix during fermentation with thermophilic lactic acid bacteria starter cultures. J
Food Prot 51:607, 1988b.
Schiemann DA. Association of Yersinia enterocolitica with the manufacture of cheese
and occurrence in pasteurized milk. Appl Environ Microbiol 36:274, 1978.
Schiemann DA. Yersinia enterocolitica in milk and dairy products. J Dairy Sci 70:383,
1987.
Schiemann DA. Yersinia enterocolitica and Yersinia pseudotuberculosis. In: Doyle MP,
ed. Foodborne Bacterial Pathogens. New York: Marcel Dekker, 1989, p 601.
Schiemann DA, Toma S. Isolation of Yersinia enterocolitica from raw milk. Appl Environ
Microbiol 35:54, 1978.
Schiemann DA, Wauters G. Yersinia. In: Vanderzant C, Splittstoesser DF, eds. Compen-
dium of Methods for the Microbiological Examination of Foods. Washington, DC:
American Public Health Association, 1992, p 433.
Schindler AF. Temperature limits for production of aflatoxin by twenty-five isolates of
Aspergillus flavus and Aspergillus parasiticus. J Food Prot 40:39, 1977.
Schleifstein JI, Coleman MB. An unidentified organism resembling B. ligineri and Past.
pseudotuberculosis, and pathogenic for man. NY State J Med 39:1749, 1939.
Schmitt N, Bowmer EJ, Willoughby BA. Food poisoning outbreak attributed to Bacillus
cereus. Can J Public Health 67:418, 1976.
Schnurrenberger LW, Pate J. Gastroenteritis attributed to imported French cheese—
United States. Morbid Mortal Weekly Rep 20:425, 1971.
Schroeder EC, Brett GW. Public health studies concerning cheese. J Am Vet Med Assoc
5:674, 1918.
Schuman JD, Zottola EA, Harlander SK. Preliminary characterization of a food-borne
multiple-antibiotic-resistant Salmonella typhimurium strain. Appl Environ Micro-
biol 55:2344, 1989.
Schussler JM, Fenves AZ, Sutker WL. Intermittent fever and pancytopenia in a young
Mexican man. Southern. Med J 90:1037, 1997.
Scott PM. Mycotoxigenic fungal contaminants of cheese and other dairy products. In: van
Egmond HP, ed. Mycotoxins in Dairy Products. London: Elsevier Applied Science,
1989, p 193.
Scott PM. Natural poisons—Mycotoxins. In: Helrich K, ed. Official Methods of Analysis
of the Association of Official Analytical Chemists. 15th ed. Arlington, VA: AOAC,
1990, p 1184.
Public Health Concerns 537
Scott WM, Minett FC. Experiments on infection of cows with typhoid bacilli. J Hyg 45:
159, 1947.
Sebald M, Jouglard J, Gilles G. Type B botulism in man due to cheese. Ann Microbiol
Inst Pasteur 125A:349, 1974.
Sedlak J, Present knowledge and aspects of Citrobacter. Curr Topics Microbiol Immunol
62:41, 1973.
Seiber SM, Correa P, Dalgard DW, Adamson RH. Induction of osteogenic sarcomas and
tumors of the hepatobiliary system in non-human primates with aflatoxin B
1
. Cancer
Res 39:4545, 1979.
Serbezov V, Kazar J, Novkirishki, Gatcheva N, Kovacova E, Voynova V. Q fever in
Bulgaria and Slovakia. Emerg Infect Dis 5:388, 1999.
Seyffert WA, Bernard JA. Brucellosis: report of six cases. Texas Med 65:47, 1969.
Shahamat M, Seaman A, Woodbine M. Survival of Listeria monocytogenes in high salt
concentrations. Zbl Bakteriol Hyg I Abt Orig A, 246:506, 1980.
Shanson DC, Gazzard BG, Midgley J, Dixey J, Gibson GL, Stevenson J, Finch RG, Chees-
brough J. Streptococcus moniliformis isolated from blood in four cases of Haverhill
fever. Lancet i:92, 1983.
Sharp JCM. Infections associated with milk and dairy products in Europe and North
America, 1980–85. Bull WHO 65:397, 1987.
Shayegani M, Morse M, DeForge I, Root T, Malmberg Parsons L, Maupin PS. Microbiol-
ogy of a major foodborne outbreak of gastroenteritis caused by Yersinia enterocoli-
tica serogroup O:8. J Clin Microbiol 17:35, 1983.
Shih CN, Marth EH. Experimental production of aflatoxin on brick cheese. J Milk Food
Technol 35:585, 1972.
Simms L, MacRae IC. Survival of Campylobacter jejuni in raw, pasteurized and ultra-
heat-treated goat’s milk stored at different temperatures. Lett Appl Microbiol 8:
177, 1989.
Sims GR, Glenister DA, Brocklehurst TF, Lund BM. Survival and growth of food poison-
ing bacteria following inoculation into cottage cheese varieties. Int J Food Microbiol
9:173, 1989.
Sims JE, Kelley DC, Foltz VD. Effects of time and temperature on salmonellae in inocu-
lated butter. J Milk Food Technol 32:485, 1970.
Singh RS, Ranganathan B. Occurrence of enteropathogenic Escherichia coli serotypes in
milk and milk products. Milchwissenschaft 29:529, 1974.
Sinnhuber RO, Lee DJ, Wales JH, Landers MK, Keyl AC. Hepatic carcinogenesis of
aflatoxin M
1
in rainbow trout (Salmo gairdneri). J Nat Cancer Inst 53:1285, 1974.
Skirrow MB. Campylobacteritis: a ‘‘new’’ disease. BMJ 2:9, 1977.
Slutsker L, Schuchat A. Listeriosis in humans. In: Ryser ET, Marth EH, eds. Listeria,
Listeriosis and Food Safety. 2nd ed. New York: Marcel Dekker, 1999, p 75.
Small RG, Sharp JCM. A milk-borne outbreak due to Salmonella dublin. J Hyg Camb
82:95, 1979.
Smith GR. Botulism. In: Smith GR, Easmon CSF, eds. Topley and Wilson’s Principles
of Bacteriology, Virology and Immunity. 8th ed. Vol 3—Bacterial Diseases. Phila-
delphia: BC Decker, 1990, p 513.
Smith JL. Cryptosporidium and Giardia as agents of foodborne disease. J Food Prot 56:
451, 1993.
538 Ryser
Sneath PHA. Endospore-forming gram-positive rods and cocci. In: Sneath PH, Mair NS,
Sharpe ME, Holt JG, eds. Bergy’s Manual of Systematic Bacteriology. Vol 2. Balti-
more: Williams & Wilkins, 1986, p 1104.
Sockett PN. Communicable disease associated with milk and dairy products: England and
Wales 1987–1989. Commun Dis Rep 1:R-9, 1991.
Sockett PN, Cowden JM, Le Baigue S, Ross D, Adak GK, Evans H. Foodborne disease
surveillance in England and Wales: 1989–1991. Comm Dis Rep 3(12):R159, Nov.
5, 1993.
Solodovnikov IP, Aleksandrovskaia IM. Multiyear observations of the dynamic epidemic
process in sonne dysentery in a small district of Vladimir Province. Zh Mikrobiol
Epidemiol Immunobiol 9–10:41, 1992.
Solomon HM, Rhodehamel EJ, Kautter DA. Clostridium botulinum. In: FDA Bacteriologi-
cal Analytical Manual. 8th ed. Gaithersburg, MD: AOAC International, 1995, p
17.01.
Somers EB, Taylor SL. Antibotulinal effectiveness of nisin in pasteurized process cheese
spreads. J Food Prot 50:842, 1987.
Southern JP, Smith RMM, Palmer SR. Bird attack on milk bottles: Possible mode of
transmission of Campylobacter jejuni to man. Lancet 336:1425, 1990.
Spira WM, Goepfert JM. Bacillus cereus—induced fluid accumulation in rabbit illeal
loops. Appl Microbiol 24:341, 1972.
Spolaor D. A microbial agent in the limelight: Clostridium botulinum. Informatore Agrario
52:45, 1996.
Stadhouders J, Cordes MM, van Schouwenburg-van Foeken AWJ. The effect of manufac-
turing conditions on the development of staphylococci in cheese. Their inhibition
by starter bacteria. Neth Milk Dairy J 32:193, 1978.
Stadhouders J, Hup G, Langeveld LPM. Some observations on the germination, heat resis-
tance and outgrowth of fast-germinating and slow-germinating spores of Bacillus
cereus in pasteurized milk. Neth Milk Dairy J 34:215, 1980.
Stadler H, Isler R, Stutz W, Salfinger M, Lauwers S, Vischer W. Beitrag zur Epidemiologie
von Campylobacter jejuni von der asymptomatischen Ausscheidung im Stall zur
Erkrankung bei u¨ber 500 Personen. Schweiz med Wschr 7:245, 1983.
Stahl S. Tuberculosis infection due to milk. Am J Public Health 29:1154, 1939.
Stanfield JT, Jackson GJ, Aulisio CCG. Yersinia enterocolitica: survival of a pathogenic
strain on milk containers. J Food Prot 48:947, 1985.
Stecchini ML, Sarais I, de Bertoldi M. The influence of Lactobacillus plantarum culture
inoculation on the fate of Staphylococcus aureus and Salmonella typhimurium in
Montasio cheese. Int J Food Microbiol 14:99, 1991.
Steede FDF, Smith HW. Staphylococcal food-poisoning due to infected cow’s milk. BMJ
2:576, 1954.
Steele JH, Ranney AF. Animal tuberculosis. Am Rev Tuberc 77:908, 1958.
Steele BT, Murphy N, Arbus GS, Rance CP. An outbreak of hemolytic uremic syndrome
associated with ingestion of fresh apple juice. J Pediatr 101:963, 1982.
Steele ML, McNab WB, Poppe C, Griffiths MW, Chen S, Degrandis SA, Fruhner LC,
Larkin CA, Lynch JA, Odumeru JA. Survey of Ontario bulk tank milk raw milk
for food-borne pathogens. J Food Prot 60:1341, 1997.
Steere AC, Craven PJ, Hall WJ III, Leotsakis N, Wells JG, Farmer JJ III, Gangarosa EJ.
Public Health Concerns 539
Person-to-person spread of Salmonella typhimurium after a hospital common-
source outbreak. Lancet i:319, 1975.
Stern NJ, Pierson MD Kotula AW. Growth and competitive nature of Yersinia entero-
colitica in whole milk. J Food Sci 45:972, 1980.
Stern NJ, Kazmi SU. Less recognized and presumptive foodborne pathogenic bacteria. In:
Doyle MP, ed. Foodborne Bacterial Pathogens. New York: Marcel Dekker, 1989,
p 71.
Stern NJ, Patton CM, Doyle MP, Park CE, McCardell BA. Campylobacter. In: Vanderzant
C, Splittstoesser DF, eds. Compendium of Methods for the Microbiological Ex-
amination of Foods. Washington, DC: American Public Health Association, 1992,
p 475.
Stevens AJ, Saunders CN, Spence JB, Newnham AG. Investigation into ‘‘disease’’ of
turkey poults. Vet Rec 72:627, 1960.
Stewart J, Sufi F, McNulty C, Park P. Outbreak of Campylobacter enteritis in a residential
school associated with bird pecked bottle tops. Commun Dis Rep CDR Rev 7:R38,
1997.
Stiles ME. Less recognized or presumptive foodborne pathogenic bacteria. In: Doyle MP,
ed. Foodborne Bacterial Pathogens. New York: Marcel Dekker, 1989, p 673.
Stoloff L. Aflatoxin M
1
in perspective. J Food Prot 43:226, 1980.
Stone RV. Staphylococci food-poisoning and dairy products. J Milk Technol 6:7, 1943.
Stratton JE, Hutkins RW, Taylor SL. Biogenic amines in cheese and other fermented
foods: a review. J Food Prot 54:460, 1991.
Street L Jr, Grant WW, Alva JD. Brucellosis in childhood. Pediatr 55:416, 1975.
Stubblefield RD, Shannon GM. Aflatoxin M
1
: Analysis in dairy products and distribu-
tion in dairy foods made from artificially contaminated milk. JAOAC 57:847,
1974.
Stubblefield RD, van Egmond HP. Chromatographic methods of analysis for aflatoxin M
1
.
In: van Egmond HP, ed. Mycotoxins in Dairy Products. London: Elsevier Applied
Science, 1989, p 57.
Styliadis S, Barnum D. Salmonella Infection in Man and Animals in the Province of On-
tario. In: Proceedings of the International Symposium of Salmonella, New Orleans,
LA, 1984, p 200.
Su, Y-C, Wong ACL. Identification and purification of a new staphylococcal enterotoxin
H. Appl Environ Microbiol 61:1438, 1995.
Suchowiak T, Haiat Z. Milk-spread Salmonella enteritis epidemic in the Wroclaw province
in June 1978. Przeg Epidemiol 34:325, 1980.
Sumner SS, Roche F, Taylor SL. Factors controlling histamine production in Swiss cheese
inoculated with Lactobacillus buchneri. J Dairy Sci 73:3050, 1990.
Sumner SS, Speckhard MW, Somers EB, Taylor SL. Isolation of histamine-producing
Lactobacillus buchneri from Swiss cheese implicated in a food poisoning outbreak.
Appl Environ Microbiol 50:1094, 1985.
Sun P, Chu FS. A simple solid-phase radioimmunoassay for aflatoxin B
1
. J Food Safety
1:67, 1977.
Sung N, Collins MT. Thermal tolerance of Mycobacterium paratuberculosis. Appl Envi-
ron Microbiol 64:999, 1998.
Swaminathan B, Rocourt J, Bille J. Listeria, identification of foodborne bacterial patho-
540 Ryser
gens by gene probes. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken
RH, eds. Manual of Clinical Microbiology 6th ed. Washington, DC: ASM Press,
1995, p 341.
Sweeney RW, Whitlock RH, Rosenberger AE. Mycobacterium paratuberculosis cultured
from milk and supramammary lymph nodes of infected asymptomatic cows. J Clin
Microbiol 30:166, 1992.
Tacket CO, Davis BR, Carter GP, Randolph JF, Cohen ML. Yersinia enterocolitica phar-
yngitis. Ann Intern Med 99:40, 1983.
Tacket CO, Narain JP, Sattin R, Lofgren JP, Konigsberg C, Rendtorff RC, Rausa A, Davis
BR, Cohen ML. A multistate outbreak of infections caused by Yersinia enterocoli-
tica transmitted by pasteurized milk. JAMA 251:483, 1984.
Tan L, Williams MA, Khan MK, Champion HC, Nielsen NH. Risk of transmission of
bovine spongiform encephalopathy to humans in the United States: report of the
Council on Scientific Affairs. AMA. JAMA 281:2330, 1999.
Tanaka N, Goepfert JM, Traisman E, Hoffbeck WM. A challenge of pasteurized pro-
cess cheese spread with Clostridium botulinum spores. J Food Prot 42:787,
1979.
Tanaka N, Traisman E, Plantinga P, Finn L, Flom W, Meske L, Guggisberg J. Evaluation
of factors involved in antibotulinal properties of pasteurized process cheese spreads.
J Food Prot 49:526, 1986.
Tarala J. Some observations on bovine brucellosis, its eradication and its relation to undu-
lant fever. State Vet J 24:220, 1969.
Tatini SR, Wesala WD, Jezeski JJ, Morris HA. Production of staphylococcal enterotoxin
A in blue, brick, mozzarella, and Swiss cheese. J Dairy Sci 56:429, 1973.
Taylor A Jr, Santiago A, Gonzalez-Cortes A, Gangarosa EJ. Outbreak of typhoid fever
in Trinidad in 1971 traced to a commercial ice cream product. Am J Epidemiol
100:150, 1974.
Taylor DN. Campylobacter infections in developing countries. In: Nachamkin I, Blaser
NJ, Tompkins LS, eds. Campylobacter jejuni: Current Status and Future Trends.
Washington, DC: American Society of Microbiology, 1992, p 20.
Taylor DN, Porter BW, Williams CA, Miller HG, Bopp CA, Blake PA. Campylobacter
enteritis: a large outbreak traced to commercial raw milk. West J Med 137:365,
1982a.
Taylor PR, Weinstein WM, Bryner JH. Campylobacter fetus infection in human subjects:
association with raw milk. Am J Med 66:779, 1979.
Taylor SL. Histamine poisoning associated with fish, cheese and other foods. Monograph
WHO, 1985.
Taylor SL. Histamine food poisoning: toxicology and clinical aspects. Crit Rev Toxicol
17:91, 1986.
Taylor SL, Keefe TJ, Windham ES, Howell JF. Outbreak of histamine poisoning associ-
ated with the consumption of Swiss cheese. J Food Prot 45:455, 1982b.
Taylor TK, Wilks CR, McQueen DS. Isolation of Mycobacterium paratuberculosis from
the milk of a cow with Johne’s disease. Vet Rec 109:532, 1981.
Teclaw RF, Heck H, Wagner GG, Romo S, Garcia Z. Prevalence of brucellosis infection
in cattle in the Mexican state of Nuevo Leon, Tamaulipas and Coahvila as deter-
mined by the ELISA. Prev Vet Med 3:445, 1985.
Public Health Concerns 541
Terhune C, Sazi E, Kalishman N, Bobst J, Bonnlander B, Googins JA, Williams P. Raw-
milk-associated illness—Oregon, California. Morbid Mortal Weekly Rep 30:90,
1981.
Ter Steeg PF, Cuppers HGAM. Growth of proteolytic Clostridium botulinum in process
cheese products: II. Predictive modeling. J Food Prot 58:1100, 1995.
Ter Steeg PF, Cuppers HGAM, Hellemons JC, Rijke G. Growth of proteolytic Clostridium
botulinum in process cheese products:I. Data acquisition for modeling the influence
of pH, sodium chloride, emulsifying salts, dry fat basis and temperature. J Food
Prot 58:1091, 1995.
Tham W. Survival of Listeria monocytogenes in cheese made of unpasteurized goat milk.
Acta Vet Scand 29:165, 1988.
Thapar MK, Young EJ. Urban outbreak of goat cheese brucellosis. Pediatr Infect Dis 5:
640, 1986.
Tibana A, Barbosa Warnken M, Paiva Nunes M, Delgado Ricciardi I, Solino Noleto AL.
Occurrence of Yersinia species in raw and pasteurized milk in Rio de Janeiro, Bra-
zil. J Food Prot 50:580, 1987.
Todd E, Szabo R, Robern H, Gleeson T, Park C, Clark DS. Variation in counts, enterotoxin
levels and Tnase in Swiss-type cheese contaminated with Staphylococcus aureus.
J Food Prot 44:939, 1981.
Toora S, Budu-Amoako E, Ablett RF, Smith J. Effect of high-temperature short-time pas-
teurization, freezing and thawing and constant freezing, on the survival of Yersinia
enterocolitica in milk. J Food Prot 55:803, 1992.
Tornadijo E, Fresno JM, Carballo J, Martin-Sarmiento R. Study of Enterobacteriaceae
throughout the manufacturing and ripening of hard goat’s cheese. J Appl Bacteriol
75:240, 1993.
Townes JM, Cieslak PR, Hatheway CL, Solomon HM, Holloway JT, Baker MP, Keller
CF, McCroskey LM, Griffith PM. An outbreak of type A botulism associated with
a commercial cheese sauce. Ann Intern Med 125:558, 1996.
Tschape H, Prager R, Steckel W, Fruth A, Tietze E, Bohme G. Verotoxigenic Citrobacter
freundii associated with severe gastroenteritis and cases of haemolytic uraemic syn-
drome in a nursery school: green butter as the infection source. Epidemiol Infect
114:441, 1995.
Tsen H-Y, Chi W-R, Lin C-K. Use of novel polymerase chain reaction primers for the
specific detection of heat-labile toxin I, heat-stable toxin I and II enterotoxigenic
Escherichia coli in milk. J Food Prot 59:795, 1996.
Tucker CB, Fulkerson GC, Neudecker RM. A milk-borne outbreak of shigellosis in Madi-
son County, Tenn. Public Health Rep 69:432, 1954.
Tulloch FE, Ryan KJ, Formal SB, Franklin FA. Invasive enteropathogenic Escherichia
coli—an outbreak in 28 adults. Ann Intern Med 79:13, 1973.
Turck WPG. Q fever. In: Braude AI, Davis CE, Fierer J, eds. Infectious Diseases and
Medical Microbiology. 2nd ed. Philadelphia: WB Saunders, 1986, p 810.
Tzipori S. Cryptosporidiosis in animals and humans. Microbiol Rev 47:84, 1983.
Ueno Y. The toxicology of mycotoxins. CRC Crit Rev Toxicol 14:99, 1985.
Uragoda CG, Lodha SC. Histamine intoxication in a tuberculosis patient after ingestion
of cheese. Tubercle 60:56, 1979.
Valkenburg HA. Streptococcal pharyngitis and tonsillitis. In: Braude AI, Davis CE, Fierer
542 Ryser
J, eds. Infectious Diseases and Medical Microbiology. 2nd ed. Philadelphia: WB
Saunders, 1986, p 715.
Valsanen OM, Mwaisumo NJ, Salkinoja-Salonen MS Differentiation of dairy strains of
the Bacillus cereus group by phage typing, minimum growth temperature, and fatty
acid analysis. J Appl Bacteriol 70:315, 1991.
Van den Heever LW. Tuberculosis in milch goats. J South Afr Vet Assoc 55:219, 1984.
van Egmond HP. Introduction. In: van Egmond HP, ed. Mycotoxins in Dairy Products.
London: Elsevier Applied Science, 1989a, p 1.
van Egmond HP. Aflatoxin M
1
: Occurrence, toxicity, regulation. In: van Egmond HP,
ed. Mycotoxins in Dairy Products. London: Elsevier Applied Science, 1989b,
p 11.
van Netten P, van de Moosdijk A, van Hoensel P. Psychrotrophic strains of Bacillus cereus
producing enterotoxin. J Appl Bacteriol 69:73, 1990.
Varadaraj MC, Nambudripad VKN. Growth and production of thermostable deoxyribonu-
clease and enterotoxin by Staphylococcus aureus in milk. Milchwissenschaft 38:
23, 1983.
Vasenin AA, Kogan VM, Nekipelova GA, Leonov VA, Gerasimova LF. Epidemiological
characteristics of tick-borne encephalitis foci in traditional landscapes of Pribaik-
alia. Med Parazit Paravit Bol 44:56, 1975.
Vazquez BI, Fente C, Franco CM, Quinto E, Cepeda A, Prognon P. Rapid semi-quantita-
tive fluorimetric determination of citrinin in fungal cultures. Lett Appl Microbiol
24:3397, 1997.
Vazquez BI, Fente C, Quinto E, Franco CM, Rodriguez JL, Cepeda A, Belda BV, Sampayo
CAF, Fernandez EQ, Abuin CF, Otero JLR, Saez AC. Incidence of toxigenic
moulds in farm-level cheesemaking units from Arzua (La Coruna, Spain). Food Sci
Technol Intern 1:91, 1995.
Veldman A, Meijs JAC, Borggreve GJ, Heeres-van-der-Tol JJ. Carry-over of aflatoxin
from cow’s food to milk. Animal Prod 55:163, 1992.
Villar RG, Macek MD, Simons S, Hayes PS, Goldoft MJ, Lewis JH, Rowan LL, Hursh
D, Patnode M, Mead PS. Investigation of multidrug-resistant Salmonella serotype
Typhimurium DT104 infections linked to raw milk cheese in Washington state.
JAMA 281:1811, 1999.
Vidon DJM, Delmas CL. Incidence of Yersinia enterocolitica in raw milk in eastern
France. Appl Environ Microbiol 41:355, 1981.
Vogt T, Hasler P. A woman with panic attacks and double vision who liked cheese. Lancet
354:300, 1999.
Vogt RL, Little AA, Patton CM, Barrett TJ, Orciari LA. Serotyping and serology studies
of campylobacteriosis associated with consumption of raw milk. J Clin Microbiol
20:998, 1984.
Vought KJ, Tatini SR. Salmonella enteritidis contamination of ice cream associated with
a 1994 multistate outbreak. J Food Prot 61:5, 1998.
Wachsmuth K, Morris GK. Shigella. In: Doyle MP, ed. Foodborne Bacterial Pathogens.
New York: Marcel Dekker, 1989, p 447.
Wade EM, Shere L. Longevity of typhoid bacilli in cheddar cheese—a study follow-
ing an outbreak of typhoid fever traced to cheese. Am J Public Health 18:1480,
1928.
Public Health Concerns 543
Wagenaar RO, Dack GM. Factors influencing growth and toxin production in cheese inoc-
ulated with spores of Clostridium botulinum types A and B. I. Studies with surface-
ripened cheese type I. J Dairy Sci 41:1182, 1958a.
Wagenaar RO, Dack GM. Factors influencing growth and toxin production in cheese inoc-
ulated with spores of Clostridium botulinum types A and B. II. Studies with surface-
ripened cheese type II. J Dairy Sci 41:1191, 1958b.
Wagenaar RO, Dack GM. Factors influencing growth and toxin production in cheese inoc-
ulated with spores of Clostridium botulinum types A and B. III. Studies with sur-
face-ripened cheese type III. J Dairy Sci 41:1196, 1958c.
Walker SJ, Gilmour A. The incidence of Yersinia enterocolitica and Yersinia enterocoli-
tica-like organisms in raw and pasteurized milk in Northern Ireland. J Appl Bacte-
riol 61:133, 1986.
Wallach JC, Miguel SE, Baldi PC, Guarnera E, Goldbaum FA, Fossati CA. Urban outbreak
of a Brucella melintensis infection in an Argentine family: clinical and diagnostic
aspects. Immun Med Microbiol 8:49, 1994.
Wallach JC, Samartino LE, Efron A, Baldi C. Human infection by Brucella melitensis:
an outbreak attributed to contact with infected goats. FEMS Immunol Med Micro-
biol 19:315, 1997.
Wang G, Zhao T, Doyle MP. Survival and growth of Escherichia coli O157:H7 in unpas-
teurized and pasteurized milk. J Food Prot 60:610, 1997.
Warburton DW, Peterkin PI, Weiss KF. A survey of the microbiological quality of pro-
cessed cheese products. J Food Prot 49:229, 1986.
Waterman SC. The heat sensitivity of Campylobacter jejuni in milk. J Hyg Camb 88:529,
1982.
Weagant SD, Bryant JL, Jinneman KG. An improved rapid technique for isolation of
Escherichia coli O157:H7 from foods. J Food Prot 58:7, 1995.
Weagant SD, Feng P, Stanfield JT. Yersinia enterocolitica and Yersinia pseudotuberculo-
sis. In: FDA Bacteriological Analytical Manual. 8th ed. Gaithersburg, MD: AOAC
International, 1998, p 8.01.
Weed LA, Michael AC, Harger RN. Fatal Staphylococcus intoxication from goat milk.
Am J Public Health 33:1314, 1943.
Wegmuller B, Luthy J, Candrain U. Direct polymerase chain reaction detection of Campy-
lobacter jejuni and Campylobacter coli in raw milk and dairy products. Appl Envi-
ron Microbiol 59:2161, 1993.
Weissman JB, Deen RMAD, Williams M, Swanston N, Ali S. An island-wide epidemic
of salmonellosis traced to contaminated powdered milk. West Indian Med J 26:
135, 1977.
Wells JG, Davis BR, Wachsmuth IK, Riley LW, Remis RS, Sokolow R, Morris GK.
Laboratory investigation of hemorrhagic colitis outbreaks associated with a rare
Escherichia coli serotype. J Clin Microbiol 18:512, 1983.
Wells JG, Shipman LD, Greene KD, Sowers EG, Green JH, Cameron DN, Downes FP,
Martin ML, Griffin PM, Ostroff SM, Potter ME, Tauxe RV, Wachsmuth IK. Isola-
tion of Escherichia coli serotype O157:H7 and other shiga-like-toxin-producing E.
coli from dairy cattle. J Clin Microbiol 29:985, 1991.
Werner SB, Humphrey BL, Kamei I. Association between raw milk and human Salmonella
dublin infection. BMJ 2:238, 1979.
544 Ryser
White CH, Custer EW. Survival of Salmonella in cheddar cheese. J Milk Food Technol
39:328, 1976.
Wieneke AA, Roberts D, Gilbert RJ. Staphylococcal food poisoning in the United King-
dom, 1969–1990. Epidemiol Infect 110:519, 1993.
Wilkins EGL, Griffiths R, Roberts C. Guinea-pig inoculation for Mycobacterium bovis—
Is it still necessary? Tubercle 68:311, 1987.
Williams RC, Bodnaurk PW, Golden DA. Survival of Yersinia enterocolitica during fer-
mentation and storage of yogurt (abstr). Annual Meeting of the Institute of Food
Technologists, New Orleans, LA, June 22–25, 1996.
Wilson CD, Richards MS. A survey of mastitis in the British dairy herd. Vet Rec 107:
431, 1980.
Wilson GS. The necessity for a safe milk supply. Lancet 2:829, 1933.
Wisniewski HJ, Krumbiegel ER. Q fever in the Milwaukee area—I. Q fever in Milwaukee
area cattle. Arch Environ Health 21:58, 1970a.
Wisniewski HJ, Krumbiegel ER. Q fever in Milwaukee—III. Epidemiological studies of
Q fever in humans. Arch Environ Health 21:66, 1970b.
Wogan GN, Edwards GS, Newberne PM. Structure—activity relationship in toxicity and
carcinogenicity of aflatoxins and analogs. Cancer Res 31:1936, 1971.
Wolf FS, Floyd C, Carden W, Brown L, Armes WH. Staphylococcal food poisoning traced
to butter—Alabama. Morbid Mortal Weekly Rep 19:271, 1970.
Wong H-C, Chang MH, Fan JY. Incidence and characterization of Bacillus cereus isolates
contaminating dairy products. Appl Environ Microbiol 54:699, 1988.
Wood DS, Collins-Thompson DL, Irvine DM, Myhr AN. Source and persistence of
Salmonella muenster in naturally contaminated cheddar cheese. J Food Prot 47:20,
1984.
Wood RC, MacDonald KL, Osterholm MT. Campylobacter enteritis outbreaks associated
with drinking raw milk during youth activities: a 10-year review of outbreaks in
the United States. JAMA 268:3228, 1992.
Woodward WE, Gangarosa EJ, Brachman PS, Curlin GT. Foodborne disease surveillance
in the United States, 1966 and 1967. Am J Public Health 60:130, 1970.
Wright EP, Tillhet HE. Milk-borne Campylobacter enteritis in a rural area. J Hyg Camb
91:227, 1983.
Wuethrich B. Back on the farm: stopping E. coli O157:H7 at its source. ASM News 60:
409, 1994.
Wundt W, Schnittenhelm P. The behavior of salmonellae and staphylococci in cooled
foods. Arch Hyg Bakteriol 149:567, 1965.
Wyatt CJ, Timm EM. Occurrence and survival of Campylobacter jejuni in milk and turkey.
J Food Prot 45:1218, 1982.
Young EJ. Human brucellosis. Rev Infect Dis 5:821, 1983.
Young EJ. Health issues at the US-Mexican border. JAMA 265:2066, 1991a.
Young EJ. Serologic diagnosis of human brucellosis: analysis of 214 cases by agglutina-
tion tests and review of the literature. Rev Infect Dis 13:359, 1991b.
Young EJ, Suvannoparrat U. Brucellosis outbreak attributed to ingestion of unpasteurized
goat cheese. Arch Intern Med 135:240, 1975.
Yousef AE, Marth EH. Degradation of aflatoxin M
1
in milk by ultraviolet energy. J Food
Prot 48:697, 1985.
Public Health Concerns 545
Yousef AE, Marth EH. Use of ultraviolet energy to degrade aflatoxin M
1
in raw or heated
milk with or without added peroxide. J Dairy Sci 69:2243, 1986.
Yousef AE, Marth EH. Behavior of Listeria monocytogenes during the manufacture and
storage of Colby cheese. J Food Prot 51:12, 1988.
Yousef AE, Marth EH. Stability and degradation of aflatoxin M
1
. In: van Egmond HP,
ed. Mycotoxins in Dairy Products. London: Elsevier Applied Science, 1989, p 127.
Yousef AE, Marth EH. Fate of Listeria monocytogenes during the manufacture and ripen-
ing of Parmesan cheese. J Dairy Sci 73:3351, 1990.
Zanini MS, Moreira EC, Lopes MT, Mota P, Salas CE. Detection of Mycobacterium bovis
in milk by polymerase chain reaction. J Vet Med Ser B 45:473, 1998.
Zehren VL, Zehren VF. Examination of large quantities of cheese for staphylococcal en-
terotoxin A. J Dairy Sci 51:635, 1968a.
Zehren VL, Zehren VF. Relation of acid development during the cheesemaking process
and development of staphylococcal enterotoxin. J Dairy Sci 51:645, 1968b.
Zottola EA, Jezeski JJ, Al-Dulaimi AN. Effect of short-time subpasteurization treatments
on the destruction of Staphylococcus aureus in milk for cheese manufacture. J Dairy
Sci 52:1707, 1969.
14
Cleaning and Sanitizing in Milk
Production and Processing
Bruce R. Cords, George R. Dychdala, and Francis L. Richter
Ecolab, Inc.
St. Paul, Minnesota
I. INTRODUCTION
All food and dairy products are handled in plants that have modern processing
equipment, utensils, and other auxiliary parts that must be cleaned and sanitized
to produce food products that are safe for human consumption. Progressively
automated cleaning systems have been developed to replace old and less efficient
ones to increase productivity, provide safe working environments and, above
all, guarantee safe and wholesome products for consumers. Good cleaning and
sanitizing of food processing equipment is essential to assure safe food products
with extended shelf life.
There are many different cleaners and sanitizers on the market, but in the
food and dairy industries, there are only a few products that are permitted for
use. For many years, the dairy industry has been the leader in developing sanita-
tion standards and practices. This was done because of pronouncements by the
U.S. Public Health Service that milk and milk products can be a potential major
cause of infection and disease. Foodborne disease is very serious and can reach
epidemic proportions. To eliminate dangers of an epidemic or costly recalls re-
sulting from unsanitary conditions of milk and milk products, strict cleaning and
sanitizing procedures must be observed throughout milk processing and packag-
ing operations. This applies not only to milk products but also to other foods and
beverages as well. To do this, chemical cleaners and sanitizers are available for
use on equipment, utensils, and other food contact surfaces. Cleaning of the
equipment surface represents the first step in sanitation to remove soils or films
547
548 Cords et al.
that may harbor bacteria. Once the surface is clean, use of a sanitizer will com-
plete the procedure. Good cleaning and sanitizing of food processing equipment
is essential to produce high-quality food products that are safe and palatable for
consumers.
II. PROCESS OF CLEANING
Five factors are involved with the practice of cleaning. These are (a) nature of
soils, (b) water, (c) surfaces, (d) methods of application, and (e) environmental
concerns.
A. Nature of Soils
A soil may be defined as unwanted material present on the surface of equipment
or utensils that must be removed. After production of a food, most equipment is
soiled and must be cleaned and sanitized to be prepared for subsequent production
of the food. Soils are classified into two groups: visible and invisible. Soils vary
in composition, necessitating a variety of cleaners that will dissolve, suspend,
and remove any of these combinations. The choice of cleaner depends on the
soil component that is most difficult to remove.
Soils or deposits must be removed and surfaces sanitized by selected clean-
ing and sanitizing procedures. Soil removal is best achieved by a combination
of chemical, thermal, and mechanical action. Wetting, penetration, solvency,
emulsification, saponification, and hydrolysis are some examples of chemical ac-
tivity. Turbulent flow, pressure spraying, and scrubbing are examples of mechani-
cal action. The major soil components of dairy and food products are lipids,
proteins, carbohydrates, and mineral deposits.
1. Lipids
Lipids present in milk and milk products are best removed with alkalis that con-
tain a synthetic detergent with emulsifying and suspending properties. Before a
detergent is used, the temperature must be raised above the melting point of fat.
Water above 55°C will melt fat. An alkaline detergent is then needed to emulsify,
and suspend the fat to remove it from equipment.
2. Proteins
Proteins are usually the most difficult of food soils to remove, especially if they
have been heated or dried, because these processes cause some denaturation to
insoluble forms. A combination of alkali and a source of chlorine can remove
proteins. This combination peptizes the protein into smaller, more soluble sub-
Sanitizing in Milk Production 549
units. Some proteins can be solubilized by highly acidic solutions. A detergent
containing a proteolytic enzyme may be used effectively in removing protein.
Depending upon the type of protease (acid or alkaline), these formulations are in
the pH range of 5–9. Hydrogen peroxide may be added as a booster for removing
proteins; however, it is much slower in action and not as effective as chlorine.
3. Carbohydrates
Carbohydrates of low molecular weight are easily soluble in water and do not
require special treatment. However, if they are burned on a hot surface (caramel-
ized) or are present as higher polysaccharides, oxidizing agents are needed to
break the molecules into smaller, more soluble components. Such oxidizers may
be hypochlorite-based products or oxygen-releasing compounds such as perbo-
rate, percarbonate, and hydrogen peroxide. The choice will depend on cleaning
conditions and materials involved.
The carbohydrates more difficult to clean from an equipment surface are
polysaccharides such as starches. When starches are processed at elevated tem-
peratures, they may become gelatinous and thus difficult to remove. If this condi-
tion exists, an acid cleaner may be a better choice. Polysaccharides may also be
hydrolyzed by specific enzymes such as amylase or other carbohydrases de-
pending upon soil composition.
4. Mineral Salts
Mineral salt deposits accumulate by precipitation from water, food, or a combina-
tion of both. For example, the calcium content of milk products and water hard-
ness can form adherent white deposits known as milkstone. Milkstone is com-
posed of these food-mineral deposits and can be effectively removed by acids.
Iron and manganese present in water are objectionable and may be responsible
for colored deposits ranging from black-brown to purple. Periodic acid washes
or rinses are typically used after an alkaline wash to control mineral deposits. In
less severe instances, these salt deposits can be dissolved by use of alkaline clean-
ers containing chelating or sequestering agents.
5. Other Soils
Other soils that may be found in dairy equipment are the food additive titanium
dioxide and materials found in water such as clay or sand. These are inert materi-
als, not soluble in either acids or alkaline products, but may be removed from
equipment by erosion and turbulence generated by a rapid flow; newer cleaning
compositions utilizing peracids and surfactants are being used in this application.
Burned food soils that are charred, polymerized, caramelized, or carbonized can
be removed from equipment with strongly formulated alkaline cleaners used at
550 Cords et al.
high temperatures and requiring longer times to be effective. Also, equipment
that is exposed to strong caustic detergent and high temperature may develop
darkening of stainless steel surfaces, which is impossible to eliminate with con-
ventional cleaners. Products are available which restore the surface to the original
appearance of stainless steel.
6. Water
Water is the most important ingredient in cleaning and sanitizing solutions. The
food and dairy industries require large quantities of high-quality water for direct
addition to foods and beverages as well as for cleaning and sanitizing. Some
waters must undergo treatment processes to minimize or eliminate impurities
(Table 1) before being used in food and dairy processing plants. Typical objec-
tionable components of water include water hardness/minerals, microorganisms,
and other impurities. Some of these impurities may adversely affect cleaners and
sanitizers and must be eliminated or reduced to acceptable levels (Table 2).
a. Water Hardness More than any other chemical property of water, hard-
ness directly affects cleaning and sanitizing. It may affect performance and con-
sumption of a cleaner or sanitizer. Poor water quality may also lead to formation
of films or deposits.
Water hardnessexists intwo different forms:temporary andpermanent. Tem-
porary hardness occurs when calcium and magnesium ions exist in water as bicar-
bonates. They are soluble and when heated will form carbonates and precipitate.
When calcium and magnesium ions appear as chloride, nitrate, or sulfate salts,
permanent hardness results. These salts are soluble and are not affected by changes
Table 1 Typical Impurities in Water
Component Chemical formula Problem caused
Barium sulfate BaSO
4
Scale
Carbon dioxide CO
2
Corrosion
Calcium bicarbonate Ca (HCO
3
) Scale and corrosion
Calcium sulfate CaSO
4
Scale and corrosion
Iron Fe Scale
Magnesium bicarbonate Mg(HCO
3
)
2
Scale
Magnesium chloride MgCl
2
Scale and corrosion
Magnesium sulfate MgSO
4
Scale and corrosion
Oxygen O
2
Corrosion
Sodium chloride NaCl Corrosion
Silica Si Scale
Suspended solids — Deposition and corrosion
Sanitizing in Milk Production 551
Table 2 Suggested Standards for Water Used in
Cleaning/Sanitizing Applications
Factor Specification (mg/L)
Turbidity 1–10
Color 5–10
Taste/odor Low
Total dissolved solids 500
Hardness as CaCO
3
250
Alkalinity as CaCO
3
250
pH 6–8
Iron 0.3
Manganese 0.1
Copper 2
Chlorides 200
Sulfates 200
Silica 15
Microorganisms Pathogen free
Standard pate count Less than 500 cfu/mL
Coliforms Less than 1 cfu/100 mL
Psychrotrophs Less than 10 cfu/mL
in temperature. Minerals causing both temporary or permanent hardness will pre-
cipitate in alkaline systems without water conditioners. Mineral salts causing tem-
porary hardness change to carbonates and precipitate, whereas salts causing perma-
nent hardness, in the presence of carbonates or hydroxides, will also precipitate.
Water hardness is expressed in either grains per gallon or parts per million (Table 3).
Many of today’s detergents can perform well at high water hardness. In
very hard water, high concentrations of cleaners or additives must be used to
compensate for the hardness. In some instances, mechanical softening of plant
water may be more economical.
Table 3 Water Hardness
Grain per
Hardness gallon (gpg) ppm
Soft 0–3.5 0–60
Moderately hard 3.5–7.0 60–120
Hard 7.0–10.5 120–180
Very hard Over 10.5 Over 180
17.1 ppm H11005 1 gpg.
552 Cords et al.
b. pH The pH of natural water varies depending on geographical location.
The normal pH of water ranges from 6.5 to 8.5. Waters outside of this range
may need treatment if they adversely affect operations in the plant. Some sanitiz-
ing solutions are affected by water with high acidity or alkalinity and will exhibit
lower antimicrobial activity.
c. Microorganisms Waters can contain diverse types of microorganisms
and may require pretreatment to conform to the U.S. Public Health Service Stan-
dards for potable or drinking water. The water must be free of pathogenic organ-
isms as indicated by coliform levels of less than 1 cfu (colony forming unit)/
100 mL of water. The total plate count in potable water is usually less than 1000/
mL. Higher levels may be indicative of serious contamination.
Although potable water may be free of pathogenic organisms, it may con-
tain spoilage organisms that can affect the shelf life of food products. For produc-
tion of high-quality products in dairy processing plants, the total plate count of
processing water should not exceed 10 cfu/mL. For postrinsing, coliform counts
of the water should be less than 1 cfu/100 mL and psychrotrophic counts should
be less than 10 cfu/mL. For direct product or process use, the level of psychro-
trophic bacteria should be less that 1 cfu/mL.
B. Surfaces
Selection of a cleaner depends on several factors, but materials used to construct
equipment are an important consideration. Today food and dairy equipment is
primarily constructed of stainless steel, which has many advantages including
being resistant to chemical attack. Polished 304 or 316 stainless steel permits use
of some cleaning chemicals not recommended for other metals such as aluminum,
zinc, and tin. When the dry metal surface of stainless steel is exposed to air, it
forms an oxide film that protects the surface from corrosion. Surfaces, after clean-
ing and sanitizing, should be allowed to dry to restore this protective film.
Some plastic and glass materials are being used for lining of tanks and
lines. Some of the plastics include polyethylene, polypropylene, polycarbonate,
and polivinylidine fluoride. These materials vary in their resistance to chemical
attack by cleaning agents. The manufacturer of the chemical should be consulted
as to compatibility of its products with these materials.
C. The Cleaning Equation
Four interrelated factors affect the efficiency of the cleaning process. They are
(a) concentration of cleaning agent, (b) water temperature, (c) time required, and
(d) amount of mechanical action.
These four factors can be adjusted according to specific situations or needs.
For example, when an employee washes equipment manually, water tempera-
Sanitizing in Milk Production 553
ture must be low enough to avoid burning skin or causing discomfort. In this
instance increased mechanical action compensates for the lower temperature. In
cleaning in place (CIP) systems, mechanical action is limited to turbulent flow,
and thus a more aggressive cleaning compound is needed to deliver acceptable
results.
1. Hand or Manual Cleaning
Using this method, parts or utensils are rinsed with water and then brushed with
detergent solution in a bucket or sink to remove soil residues. The temperature
of the cleaning solution should not exceed 50°C, and the pH should be in the
range of 4.0–10.5 to ensure the safety of the operator during manual application.
To avoid irritation to skin and eyes, use of suitable gloves and eye protection is
recommended.
2. Spray or High-Pressure Cleaning
In high-pressure, low-volume cleaning operations, the effect of physical force
is used as an important cleaning component. This allows for reduced chemical
usage both in terms of volume and concentration. If spraying is done in an open
space, all employees should be protected by safety equipment from exposure to
the cleaner because of misting and atomization in the area. When using this
method of cleaning, care must be taken not to distribute soils to previously
cleaned areas.
3. Foam, Gel, and Thin-Film Cleaning
A safer and more effective way to clean equipment is to use foam, gel, or thin-
film methods. Foam, gel, or a thin film can be generated via a portable or central-
ized foam unit which combines air pressure and water with a foaming detergent
to generate a stable foam or gel. This method of cleaning maximizes contact time
in the four-parameter cleaning equation. The exterior of processing equipment,
walls, and ceilings are covered with stable foam that adheres to outer surfaces
for 5–10 min. When the surface is still wet, it should be rinsed off with warm
water. A gel cleaner is more viscous. It adheres to vertical surfaces longer than
a foam cleaner, and then is rinsed with warm water. Thin film, on the other hand,
is a less viscous mixture and when applied to vertical surfaces it clings like a
gel, leaving only a thin film that stays wet and active up to 30 min or longer.
When compared to gel cleaner, it uses less product, less application time, and
smaller quantities of rinse water.
Gels or thin films should be applied from the bottom of the equipment to
the top and rinsed from top to bottom. Foam should be applied from top to bottom
554 Cords et al.
of the area to be cleaned and rinsed from top to bottom. Use of foam, gel, or
thin-film cleaners replaces the potentially unsafe misting of detergent, especially
in an open area. These types of cleaners are generally formulated with less aggres-
sive chemicals and mechanical energy is minimized.
4. Cleaning Out of Place
In cleaning out of place (COP) systems, disassembled parts and utensils are
placed in the recirculation parts washer equipped with circulation pump and dis-
tribution headers that agitate cleaning solutions. Initially, parts are rinsed and
then the cleaning solution is circulated, providing some agitation necessary for
soil removal. Parts are subsequently rinsed and sanitized.
5. Cleaning in Place
In the dairy industry, most equipment is cleaned in place (CIP). This means deter-
gent and sanitizer are delivered to the equipment without disassembly. The CIP
unit is designed to recirculate detergents, rinses, and sanitizing solutions for tanks,
silos, vats, pasteurizers, sterilizers, and their pipelines. It is usually automated
for time, temperature, detergent concentration, and volume of water. All pipelines
must be installed with at least a 1/8 in/ft incline to allow good drainage. Also,
velocity of the cleaning solution through the pipeline should be at least 5 ft/s,
and flow rate of the cleaning solution should be greater than that of the product.
CIP systems may be divided into two basic types: a reclaim system where deter-
gent solution is saved and concentration readjusted each time before the next
cleaning and a single-usage system where the detergent is used only once. There
are four or five steps in the CIP cleaning cycle: (a) prerinse with water, (b) alka-
line wash, (c) postrinse, (d) acid wash or rinse (optional), and (e) sanitizing rinse.
Circulation time, temperature, and concentration of detergent have to be synchro-
nized to get optimum cleaning and sanitizing results.
In single-phase cleaning, either the alkaline or acid wash is eliminated.
These products are formulated to deliver the same result as the combined effect
of alkaline plus acid steps. In addition to good cleaning results, some other advan-
tages of single-phase cleaners are savings in time, water, energy, and effluent
costs. Saving in chemicals is accomplished by eliminating either the acid or alka-
line cycle. Solutions are sometimes reused and require more adjustments because
of the complexity of the formulation.
In the override system of CIP cleaning, a hot acid-containing surfactant
solution is circulated through equipment and is returned to the make-up tank.
Subsequently, alkali is added to the acid solution, and the hot mixture is recircu-
lated. The only saving gained in this method is elimination of intermediate water
Sanitizing in Milk Production 555
rinses used between alkaline and acid cleaning. This type of cleaning is some-
times used in HTST units and vacuum pans.
D. Environmental Factors
Dairy plants generate relatively high levels of wastewater because of (a) fre-
quency of cleaning and (b) extensive surface area to be cleaned. The milk soil
can contribute a fairly significant BOD (Biochemical Oxygen Demand) load, and
the classic cleaning processes create wastes of pH as high as 12 or as low as 2.
Many municipalities will not accept wastes of this nature, and therefore on-site
neutralization processes are employed. In some instances, limits are set on other
detergent compounds such as phosphate, nitrate, for ultimate biodegradability.
III. DETERGENT INGREDIENTS
Detergents employed in commercial dairy cleaning formulations contain a broad
range of chemical compounds. These cleaning compounds may be divided into
the following general categories: (a) surfactants, (b) builders (alkaline builders,
acid builders, enzymes, water conditioners, oxidizing agents), (c) fillers, and (d)
miscellaneous additives
A. Surfactants
Surfactants are organic compounds that play a very important role in the cleaning
process. These molecules are composed of a hydrophilic and hydrophobic moiety.
The balance between hydrophilic and lipophilic (hydrophobic) groups is called
HLB (hydrophilic-lipophilic balance). Surfactants lower surface tension and are
good wetting, penetrating, emulsifying, solubilizing, and dispersing agents. All
of these properties of surfactants are actively involved in removal of soils from
equipment surfaces. When incorporated into cleaning solutions, they enable the
solution to enter into pores, cracks, and crevices, penetrate soil, emulsify soil,
and disperse soil into the solution. Several different types of surfactants are em-
ployed in cleaning solutions (Table 4).
Anionic surfactants are good detergents, wetting agents, solubilizing, dis-
persing agents, and foamers. Water hardness and the presence of cation-
ics adversely affects their performance.
Cationic surfactants are not recognized as being particularly good emulsify-
ing or dispersing agents. They are adversely affected by water hardness
and will react with anionic surfactants.
556 Cords et al.
Table 4 Surfactants Employed in Cleaning Solutions
Class Description Examples
Anionics Ionize in solution to give an active Alkyl sulfonates
negative ion Alkylaryl sulfonates
Alkyl ether sulfates
Alkyl sulfates
Phosphoric acid esters
Cationics Ionize solution to give an active Quaternary ammonium compounds
positive ion Alkyl amines
Ethoxylated amines
Alkyl betaines
Nonionics No charge in solution Alkylphenol ethoxylates
Alcohol ethoxylates
Ethylene oxide/propylene oxide
polymers
Amphoterics Have both positive and negative Acylamino acids
charge depending upon pH N-alkyl amino acids
Nonionic surfactants are stable in the presence of hard water. They are
effective over a wide pH range. Nonionic surfactants are good emulsifi-
ers, powerful surface-tension reducers, and good foamers and defoamers.
The use of a nonionic surfactant as a defoamer is dependent on tempera-
ture and cloud point, which is defined as that temperature at or near
which nonionics begin to become insoluble in a heated solution causing
a cloudy or turbid appearance. Below the cloud point temperature, they
are foamers, but above they are defoamers. Low-foaming nonionic sur-
factants also exhibit good rinsing properties.
Amphoteric surfactants behave either as cationic or anionic surfactants de-
pending on the pH. They have the advantage of being compatible with
either cationic or anionic surfactants. These compounds have emulsify-
ing, foaming, solubilizing, and lime-dispersing capabilities and are resis-
tant to water hardness.
B. Builders
In addition to surfactants, builders also contribute to the actual cleaning power
in a detergent. There are five generally recognized classes of builders: (a) alka-
line builders, (b) acid builders, (c) enzymes, (d) water conditioners, and (e) oxi-
dizers.
Sanitizing in Milk Production 557
1. Alkaline Builders
Alkaline builders constitute the bulk of all detergents used on food and dairy
processing equipment, because they most effectively remove all food soils such
as fats, proteins, and carbohydrates. They contribute electrons or negative ions
that surround soils and disrupt their structure, swell them, and free them from
surfaces. Alkaline builders include sodium hydroxide, potassium hydroxide, so-
dium (potassium) metasilicate (silicate), sodium carbonate, and some phosphates
(trisodium phosphate) (Table 5).
Alkalinity consists of two parts, active alkalinity and inactive alkalinity,
and together they comprise total alkalinity. Active alkalinity titrates to pH 8.4
or to the phenolphthalein endpoint, whereas inactive alkalinity titrates from pH
8.4–3.4 or to the methyl orange endpoint. Active alkalinity is the alkalinity re-
sponsible for the actual cleaning action of alkaline products. If the cleaning solu-
tion is reused, active alkalinity must be monitored and upgraded to the desired
concentration for the cleaning solution to be effective in the new cleaning cycle.
2. Acid Builders
Acid detergents can be very effective in solutions where soils fail to respond to
alkaline cleaners. Because of corrosion and safety concerns associated with strong
mineral acids such as hydrochloric acid, milder acids or acid combinations are
usually selected for use on dairy equipment. For many years, acids have been
employed as milkstone (calcium phosphate) removers in the dairy industry. In
addition, acids have been extensively used in the dairy plant sanitation program,
especially for cleaning high-temperature processing equipment such as HTST
pasteurizers, evaporators, UHT units, as well as in CIP cleaning of other milk
processing and storage equipment. Applications of acid maintain the equipment
surface free of mineral (water hardness) deposits and keep stainless steel in good
condition. Often acids are used as acidified rinses to ensure neutralization of
alkaline residues that may be left on equipment after insufficient rinsing of the
alkaline cleaner.
The most widely used acids in the food and dairy industries are phosphoric,
nitric, sulfamic, citric, lactic, and hydroxyacetic (Table 6). Because inorganic
acids are more aggressive, they are better cleaners, more corrosive, and more
economical, whereas organic acids are safer and less aggressive but more expen-
sive to use. These acids are used alone or in combinations, and for best results,
they are often formulated with corrosion inhibitors and surfactants. By removing
mineral deposits, sites for bacterial attachment are minimized.
3. Enzymes
Enzymes are employed as detergent additives where less corrosive formulations
are desired. They are often used when effluent restrictions on very high or low
558
Cords
et
al.
Table 5 Typical Alkaline Builders
Comparative ability
Ingredients Saponi
fi
cation
Emulsi
fi
cation
Protein
control
Penetration Suspension Water
conditioning
Rinsability Foam Noncorroxive Nonirritating
Basic alkalis
Sodium or potassium hydroxide A C B C C D D C D DD
Silicates C B C C B D D C A D
Carbonates C C C C C D C C C C
TriSodium phosphate C B C C B C A C C D
Complex phosphates
Tetrasodium pyrophosphate C B C C B B A C A A
Sodium tripoly phosphate C A C C A AA A C A A
Sodium polyphosphate C A C C A AA A C A A
Gluconates C C C C B B B C A A
Organic materials
EDTA C C C C C AA C C B A
Phosphonates C B C C C-B AA C C A A
Polyelectrolytes C B C C B A B C A A
Wetting Agents C AA C AA AA C AA D-A A A
Protease Enzymes C C AA C C C C C A D
A, excellent; B, good; C, no/minor contribution; D, negative performance
Sanitizing
in
Milk
Production
559
Table 6 Acid Detergents
Comparative Ability
Ingredients Mineral
/
scale
removal
Emulsi
fi
cation
Penetration Suspension Rinsability Foam Noncorrosive
stainless
steel
Noncorrosive
soft
metals
Nonirritating Passivation
Mineral Acids
Muriatic (hydrochloric) AA C C C C C DD DDD DD DD
Sulfuric AA C C C C C DD DDD DD DD
Sulfamic A C C C C C B D C C
Nitric A C C C C C A DDD DD AA
Phosphoric A C C C C C A DD C A
Organic Acids
Citric B C C C C C A D B A
Hydroxyacetic B C C C C C A D B B
Glycolic B C C C C C A D A C
Wetting Agents
Nonionic D
Anionic A
A, excellent; B, good; C, no/minor contribution; D, negative performance.
560 Cords et al.
pH are in effect. The most widely used enzymes are proteases. In recent years,
commercial products containing proteolytic enzymes have been used as replace-
ments for chlorinated alkaline cleaners. In these applications, the enzyme replaces
hydrolytic activity of the chlorine/high alkalinity system. Use of other enzymes
such as lipase and carbohydrases is less common.
Although enzymes present an environmentally favorable profile, worker
exposure through aerosolization must be avoided because of the potential for
allergic reaction. Enzyme-containing detergents are therefore not recommended
in open-spraying or manual cleaning operations.
4. Water Conditioners
Water conditioners represent a very important group of builders that considerably
enhance cleaning performance of alkaline and neutral cleaners with their desir-
able properties. These builders when incorporated into cleaners react with cal-
cium, magnesium, or other ions present in soil or in hard water and greatly aid
in the soil-removal process. Water conditioners may be placed into the following
groups:
1. Inorganic phosphates. These compounds include sodium tripolyphos-
phate, tetrasodium and tetrapotassium pyrophosphates, sodium hexa-
metaphosphate, trisodium phosphate, and orthophosphates. These
polyphosphates form soluble undissociated complexes with metallic
ions such as calcium, magnesium, iron, and copper and prevent them
from precipitating. In addition to being good sequestering agents, they
also exhibit good buffering and deflocculation properties, as well as
enhance overall cleaning efficiency of the formulated product. Triso-
dium phosphate, higher in alkalinity than other phosphates, is also a
saponifier and emulsifier of oily soils. Another characteristic property
of phosphates is their ability to treat hard water at very low concentra-
tions. This so-called ‘‘threshold effect’’ utilizes minute levels of 10–
20 ppm of phosphate to treat hard water and prevent minerals from
precipitating. Although the cleaning solution will be cloudy, minerals
will not precipitate and can be rinsed freely from equipment surfaces.
Orthophosphates such as monosodium- and disodium phosphate are
inorganic phosphates and usually serve as fillers. There are several
disadvantages of polyphosphates: (a) at high temperatures, they revert
to orthophosphates, (b) they are undesirable in the effluent and need
special treatment for disposal, and (c) they are rather expensive to use.
2. Organic phosphonates. Three known liquid builders that are used in
dairy cleaners are: (a) nitrilomethylene phosphonate, (b) hydroxy-
ethanediphosphonate, and (c) 2-phosphonobutane-1,2,4-tricarboxylate.
Sanitizing in Milk Production 561
They are effective sequestering agents, prevent scale formation, and
provide corrosion inhibition in aqueous systems.
3. Polyelectrolytes. These compounds include polyacrylates and other
polycarboxylic acids. These organic compounds were developed as
replacements for phosphates. They are good soil removers and soil
dispersants, water conditioners, and anti–soil redeposition agents.
4. Chelating agents. Ethylene diamine tetraacetic acid (EDTA) and its
disodium, trisodium, and tetrasodium salts; diethylene-triamine penta-
acetic acid (DTPA), pentasodium salt; N-(hydroxyethyl) ethylene di-
amine triacetate (HEEDTA); nitrilotriacetic acid (NTA), and trisodium
salt are organic compounds with higher sequestering power than com-
plex phosphates. They are stable at different pH values and tempera-
tures. They are effective in preventing and dissolving scale and lime
deposits, removing water hardness and other metal ions by forming
soluble complexes, and keeping the detergent solution clear.
5. Salts of organic acids. Gluconic, citric, and glucoheptonic acids are
also used to sequester calcium and iron. Sodium gluconate is a good
additive for caustic soda in a bottle-washing application. Some formu-
lators suggest that mixtures of sodium glucoheptonate or sodium citrate
with sodium gluconate may provide better overall cleaning results. Cit-
ric acid and sodium citrate are also good sequestering and buffering
agents that are present in some food and dairy cleaners.
5. Oxidizers
Chlorinated compounds, such as sodium or potassium hypochlorite at 50–100
ppm levels can be added to cleaning solutions to assist in protein removal. This
cleaning enhancement in alkaline systems by chlorine is frequently used in dairies
and on dairy farms. Active chlorine is a strong oxidizing agent and it reacts
with polymeric soils in the oxidation-reduction process by breaking them down.
Similarly, in removal of starches, chlorine addition is helpful in the degradation
process of the compound. Corrosion to metals is a disadvantage of using chlorine
at high temperatures in alkaline systems over a prolonged time. Hydrogen perox-
ide is not as corrosive as chlorine and is sometimes used as a cleaning booster
in similar applications. It is not as effective as chlorine and must be used at
higher concentrations. Hydrogen peroxide is not as corrosive as chlorine. Sodium
perborate is sometimes added as an oxygen donor to detergents to boost cleaning
efficiency.
C. Fillers
Several ingredients that are present in a typical detergent formula serve as fillers.
Some of the fillers in dry products include sodium chloride, sodium sulfate, and
562 Cords et al.
sodium hydroxide. Quite often during formulation, fillers are also used to dilute
a concentrated product for safer handling.
D. Miscellaneous Ingredients
There are several different ingredients that can be added to a formulation such
as preservatives, corrosion inhibitors, dyes, pigments, thickeners, antioxidants,
indicators, and solvents. Generally, products intended for use in food or dairy
plants may contain corrosion inhibitors to protect metals from aggressive acids,
and frequently a dye is incorporated into liquid product for differentiation. If a
liquid formulation is susceptible to biological deterioration, a preservative or bio-
cide may be added. Also, solvents such as glycol ethers may be added to a liquid
cleaner to improve removal of grease and oils from surfaces. If a thicker product
is required, a thickening agent is added to the formulation.
IV. CLEANING PROCEDURES
In most applications, the detergent is preceded by a water rinse to remove most
soils. Cleaning practices around the world may vary considerably owing to factors
such as regulations, environmental issues, and economics. Cleaning processes
typically used for various types of equipment from dairy farms through pro-
cessing are described in Tables 7–11.
Table 7 Cleaning and Sanitizing of Dairy Equipment—Dairy Farms
Problem Application
soil method Procedure
Milking equipment Raw milk COP Mildly alkaline detergent w/sanitizing
Inflation and claw step
assembly
Pipeline Raw milk CIP Chlorinated alkaline single-phase
cleaner w/sanitizing step
a
Enzyme cleaner w/sanitizing steps
Bulk tank Raw milk CIP Chlorinated alkaline single-phase
cleaner w/sanitizing step
a
Enzyme cleaner w/sanitizing steps
a
May require acid cleaning once per week.
Sanitizing in Milk Production 563
Table 8 Cleaning and Sanitizing of Dairy Equipment—Raw Milk
Application
Equipment Soil Method Procedure
Tankers Thin layers of proteins CIP Chlorinated alkaline single
and hard water de- phase cleaners w/sanitiz-
posits ing step
a
Enzymatic cleaner w/sani-
tizing step
a
Receiving Thin layers of proteins CIP Chlorinated alkaline single
and hard water de- phase cleaners w/sanitiz-
posits ing step
a
Enzymatic cleaner w/sani-
tizing step
a
Raw milk Thin layers of proteins CIP Chlorinated alkaline single
storage and hard water de- phase cleaners w/sanitiz-
posits ing step
a
Enzymatic cleaner w/sani-
tizing step
a
Separator Thick layers of pro- CIP Dual-phase cleaning
teins, fat and milk- Alkaline followed by
stone acid rinse and a sanitiz-
ing step
Override cleaning
Acid cleaner followed by
an alkaline cleaner and
a sanitizer step
Homogenizer Thick layers of pro- CIP Dual-phase cleaning
teins, fat and milk- Alkaline followed by
stone acid rinse and a sanitiz-
ing step
Override cleaning
Acid cleaner followed by
an alkaline cleaner and
a sanitizer step
External surfaces Proteins, fat, dust, and Foam/gel/ Chlorinated alkaline single-
of equipment water deposits thin film phase cleaners w/sanitiz-
ing step
a
a
May require acid cleaning once per week.
564 Cords et al.
Table 9 Cleaning and Sanitizing of Dairy Equipment—Pasteurized Milk
Application
Equipment Soil method Procedure
HTST pasteurizer Thick layers of CIP Dual-phase cleaning
fat, protein, and Alkaline followed by acid
milkstone rinse and a sanitizing step
Override cleaning
Acid cleaner followed by an
alkaline cleaner and a sani-
tizer step
Pasteurized milk Thin layers of pro- CIP Chlorinated alkaline single-
storage tank tein phase cleaners with sanitiz-
ing step
a
Enzymatic cleaner with sanitiz-
ing step
a
Filling equipment Thin layers of pro- CIP Chlorinated alkaline single-
teins and hard phase cleaners with sanitiz-
water deposits ing step
a
Enzymatic cleaner with sanitiz-
ing step
a
External surfaces Proteins, fats, dust, Foam/gel/ Chlorinated alkaline single-
of equipment and water de- thin film phase cleaners with sanitiz-
posits ing step
a
Enzymatic cleaner with sanitiz-
ing step
a
a
May require periodic acid cleaning.
V. SANITIZERS
There are several reasons why we clean and sanitize food and dairy processing
equipment. Cleaning is only the first step to good sanitation. Most cleaning opera-
tions are insufficient in totally eliminating microorganisms from the processing
equipment. Thus, the use of efficient sanitizers is required to ensure a surface
which is substantially free of microorganisms.
A. Governmental Regulations
The Environmental Protection Agency (EPA) through its Office of Pesticide Pro-
grams (OPP) regulates pesticide products. In the United States, all sanitizers are
classified as pesticides and must be registered. The Federal Insecticide, Fungicide
and Rodenticide Act (FIFRA) of 1947 and more recently the Federal Pesticide
Sanitizing in Milk Production 565
Table 10 Cleaning and Sanitizing of Dairy Equipment—Cheese Production
Application
Soil method Procedure
Starter tank Thick layers of fat, pro- CIP Dual-phase cleaning
tein, and milkstone Alkaline followed by
acid rinse and a sanitiz-
ing step
Override cleaning
Acid cleaner followed by
an alkaline cleaner and
a sanitizer step
Cheese vats Thick layers of fat, pro- CIP Dual-phase cleaning
tein, and milkstone Alkaline followed by
acid rinse and a sanitiz-
ing step
Override cleaning
Acid cleaner followed by
an alkaline cleaner and
a sanitizer step
Preprocessing Thick layers of fat, pro- CIP Dual-phase cleaning
vat tein, and milkstone Alkaline followed by
acid rinse and a sanitiz-
ing step
Override cleaning
Acid cleaner followed by
an alkaline cleaner and
a sanitizer step
Cheddaring Thick layers of fat, pro- CIP Dual-phase cleaning
machine tein, and milkstone Alkaline followed by
acid rinse and a sanitiz-
ing step
Override cleaning
Acid cleaner followed by
an alkaline cleaner and
a sanitizer step
Curd milling and Thick layers of protein, CIP Dual-phase cleaning
salting system fat, milkstone, and Alkaline followed by
salt acid rinse and a sanitiz-
ing step
Override cleaning
Acid cleaner followed by
an alkaline cleaner and
a sanitizer step
566 Cords et al.
Table 11 Cleaning and Sanitizing of Dairy Equipment—By-Product and Further
Processing
Application
Soil method Procedure
Whey evaporator Coagulated/ CIP Acid prewash (recovered
denatured protein from previous cleaning)
Calcium phosphate 2% hot acid wash
stone Acid sanitizing
Milk evaporator Denatured protein CIP Caustic prewash (recovered
Calcium deposits solution)
Lipids 2% hot acid wash
1% hot acid wash or rinse
Acid sanitizing
Spray dryers Whey or milk solids CIP Caustic prewash (recovered
solution)
3–4% hot caustic wash
1–2% hot acid wash
Acid sanitizing
HTST Denatured protein CIP Caustic prewash (recovered
Calcium deposits solution)
Lipids 1.5% hot caustic wash
1% hot acid wash
UHT Denatured protein CIP Caustic prewash (recovered
Calcium deposits solution)
Lipids 2–4% hot caustic wash
1–2% hot acid wash
Notes: Some whey evaporators concentrate predenatured (hot-well) whey. Cleaning program then
becomes same as milk evaporator.
Evaporator detergent concentrations are in-let concentrations. Evaporators are cleaned under vacuum.
Detergent concentration will gradually increase as water is removed.
Detergent temperatures are typically 82°C or higher. Times are typically 60 min for alkaline wash
and 30 min for acid wash if used together, or 60 min for a single, primary acid wash. Sanitizers are
once through and discard. Cleaning programs are currently trending from time to cycles. One cycle
being one complete circuit through equipment being cleaned. Caustic washes typically recycle four
to five times (or single, primary acid washes) and secondary acid washes recycle two to three times.
HTST and UHT systems are periodically cleaned by one or several miniwashes or mid-washes to
remove gross soils and maintain efficiency of heat transfer surfaces. These consist of 10–15 min
caustic wash or flush which is then discarded.
Sanitizing in Milk Production 567
Control Act of 1972 are the basic laws requiring that such products be registered.
No-rinse sanitizers are considered to be indirect food additives and up until 1996
required FDA approval. With passage of the Food Quality Protection Act of
1996, this responsibility was transferred to the EPA. For this purpose, a new
Antimicrobial Division was formed at the EPA to handle only antimicrobial prod-
uct applications and functions.
There are currently over 40 compositions approved for use on food contact
surfaces without a water rinse (Table 12). (FDA, 1999)
B. Definition of Key Terms
It may be practical to start the review of sanitation and sanitizers by defining the
terms that will be used frequently in the following pages of this chapter:
Antiseptic. An agent that frees from infection by killing harmful micro-
organisms on living tissues of the human or animal body.
Bactericide. An agent that kills bacteria.
Bacteriostat. An agent that inhibits growth of bacteria in the presence of
moisture and may or may not affect viability of bacterial cells.
Biocide. An agent that kills bacteria, fungi, or viruses.
Detergent-sanitizer. A product that possesses the properties of a cleaner
and sanitizer.
Disinfectant. An agent that frees from infection by destroying harmful
microorganisms on inanimate surfaces.
Fungicide. An agent that kills yeasts and molds (fungi).
Fungistat. An agent that inhibits growth of yeasts and molds.
Germicide. An agent that kills germs that may be pathogenic.
Sanitation. The establishment of environmental conditions favorable to
health.
Sanitizer. An agent that reduces the microbial contaminants to safe levels as
determined by the EPA requirements. It is commonly used on inanimate
surfaces.
Sterilant. An agent that kills all forms of vegetative bacteria, bacterial
spores, fungi, and viruses.
Virucide. An agent which kills viruses.
C. Importance of Label Directions
An EPA label provides very important information to the user. Therefore, it is
imperative for an initial user to read the label contents. From an approved EPA
sanitizer label, the user can learn several important facts: (a) warnings and precau-
tionary statements, (b) identity of active ingredient and its percentage, (c) state-
568
Cords
et
al.
Table 12 Approved Sanitizing Solutions
Active ingredient(s)
a
Use solution levels
b1 Potassium, sodium, calcium hypochlorites max 200 ppm available chlorine
b2 Ditrichloroisocyanuric acids or sodium, potassium salts max 100 ppm available chlorine
b3 Potassium iodide/iodine max 25 ppm titratable iodine
b4 Iodine-surfactant complex max 25 ppm titratable iodine
b5 Iodine-surfactant complex max 25 ppm titratable iodine
b6 Iodine-surfactant complex max 25 ppm titratable iodine
b7 Dodecylbenzene sulfonic acid (DDBSA) max 400 ppm
b8 Iodine-surfactant complex max 25 ppm titratable iodine
b9 n-alkyl
C12-C18
Benzyl dimethylammoniumchlorides max 200 ppm active quaternary
b10 Trichloromelamine and dodecylbenzene sulfonic acid max 200 ppm available chlorine
max 400 ppm
b11 n-alkyl
C12-C18
Benzyl dimethylammonium chlorides and max 200 ppm total active quaternary
n-alkyl
C12-C18
dimethyl ethylbenzylammonium chlorides
b12 Sodium salt of sulfonated oleic acid max 200 ppm sulfonated oleic
b13 Iodine-polyglycol complex max 25 ppm titratable iodine
b14 Iodine-surfactant complex max 25 ppm titratable iodine
b15 Lithium hypochlorite max 200 ppm available chlorine
b16 n-alkyl
C12-C18
Benzyl dimethylammonium chlorides, and max 200 ppm total active quaternary
n-alkyl
C12-C14
dimethyl ethylbenzylammonium chlorides
b17 di-n-alkyl
C8-C10
Dimethylammonium chlorides max 150 ppm active quaternary
b18 n-alkyl
C12-C18
Benzyl dimethylammonium chlorides max 200 ppm active quaternary
b19 Sodium dichloroisocyanurate 100 ppm available chlorine
b20 Ortho-phenolphenol, ortho-benzyl-para-chlorophenol, and 400 ppm active
para-tertiaryamyl phenol 320 ppm active
80 ppm active
Sanitizing
in
Milk
Production
569
b21 Sodium dodecylbenzenesulfonate (SDDBS) max 430 ppm: min 25 ppm
b22 di-n-alkyl
C8-C10
Dimethylammonium chlorides and max 400 ppm: min 150 ppm total active quaternary
n-alkyl
C12-C18
benzyl dimethylammonium chlorides
b23 n-alkyl
C12-C16
Benzyl dimethylammonium chlorides and max 200 ppm: min 150 ppm total active quaternary
dodecyl dimethylammonium chloride
b24 Iodine-surfactant complex max 25 ppm: min 12.5 ppm titratable iodine
b25 Iodine-isopropanol solution max 25 ppm: min 12.5 ppm titratable iodine
b26 (Reserved)
b27 Octanoic acid and decanoic acid max 218 ppm: min 109 ppm total active fatty acids
b28 Sulfonated 9-octadecenoic acid max 312 ppm: min 156 ppm
b29 Sulfonated tall oil fatty acid and neo-decanoic acid max 66 ppm: min 33 ppm
max 174 ppm: min 87 ppm
b30 Hydrogen peroxide and peroxyacetic acid max 1,100 ppm: min 550 ppm
max 200 ppm: min 150 ppm
b31 Iodine-surfactant complex max 25 ppm: min 12.5 ppm titratable iodine
b32 di-n-alkyl
C8-C10
Dimethylammonium chlorides, and max 400 ppm: min 150 ppm total active quaternary
n-alkyl
C12-C18
benzyl dimethylammonium chlorides
b33 di-n-alkyl
C8-C10
Dimethylammonium chlorides, and max 400 ppm: min 150 ppm total active quaternary
n-alkyl
C12-C18
benzyl dimethylammonium chlorides
b34 Mixture of oxychloro species (predominantly chlorite, max 200 ppm: min 100 ppm titrated as chlorine dioxide
chlorate, and chlorine dioxide)
b35 Octanoic acid and decanoic acid max 234 ppm: min 117 ppm total active fatty acids
b36 Octanoic acid and decanoic acid max 176 ppm: min 88 ppm
max 58 ppm: min 29 ppm
570
Cords
et
al.
b37 Sodium hypochlorite and potassium permanganate (potas- max 200 ppm: min 100 ppm available halogen as chlorine
sium bromide optional)
b38 Hydrogen peroxide and peroxyacetic acid max 465 ppm: min 300 ppm
max 315 ppm: min 200 ppm
b39 n-carboxylic
C6-C12
Acid mixture max 39 ppm: min 29 ppm mixture consisting of 56% C
8
, 40% C
10
b40 Iodine-surfactant complex and dodecylbenzene sulfonic acid max 25 ppm: min 12.5 ppm titratable iodine
max 5.5 ppm: min 2.7 ppm
b41 n-alkyl
C12-C16
Benzyl dimethylammonium chlorides max 200 ppm: min 150 ppm total active quaternary
b42 Nonanoic acid and decanoic acid max 90 ppm: min 45 ppm
max 90 ppm: min 45 ppm
b43 Iodine, hypochlorous acid, and iodine monochloride max 25 ppm: min 12.5 ppm titratable halogen as iodine
b44 Sodium lauryl sulfate, and monosodium phosphate max 350 ppm: min 175 ppm
max 350 ppm: min 175 ppm
b45 Hydrogen peroxide, peroxyacetic acid, octanoic acid, and max 216 ppm: min 72 ppm
peroxyoctanoic acid max 138 ppm: min 46 ppm max 122 ppm: min 40 ppm of total
octanoic and peroxyoctanoic acids
b46 Chlorine dioxide and related oxy-chloro species max 200 ppm: min 100 ppm titrated as chlorine dioxide
Note: The table shows that seven general chemical classes comprise most antimicrobial agents used for sanitation in the dairy industry:
? acid-anionic surfactants
? carboxylic acids
? chlorine and chlorine compounds
? iodine complexes
? peroxide and peroxyacid mixtures
? phenolics
a
Quaternary ammonium compounds
Source: April 1, 1999 Code of Federal Regulations, title 21, part 170, section 178.1010, paragraph b, sub-paragraph references 1–46. Active ingredients
listed are those considered by the chapter authors to be the major antimicrobial agents within each reference composition. Other component adjuvants may
contribute to biocidal efficacy. Use solution levels are taken from same section, paragraph c, sub-paragraph references 1–40.
Sanitizing in Milk Production 571
ment of ‘‘first aid’’ treatment, (d) statement on hazards to humans and domestic
animals, (e) environmental hazards, (f) physical or chemical hazards, (g) storage
and disposal, (h) directions for use, and (i) effectiveness against various organ-
isms.
It is important that the user prepare the sanitizing solution accurately to
ensure that the concentration is in the effective range for optimal results. The
method of application should direct the user as to exposure time requirements.
After the application, the user should either drain the sanitizer solution from
equipment surfaces if it has clearance as an indirect food additive or rinse the
equipment with potable water. In many countries, a potable water rinse is required
after sanitizing. Although this avoids any issues with chemical residuals, the wa-
ter can often reintroduce spoilage bacteria to the food contact surface. In the
United States, sanitizing solution cannot be reused. In some countries, this proce-
dure may be allowed. For manual operations, the user should start with fresh
sanitizing solution prepared at least daily or more often if the solution becomes
soiled or diluted.
1. Chlorine and Chlorine Compounds
a. Properties Several types of chlorine compounds are available (Table
13), with the hypochlorites being the most commonly used chlorine compounds
in the dairy industry. Chlorine-based sanitizers form hypochlorous acid (HOCl)
in solution. ‘‘Available’’ chlorine is a measurement of oxidizing capacity and is
expressed in terms of the equivalent amount of elemental chlorine. In general,
the organochlorines are slower acting bactericides than inorganic forms, but they
offer the advantage of stability and are relatively less irritating to personnel and
less corrosive to equipment.
The chemistry of chlorine in solutions, whether the source is elemen-
tal chlorine, hypochlorites, or organochlorines, can basically be described as
follows:
Cl
2
H11001 H
2
O ? HOCl H11001 H
H11001
H11001 Cl
H11002
NaOCl H11001 H
2
O ? NOCl H11001 NaOH
Ca(OCl)
2
H11001 2H
2
O ? Ca(OH)2 H11001 2HOCL
NaCO
2
(NCO)
3
H11001 H
2
O ? HOCl H11001 HOCHC(OH)NC(OH)N
The term free available chlorine is usually applied to the three forms of
chlorine that may be present in water. These forms are (a) elemental chlorine
(Cl
2
), (b) hypochlorous acid (HOCl), and (c) hypochlorite (OCl). At pH 4–5,
most of the chlorine is in the HOCl form. As the pH is decreased below 4, increas-
ing amounts of Cl
2
are formed. Above pH 5, OCl
H11002
proportions increase. Table
14 illustrates the relative percentages of the HOCl species present over a wide
pH range. Hypochlorous acid is the most bactericidal species of the three; how-
572 Cords et al.
Table 13 Characteristics of Chlorinated Compounds
Typical
maximum
Chemical water
Chemical abstracts solubility
Name formula registry no. at 20°C (%)
Gaseous chlorine Cl
2
7782-50-5 0.7
a
Hypochlorous acid HOCl 7790-92-3 16 Maximum
Sodium hypochlorite NaOCl 56802-99-4 50 Maximum
Chlorinated trisodium phosphate Na
3
PO
4
-12H
2
O- 56802-99-4 18
1/4NaOCl
Calcium hypochlorite Ca(OCl)
2
7778-54-3 60 Maximum
Potassium hypochlorite KOCl 7778-66-7 45
Chloramine-T C
7
H
7
ClNNaO
2
S 473-34-7 15
Dichlorodimethyl-hydantoin C
5
H
6
Cl
2
N
2
O
2
1118-52-5 0.2
Trichloro(iso)cyanuric acid Cl
3
(NCO)
3
87-90-1 1.2
Sodium NaCl
2
(NCO)
3
2893-78-9 25
dichloro(iso)cyanuric acid
Chlorine dioxide ClO
2
11049-04-4 1
a
As total of (Cl
2
H11001 HOCl H11001 Cl) moieties.
Source: Corda and Dychdala (1993).
Table 14 Relationships Between
Hypochlorous Acid (HOCl) Content
and pH
Amount of chlorine
present as HOCl
pH species (%)
4.5 100
5.0 98
7.0 94
7.0 75
8.0 23
9.0 4
10.0 0
Source: Cords and Dychdala (1993).
Sanitizing in Milk Production 573
ever, the other forms possess some antimicrobial activities (Cords and Dychdala,
1993).
b. Advantages Chlorinated sanitizers have a long experience as effective
sanitizers. They also have rapid antimicrobial activity against a very wide spec-
trum of microorganisms, are nonstaining, nonresidual, economical to use, and
their activity is not affected by water hardness or lower temperature.
c. Disadvantages Chlorinated sanitizers have the potential for chlorine
gas formation if contaminated with acids. In addition, they may be corrosive to
metal, plastic, or elastomers and are not very stable at high temperatures. Chlori-
nated compounds, when reacted with humic acids present in water, may form
potentially toxic by-products referred to as trihalomethanes or ADX (alkyl or-
ganic halides).
d. Iodophors
Properties: Iodophors are mixtures of iodine and agents that act as carri-
ers and solubilizers for the iodine. Today, the term iodophor refers to two basic
types of aqueous iodine preparations: (a) reaction of iodine with polyvinylpyr-
rolidone (PVP) and (b) reaction of iodine with surfactant molecules. The latter
type, iodine combined with surfactants, is the important type of compound
with respect to food industry use. Iodophors are primarily produced from
polyethoxylated nonylphenol or polyol, which is a block copolymer of propylene
and ethylene oxide. Various other surfactants, including anionics, cationics, am-
photerics, and other nonionics, have also been used. The iodine is bound in micel-
lar aggregates in the carrier and, upon dilution, micelles are dispersed and the
linkage of the iodine is progressively reduced (Cords and Dychdala, 1993). The
forms of iodine present in aqueous solutions as a function of pH and the relative
bactericidal activity of the various chemical species of iodine are illustrated in
Table 15.
Advantages: Idophors are useful because they are (a) fast-acting antimi-
crobials and show good activity against yeast and mold, (b) effective against a
wide spectrum of bacteria, (c) nonirritating, (d) more stable in the presence of
organic material than chlorine, (e) nonresidual, (f) not as affected by water hard-
ness or organic contaminants as chlorine, (g) self-indicating, and (h) low in tox-
icity.
Disadvantages: Iodophors may stain some surfaces or products. They are
somewhat unstable and ineffective at alkaline pH and elevated temperatures.
They also lose activity rapidly at temperatures below 10°C. Iodophors are more
expensive than chlorine, and the lower pH versions can be corrosive to soft
metals.
574 Cords et al.
Table 15 Relationship Between pH and Bacterial
Efficacy of Iodine
Relative
Major ionic bactericidal
pH species present activity
a
Acid I
2
H11001H11001H11001
Intermediate I
2
H11001H11001H11001
HIO H11001H11001
IO
H11002
H11001
Alkaline IO
H11002
H11001
IO
3
H11002
H11002
I
H11002
H11002
I
3
H11002
H11002
a
H11001H11001H11001, most active;H11001H11001, moderately active;H11001, slightly active;
H11002 inactive.
Source: Cords and Dychdala (1993).
e. Quaternary Ammonium Compounds
Properties: The term quaternary ammonium compound (QAC) defines a
group of chemical substances that are produced by a nucleophilic substitution
reaction between tertiary amines and a suitable quaternizing agent, such as an
alkyl halide or benzyl chloride. The basic chemical structure can be depicted as
follows:
R
1
R
3 H11001
NX
H11002
R
2
R
4
Where R
1
,R
2
,R
3
, and R
4
represent covalently bound alkyl groups, which may
be alike or different, substituted or unsubstituted, saturated or unsaturated,
branched or unbranched, cyclic or acylic, aromatic or substituted aromatic groups.
In addition, the alkyl groups may contain ester, ether, or amide linkages. The
nitrogen atom plus the attached R groups form the cation. The anion (X
H11002
), most
often chloride, is bound to the nitrogen by ionic bonding (Cords and Dychdala,
1993).
The QACs were originally developed as aqueous solutions to be used as
simple disinfectants. Today, many formulations are classified as detergent sani-
tizers in which quaternary compounds are combined with nonionic surfactants
or other detergent builders.
Sanitizing in Milk Production 575
Advantages: ‘‘Quats’’ are stable in concentrated and diluted forms, are
relatively noncorrosive to metals, and are effective over a relatively wide pH
range. In addition, they are more stable to heat and organic contamination, and
provide some residual bactericidal activity as well as detergency.
Disadvantages: A few disadvantages of quats are (a) selectivity in antimi-
crobial action, not as effective against gram-negative bacteria, (b) not as effective
at lower temperatures, (c) inhibited or inactivated by most anionics and hard
water salts, (d) moderate to high foam limits application in CIP systems, (e) may
leave an off-flavor in some products, (f) not effective against tuberculosis, and
certain viruses and bacteriophage, and (g) residual activity may affect lactic acid
bacteria in fermented products, and (h) overuse may adversely affect on-premise
waste-treatment systems.
f. Acid-Anionic Surfactants
Properties: Anionic surfactants are characterized by a structural balance
between a hydrophobic residue (e.g., paraffinic chain or alkyl-substituted benzene
or naphthalene ring) and a negatively charged hydrophilic group (e.g., carboxyl,
sulfate, sulfonate, or phosphate). The anionics employed in approved sanitizing
solutions for use on food-contact surfaces include dodecylbenzene sulfonic acid,
sodium dodecylbenzene sulfonate, sodium dioctylsulfosuccinate, sodium lauryl
sulfate, sodium salt of sulfonated oleic acid, sodium 1-octane sulfonate, sulfonate
9-octadecenoic acid, sodium xylene sulfonate, dodecyldiphenyloxide disulfonic
acid, sulfonated all oil fatty acid, and the sodium salt of naphthalene-sulfonic
acid (Cords and Dychdala, 1993).
Advantages: The advantage of acid-anionics are (a) nonstaining, (b) de-
void of objectionable odor, (c) effective in removing milkstone and waterstone,
(d) effective against wide spectrum of organisms, (e) stable in concentrated and
diluted forms, (f) stable in the presence of organic material and at high tempera-
tures of application, and (g) noncorrosive to stainless steel. These products were
developed to combine sanitizing and acid treatments in one step.
Disadvantages: Some disadvantages of acid-anionics are (a) effective in
acid pH only, (b) excessive foam in CIP systems for some products, (c) slower
activity against spore-forming organisms, (d) incompatible with quaternary am-
monium compounds, and (e) active at lower temperatures.
g. Fatty Acid Santizers
Properties: Fatty acid sanitizers, also referred to as carboxylic acid sani-
tizers, are more recently developed compositions utilizing free fatty acids and
sulfonated fatty acids combined with a mineral acid such as phosphoric acid.
These compositions exhibit good overall bactericidal activities. Fatty acid sani-
tizers are effective at acid pH 2.5–3.5. They are noncorrosive to stainless steel
equipment, are acceptable for CIP application, and are functional in removing
hard water deposits during sanitizing.
576 Cords et al.
Advantages: Fatty acid sanitizers are (a) effective broad-spectrum anti-
microbials, (b) stable in the presence of organic material, (c) noncorrosive to
stainless steel, (d) low foaming and suitable for CIP application, (e) both sanitiz-
ing with acidified rinse in one step, and (f) convenient to use.
Disadvantages: Some disadvantages are that they (a) are only effective
at acid pH (pH of 4 or below), (b) are less effective against mold and spore-
forming bacteria, (c) are not compatible with quats, (d) are less effective in cold
temperatures, (e) are potentially corrosive to soft metals, (f) may be irritating to
skin, and (g) possess a slight fatty acid odor.
h. Peroxyacetic Acid
Properties: Peroxyacetic acid (POAA) is a peroxygen compound that ex-
hibits good antimicrobial activity. This compound, often referred to as the perox-
ide of acetic acid, is a strong oxidizing agent. Concentrated liquid POAA has a
strong pungent odor, is soluble in water, usually contains stabilizers, and is ad-
versely affected by high temperatures and metal ion contamination. Typical com-
mercial formulations that contain POAA (ranging from 4 to 15%) also contain
acetic acid, hydrogen peroxide, and a chelating agent. Most recently, new formu-
lations containing other longer chain length carboxylic acids have been intro-
duced (Cords, 1994). Some formulations may contain a small amount of sulfuric
or phosphoric acid.
Advantages: Some advantages of peroxyacid compounds include rapid
antimicrobial activity against a wide spectrum of organisms at lower temperatures
(5°C) and at acid and neutral pH. They are noncorrosive to low-carbon grades
of stainless steel. They are also (a) nonfoaming and suitable for CIP or spray
applications, (b) nontoxic to humans at use concentrations, (c) biodegradable, (d)
effective against biofilms, and (e) practically odorless at use solutions (Fatemi,
1999).
Disadvantages: A few disadvantages of peroxyacid compounds are that
they (a) are not effective at alkaline pH, (b) have a pungent odor in concentrated
product, (c) are difficult to be measured by conductivity at low use concentrations,
and (d) have limited storage stability of use solution, (e) are destabilized by heavy
metals, and (f) are corrosive to soft metals such as brass and copper and lower
grades of stainless steel.
i. Hot Water Sterilization
Properties: Heat is the most widely used method for destruction of micro-
organisms. Hot water has been used successfully for sanitizing equipment and
utensils for many years. Various forms of heat are utilized such as hot water,
steam, or dry heat. Hot water and steam are more efficient than dry heat, because
they cover all of the surfaces completely, including penetration into cracks and
crevices much faster and more efficiently. According to the Grade ‘‘A’’ Pasteur-
ized Milk Ordinance, hot water sanitation may be used as an alternative to chemi-
Sanitizing in Milk Production 577
cal sanitation. This ordinance recommends complete immersion of utensils, vats,
or equipment in hot water or hot water circulation maintaining the minimum
temperature of 77°C for at least 5 min. Sometimes higher temperatures or longer
times may be required to assure complete destruction of more heat-resistant or-
ganisms. The only requirement for effective heat sterilization is that all equipment
and utensil surfaces must be completely clean. Hot water or steam sanitation has
been largely replaced with chemical sanitizers because of high energy costs and
time required for sanitizing.
Advantages: Hot water sanitation has several advantages over other forms
of sanitizing in that it is (a) readily available, (b) nontoxic, (c) a good penetrant,
(d) effective against a broad spectrum of organisms under conditions of time and
temperature, and (5) nonresidual and nonfoaming.
Disadvantages: Hot water sterilization takes a longer time to sanitize
when compared to the use of chemicals and is high in energy costs. It is also
difficult to assure adequate temperature control and thus effectiveness in large
systems. It also requires special equipment, may produce water hardness films,
and can be unsafe as well as a difficult procedure to control. Expansion and
contraction of equipment from external temperature fluctuation can also affect
equipment integrity.
j. Ultraviolet Irradiation
Properties: Ultraviolet irradiation (UV) has been used for some time
as a vehicle of supplemental disinfection in the food and dairy industry. Light
rays of the UV lamp in the UV region of 2400–2800 A
?
produce antibacter-
ial activity. Growth of organisms may be inhibited or they may be completely
destroyed depending upon the efficiency of systems. Mold spores and viruses
are most resistant and require as much as 50 or more times longer exposure
in comparison to gram-negative organisms at the same dose (Shechmeister,
1991).
The UV rays are effective exclusively against microbes on surfaces, in air,
and in clear liquids. They are absorbed by dust, thin films of fat, and turbid
liquids. Hence, UV activity is limited to surface or thin-layer antimicrobial appli-
cations. Microbes that are presumably killed by ultraviolet irradiation can be
revived by exposure to visible wavelengths of light. This phenomenon is called
photoreactivation. The major use of UV lamps in the food and dairy industries
is in the disinfection of air and water.
Advantages: The activity of UV irradiation is not dependent on pH or
temperature but rather on time and location of the wavelength in the antimicrobial
UV spectrum. In addition, it has a low overall toxicity and does not affect the
taste or odor of foods. No residual or environmental effects are also advantages.
Disadvantages: Several disadvantages are (a) variable antimicrobial ef-
ficacy, (b) limited to surface and air sanitation, (c) distance from light determines
578 Cords et al.
effectiveness, and (d) long exposure to UV irradiation may cause eye damage
or skin irritation.
D. Factors Affecting Activity of Chemical Sanitizers
It is a well-recognized fact that activity of chemical germicides is affected by
several different factors. The type of compound, concentration at which it is used,
period of contact time, and temperature of the solution are of significant impor-
tance. There are, in addition, factors such as the presence of organic matter, pH
of the solution, wetting ability, stability of the chemical, type or condition or
number of organisms present, nature and condition of the surface to be treated,
presence of incompatible compounds, residual film effect, and hard water condi-
tions.
1. Concentration
In general, the higher the concentration, the faster the inactivation rate. Most
often the concentration cannot be increased because of limitations by the FDA
indirect food additive regulation where use levels are defined by each individual
product label.
2. Time of Exposure
Time is a very important factor. The longer the contact time, the higher the inacti-
vation rate. Sanitizers are approved by a protocol which requires a defined level
of kill within 30 s at room temperature.
3. Temperature
As a general rule, the higher the temperature, the faster the kill of organisms.
Most sanitizers are designed to be effective at room temperature. Iodophors are
limited to below 50°C because of high vapor pressure. Also, they exhibit poor
efficacy at low temperatures. Peroxyacid sanitizers and chlorinated compounds
show good low-temperature efficacy and are effective at a temperature as low
as 5°C. In general, QACs exhibit reduced activity at lower temperatures with
significant effects below 10°C (Taylor, 1999).
4. Organic Matter
The presence of organic material slows bactericidal activity. This is true of chlori-
nated sanitizers and, to a lesser degree, iodophors and quats. Carboxylic acid
sanitizers, acid-anionic sanitizers, and peroxyacid sanitizers are less affected by
organic contamination. Under heavily soiled conditions, all sanitizers will be ad-
versely affected.
Sanitizing in Milk Production 579
5. pH
The pH is a very important factor in germicidal activity of chemical sanitizers.
Chlorinated sanitizers, iodophors, acid-anionics, peroxy acids, and fatty acid sani-
tizers are all dependent on low pH for their activity. Quats, chlorine dioxide, and
phenolics are not as dependent on changes in pH.
6. Hard Water
Hard water directly slows antimicrobial activity of quats and phenolics. Other
sanitizers appear not to be affected by hardness as high as 500 ppm CaCO
3
. Some
quats do incorporate chelating agents to overcome water hardness. The modern
quats, in general, have higher tolerances to hard water.
7. Wetting Ability
Wetting of surfaces helps in penetration of sanitizing solution into cracks and
crevices. Acid-anionics, iodophors, QACs, perhaps carboxylic acid sanitizers,
and the newer peracid/organic acid mixtures contain surfactants.
8. Stability of Product
Some products lose activity during storage and in solution. Acid-anionic
sanitizers, carboxylic acid sanitizers, and QACs are very stable products. Most
others, although stable in concentrate, will lose long-term stability in diluted solu-
tions.
9. Type of Organism
Different organisms have different resistances to chemicals. Spore-forming or-
ganisms, viruses, and molds are most resistant to chemicals, and to destroy
them, we need either higher concentrations and/or longer time exposures. The
general order of descending resistance is shown in Fig. 1. To inactivate the more
resistant forms, higher concentrations of chemical, longer exposure time, in-
creased temperature, or a combination of all three must be employed. Prions,
nonenveloped viruses, and spores are largely unaffected by standard no-rinse
sanitizing solutions, and other control measures must be employed if their pres-
ence in the dairy product in questions pose a health risk. Chlorinated sanitizers,
iodophors, and peroxyacid sanitizers exhibit the best broad-spectrum antimicro-
bial activity.
10. Condition and Number of Organisms
In general, the older the cell, the more resistant it becomes. Organisms in the
log phase of growth are more sensitive than those in the stationary phase. Moist
580 Cords et al.
Figure 1 Resistance of infectious agents to biocidal agents.
bacteria are killed faster than bacteria in a the dry state. Also, the greater the
number of organisms, the greater the chance for survivors.
11. Physical Condition of Surface
Microorganisms are more readily destroyed when on a smooth surface than on
rough or porous surfaces with cracks and crevices.
12. Incompatible Compounds
It is important to be aware of chemical interactions that may severely inhibit
activity of the sanitizer. Examples include (a) failure to rinse completely a deter-
gent containing an anionic surfactant before applying a quaternary ammonium
compound sanitizer, (b) following an acid rinse with a hypochlorite sanitizer with
subsequent release of chlorine gas, and (c) use of peracetic acid–based sanitizers
in water containing greater than 0.5 ppm iron.
Sanitizing in Milk Production 581
13. Residual Activity
After sanitizing, some compounds leave a film on the surface, which exhibits
residual antimicrobial activity for a short time. Acid-anionic sanitizers, carboxylic
acid sanitizers, and quats belong to this group of sanitizers.
E. Application and Validation
1. Application
Sanitizer solutions can be utilized in several different ways. Usually, they
may be applied from portable spray units, circulated through the equipment, or
through soaking in vats or buckets. In CIP systems, sanitizing is the last step
of the cleaning program. It usually employs a separate tank where the saniti-
zing solution is prepared at least once per day or more often if the solution is
soiled or diluted. From the centralized sanitizer preparation system, the sanitiz-
ing solution may be piped to portable distribution points strategically lo-
cated throughout the plant for easy use by operators. Generally, the portable
units should contain the maximum concentration allowed by the no-rinse
regulation to assure fast destruction of organisms. Should it be necessary to
employ higher than approved concentrations, the surfaces must be rinsed with
potable water followed by reapplication of an acceptable concentration of
sanitizer.
Other possible ways that sanitizers can be applied: (a) through a fogger to
sanitize air space in processing areas to control possible contamination from the
air, (b) via foaming equipment to control surface contamination on walls, ceiling,
floors, or outside of the equipment, (c) in foot baths to eliminate contamination
by employee footwear before entering the processing areas, and (d) in hand soap
stations to minimize contamination from hands.
After a sanitizer is applied, the operators and management routinely deter-
mine whether cleaning and sanitizing of any equipment was done correctly or
not. To assess these results, a validation process is completed by visual, microbio-
logical, organoleptic, and performance monitoring procedures.
2. Visual Validation
Based on everyday experience, operators are in a very good position to determine
by visual inspection whether or not the equipment is clean. They check the rinse
brake and sheathing of rinse water using a flashlight for tough soil areas or even
a black light for scales. Operators can tell, and most of the time they are in
agreement with, the more sophisticated methods.
582 Cords et al.
3. Microbiological Validation
This is the more sophisticated method of evaluation where surface swabbing,
rinsing, and RODAC plating is necessary. This procedure is good, but it takes
24–48 h for bacteria to grow and 3–7 days for yeasts and molds; thus, results
are available long after the finished dairy product has left the plant. However,
more recently, several procedures have been developed that provide more rapid
identification of pathogens using enzymes and DNA, but these require special
training and special equipment.
4. ATP Validation
This is the most recent innovation for immediate validation checking of cleaning
and sanitizing procedures. This technology is based on determination of adeno-
sine triphosphate (ATP), which is present in soil and in microorganisms. A mix-
ture of luciferin/luciferase reagent, when added to released ATP from soil and
microorganisms, will produce light that in turn is measured by a luminometer.
Results on cleanliness and contamination can be obtained in several minutes,
whereas the total plate count, by comparison, takes several days. A conclusion
can be established between level of bacteria and ATP content; however, since
food soils also contain ATP, it is more realistic to use ATP as an indicator of
general cleanliness.
5. Performance Monitoring
This procedure involves actual checks during cleaning and sanitizing by use of
a computer. It monitors during the CIP procedure and records temperature, pres-
sure and flow, pH, conductivity, time, and concentration. Should there be any
noticeable deviation from normal, it can be immediately corrected and save the
procedure and time rather than waiting until the end of the cycle and having to
repeat the procedure.
By using the aforementioned monitoring techniques, it is possible to make
a decision about the cleaning and sanitizing results and, if necessary, make proper
adjustments for bringing the sanitation process back under control.
VI. CONCLUSION
It is difficult to make direct comparisons between the various types of sanitizing
solutions because of the variability in formulations among the commercially
available products. The information provided in Tables 16 and 17 is based upon
the most commonly used commercial products. Exceptions to the norm may be
encountered, especially with respect to iodophor and quaternary ammonium com-
Sanitizing
in
Milk
Production
583
Table 16 Comparison of the Commonly Used Sanitizers
a
in Chemical and Physical Properties
Quaternary
ammonium Acid anionic Peroxyacetic
Property Chlorine Iodophors compounds Carboxylic acids surfactants acid
Corrosive Corrosive Slightly corrosive Noncorrosive Slightly corrosive Slightly corrosive Slightly corrosive
Irritating to skin Irritating Not irritating Not irritating Slightly irritating Slightly irritating Not irritating
Effective at neutral pH Yes Depends on type In most instances No No Yes
Effective at acid pH Yes, but unstable Yes In some instances Yes, below 3. Yes, below 3.0– Yes
3.5
Effective at alkaline Yes, but less than No In most instances No No Less effective
pH at neutral pH
Affected by organic Yes Moderately Moderately Moderately Moderately Partially
material
Affected by water No Slightly Yes No Slightly Slightly
hardness
Residual antimicrobial None Moderate Yes Yes Yes None
activity
Cost Low High Moderate Moderate Moderate Moderate
Incompatibilities Acid solutions, Highly alkaline de- Anionic wetting Cationic surfac- Cationic surfac- Reducing agents
phenols, amines tergents agents, soaps, tants tants and alka- metal ions,
and acids line detergents strong alkalines
Stability of use solu- Dissipates rapidly Dissipates slowly Stable Stable Stable Dissipates slowly
tion
Maximum level permit- 200 ppm 25 ppm 200 ppm 200 ppm sodium 430 ppm dodecyl- 100–200 ppm
ted by FDA without salt of oleic acid benzene sulfo-
rinse 350 ppm C8- nate 200 ppm so-
C10 fatty acids dium salt of
oleic acid
Water temperature None High High Moderate Moderate None
sensitivity
Foam level None Low Moderate Low Moderate None
Phosphate None High None High High None
Soil load tolerance None Low High Moderate Moderate Low
a
Comparisons made at approved ‘‘no-rinse’’ use levels.
Source: Adapted from Cords and Dychdala (1993).
584
Cords
et
al.
Table 17 Comparison of the Commonly Used Sanitizer
a
in Antimicrobial Activity
Quaternary Acid
ammonium Carboxylic anionic Peroxyacetic
Cidal activity against Chlorine Iodophors compounds acids surfactants acid
Gram-positive non–spore- H11001H11001
b
H11001H11001 H11001H11001 H11001H11001 H11001H11001 H11001H11001
forming bacteria
Gram-negative bacteria H11001H11001 H11001H11001 H11001 H11001 H11001 H11001H11001
Bacterial spores H11001H11001H11001H11006H11006H11006H11001H11001
Yeast H11001H11001H11001 H11001 H11006 H11001 H11001
Mold H11001H11001 H11001H11001 H11001 H11001 H11001 H11001H11001
Bacteriophage H11001H11001H11001H11006H11006H11006H11001H11001
a
Comparisons made at approved ‘‘no-rinse’’ use levels.
b
Relative effectiveness: H11001H11001, effective; H11001, moderately effective; H11006, variable effectiveness: (a) depends upon specific formulation, (b) varies with genus or
type, and (c) contact times required are in excess of practical use conditions.
Source: Adapted from Cords and Dychdala (1993).
Sanitizing in Milk Production 585
pounds. The manufacturers of these products can provide the user with informa-
tion relating to antimicrobial efficacy and other factors relevant to use of specific
products.
REFERENCES
Cords BR. New peroxyacid sanitizer. Proceedings of the 23rd Convention. Institute of
Brewing. Sydney, Australia, 1994, pp 165–169.
Cords BR, Dychdala GR. Sanitizers: halogens, surface-active agents, and peroxides. In:
Davidson PM, Branen AL, eds. Antimicrobials in Foods. 2nd ed. New York: Marcel
Dekker, 1993, pp 469–537.
Elliot RP. Cleaning and Sanitizing. In: Katsuyama AH, ed. Principles of Food Processing
Sanitation. Washington, DC: Food Processing Institute, 1980.
FDA. Code of Federal Regulations, Title 21 CFR, Part 178, Section 1010 Washington,
DC: US Government Printing Office, 1999.
Fatemi P, Frank JF. Inactivation of Listeria monocytogenes/Pseudomonas biofilms by
peracid sanitizers. J Food Prot 62:761–765, 1999.
Shechmeister IL. In: Block SS, ed. Disinfection, Sterilization, and Preservation. 4th ed.
Philadelphia, Lea & Febiger, 1991, pp 553–565.
Taylor JH, Rogers SJ, Holah JT. A comparison of the bactericidal efficacy of 18 disinfec-
tants used in the food industry against Escherichia coli 0157:H7 and Pseudomonas
aeruginosa at 10° and 20°C., J. Appl Microbiol 87:178–725, 1999.
Key References for Detergents and Antimicrobials
Block SS. Disinfection, Sterilization and Preservation. 4th ed. Philadelphia: Lea & Feb-
iger, 1991.
Cutler WG, Kissa E. Detergency Theory and Technology. New York: Marcel Dekker,
New York, 1987.
Davidson PM, Branen AL. Antimicrobials in Foods. 2nd ed. New York: Marcel Dekker,
1993.
Russell AD, Hugo WB, Ayliffe CAJ. Disinfection, Preservation and Sterilization. 3rd ed.
Oxford, UK: Blackwell, 1999.
15
Control of Microorganisms in Dairy
Processing: Dairy Product
Safety Systems
Robert D. Byrne
National Milk Producers Federation
Arlington, Virginia
J. Russell Bishop
University of Wisconsin–Madison
Madison, Wisconsin
I. INTRODUCTION
Control of microorganisms in dairy processing is necessary to produce a safe
product of the highest quality. The focus of this chapter is on production of safe
dairy products. To accomplish this, pathogenic microorganisms need to be con-
trolled. Whereas the techniques described result in a high-quality product, the
intent of a dairy product safety system is to ensure that a safe product reaches
the consumer. One of the most effective ways to control microorganisms is
through the use of the Hazard Analysis and Critical Control Point (HACCP)
program (Anonymous, 1996a; Pierson and Corlett, 1992). However, a complete
dairy processing system encompasses more than just HACCP. To ensure that all
hazards are addressed and a safe product is produced, prerequisite programs must
be in place before HACCP controls are addressed. A sound prerequisite program
also simplifies the HACCP program and minimizes the number of critical control
points that need to be monitored. This chapter focuses on those areas that are
defined as prerequisites and how effectively to control them, describes the imple-
mentation of a HACCP program, and provides a model HACCP program as a
guide to developing an effective safety system in a dairy plant.
587
588 Byrne and Bishop
II. PREREQUISITES/GOOD MANUFACTURING PRACTICES
Before developing HACCP plans under the Dairy Products Safety System (Anon-
ymous, 1996b), it is necessary for dairy plants to have developed, documented,
and implemented programs to control factors that may not be directly related to
manufacturing controls but support HACCP plans. These are prerequisite pro-
grams and need to be effectively monitored and controlled before HACCP plans
are developed. Prerequisite programs are defined as universal steps or procedures
that control operational conditions within a dairy plant, allowing for environmen-
tal conditions that are favorable to production of safe dairy products. Prerequisite
areas include premises, receiving and storage, equipment performance and main-
tenance, personnel training, sanitation, and recalls (Anonymous, 1995, 1996a).
When implementing HACCP in a dairy plant, the first step is to review
existing programs to verify whether all prerequisite requirements are being met
and whether all necessary controls and documentation (e.g., program description,
individual responsible, and monitoring records) are in place. Prerequisite pro-
grams are evaluated for their conformance to minimum requirements. Effective-
ness of programs is monitored and required records are properly maintained.
The importance of prerequisite programs cannot be overstated. Prerequisite
programs are the foundation of HACCP plans and must be adequate and effective.
If any portion of a prerequisite program is not adequately controlled, then addi-
tional critical control points would have to be identified, monitored, and main-
tained under HACCP plans. In summary, comprehensive, effective prerequisite
programs simplify HACCP plans and ensure that the integrity of the HACCP
plan is maintained and that the manufactured product is safe.
A. Premises
Buildings and surroundings must be designed, constructed, and maintained to
prevent conditions that may result in contamination of dairy products. Dairy
plants must have an adequate program in place to monitor and control all elements
in this section and maintain appropriate records. Premises include all elements
of the building and building surroundings: outside property, roadways, drainage,
building design and construction, product flow, sanitary facilities, and water qual-
ity. Adherence to requirements is verified through the written program of the
plant, which outlines procedures that ensure satisfactory conditions are main-
tained (e.g., areas to be inspected, tasks to be performed, persons responsible,
inspection frequencies, and records to be kept).
Land must be free of debris and refuse and must not be in close proximity
to any source of pollution (e.g., objectionable odors, smoke, dust, or other con-
taminants). Roadways must be properly graded, compacted, dust proof, and
Control of Microorganisms in Dairy Processing 589
drained. Premises and shipping and receiving areas must provide or permit good
drainage.
The building and facilities must be designed to readily permit cleaning,
prevent entrance and harboring of pests, and prevent entry of environmental con-
taminants. Buildings need to be of sound construction, maintained in good repair,
and not present any microbiological, chemical, or physical hazards to the dairy
food. The building must be designed to provide suitable environmental condi-
tions, permit adequate cleaning and sanitation, minimize contamination by extra-
neous materials, prevent access by pests, and provide adequate space for satisfac-
tory performance of all operations. Construction and layout should reflect
approved blueprints where applicable.
Floors, walls, and ceiling materials, as well as various coating and joint
sealants, must be approved materials that are durable, smooth, cleanable, and
suitable for production conditions conducted in the area. Walls must be light
colored and well joined. Floors must be sufficiently sloped for liquids to drain
into trapped outlets. Windows, if opened, must be equipped with close fitting
screens. Doors must have smooth, nonabsorbent surfaces that are close fitting.
Stairs, elevators, and other structures must be situated and constructed so that
there is no contamination of dairy food and packaging materials. Overhead struc-
tures must be designed and installed in a manner that prevents contamination of
dairy food and packaging materials and does not hamper cleaning operations.
Adequate lighting must be provided throughout the establishment. For op-
erational purposes, lighting should not alter food colors. Light bulbs and fixtures
suspended over exposed dairy food or packaging materials at any stage of produc-
tion or storage must be of a safety type or be protected to prevent contamination
of food if breakage occurs. Ventilation must be provided to prevent a build-up
of heat, steam, condensation, or dust and to remove contaminated air. In microbi-
ologically sensitive areas, positive air pressure needs to be maintained. Ventila-
tion openings must be equipped with close-fitting screens or otherwise protected
with noncorrodible material. Air intakes must be located to prevent an intake of
contaminated air.
Drainage and sewage systems must be equipped with appropriate traps and
vents. Plants must be designed and constructed so that there is no cross connection
between the effluent of human wastes and any other wastes in the plant. Facilities
must be provided for storage of waste and inedible material before removal from
the plant. These facilities must be designed to prevent contamination. Containers
used for waste must be clearly identified and leak proof.
The traffic pattern of employees and equipment must avoid cross contami-
nation of the product. Product flow must prevent contamination of the dairy food
through physical or operational separation. Plants must provide physical and op-
erational separation of incompatible operations. The facilities must be adequate
590 Byrne and Bishop
for maximum production volume that is encountered. Living quarters and areas
where animals are kept must be completely separated from and not open directly
into areas where dairy foods or packaging materials are handled or stored.
Washrooms with self-closing doors must be provided. Washrooms, lunch-
rooms, and change rooms must be separate from and not lead directly into food
processing areas and must also be correctly ventilated and maintained. Wash-
rooms must have hand-washing facilities with a sufficient number of well-
maintained sinks with properly trapped waste pipes connected to drains. Hand-
washing facilities must have hot and cold potable running water, soap, sanitary
hand-drying supplies or devices, and, where required, a cleanable waste recep-
tacle.
Processing areas must contain a sufficient number of conveniently located
hand-washing stations with properly trapped waste pipes connected to drains. In
processing areas, remote controlled (e.g., foot, knee, timed) hand-washing sta-
tions are preferable. Sanitizing facilities (e.g., hand dips) must be in areas where
plant employees are in direct contact with microbiologically sensitive dairy foods.
Notices must be posted for employees to wash hands.
Plants must provide adequate facilities and means for cleaning and sanitiz-
ing equipment. Separate means must be provided for cleaning and sanitizing
equipment used for inedible materials.
The water control program evaluates the microbiological, chemical, and
physical quality of source and in-plant water (from various points of usage). This
water includes the steam supply, cooling medium, process waters, and ice supply.
The program establishes frequency of testing, procedures for testing, person re-
sponsible, and records to be kept. The plan has procedures in place to deal with
water that does not meet specific standards. Records of water potability (labora-
tory test results) and water treatments applied must be maintained.
Potable hot and cold water is used in dairy food processing, handling, pack-
aging, and storage areas and must be provided at adequate temperatures and pres-
sures and in quantities sufficient for all operational and cleanup needs. Where
required, facilities that protect against contamination must be provided for storage
and distribution of water. Bacteriological testing of water is done on a semiannual
basis for municipal water and on a monthly basis for water from other sources.
Records of water potability testing must be maintained.
When chlorination of water occurs on premises, a metering device for add-
ing the correct concentration of chlorine, which is designed to readily indicate
a malfunction, must be used. Also, twice daily checks to determine total available
chlorine must be done or an automatic analyzer equipped with a recorder, and
an alarm must be used.
No cross connections can exist between potable and nonpotable water sup-
ply systems. Nonpotable water is never used in dairy food processing, handling,
Control of Microorganisms in Dairy Processing 591
packaging, or storage areas. All hoses, taps, cross connections, or similar sources
of possible contamination must be equipped with antibackflow devices.
Water treatment chemicals used must be appropriate for their intended pur-
pose. The treatment process and recirculated water and process waters must be
treated and maintained in a condition so that no health hazard results from their
use. Recirculated water must be a separate distribution system that can be readily
identified. Records of treatment must be maintained. Microbiological testing
needs to be done to monitor effectiveness.
Ice must be made from potable water and manufactured, handled, and
stored to protect it from contamination. Bacteriological testing of ice must be
done on a semiannual basis for plants using municipal water supplies and on a
monthly basis for plants using other sources. Records of ice potability testing
must be maintained.
Steam coming into direct contact with dairy food or food contact surfaces
must be generated from potable water with no harmful substances added. The
steam supply must be adequate to meet operational requirements. Boiler treatment
chemicals used must be appropriate for their intended use. Records of treatments
must be maintained.
B. Receiving and Storage
Plants must receive, inspect, and store ingredients, packaging material, and in-
coming materials in ways to prevent conditions that may result in contamination
of dairy foods. Plants must have an adequate program in place to monitor and
control all elements in this section and maintain the appropriate records.
Raw materials, ingredients, and packaging material (i.e., incoming materi-
als) must be inspected on receipt and stored and handled in a sanitary manner
(i.e., to prevent microbiological, chemical, or physical contamination). Effective
measures must be taken to prevent contamination of raw materials, ingredients,
and packaging materials by direct or indirect contact with contaminating material.
Certification of some incoming materials by letters of guarantee, certificates of
analysis, or other satisfactory means may be required and then should be in accor-
dance with the HACCP plan.
Incoming materials must be received into an area separate from the pro-
cessing area. All food additives must be food grade (i.e., they meet Code of
Federal Regulations [CFR] [Anonymous, 1996] specifications or equivalent). All
ingredients must be safe and not impact negatively on safety of the dairy food.
Plants must use packaging materials that are appropriate for their intended use.
Incoming raw materials, ingredients, and packaging materials must be monitored
on receipt for acceptability for use in dairy foods, and records of this monitoring
need to be maintained.
592 Byrne and Bishop
Where applicable, plants must have adequate means of establishing, main-
taining, and monitoring temperature and humidity of rooms where raw materials,
ingredients, packaging materials, and dairy foods are stored. Records of monitor-
ing must be maintained.
Raw materials, ingredients, and packaging materials must be handled and
stored in ways to prevent damage and contamination, and must be held to avoid
growth of microorganisms. Conditions of storage and transport must be such that
safety of the dairy food is not affected.
Returned or damaged goods must be clearly identified and stored in a desig-
nated area for appropriate disposition. Conditions of storage must not affect the
safety of the finished product. Detergents, sanitizers, or other chemical agents in
a dairy plant must be properly labeled, stored, and used in ways that prevent
contamination of dairy foods, packaging materials, and food contact surfaces.
Chemicals must be stored and handled in an area that is kept dry and well venti-
lated and is separate from all food handling areas. Chemicals must be mixed and
stored in clean, labeled containers and dispensed and handled only by authorized
and properly trained personnel.
C. Equipment Performance and Maintenance
Dairy plants must use equipment that is designed for production of dairy foods
and must install and maintain equipment in ways to prevent conditions that
may result in contamination of food. Plants must have an adequate program in
place to monitor and control all elements in this section and maintain appropriate
records.
Equipment and utensils must be designed and maintained in ways that pre-
vent contamination of dairy foods and be constructed of corrosion-resistant mate-
rial. Food contact surfaces must be nonabsorbent, nontoxic, smooth, free from
pitting, unaffected by food, and able to withstand repeated cleaning and sanitiz-
ing. All chemicals, lubricants, coatings, and paints used on equipment in contact
with food must be appropriate for their intended use.
Equipment and utensils must be installed in a way that prevents contamina-
tion of food with adequate space within and around equipment. Equipment must
be accessible for cleaning, sanitizing, maintenance, and inspection. Where re-
quired, equipment must be properly vented. Equipment must be maintained in a
clean and sanitary manner in accordance with the sanitation program. Equipment
and utensils used to handle inedible material must not be used to handle edible
material. Containers for inedible and waste material must be clearly identified
and be leak proof.
Monitoring devices and any equipment that could have an impact on
dairy food safety must be listed together with their intended use. Protocols and
Control of Microorganisms in Dairy Processing 593
calibration methods must be established for those equipment and monitoring
devices. This may include thermometers, pH meters, a
w
meters, refrigeration unit
controls, scales, recording thermometers, recording hygrometers, and other
equipment.
Frequency of calibration, responsible person, monitoring and verification
procedures, appropriate corrective actions, and record keeping must be specified.
If reagents are used for monitoring or verification activities, procedures for keep-
ing and calibrating reagents must be documented. Required information on cali-
bration of reagents includes frequency of testing for all reagents, responsible
person, dating system, storage conditions, and records to be kept.
A preventive maintenance program must be in place that lists equipment
and utensils together with preventive maintenance procedures. The program spec-
ifies necessary servicing of equipment and frequency, including replacement of
parts, responsible person, method of monitoring, verification activities, and rec-
ords to be kept.
D. Personnel Training
Dairy plants must have an adequate program in place to monitor and control
training programs and maintain appropriate documentation. The objective of the
personnel training program must be to ensure safe food handling practices. The
personnel training program must provide, on an ongoing basis, necessary training
for production personnel. A procedure must be developed to verify effectiveness
of the training program.
Production personnel must be trained to understand critical elements for
which they are responsible, what critical limits are, importance of monitoring
limits, and actions they must take if limits are not met. Ongoing training in per-
sonal hygiene and hygienic handling of food must be provided to every food
handler, and training in personal hygiene and hygienic handling of food must be
provided to all persons entering food handling areas. Plants must demonstrate
that personal hygiene is carried out and controlled. No person known to be suffer-
ing from or to be a carrier of a disease likely to be transmitted through food or
afflicted with infected wounds, skin infections, sores, or diarrhea is permitted to
work in any food handling area in any capacity in which there is any likelihood of
such a person contaminating food with pathogenic microorganisms. All persons
having open cuts or wounds may not handle food or food contact surfaces unless
the injury is completely protected by a secure, waterproof covering.
All persons entering a dairy food production area must wash their hands
thoroughly with soap under warm-running potable water. Hands must be washed
after handling contaminated materials and after using toilet facilities. Where re-
quired, employees must use disinfectant hand dips.
594 Byrne and Bishop
All persons working in dairy food handling areas must maintain personal
cleanliness while on duty. Protective clothing, hair covering, and footwear func-
tional to the operation in which the employee is engaged must be worn and main-
tained in a sanitary manner. Gloves, if worn, must be clean and sanitary. All
persons entering dairy food handling areas must remove objects from their person
that may fall into or otherwise contaminate food. Tobacco, gum, and food are
not permitted in dairy food handling areas. Jewelry must be removed before enter-
ing food handling areas. Jewelry, including Medic Alerts that cannot be removed,
must be covered. Personal effects and street clothing must not be kept in food
handling areas and must be stored in a manner to prevent contamination of dairy
foods.
Access of personnel and visitors must be controlled to prevent contamina-
tion. All necessary precautions must be taken to prevent contamination, including
use of foot baths and hand dips where required.
E. Sanitation
Plants must have an adequate sanitation program in place and maintain appro-
priate records. The sanitation program outlines parameters that need to be con-
trolled to ensure safety of the dairy food product. Sanitation procedures must be
developed for equipment, utensils, overhead structures, floors, walls, ceilings,
drains, lighting devices, refrigeration units, and anything else impacting on safety
of the dairy food. Equipment and facilities must be cleaned and sanitized as
defined in a written schedule. Cleaned equipment must be visually inspected on
a routine basis. Equipment must be free of any residue and foreign material before
being used.
For each area and each piece of equipment and utensil, the written cleaning
and sanitizing program specifies name of person responsible, chemicals used,
procedures used, and frequency of cleaning and sanitizing.
Chemicals must be used in accordance with the manufacturer’s recommen-
dations. The sanitation program must be carried out in a way so it does not con-
taminate food packaging materials during or after cleaning and sanitizing. Equip-
ment for cleaning and sanitizing food processing equipment must be designed
for its intended use and properly maintained.
Hand-cleaned or cleaned out-of-place (COP) equipment must be dis-
assembled for each cleaning and inspection, whereas equipment cleaned by an
accepted clean in-place (CIP) system must be inspected as prescribed in the CIP
program. General housekeeping and special sanitation procedures carried out
during operations must be specified (e.g., mid-shift cleanup, responsible person,
procedure).
Examples of information to be included in the written sanitation program
are (a) area/line, equipment to be cleaned, frequency, and responsible person;
Control of Microorganisms in Dairy Processing 595
(b) special instructions for cleaning specific equipment and responsible person;
(c) cleaning equipment that is to be used along with instructions for its proper
operation (e.g., pressure, volume); (d) detergent/sanitizer to be used (including
commercial and generic names, dilution factor, temperature); (e) method to apply
the solution, contact time, foam consistency, scrubbing (if necessary), high/low
pressure; (f ) rinsing instructions, water temperature; (g) sanitizing instructions,
commercial and generic names, dilution factor, pH, temperature, contact time;
(h) final rinsing instructions (if applicable); and (i) safety instructions for prod-
ucts.
Adherence to the written sanitation program must be monitored and re-
corded (e.g., temperature, concentration, contact parameters). Effectiveness of
the sanitation program must be monitored on a routine basis by a company repre-
sentative (e.g., using microbiological swab tests, visual inspection of areas/equip-
ment, or direct observation of sanitation procedures done by designated person-
nel). Operations should begin only after all sanitation requirements are met.
Records of all monitoring results need to be maintained. Deviations and correc-
tive actions taken must be recorded.
Dairy plants must have an adequate, effective, safe, and written pest control
program in place and must maintain appropriate records. Birds and animals must
be excluded from dairy plants. The written pest control program should include
name of a contact person at the establishment for pest control, name of any appli-
cable extermination company or name of person responsible for the program, list
of chemicals and methods used, a map of bait and trap locations, frequency of
treatment and inspection, and pest survey and control reports. Chemicals must
be used according to manufacturer’s instructions, appropriate for their intended
use, and used in a manner to prevent contamination.
Adherence to the written pest control program must be monitored and
recorded. Effectiveness of the pest control program must be verified by on-
site inspection of areas for the presence of insect and rodent activity. Rec-
ords of all monitoring results, recommendations, and action taken must be main-
tained.
F. Recalls
The recall program outlines procedures that the company would implement in
the event of a product recall. The objective of the written recall procedure is to
ensure that an identified dairy food is removed from the market as efficiently,
rapidly, and completely as possible via a plan that can be put into operation at
any time. The program must be tested to validate its effectiveness.
Each manufacturer of a dairy food product must maintain a system of con-
trol that permits a complete and rapid recall of any lot of food product. The
written recall procedure includes the following:
596 Byrne and Bishop
1. Documentation pertaining to the product coding system. All products
must be identified with a production date or code identifying each lot.
Sufficient coding of dairy products is used and explained in the written
recall program to permit positive identification and to facilitate an ef-
fective recall.
2. Finished product distribution records must be maintained for a time
that exceeds the shelf life of the product. Records must be adequately
designed and maintained to facilitate location of the product if it is
recalled.
3. A complaint file must be maintained. Records documenting all related
complaints and action taken must be included.
4. Responsible individuals who are part of the recall team, along with
their respective business and home telephone numbers, must be listed.
For each individual, an alternate is designated to act on his or her behalf
in the event of absence. Roles and responsibilities for every member
on the recall team must be clearly defined.
5. The step-by-step procedures to follow for a recall must be described.
These procedures should include extent and depth of the recall (i.e.,
consumer, retailer, or wholesaler level) according to the recall classifi-
cation.
6. Means of notifying affected customers in a manner appropriate to the
type of hazard must be defined. Channels of communication (FAX,
telephone, radio, letter, or other means) to be used for trace-back and
recovery of all affected products must be identified. Typical messages
directed to consumers, retailers, or wholesalers according to severity
of hazards must be included.
7. Control measures for the returned recalled dairy food must be planned.
This includes both returned product and product still in stock on the
premises. Control measures and disposal of the affected product must
be described according to the type of hazard involved.
8. Means of assessing progress and efficacy of the recall must be stated.
A method of checking effectiveness of the recall needs to be defined.
Any manufacturer who initiates a food safety–related recall of a food im-
mediately notifies the regulatory agency that has jurisdiction with information
that includes (a) reason for the recall; (b) recalled product identification (e.g.,
name, code marks or lot numbers, plant number, date of production, date of im-
portation or exportation, if applicable); (c) amount of recalled product involved,
subdivided to include original quantity of product, distributed quantity, and quan-
tity remaining in possession of the company; (d) areas of distribution of the re-
called food, by areas, cities, states, and, if exported, by country, along with names
Control of Microorganisms in Dairy Processing 597
and addresses of retailers and wholesalers; and (e) information on any other prod-
uct that could be affected by the same hazard.
III. HAZARD ANALYSIS AND CRITICAL CONTROL
POINT—AN OVERVIEW
After prerequisite programs have been completed and documented, an HACCP
program can be implemented. Use of the HACCP system is not new to the dairy
food industry. HACCP is a logical, simple, effective, but highly structured system
of food safety control. It is a system designed to identify ‘‘hazards and/or critical
situations’’ and to produce a plan to control these situations.
The HACCP system was introduced to the food industry as a ‘‘spinoff’’
of the space program during the 1960s. The National Aeronautics and Space
Administration (NASA) used HACCP to provide assurance of the highest quality
available for components of space vehicles. This program, which was designed
to develop assurance of product reliability, was carried over into development
of foods for astronauts.
The U.S. Army Natick Laboratories, in conjunction with NASA, began to
develop foods needed for manned space exploration. They contracted with the
Pillsbury Company to design and produce the first foods used in space. While
researchers at Pillsbury struggled with certain problems, such as how to keep
food from crumbling in zero gravity, they also undertook the task to come as
close as possible to 100% assurance that foods they produced would be free of
bacterial or viral pathogens. A foodborne illness that causes severe diarrhea in
the confines of a space suit combined with zero gravity could be just as cata-
strophic to astronauts as a failure of the rockets.
Use of standard quality control methods common to the food industry was
soon proven to be unworkable for the task Pillsbury had undertaken. Either the
degree of safety desired was not provided or product sampling would have been
prohibitive to commercialization of space foods. Pillsbury researchers discarded
the standard quality control methods and began an extensive evaluation, in con-
junction with NASA and Natick Laboratories, to evaluate food safety. They soon
realized that to be successful they would need control over their process, raw
materials, environment, and their people. In 1971, they introduced HACCP as a
preventive system that provided manufacturers a high degree of assurance that
foods were produced safely. If the HACCP system is correctly implemented,
there is little requirement for testing of final product other than for verification
purposes.
HACCP is a management tool that provides a more structured approach to
control of identified hazards than that achievable by traditional inspection and
598 Byrne and Bishop
quality control procedures. It starts with product design and provides a means to
identify potential areas of concern, where failure has not yet been experienced,
and is, therefore, particularly useful for new operations. HACCP is a logical basis
for better decision making with respect to product safety. It provides dairy food
manufacturers with greater security of control over product safety than is possible
with endproduct testing. HACCP has international recognition as the most effec-
tive means of controlling foodborne disease and is endorsed as such by the joint
Food and Agriculture Organization/World Health Organization (FAO/WHO)
Codex Alimentarius Commission.
One of the key advantages of the HACCP concept is that it enables a dairy
food manufacturing company to move away from a philosophy of control-based
testing (i.e., testing for failure) to a preventive approach, whereby potential haz-
ards are identified and controlled in the manufacturing environment (i.e., preven-
tion of product failure).
HACCP has many other benefits as well: It ensures dairy product safety,
is science based, focuses appropriate technical resources on critical processes,
lessens emphasis on endproduct testing, focuses on prevention, uses resources
effectively, and meets customer expectations.
HACCP has been recognized internationally as a logical tool for use in
moving toward a more modern, scientifically based inspection system. The most
important element of a HACCP-based system is its preventive nature, and it thus
exercises control throughout the manufacturing process at critical steps. By doing
so, defects that could impact on the safety of the dairy food being processed can
be readily detected and corrected at these points before the product is completely
processed and packaged.
IV. PRINCIPLES OF HAZARD ANALYSIS AND CRITICAL
CONTROL POINT
The following seven principles of HACCP were adopted by the National Advi-
sory Committee on Microbiological Criteria for Foods (Pierson and Corlett,
1992). These principles allow for a systematic approach to dairy product safety:
1. Conduct a hazard analysis associated with growing, harvesting, raw
materials and ingredients, processing, manufacture, distribution, mar-
keting, preparation, and consumption of the dairy food.
2. Identify critical control points (CCPs) required to control identified
hazards in the process.
3. Establish critical limits for preventive measures associated with each
identified CCP.
Control of Microorganisms in Dairy Processing 599
4. Establish CCP monitoring requirements. Establish procedures for us-
ing results of monitoring to adjust the process and maintain control.
5. Establish corrective actions to be taken when monitoring indicates
there is a deviation from an established critical limit.
6. Establish effective record-keeping systems that document the HACCP
plan.
7. Establish procedures for verification that the HACCP system is work-
ing correctly.
V. HAZARD COMPONENTS
To produce a safe dairy product effectively, all hazards that might occur must be
controlled, reduced to an acceptable level, or eliminated. An effective prerequisite
program should control many of the environmental hazards. The HACCP system
controls any remaining hazards inherent to the food or that may result from pro-
cessing.
The three hazards that must be controlled are microbiological, chemical,
and physical hazards (Anonymous, 1996b; Pierson and Corlett, 1992). There are
three types of microbiological hazards: severe, moderate with potentially exten-
sive spread, and moderate with limited spread.
Severe microbiological hazards include Brucella, Clostridium botulinum,
Listeria monocytogenes, Salmonella Typhi, S. Paratyphi, S. Dublin, Shigella
dysenteriae, and hepatitis A and E. Microbiological hazards with potentially
extensive spread include Salmonella spp., enterotoxigenic Escherichia coli,
enteroinvasive E. coli, E. coli O157:H7, Shigella spp., viruses, and Crypto-
sporidium. Microbiological hazards that are moderate with limited spread include
Bacillus cereus, Campylobacter jejuni and other species, Clostridium per-
fringens, Staphylococcus aureus, Aeromonas spp., Yersinia enterocolitica, and
parasites.
Physical hazards that could potentially occur include entry into the food
of metal, glass, insect/pest parts, dirt, wood fragments, personal effects, plastic,
and any other physical object that may render the food unsafe. Chemical hazards
that may occur include the presence of natural toxins, metals, drug residues, sani-
tizer residues, pesticides, food additives, and inadvertent chemicals. Natural tox-
ins include mycotoxins and other natural thyrotoxicoses. Mycotoxins are divided
into those causing acute and chronic mycotoxicoses. The acute mycotoxins in-
clude ochratoxin, trichothecene, zearalenone, and aflatoxin, whereas the chronic
mycotoxins include aflatoxin, sterigmatocystin, and patulin. Metal hazards in-
clude the presence of copper, cadmium, and mercury. Drug residues are beta-
lactams, sulfonamides, tetracyclines, and others. Examples of sanitizer residues
600 Byrne and Bishop
are chlorinated compounds, fatty acids, and idophors. Inadvertent chemicals in-
clude among others lubricants and boiler additives.
VI. HAZARD ANALYSIS AND CRITICAL CONTROL POINT
IMPLEMENTATION
Implementation of HACCP involves a 12-step process, which, when complete
and maintained, ensures a safe dairy product is being produced.
A. Step 1: Gain Management Commitment and Assemble
the HACCP Team
Before proceeding to the HACCP team selection, it is extremely important to
get full commitment from all levels of management to the HACCP initiative.
Without a firm commitment of time, personnel, and resources, the HACCP plan
may be difficult, if not impossible, to implement effectively. The first step in
developing an HACCP plan is to assemble an HACCP team consisting of individ-
uals who have specific knowledge and expertise appropriate to the dairy product
and process. It is the team’s responsibility to develop each step of the HACCP
plan. The team should be multidisciplinary and should include all personnel who
are directly involved in the daily process activities, because they are most familiar
with the operation.
It is recommended that experts who are knowledgeable about the dairy
food and its process should either participate in or verify the completeness of
the hazard analysis and the HACCP plan. These individuals should have the
knowledge and experience needed to identify correctly potential hazards; assign
levels of severity and risk; recommend controls, criteria, and procedures for mon-
itoring and verification; recommend appropriate corrective actions when a devia-
tion occurs; and recommend research related to the HACCP plan if important
information is not known.
B. Step 2: Describe Dairy Food and Method of Distribution
A separate HACCP plan must be developed for each dairy food product that
is being processed in a facility. The HACCP team must first fully describe the
dairy food product or intermediate dairy product if only part of the process is
studied. The dairy product should be defined in terms of composition, structure,
processing, packaging system, storage, required shelf life, and instructions for
use.
The method of distribution should be described along with information on
whether the dairy food is to be distributed frozen or refrigerated or is shelf stable.
Control of Microorganisms in Dairy Processing 601
Consideration should be given to the potential for abuse in the distribution chan-
nel and by consumers, but the question, ‘‘Is this a hazard or a quality issue?’’
must be asked.
C. Step 3: Identify Intended Use and Potential Consumers
The intended use of the dairy food should be based on its normal use by end-
users, consumers, and consumer target groups. Intended consumers or users may
be the general public, a particular segment of the population, another food (dairy
or nondairy), or nonfood product. The use of dairy foods as an intermediate or
nontraditional product represents a growing market and must be considered more
so than in the past.
Intermediate or nontraditional products include dairy foods that serve
as ingredients (e.g., cheeses used in processed foods, whey products used in
infant formulas, canned cheese, modified atmosphere-packaged dairy foods).
Particular attention should be given to lower fat dairy products, because re-
duction of fat within the product alters its composition as related to water ac-
tivity, pH, and other characteristics important to microbiological safety of the
product.
D. Step 4: Develop and Verify a Flow Diagram
The purpose of the flow diagram is to provide a clear, simple description of
steps involved in production of the dairy food. The scope of the diagram must
cover all steps in the process that are directly under control of the facility.
The flow diagram should consist of words in boxes, not engineering drawings.
When developing a flow diagram, certain types of information must be con-
sidered: prerequisites/good manufacturing practices already established, all raw
materials/ingredients and packaging used (microbiological, chemical, and physi-
cal data), sequence of all process steps (including raw material addition), time/
temperature considerations, product recycle/rework loops, and storage and distri-
bution conditions.
The HACCP team should inspect the operation to verify accuracy and com-
pleteness of the flow diagram by taking the diagram to the production floor and
walking through the steps to ensure accuracy of the diagram. The flow diagram
should be modified as necessary.
E. Step 5: Conduct a Hazard Analysis (Principle 1)
A hazard is any microbiological, chemical, or physical property that may cause
a dairy food to be unsafe for human consumption. The HACCP team con-
ducts a hazard analysis and identifies steps in the process where hazards of poten-
602 Byrne and Bishop
tial significance can occur. Hazards must be of such a nature that their prevention,
elimination, or reduction to acceptable levels is essential to production of a safe
dairy food. The team must consider what preventive measures, if any, can be
applied for each hazard.
Hazard analysis and identification of associated preventive measures allow
identification of those hazards of significance and associated preventive mea-
sures, modification of a process or product to further assure or improve safety,
and determination of CCPs in principle 2.
During hazard analysis, the potential significance of each hazard should be
assessed by considering its risk and severity. The estimate of risk is usually based
on a combination of experience, epidemiological data, and information in the
technical literature. Safety concerns must be differentiated from quality concerns.
The term hazard is limited to safety.
Upon completion of the hazard analysis, significant hazards associated with
each step in the flow diagram should be listed along with any preventive measures
to control the hazards. For example, if the HACCP team were to conduct a hazard
analysis for the manufacture of yogurt, possible pathogens in raw milk would be
identified as a potential hazard. Thus, pasteurization would be listed along with
the hazard as the preventive measure. Hazards should be only those that will
result in an unsafe product. This same approach may be used for quality or eco-
nomic issues, but HACCP is limited to product safety only.
F. Step 6: Critical Control Points (Principle 2)
A CCP is any point, step, or procedure at which control can be applied and a
dairy food safety hazard can be prevented, eliminated, or reduced to an acceptable
level. The hazard analysis conducted in step 5 has identified areas that are neces-
sary to control. The prerequisite/good manufacturing practices program may be
used to control many of the identified hazards. Any hazards not controlled
through prerequisite programs must be identified as CCPs.
Examples of CCPs include temperature of incoming raw milk, animal drug
residue monitoring in raw milk, storage temperature of raw milk or cream, pas-
teurization temperature and time, and use of metal detectors.
Information developed during the hazard analysis should enable the
HACCP team to identify which steps in the process are CCPs. Identification of
each CCP can be facilitated by use of the CCP decision tree. All hazards that
could reasonably be expected should be considered. Application of the CCP deci-
sion tree can help determine whether a particular step is a CCP for previously
identified hazard.
Different facilities preparing the same dairy product can differ in the risk
of hazards and the points, steps, or procedures that are CCPs. This can result
Control of Microorganisms in Dairy Processing 603
from differences in each facility layout, equipment, selection of ingredients (in-
cluding raw versus pasteurized milk), or the process that is used. This is why
HACCP plans must be developed by each individual plant for every product it
produces.
G. Step 7: Critical Limits (Principle 3)
A critical limit is a criterion that must be met for each preventive measure associ-
ated with a CCP. Therefore, there is a direct relationship between the CCP and
its critical limits that serve as boundaries of safety. Critical limits must be met
to ensure safety of the dairy product. Exceeding a critical limit means a health
hazard may exist or develop or the product was not produced under conditions
assuring safety. Critical limits may be derived from sources such as regulatory
standards and guidelines, literature searches, experimental studies, and experts.
Critical limits may be established for preventive measures such as temperature,
time, a
w
, pH, titratable acidity, drug residues, and microbiological numbers and
kinds.
H. Step 8: Monitoring/Inspection (Principle 4)
Monitoring is a planned sequence of observations or measurements to assess
whether a CCP is under control and to produce an accurate record for future use
in verification. Monitoring serves to track the system operation, determine when
there is a loss of control and a deviation occurs at a CCP (i.e., exceeding the
critical limit), and provide written documentation for use in verification of the
HACCP plan.
Because of the potentially serious consequences of a critical defect,
monitoring procedures must be effective. Ideally, monitoring should be at the
100% level. Continuous monitoring is possible with many types of physical
and chemical methods (e.g., the time and temperature of pasteurization).
The person responsible for monitoring also must report a dairy process or pro-
duct that does not meet critical limits so that immediate corrective action can be
taken.
When it is not possible to monitor a critical limit on a continuous basis, it
is necessary to establish the monitoring interval that is reliable enough to indicate
that the hazard is under control. Statistically designed data collection or sampling
systems lend themselves to this purpose. When using statistical process control,
it is important to recognize that critical limits must not be exceeded.
Most monitoring procedures for CCPs need to be done rapidly, because
they relate to an on-line process and there is no time for lengthy analytical testing.
Microbiological testing is seldom, if ever, effective for monitoring CCPs because
604 Byrne and Bishop
of the time required to conduct tests. Therefore, physical and chemical measure-
ments are preferred, because they may be done rapidly and can indicate condi-
tions of microbiological control in the process.
The following areas must be addressed when considering monitoring/in-
spection: monitoring/inspection controls, procedures, frequency, responsibility,
customized contingency plans, monitoring activities, and exceeding the limit.
Design of HACCP systems is the most important feature of developing effective
monitoring systems. Judgment and discretion are of key importance in designing
the CCP and the monitoring system.
I. Step 9: Corrective Actions (Principle 5)
Corrective actions are procedures to be followed when a deviation occurs. Be-
cause of variations in CCPs for different dairy products and the diversity of possi-
ble deviations, specific corrective action plans must be developed for each CCP.
The actions must demonstrate that the CCP has been brought under control. Indi-
viduals who have a thorough understanding of the dairy process, product, and
HACCP plan should be assigned responsibility for taking corrective action. Cor-
rective action procedures must be documented in the HACCP plan.
Actions taken should eliminate actual or potential hazards created by devia-
tion, develop specific corrective actions for each CCP, assure safe disposition of
the dairy product involved, and demonstrate that the CCP has been brought under
control.
Responsibilities include placing the dairy product on ‘‘hold’’ pending com-
pletion of corrective action. If difficult to establish, the effect of deviation on
safety, testing, and final disposition of the dairy product must be agreed to by
appropriate individuals; records that identify deviant lots and corrective action
must be part of records and records must be kept for a reasonable period after
the expected end of shelf life of the dairy product.
J. Step 10: Records (Principle 6)
The requirement for records is similar to low-acid canned food requirements.
Generally, records used in the total HACCP system include a listing of the
HACCP team and assigned responsibilities; description of the dairy product and
its intended use; flow diagram for the entire dairy manufacturing process indicat-
ing CCPs, hazards associated with each CCP, and preventive measures; critical
limits; monitoring system; corrective action plans for deviations from critical
limits; records for all CCPs; and procedures for verification of the HACCP
system.
Control of Microorganisms in Dairy Processing 605
K. Step 11: Verification (Principle 7)
Verification consists of use of methods, procedures, or tests in addition to those
used in monitoring to determine that the HACCP system is in compliance with
the HACCP plan and/or whether the HACCP plan needs modification and revali-
dation. Verification involves the following:
1. The scientific or technical process to verify that critical limits at
CCPs are satisfactory. This consists of a review of the critical limits
to verify that they are adequate to control hazards that are likely to
occur.
2. Ensuring that the HACCP plan is functioning effectively. Rather than
relying on endproduct sampling, firms must rely on frequent reviews of
their HACCP plan, verification that the HACCP plan is being correctly
followed, review of CCP records, and determinations that appropriate
risk management decisions and dairy product dispositions are made
when process deviations occur.
3. Documented periodic revalidations, independent of quality audits or
other verification procedures, that must be done to ensure accuracy of
the HACCP plan.
Verification inspections should be conducted routinely or on an unan-
nounced basis (a) to assure selected CCPs are under control, (b) when intensive
coverage of a specific commodity is needed because of new information concern-
ing dairy food safety, (c) when dairy foods produced have been implicated as a
vehicle of foodborne disease, (d) when requested on a consultive basis or estab-
lished criteria have not been met, and (e) to verify that changes have been imple-
mented correctly after the HACCP plan has been modified.
Verification reports should include (a) information about existence of an
HACCP plan and persons responsible for administering and updating the HACCP
plan, (b) status of records associated with CCP monitoring, (c) direct monitoring
data of the CCP while in operation, (d) certification that monitoring equipment
is properly calibrated and in working order, (e) deviations and corrective actions,
(f ) any samples analyzed to verify that CCPs are under control (analyses may
involve microbiological, chemical, physical, or organoleptic methods), (g) modi-
fications to the HACCP plan, and (h) training and knowledge of individuals re-
sponsible for monitoring CCPs.
L. Step 12: Evaluating and Revising HACCP Systems
A full review should take place at least annually and should include validation
and assessment of CCP. Other situations that trigger evaluation include (a)
606 Byrne and Bishop
new potential hazards for the dairy food such as newly recognized pathogens
and new CCPs, (b) when an existing HACCP is out of date, (c) when records
are not available, and (d) if changes in production occur and problems are dis-
covered. Another situation that may trigger evaluation is the response to
new dairy product development such as raw material change; preparation
and processing change; formulation change; packaging change; distribution,
storage or display system change; or new use of the dairy product by consu-
mers. The response to a manufacturing change may also trigger evaluation if
there are changes in dairy product flow in a plant, equipment changes, shift
changes, especially if they affect cleaning, and changes in storage or distribu-
tion.
VII. EMPLOYEE EDUCATION AND TRAINING
Product safety systems are people programs. Training people is an essential part
of safety systems. Employees must develop an awareness of safety and create a
proactive environment for dairy product safety. Successful introduction of a
safety system needs to be accompanied by both education and training. Informa-
tion and training needs of staff vary and should be an ongoing process, not a
one-time event.
As stated previously, any safety system must have the full support of
top-level management who will need to be briefed about positive benefits of us-
ing this approach to assure product safety. This briefing should include re-
source implications, especially in terms of time input, person power, and
staff training requirements, during the setting up and subsequent operating of
the system. Other managers and staff, whether or not they are involved di-
rectly in the safety system program, need to be briefed in general terms about
the reasons for this approach and their likely role in the resulting safety sys-
tem. At the very least, managers and staff should be made aware of reasons
for such a new approach. All personnel need to be kept informed of prog-
ress during development of safety systems that involve their work, and this
may be done via information sheets, meetings, and workshops among other
modes.
Team members need training in (a) principles of HACCP; (b) approaching
the analysis logically, systematically, and thoroughly; (c) benefits of the HACCP
system; and (d) role that the team plays in dairy product safety. Production staff
managers, supervisors, engineers, and operators need training on two levels to
enable them to carry out their parts in changes that result from a safety system
program. The first level involves how application of the safety system program
will affect an individual’s work. For example, staff who monitor CCPs need to
Control of Microorganisms in Dairy Processing 607
know what corrective actions to take when a control measure fails (exceeds the
specified tolerances) or moves toward failure. Training may also be needed to
interpret data produced when monitoring is done. The second level involves spe-
cific training in technical skills, for example, taking an accurate and relevant
temperature measurement.
Both team members and production staff need to understand that team
meetings, verification audits, and changes arising from findings of these audits
all form part of the safety system and are all aimed at achieving the objective
of the program in the most effective way. It is suggested that dairy plant personnel
be trained in four distinct groups: (a) senior management, (b) HACCP coordina-
tor, (c) HACCP team member, and (d) on-line personnel. Senior management
should have general knowledge of HACCP principles and the safety system plan.
Both the HACCP coordinator and the HACCP team members should have a
broad and detailed understanding of HACCP principles and the safety system
plan. On-line employees need to know the importance of specific CCPs, and new
personnel need to be made familiar with the safety system and be equipped with
the necessary skills to carry out their role within it. This information should be
conveyed during induction training.
VIII. MODEL HACCP PROGRAMS
Generic HACCP plans can serve as useful guidelines; however, it is essential
that the unique conditions within each dairy facility be considered during de-
velopment of an HACCP plan. Subtle differences in product raw materials and
manufacturing require managers to examine CCPs line-by-line and plant-by-
plant.
The following model/generic HACCP plan has been developed to serve as
a guideline upon which individuals can build their HACCP programs. A hazard
analysis chart (Table 1), flow diagram (Fig. 1), and description chart (Table 2)
are included. Simple and straightforward are the keys to a successful HACCP
plan. If modifications are necessary, only safety issues should be considered if
new CCPs are added.
The fluid milk model program is based on a typical high-temperature, short-
time system and includes CCPs that were developed to address raw milk receiv-
ing, storage, pasteurization, and vitamin addition. A hazard analysis should be
conducted if any changes are made to the program to determine whether the
change creates a hazard. This model program could also be used for flavored
milk products by including additional elements for nondairy ingredient receiving
and storage to the flow chart. Other fluid products such as half and half or cream
could follow a similar flow chart.
608
Byrne
and
Bishop
Table 1 Hazard Analysis Chart: Fluid Milk
Process Step Identified Hazard Preventive Measures CCP
Raw milk receiving Microbiological (M)—Pathogens, Staphylococ- Pathogens are eliminated by pasteurization. Yes (M, C)
cus toxin Temperature control is necessary to prevent
Staphylococcus toxin production. Testing is
necessary to prevent presence of drug resi-
dues.
Chemical (C)—Animal drug residues
Filter Physical—presence of any foreign object that System prevents passage of a foreign object No
may remain in finished product large enough to be a hazard.
Raw milk storage Microbiological—Pathogens, Staphylococcus Pathogens are eliminated by pasteurization. Yes (M)
toxin Temperature control is necessary to prevent
Staphylococcus toxin production.
Clarifier/separator Microbiological—Pathogens, Staphylococcus Pathogens are eliminated by pasteurization. No
toxin Resident time not adequate for Staphylococ-
cus toxin production.
Raw cream storage Microbiological—Pathogens, Staphylococcus Pathogens are eliminated by pasteurization. Yes (M)
toxin Temperature control is necessary to prevent
Staphylococcus toxin production.
Control
of
Microorganisms
in
Dairy
Processing
609
Homogenation Microbiological—Pathogens, Staphylococcus Pathogens are eliminated by pasteurization. No
toxin Resident time not adequate for Staphylococcus
toxin production.
Vitamin addition Microbiological—Pathogens, Staphylococcus Prerequisite programs are in place for ingredi- Yes (C)
toxin ent receiving. Usage records and proper pump
calibration ensure proper addition.
Chemical—Toxic levels of vitamin A
and/or D
Pasteurization Microbiological—Pathogens Pathogens are eliminated by pasteurization. Yes (M)
Pasteurized storage Introduction of pathogen hazards after pasteuri- Prerequisite programs are in place to prevent No
zation post-pasteurization contamination.
Packaging material Introduction of pathogens, chemicals, or physi- Prerequisite programs are in place to prevent No
cal hazards after pasteurization post-pasteurization contamination.
Filler Introduction of pathogens, chemicals, or physi- Prerequisite programs are in place to prevent No
cal hazards after pasteurization post-pasteurization contamination.
Cold storage Properly pasteurized, packaged product con- Not applicable. No
tains no hazards
Distribution Properly pasteurized, packaged product con- Not applicable No
tains no hazards
610 Byrne and Bishop
Figure 1 Fluid milk flow diagram.
Control
of
Microorganisms
in
Dairy
Processing
611
Table 2 Hazard Analysis Critical Control Point Description Chart for Fluid Milk
CCP/
Process Hazard/ Control Critical Monitoring/ Records/ Corrective
Step Concern Point Limit Frequency Location Responsibility Action Verification
CCP1: Raw Microbiolog- Temperature H1134945°F(7°C) Every tanker Load ticket Intake op- Hold and Indicating
milk re- ical QA/QC erator evaluate ther-
ceiving office product mometer
Chemical— β-Lactam No positives Every tanker Receiving Intake op- Reject Calibrate test
Drug screening log; QA/ erator kit
residues QC office
(raw milk)
CCP2: Raw Microbiolog- Temperature H1134945°F(7°C) Continuous Recording QA tech- Hold product, Recording vs.
milk ical Time H1134972 hr but chart; QA/ nician investigate indicating
storage checked QC office cause and ther-
four times adjust mometer
daily
CCP3: Raw Microbiolog- Temperature H1134945°F(7°C) Continuous Recording QA tech- Hold product, Recording vs.
cream ical Time H1134972 hr but chart; QA/ nician investigate indicating
storage checked QC office cause and ther-
four times adjust mometer
daily
CCP4: Vita- Chemical Proper con- H11021300% of la- Daily Vitamin log; Pasteurizer Hold product, Pump calibra-
min ad- centrations bel claim QA/QC operator investigate tion, usage
dition office cause and records
adjust
CCP5: Microbiolog- Temperature H11350161°F Continuous Recording Pasteurizer Flow divert, Cut-in/cut-
Pasteuri- ical (72°C) chart; pro- operator recirculate, out
zation Time H1135015 sec duction and heat checks;
office indicating
thermome-
ter cali-
bration
612 Byrne and Bishop
REFERENCES
Anonymous. Pre-requisites Assessment Plan Manual. Cornwall, Ontario, Canada: Cibus
Consulting, 1995.
Anonymous. Dairy Product Safety System Manual. Washington, DC: International Dairy
Foods Association, 1996a.
Anonymous. Title 21, Code of Federal Regulations. Washington, DC: U.S. Government
Printing Office, 1996b.
Pierson MD, Corlett DA Jr, eds. HACCP Principles and Applications, New York: Van
Nostrand Reinhold, 1992.
16
Regulatory Control of Milk
and Dairy Products
William W. Coleman
Minnesota Department of Agriculture
St. Paul, Minnesota
I. INTRODUCTION
‘‘The dairy industry must be the most regulated industry in this country,’’ is a
statement frequently quoted by dairy producers or processors, usually following
their latest in a series of regulatory inspections. Most sections of the dairy industry
are regulated by multiple agencies, with multiple laws, rules, and regulations,
some of which may at times seem to be overlapping or even conflicting. This is
because milk and many of its products provide good media to support growth
of microorganisms, many of which can cause product spoilage or, of greater
concern, endanger public health. It is for the latter reason that regulation of the
dairy industry really developed and continues to be so complex.
In the 1800s, many of the larger U.S. cities, to have enough milk to feed
their rapidly growing populations, kept herds of thousands of dairy cows, most
of which were poorly fed and housed under deplorable conditions. As a result
raw milk distributed by these dairies, and consumed mostly by young children,
often contained dangerous pathogens which caused diseases such as typhoid fe-
ver, scarlet fever, tuberculosis, and diphtheria, just to name a few. With many
infants dying as a result of these illnesses, the city and county health departments
began to set up rules and regulations to control production facilities and set qual-
ity standards for milk sold in their cities. Milk produced in compliance with these
early local requirements was often classified as ‘‘certified’’ or ‘‘pure.’’ In some
areas, a heating process was required for ‘‘drinking’’ milk, which eventually
became known as pasteurization.
613
614 Coleman
Early dairy regulations in the United States were mostly under local health
departments and could vary greatly from city to city. Beginning in 1880, there
were extensive Congressional investigations and debates concerning the safety
and wholesomeness of the United States food supply and the need for federal
legislation. It was not until Upton Sinclair’s book The Jungle (Bantam Books,
1981) was published in 1906 that the federal government took action to establish
regulations to control interstate commerce of adulterated food. Although Sin-
clair’s book was written to be more of a statement of his feelings about socialism,
it graphically described both the deplorable conditions and adulterated meat being
produced in and sold by meat packing plants around Chicago. As a result, the
Pure Food and Drug Act of 1906 was passed, and this new law banned from
interstate commerce any traffic in adulterated or misbranded food or drugs. This
marked the beginning of federal oversight of the food industry in the United
States.
II. THE HISTORY OF DAIRY REGULATIONS
The first federal milk ordinance was written by the U.S. Public Health Service
(USPHS) in 1924 and was known as the Standard Milk Ordinance. It was a
voluntary program intended to help states and local milk control agencies in
initiating and maintaining more effective programs for prevention of milkborne
diseases. To provide for a uniform interpretation of this Ordinance, an accompa-
nying Code was published in 1927. This Code, through many revisions, eventu-
ally led to the current Grade A Pasteurized Milk Ordinance (U.S. Public Health
Service, 1999).
The Food, Drug, and Cosmetic Act of 1938 substantially revised and re-
placed the original Act of 1906. It broadened protection, established standards,
required new and more affirmative labeling, prohibited misleading containers,
and authorized plant inspections. At the time this Act was passed, milkborne
illness outbreaks constituted 25% of all disease outbreaks associated with infected
foods and contaminated water, whereas today this rate has dropped to less than
1% (U.S. Public Health Service, 1987). In 1944 the Public Health Service Act
was passed and consolidated all previous Public Health Service legislation. It also
provided to the Food and Drug Administration (FDA) authority for the Center for
Food Safety and Applied Nutrition (CFSAN) with programs for sanitation in
milk processing as well as for shellfish, restaurant, and retail market operations.
The Factory Inspection Act of 1953 provided FDA the authority for mandatory
inspection, which was not clearly stated in the 1938 Act.
Before the Public Health Service Act of 1944, legislation in 1940 had al-
ready transferred FDA to the Federal Security Administration, separating it from
the United States Department of Agriculture (USDA). Thus began the division
Regulatory Control of Milk and Dairy Products 615
of the U.S. milk supply into two segments, milk for fluid use, designated as grade
A milk and under programs of the FDA in CFSAN. The other portion, designated
as manufacturing-grade milk remained under USDA and consisted of milk used
for butter, cheese, dry milk, evaporated and condensed milk, and other similar
dairy products. The first standards for manufacturing grade milk were drafted in
1948 and promulgated in 1949 as the U.S. Sediment Standards for Milk and
Milk Products. From 1950 on there was much effort put forth to develop quality
standards for manufacturing grade milk, but it was not until 1963 that the pro-
posed standards were published in the Federal Register for public comment. Even
though they were intended to be minimum standards for voluntary adoption, they
continued to create much controversy throughout the industry. In the meantime,
USPHS published its new milk ordinance and code in 1965 as the first Pasteurized
Milk Ordinance (Publication No. 229). Publication of these two documents
brought about a conflict concerning overlapping responsibilities between USDA
and FDA. A memorandum of understanding (MOU) was issued in 1969, and the
USDA proceeded to publish a revision of the requirements for milk for manufac-
turing purposes, which eventually led to the publication of the ‘‘Milk for Manu-
facturing Purposes and Its Production and Processing, Recommended Require-
ments’’ in the Federal Register, Friday April 7, 1972. This document has been
continually updated over the years and the most current edition became effective
November 12, 1996 (U.S. Department of Agriculture, 1996). The Grade A Pas-
teurized Milk Ordinance also continued to develop with the 1978 revision being
the first published as recommendations of the U.S. Public Health Service/Food
and Drug Administration. The latest revision of this publication (No. 229) was
published in 1999 (U.S. Public Health Service, 1999) and represents the 30th
revision since 1924.
III. NATIONAL CONFERENCE ON INTERSTATE MILK
SHIPMENTS (NCIMS)
As World War II intensified during the early 1940s, it became evident that the
movement of high-quality milk and dairy products from one state or region to
another to support the war effort was difficult because of the costly and time-
consuming verification of quality requirement needed from each source. After
the war, many of these same problems continued to exist because of relocation
of population centers and the need to move more milk. At the same time, these
local milk laws and regulations were being used to protect local markets from
outside supplies. Without federal economic laws to prevent this, local sanitary
regulations were used to prohibit purchase of raw milk outside of that specific
area to control and strengthen the welfare of the local industry. This misuse of
sanitary regulations was the impetus that led to formation of the National Confer-
616 Coleman
ence on Interstate Milk Shipments (NCIMS) (Boosinger, 1983). The first action
really occurred in 1944 when the Committee on Interstate Quarantine of the State
and Territorial Health Authorities Association passed a motion to have the
USPHS publish lists of milk shippers having supplies that were inspected, sam-
pled, and certified as in compliance by state health or other milk control agencies
whose rating procedures had been checked and approved by USPHS. This pro-
posal was sent out for comment to the states and territories, and most of those
who responded were in favor of developing a program of this type.
Over the next 5 years, planning meetings were held, problems were
discussed, and finally the first National Conference on Interstate Milk Ship-
ments was held in St. Louis, Missouri, in June of 1950. Dr. James Rowland,
Director of the Missouri Bureau of Food and Drugs under the Division of
Health, served as the first chairman and set forth the now familiar objective, ‘‘The
best possible milk supply for all the people.’’ The first meeting, attended by
representatives from 22 states and the District of Columbia, adopted the USPHS’s
Recommended Milk Ordinance and Code as its basic regulation. Compliance
with this standard was to be measured by the USPHS milk sanitation rating
method. This remained the basic document as the NCIMS conferences moved
forward on an every other year basis beginning in 1953. Subsequent national
conferences were held in every odd-numbered year through 1995. Two confer-
ences were held in 1997 to evaluate the progress achieved under the cooperative
program, to make constructive improvements, and to clarify operating proce-
dures. A more complete history of the NCIMS can be found in ‘‘The History
and Accomplishments of the National Conference on Interstate Milk Shipments’’
(Boosinger, 1983).
The NCIMS operates under an Agreement between the Conference and the
FDA, and is in the form of a MOU, which became effective August 5, 1977.
This Agreement is based upon principles set forth in the MOU printed in the
‘‘Procedures Governing the Cooperative State-Public Health Service/Food and
Drug Administration Program for Certification of Interstate Milk Shippers’’ (U.S.
Public Health Service, 1999). This MOU, which is the foundation of the interstate
grade A program, is as follows:
A. The Interstate Milk Shippers Program shall be governed by provisions
of the current FDA publication No. 72-2022, ‘‘Procedures Governing
the Cooperative Federal-State Program for Certification of Interstate
Milk Shippers’’ (Procedures Manual), and by documents referenced
therein. Copies of all governing documents are available for review
in the office of the FDA Hearing Clerk.
B. The responsibilities of the NCIMS, participating states, and FDA for
execution of the Interstate Milk Shippers Program shall be stated in
the above referenced Procedures Manual.
Regulatory Control of Milk and Dairy Products 617
C. Failure on the part of any certified state milk sanitation rating officer,
state milk laboratory survey office, or state sampling surveillance of-
ficer to comply with the provisions of this Memorandum or the Proce-
dures Manual shall be sufficient cause for FDA to proceed to a hearing
to provide said rating officer, laboratory survey officer, or sampling
surveillance officer an opportunity to show cause why his/her certifi-
cation or approval should not be revoked.
D. It shall be the right of the NCIMS and each participating state to re-
quest and receive consultation with the appropriate representatives of
the FDA to discuss provisions of this Memorandum or problems en-
countered in execution of provisions of the Procedures Manual. The
initial contact office at FDA for all inquiries pertaining to the Program
is the Bureau of Foods (now Center for Food Safety and Applied Nu-
trition, Milk Safety Branch—HFS-626), FDA, 200 C Street SW,
Washington, DC 20204.
E. It shall be the right of the FDA to request and receive consultation
with appropriate officials of the NCIMS or any of its member states
to discuss the provisions of this Memorandum or problems encoun-
tered in execution of provisions of the Procedures Manual. The Execu-
tive Board of NCIMS can be contacted by FDA personnel through
the Milk Safety Branch at the address indicated in paragraph D, above.
F. Problems of interpretation regarding provisions of the Procedures
Manual and documents referenced therein, or their application, shall
be subject to resolution by mutual agreement of the parties.
G. Changes in provisions of the Procedures Manual and documents re-
ferred to therein, shall be mutually concurred on by NCIMS and FDA.
H. This Memorandum of Understanding may be modified by mutual con-
sent of the parties and may be terminated by either party upon thirty
(30) days advanced written notice to the other. Any modification or
notice of termination will be published in the Federal Register.
The above MOU is the basis for the operation of the NCIMS and provides
for the Constitution and Bylaws under which the Conference operates. The com-
plete set of these documents can be found in the Procedures Manual (U.S. Public
Health Service, 1999).
Any person interested may attend the NCIMS by registering and paying
the required fee. Participation as a voting member is restricted to certified dele-
gates who are representatives of the state rating, and/or state enforcement agen-
cies or like representatives from the District of Columbia, participating U.S. Trust
Territories, and each participating non-U.S. country or political subdivision. The
NCIMS is governed by an Executive Board, which is elected by the voting dele-
gates at the biennial meeting. This Board is composed of 22 members as follows:
618 Coleman
Group I consists of four members from the eastern states. One each from
a state rating agency, state enforcement agency, an industry representa-
tive, and from a state health agency or other state enforcement body.
One at large member is also appointed by the Commissioner to represent
the FDA.
Group II consists of four members from the central states. One from each
of the same type of agencies or bodies set forth in Group I plus one
at large member from an educational institute and one member from a
laboratory.
Group III consists of four members from the western states. One from each
of the same type of agencies or bodies set forth in Groups I and II plus
one at large member appointed by the Secretary of Agriculture to repre-
sent the USDA.
Representatives from any other participating territories, countries, or pol-
itical subdivisions are assigned to either Groups I, II or III by the Executive
Board.
The Executive Board elects a Chairperson and a Vice Chairperson from
its membership after each biennial meeting. The immediate Past Chairperson of
the Board continues to serve as a member of the current Board. The Board also
retains the services of an Executive Secretary. This Executive Board manages
the affairs of the NCIMS and acts for the Conference on emergency matters
deemed appropriate by FDA and/or the members of this Board. The NCIMS
Web site can be accessed at www.ncims.org.
A. Operation of an NCIMS Biennial Conference
A Program Committee and Chairperson are appointed by the Chairperson of the
Executive Board to organize the biennial meeting of the NCIMS. This committee
solicits proposals for changes, additions, or deletions to the PMO, and related
documents as well as to the Constitution and Bylaws. They will then arrange all
submitted proposals in accordance with their subject matter and assign them to
one of three Councils. They may also assign them to specific committees, which
have been established by the Executive Board (e.g., Laboratory, Technical, Drug
Residue), for their consideration and specific recommendations back to a Council.
The structure of the Councils is set forth in the Bylaws of the NCIMS which are
printed in the Procedures Manual (U.S. Public Health Service, 1999).
The Chairperson of the Executive Board appoints a Chairperson and a Vice
Chairperson for each Council, alternating them between regulatory and industry.
The three Councils are made up of 20 members each, 10 representing state rating
or enforcement and 10 representing industry. The industry representatives are to
Regulatory Control of Milk and Dairy Products 619
be divided evenly between producers and processors. These industry persons are
usually recommended to the Council Chairperson by either the International
Dairy Foods Association (IDFA) for dairy processors or by the National Milk
Producers Federation (NMPF) for dairy producers. The Chairperson of the Execu-
tive Board also appoints a consultant to each Council, as does the FDA, and these
individuals act as advisors only and do not vote.
Each of the Councils is set up to deal with specific subject matter and
sections of the Procedures Manual. Council I handles laws and regulations plus
Section I and II of the Procedures Manual. Council II handles responsibilities of
the Conference participants as to reciprocity and cooperation plus Sections V and
VI of the Procedures Manual. Council III handles the application of Conference
agreements and the Constitution and Bylaws plus Sections III, IV, VII, and VIII
of the Procedures Manual. Each Council then deliberates on their assigned pro-
posals and the Council Chairpersons report their action or no-action votes and
recommendations back to the certified voting delegates in the General Assembly
for final delegate action.
Any attendee at the Conference may speak for or against any proposal after
being recognized and asked to speak by either a Council member or delegate of
the General Assembly. Voting, however, is limited to appointed members of a
Council and final action only to certified delegates in the General Assembly. The
one vote given to each state or other participating delegate in the General Assem-
bly may be split in half if there are two agencies responsible for the grade A
program in a state or territory.
If a proposal receives no action in a Council, it may be brought to the floor
of the General Assembly for further consideration, by a delegate as a minority
report, for action by the delegates of the General Assembly. Otherwise it will be
voted no-action by the Conference. Proposals moved forward by positive action
of the three Councils will be discussed and voted on by the certified delegates
in the General Assembly and their action or no-action will determine which pro-
posals will be sent to the FDA for its deliberation and concurrence or nonconcur-
rence.
If upon its deliberation, the FDA feels that any of the NCIMS approved
proposals do not meet what they consider to be the intent of the PMO or its
related documents they can decide to not concur and the change set forth in that
proposal will not be allowed to take effect. Once the NCIMS Executive Board
and the FDA have discussed their differences and agreed upon concurrence, those
changes to the PMO or related documents will become effective in 60 days or
on a later date as may have been set up in one or more of the proposals.
Although this may appear to be a somewhat cumbersome process, the
NCIMS has worked well to keep the PMO and its related documents fairly well
up-to-date. However, with technology advancing at such an accelerated rate, the
620 Coleman
question continually arises as to the ability of the PMO, in its current form, to
meet the future needs of the dairy industry.
B. Grade A Pasteurized Milk Ordinance (PMO)
Currently, the PMO serves as the regulating document for over 97% of the U.S.
milk supply. This figure represents only milk produced at the farm and does not
indicate what will eventually end up in grade A products. Many of the manufac-
turing-grade products, especially cheese, will also be made from milk which,
although produced on a grade A farm, was received and processed in a non–
grade A plant. Processing plants may be under manufacturing-grade regulations
and inspection but their milk supply will quite often be rated under the Interstate
Milk Shipper (IMS) program as being a grade A supply for purposes of interstate
commerce under the PMO.
The PMO provides a regulatory program which each of the states and some
territories have adopted either by reference or in a similar form in their statutes,
laws, or regulations. Enforcement of requirements of the PMO is therefore a
function of a state or local milk control or health agency. Oversight by the FDA is
through the IMS Program, which is published in ‘‘Methods of Making Sanitation
Ratings of Milk Shippers’’ (U.S. Public Health Service, 1999). Through this pro-
gram State Rating Officers, trained and certified by the FDA, evaluate and rate
the inspection and enforcement activities of state or local milk regulatory agen-
cies. Milk supplies or plants that fail to pass one of these ratings must correct
the noted problems and be reinspected, as provided for in the Procedures Manual,
or they will lose the grade A status for that plant or supply and may no longer
be able to ship those affected products as grade A in interstate commerce. The
FDA publishes a quarterly publication ‘‘IMS List, Sanitation Compliance and
Enforcement Ratings of Interstate Milk Shippers’’ (U.S. Public Health Service)
which lists the compliance rating and status of all grade A plants and milk sup-
plies by state and plant number.
In today’s market, losing grade A status can cause a plant serious economic
problems because of the large amount of grade A milk and dairy products that
moves across state lines. Therefore, it is important for producers and processors
to keep up-to-date on changes agreed upon by the NCIMS and FDA and enforced
by their local milk regulatory agency. There are three national associations which
have taken a lead role in this activity: the American Dairy Products Institute
(ADPI), the International Dairy Foods Association (IDFA), and the National Milk
Producers Federation (NMPF). These organizations have been very active in the
NCIMS and also provide training opportunities and publications for their mem-
bers to keep them up-to-date on matters related to milk regulations and changes
in the PMO.
The PMO is a detailed document designed to provide state and/or local
Regulatory Control of Milk and Dairy Products 621
regulatory agencies with a printed ordinance that can be adopted as a legal regula-
tory instrument. It is almost 300 pages long with two main parts and a number
of appendices. Part I is the unabridged form of the Ordinance, which would be
the format required for adoption by a state or local agency. Part II contains the
Ordinance, the public health reasons for each requirement, and the administrative
procedures that are designed to unify the interpretation of the Ordinance and, for
sanitation requirements, provide details as to methods of sanitation compliance.
There are 16 appendices containing explanatory material on various aspects of
milk sanitation technology and administration. Some of the appendices also pro-
vide for mandatory compliance with specific provisions and constitute legal re-
quirements for the PMO.
Contained within the PMO also are chemical, bacteriological, and tempera-
ture requirements for grade A milk and milk products (Table 1). No state can
legislate standards that are less stringent than those in the PMO, but some states
do have more stringent requirements, such as for number of somatic cells. En-
forcement procedures are usually fairly uniform between states. If two of the last
four product samples are out of compliance, a warning letter is issued. Following
that, if three of the last five product samples are out of compliance, further regula-
tory action will be taken. The PMO requires grade A milk and milk products to
be sampled at least four times in 6 months, but most states take regulatory samples
at least monthly.
The PMO itself is divided into 18 sections, with many being divided be-
tween ‘‘r’’ when pertaining to raw milk and ‘‘p’’ when for pasteurized milk:
1—Definitions; 2—Adulterated or Misbranded Milk or Milk Products; 3—
Permits; 4—Labeling; 5—Inspection of Dairy Farms and Plants; 6—Examina-
tion of Milk and Milk Products; 7—Standards for Milk and Milk Products; 8—
Animal Health; 9—Milk and Milk Products Which May Be Sold; 10—Transfer-
ring, Delivery Containers, Cooling; 11—Milk and Milk Products From Beyond
the Limits of Routine Inspection; 12—Future Dairy Farms and Milk Plants; 13—
Personnel Health; 14—Procedure When Infection or High Risk of Infection Is
Discovered; 15—Enforcement; 16—Penalty; 17—Repeal and Date of Effect;
18—Separability Clause.
Under Section 7r are the ‘‘Sanitation Requirements for Grade A Raw Milk
for Pasteurization, Ultra-pasteurization or Aseptic Processing,’’ which contain
19 items to be addressed when evaluating the raw milk supply; these are outlined
in the ‘‘Dairy Farm Inspection Report’’ (Fig. 1). Following those under Section
7p are the ‘‘Sanitation Requirements for Grade A Pasteurized, Ultra-pasteurized
and Aseptically Processed Milk and Milk Products,’’ which contain 22 items to
be addressed when evaluating milk processing plants and pasteurized products;
these are outlined in the ‘‘Milk Plant Inspection Report’’ (Fig. 2). An important
part of the plant inspection is evaluation and inspection of the pasteurization
system. The ‘‘Milk Plant Equipment Test Report’’ (Fig. 3) is used to record these
622 Coleman
Table 1 Grade A Chemical, Bacteriological, and Temperature Standards
from the PMO (USPH, 1997)
Grade A raw milk and milk products Temperature Cooled to 7°C (45°F) or less within 2 h
for pasteurization, ultrapasteuriza- after milking: provided that the blend
tion or aseptic processing temperature after the first and
subsequent milkings does not exceed
10°C (50°F).
Bacterial limits Individual producer milk not to exceed
100,000/mL prior to commingling with
other producer milk.
Not to exceed 300,000/mL as
commingled milk prior to
pasteurization.
Drugs No positive results on drug residue
detection methods as referenced in
Section 6—Laboratory Techniques.
Somatic Cell Individual producer milk: Not to exceed
Count
a
750,000/mL.
Grade A pasteurized milk and milk Temperature Cooled to 7°C (45°F) or less and
products and bulk shipped heat- maintained thereat.
treated milk products Bacterial limits
b
20,000/mL, or gm
c
.
Coliform
d
Not to exceed 10/mL. Provided that in
the case of bulk-milk transport, tank
shipments shall not exceed 100/mL.
Phosphatase
d
Less than 1 μg/mL by the Scharer Rapid
Method. Less than 350 mU/L for fluid
products and less than 500 for other
milk products by the fluorometer or
Charm ALP or equivalent.
Drugs
b
No positive results on drug residue
detection methods as referenced in
Section 6—Laboratory Techniques,
which have been found to be
acceptable for use with pasteurized and
heat-treated milk and milk products.
Grade A aseptically processed milk Temperature None.
and milk products Bacterial limits No growth by test specified in Section 6.
Drugs
b
No positive results on drug residue
detection methods as referenced in
Section 6—Laboratory Techniques,
which have been found to be
acceptable for use with aseptically
processed milk and milk products.
a
Goat’s milk 1000,000/mL.
b
Not applicable to cultured products.
c
Results of the analysis of dairy products which are weighed in order to be analyzed will be reported in
# per gram (see the current edition of the Standard Methods for the Examination of Dairy Products).
d
Not applicable to bulk-shipped heat-treated milk products.
Source: USPH, 1997.
Regulatory Control of Milk and Dairy Products 623
results during the quarterly plant inspection. The State Training Branch of FDA
has published a course manual ‘‘Milk Pasteurization Controls And Tests’’ (U.S.
Public Health Service, 1993) which describes approved types of pasteurization
systems and proper testing methods.
The principle behind these grade A inspection reports is to provide a check
sheet to review periodically (semiannually for farms, quarterly for plants) those
areas or conditions that are most likely to cause milk to become contaminated
or adulterated during production or processing. Out of compliance items are
marked and correction is required, or if conditions are found to be serious enough,
a farm may be taken off the market or a plant shut down until the problem is
corrected. The most critical items on a farm are temperature of milk, health of
cows (antibiotic contamination), and bacterial content of milk, or any factors
impacting on these main points. In a plant, the most critical items are pasteuriza-
tion, cross contamination between raw and pasteurized products, postpasteuriza-
tion contamination, and product temperature, or any factors impacting on these
main points.
The PMO and its overview by the NCIMS in conjunction with the FDA
provides a uniform system for grade A dairy inspection and enforcement through-
out the United States. With movement to incorporate the principles of Hazard
Analysis Critical Control Point (HACCP) into the PMO (see Chap. 15), it should
even better serve future needs of the dairy industry.
C. PMO-Related Documents and Programs
The PMO is the main regulatory document, but there are other programs designed
to work in conjunction with it and cover such areas as sampling, laboratory certi-
fication, and other grade A products. These programs are outlined in the Proce-
dures Manual and detailed in other documents as follows:
1. Grade A Condensed and Dry Milk Ordinance (DMO)
The DMO (U.S. Public Health Service, 1995) was developed as a supplement
to the PMO specifically to cover the manufacture of condensed milk, dry milk,
and whey products intended for use in commercial preparation of grade A pas-
teurized milk products. The NCIMS recognized the need for such a document
to reflect more accurately sanitary quality comparable to grade A market milk,
which would be different from that required under recommended manufacturing-
grade regulations. The format of the DMO is similar to the PMO, and deviations
in content relate mostly to practices that are specific to the condensing and drying
process. It is intended to cover production of condensed milk, dry milk, and
whey products that are acceptable to state and local regulatory agencies for use
in processing grade A pasteurized milk products.
624
Coleman
Regulatory
Control
of
Milk
and
Dairy
Products
625
Figure 1 Grade A dairy farm inspection report, FDA form 2359a. (USPH, 1997)
626
Coleman
Regulatory
Control
of
Milk
and
Dairy
Products
627
Figure 2 Grade A milk plant inspection report, FDA form 2359. (USPH, 1997)
628
Coleman
Regulatory
Control
of
Milk
and
Dairy
Products
629
Figure 3 Grade A milk plant equipment test report, FDA form 2359b. (USPH, 1997)
630 Coleman
2. Standards for the Fabrication of Single-Service Containers
and Closures (SSCC)
The SSCC (U.S. Public Health Service, 1999) provides a means to deter-
mine acceptability of manufacturing plants and processors of single-service
containers and closures to be used for packaging grade A milk and dairy pro-
ducts. It contains an inspection program designed to prevent contamination
of these types of containers during manufacture and before being filled with
product. A list of approved plants and processors appears quarterly in the ‘‘IMS
List, Sanitation Compliance and Enforcement Ratings of Interstate Milk Ship-
pers’’ (U.S. Public Health Service). Only the listed sources that are currently
approved can supply containers or packaging materials for use with grade A
products.
The SSCC has been incorporated into the 1999 revision of the PMO, as
directed by the 1999 NCIMS, but should also be available again as a separate
document.
3. Evaluation of Milk Laboratories (EML)
The EML (U.S. Public Health Service, 1995) is the publication that covers the
IMS sampling procedures used to collect milk and milk products, test containers
and closures, examine milk and milk products, and test for vitamin content. All
sampling and laboratory procedures must conform to those in the latest edition
of Standard Methods for the Examination of Dairy Products (Marshall, 1992)
and/or the Official Methods of Analysis of the Association of Analytical Chemists
(Cunniff, 1998).
Milk haulers and all other personnel who collect samples of grade A raw
milk from individual producers or finished products from plants are required to
be evaluated and certified by an FDA-approved State Sampling Surveillance Of-
ficer. A detailed evaluation form, FDA form No. 2399 a, is used to certify these
individuals (Fig. 4). An evaluation and certification of every sampler is required
once in every 24-month period.
Appendix B of the PMO (1999 revision) has been rewritten to cover in
more detail the sampling, hauling, and transportation of grade A milk and also
the new requirements for bulk milk pick-up tanker permits and inspection.
The EML details a similar evaluation and certification program for grade
A milk laboratories. Every laboratory that analyzes grade A milk and/or milk
products must be evaluated and certified by a State Laboratory Evaluation Officer
once in every 24-month period. Every approved method of analysis used by a
laboratory must be evaluated using a separate specialized FDA form No. 2400.
Only a portion of one of these forms is shown as an example (Fig. 5), as these
forms tend to be quite detailed and can be rather lengthy. Also each laboratory
Regulatory Control of Milk and Dairy Products 631
Figure 4 Grade A bulk milk pickup tanker, hauler report, and sampler evaluation form,
FDA form 2399a. (USPH, 1997)
632
Coleman
Regulatory
Control
of
Milk
and
Dairy
Products
633
Figure 5 A portion of a grade A milk laboratory evaluation form, as a format example of one of the many FDA 2400 forms used
as part of the EML. (USPH, 1995)
634 Coleman
analyst must be evaluated and certified for each procedure he/she uses to test
grade A milk or milk products once in every 24-month period.
Annually, each certified laboratory receives a set of split milk samples for
analysis using the methods that have been certified for the laboratory and its
analysts. Submitted results will be compared to those established for split samples
by the FDA-certified Official State Laboratory. Laboratories with results outside
of the logarithmic mean (rejection limit) for these split samples will have to be
recertified to prevent losing their ability officially to test grade A milk and milk
products. All currently certified grade A laboratories are also listed in the quar-
terly publication ‘‘IMS List, Sanitation Compliance and Enforcement Ratings of
Interstate Milk Shippers’’ (U.S. Public Health Service).
4. Methods for Making Sanitation Ratings
of Milk Supplies (MMSR)
The MMSR (U.S. Public Health Service, 1999) is the document used to determine
compliance with sanitation and enforcement procedures contained in the PMO
and related documents. The object of a rating is to provide an assessment of
state and local regulatory agencies’ sanitation activities regarding public health
protection and milk quality control, as provided for in the PMO and the Proce-
dures Manual. Rating results provide a means of determining the degree of com-
pliance with public health standards and also provide a basis for acceptance/
rejection of milk shippers by public health officials beyond the limits of local
routine inspections. These ratings are intended to establish uniform reciprocity
between states to prevent unnecessary restrictions on the interstate flow of grade
A milk and milk products. These ratings are conducted by State Milk Sanitation
Rating Officers who have been trained and certified by the FDA to conduct such
ratings in their state or territory. The FDA will also conduct a recertification of
each State Milk Sanitation Rating Officer once every 3 years.
IMS ratings are scored on a basis of 100 points, with 90 being the required
passing score. However, under certain conditions, as outlined in the MMSR,
scores lower than 90 may be acceptable. The exact method of calculating a rating
score for a plant or for a milk supply, referred to as a bulk tank unit (BTU), is
detailed in the MMSR document. Every grade A plant and/or BTU must be rated
once in every 24-month period. If a plant or BTU receives a rating score below
90 or as otherwise allowed by the MMSR, it must be resurveyed and receive a
passing score to maintain its grade A status. All grade A plants and BTUs are
listed in the quarterly publication ‘‘IMS List, Sanitation Compliance and Enforce-
ment Ratings of Interstate Milk Shippers’’ (U.S. Public Health Service). This
publication is arranged by state and plant number and also lists the grade A
products approved for each plant along with the current rating score and the most
recent date the rating was published.
Regulatory Control of Milk and Dairy Products 635
The FDA conducts a number of annual, random check ratings within each
state to review and verify the current rating score that has been assigned to a plant
or BTU by a State Milk Sanitation Rating Officer. If the rating score calculated by
the FDA in a check rating is below 85 for farms (BTU) or below 81 for plants,
then that BTU or plant must be resurveyed by the state within 60 days and found
to be in compliance or it will lose its grade A status. These check ratings are
done in addition to the regular IMS ratings conducted by the State Rating Officers.
IV. USDA MANUFACTURING–GRADE PROGRAM
The manufacturing-grade standards (USDA, 1996) cover the recommended re-
quirements for both farms and plants, but with manufacturing-grade raw milk
making up less than 3% of the total raw milk supply in the United States, the
main focus of these requirements now is more toward manufacturing plants than
farms. USDA has no legal responsibility for enforcement within a state of ‘‘Milk
for Manufacturing Purposes and Its Production and Processing, Recommended
Requirements’’ (USDA, 1996). It is the responsibility of each state to adopt and
enforce these recommended requirements. The Agricultural Marketing Act of
1946 grants authority to USDA to act only in an advisory capacity to aid with
interpretation and to promote the purpose and intent of the requirements as they
have been published in the Federal Register. In addition, USDA continues to
review and update these recommended requirements as is necessary to meet the
needs of the states and their manufacturing-grade dairy industry.
In conjunction with this program, USDA also offers a voluntary inspection
and grading service to manufacturing plants on a fee-for-service basis. It is the
intent of this program to provide for consistently uniform high-quality dairy prod-
ucts, which can then carry an official government identification and grade (i.e.,
U.S. Grade AA, A, B, C, Extra or Standard). To obtain this approval, a plant
must be surveyed under the inspection and grading services program as given in
‘‘General Specifications for Dairy Plants Approved for USDA Inspection and
Grading Service’’ (USDA, 1995). This program provides for surveying the prem-
ises, equipment, facilities, operation methods, and raw milk quality for adequate
compliance so a plant is eligible for inspection and grading services. A resident
grading service can also be provided where a USDA Grader is assigned to an
eligible plant or station on a continuous basis; otherwise a Grader is provided as
needed by the plant. Failure by an approved plant to maintain these USDA prod-
uct or process standards could lead to loss of their eligible status.
Manufacturing-grade dairy products purchased by the federal government
for use, distribution, or storage under various government programs, with few
exceptions, come from eligible plants covered by the USDA inspection and grad-
ing services program.
636 Coleman
V. 3-A SANITARY STANDARDS
The objective of the 3-A Sanitary Standards Committees is to formulate standards
and accepted practices for equipment and systems used to process milk, milk
products, and other perishable foods. The International Association of Food In-
dustry Suppliers (IAFIS) is the secretariat and the International Association for
Food Protection (IAFP) through the Committee on Sanitary Procedures repre-
sents the regulatory stakeholders to the 3-A program (IAFIS, 1999). The dairy
processors are represented by IDFA, ADPI, and the American Butter Institute.
There are more than 50 3-A Equipment Task Committees staffed by volun-
teers who support the activities of this program. Most dairy and food regulatory
programs have incorporated the 3-A criteria as part of their regulations for both
grade A and manufacturing-grade farms and plants. In addition, the 3-A Secretary
and 3-A Steering Committee members provide the interface with two European
and two international hygienic standards developers and also with the NSF Inter-
national.
The 3-A Committees and their partners seek voluntary consensus to dis-
cover solutions to sanitary problems in construction and operation of dairy and
food processing equipment. For over 70 years, processors have known they will
be in compliance with applicable sanitary codes for equipment and processes
that have received approval by the 3-A Sanitary Standards Committee. Equip-
ment manufacturers also know that equipment fabricated in conformance to 3-
A Sanitary Standards will receive universal acceptance from processors and regu-
lators.
A. Preparation of a 3-A Sanitary Standard
or Accepted Practice
A proposal request is sent to the 3-A Secretary’s office and is then routed to the
3-A Steering Committee, who will assign the proposal to the appropriate Task
Committees for study and preparation of the initial draft document. The 3-A
Secretary incorporates the comments of all assigned committees and prepares a
redraft. The redraft is distributed to the Task Committee to vote acceptance. The
draft is then circulated to the technical committee and user group or other appro-
priate organizations until initial acceptance is achieved. The draft is then sent to
the Committee on Sanitary Procedures/USPHS for review and acceptance. When
all comments have been resolved at a plenary session of tripartite 3-A Commit-
tees, final adoption for signing and publication is based on the affirmation vote
of all 3-A Sanitary Standards Committees. The 3-A Secretary then prepares the
document for final review and validation. New standards and accepted practices
or revisions and amendments to existing documents become effective 6 months
after receiving the validating signatures.
Regulatory Control of Milk and Dairy Products 637
3-A Sanitary Standards consist of six main parts; (a) scope of the Standard,
(b) definition of the terms used in the Standard, (c) description of the permit-
ted materials of the equipment, (d) details of the fabrication of the equipment,
(e) appendix of references and special considerations, and (f) effective date.
Equipment manufacturers who wish to display the 3-A symbol on their
equipment must apply to the 3-A Sanitary Standards Symbol Administrative
Council. They must also submit the required supporting documents and self-
declarative statement to receive approval. These authorizations to display the 3-A
symbol are reviewed annually and can be amended as the manufacturer desires
and can also be withdrawn for noncompliance by the Council.
Publication of the actions by the 3-A Committees takes place in Dairy,
Food and Environmental Sanitation (IAFP) periodically during each year. Appro-
priate 3-A Committees review each standard at least once every 5 years. Sets of
‘‘3-A Sanitary Standards and Accepted Practices’’ are available through the Web
site, www.3-A.org.
VI. OTHER REGULATORY PROGRAMS AFFECTING
THE DAIRY INDUSTRY
As one of the most regulated industries, dairy farms and plants are affected to
various degrees by several federal, state, and local regulatory agencies and pro-
grams other than the basic inspection-type programs covered in the earlier parts
of this chapter. Although many of these do not directly impact on the microbial
quality, they all in some way could impact on the overall quality, safety, and
acceptance of the industry and its products. It would be virtually impossible to
mention every one and discuss each in much detail, as they can vary from state to
state or region to region. The following are a few which might be of considerable
significance to the overall industry.
A. Food Labeling Laws
Although product labeling is covered under Section 4 and Appendix L of the
PMO, it also references other federal documents, the ‘‘Federal Food, Drug, and
Cosmetic Act’’ (FDCA) as amended, the ‘‘Nutrition Labeling and Education Act
of 1990’’ (NLEA), and the Code of Federal Regulations (CFR) along with ‘‘Title
21’’ of the Code (21CFR).
1. Federal Food, Drug, and Cosmetic Act (FDCA)
The FDCA is the primary law under which the U.S. government acts to prevent
adulteration and misbranding of the food supply. It contains general requirements
638 Coleman
for foods, drugs, and cosmetics as well as sections that deal specifically with
requirements for each. Section 401 provides the definitions and standards used
in the PMO, but it also contains literally hundreds of other food product standards
along with standards for most of the major dairy products. Other sections of the
FDCA listed here also contain regulations of importance to the dairy industry:
Sec. 402—Adulterated Food, Sec. 403—Misbranded Food, Sec. 408—Toler-
ances for Pesticides Chemicals, Sec. 409—Food Additives, Sec. 411—Vitamins
and Minerals, Sec. 701—Regulations and Hearings, Sec. 702—Examinations and
Investigations, Sec. 703—Records of Interstate Shipments, Sec. 704—Factory
Inspections, Sec. 705—Publicity, Sec. 706—Listing and Certification of Color
Additives, Sec. 707—Advertising of Certain Foods, and Sec. 801—Imports.
With some part in each of these sections having an impact on the dairy industry,
this document and the Code of Federal Regulations should be familiar to every
dairy plant operator (Vetter, 1996).
2. Title 21 of the Code of Federal Regulations (21CFR)
The FDCA is the law that establishes the authority of FDA to regulate food
products. 21CFR contains all rules promulgated and amended by the FDA for
enforcement of laws pertaining to food products over which it has been given
jurisdiction. These are contained in a nine-volume set of books, with the first
three volumes dealing with food, the remaining six dealing with drugs, cosmetics,
and medical devices. Updates are published every fall and include new and modi-
fied regulations that were finalized before April 1 of that year.
3. Fair Packaging and Labeling Act (FPLA) of 1966 and the
Nutrition Labeling and Education Act (NLEA) of 1990
The purpose of the FPLA is to provide consumers with information on which to
make purchasing decisions. This is accomplished by standardizing the specific
size, type, and location of information on quantity and contents of a food package,
which also better facilitates value comparisons. The details of where and how
required information is presented on labels or in labeling are provided in regula-
tions found in 21CFR.
NLEA of 1990 mandated nutritional labeling for FDA-regulated foods. Al-
though not required by law, USDA promulgated nutrition labeling regulations
for meat and poultry very similar to those for FDA-regulated food products. The
detailed requirements for declaring nutritional information are found in 21CFR
101.9 for FDA-regulated food and 9CFR 317 for meat and 9CFR 381 for poultry.
The total nutritional labeling regulation is very long and detailed but there is
some specific information that must always be present on a regulated food label.
This includes serving size, number of servings, declarations per serving of calo-
ries, and calories from fat. Also included are the content and percentage of daily
Regulatory Control of Milk and Dairy Products 639
value for the following: total fat, saturated fat, cholesterol, sodium, total carbohy-
drate, dietary fiber, sugars, and protein. Included must also be percentage of daily
value of vitamins A and C, calcium, and iron. Other values required by the regula-
tion to be stated on a label will depend on additions and declarations made for
a specific food product. Examples of standard formats for a nutritional facts panel
along with other general information on proper product labeling can be found in
the FDA publication ‘‘A Food Labeling Guide’’ (USPH, 1999). There are many
other types and variations of these basic formats that are described in more detail
in the complete NLEA regulations presented in 21CFR 101.9.
B. Food Product Recalls
The primary purpose of a food product recall is to protect consumers from a
potential health hazard, severe economic deception, or other major violation of
the FDCA. A withdrawal of product is classified as one of the following three
general types:
1. ‘‘Stock Recovery,’’ the removal of a violative product that is still under
the control of the manufacturer.
2. ‘‘Market Withdrawal,’’ the removal of a product that is an insignificant
violation or may just be of a lesser quality than a manufacturer might
desire.
3. ‘‘Recall,’’ the removal of violative product that represents a potential
hazard to consumers or is a serious violation of the FDCA.
The FDA defines three classes of recalls in 21CFR 7.3 based on the seri-
ousness of the violation of the food product to the FDCA:
? Class I. Reasonable probability that use of the product will cause seri-
ous adverse health consequences or death.
? Class II. It may cause temporary or medically reversible adverse health
consequences but the probability of serious adverse health conse-
quences is remote.
? Class III. It is not likely to cause adverse health consequences but may
have a physical defect or some type of contamination of no real health
significance.
Recalls, for the most part, are voluntary. FDA has no authority to order a
recall, but it can threaten a seizure action if the company does not offer to recall
the violative product. Although recalls are voluntary, in 21CFR 7 there is a set
of guidelines that companies have found to be desirable and beneficial to follow
when recalling a product. Notifying FDA of a recall is not required but is a good
idea, as the agency will be of great assistance in establishing the class and effec-
tive recall plan. The agency can also be of assistance in determining the cause
640 Coleman
and in helping to correct the problem. FDA will also notify the appropriate state
agency to help in development of a basic plan of action and to oversee the effec-
tiveness of the recall. Should a company or state agency not act appropriately in
carrying out the recall or in correcting the cause, FDA is prepared to step in and
take the necessary enforcement action to protect the public health. When a recall
has effectively removed all products in question, FDA will then issue a written
notification that the recall is terminated.
It is important that a company be prepared to handle a recall by having a
written plan to conduct the recall, a coding system to identify all products pro-
duced, and distribution records for all products.
C. Other Federal Agencies Impacting on the Dairy
Industry
Other than those mentioned earlier in this chapter, there are the following, which
depending on the production facility, processing plant, or product, could have
some regulatory impact:
? Environmental Protection Agency (EPA)
? Occupational Safety and Health Administration (OSHA)
? Federal Trade Commission (FTC)
? U.S. Department of Commerce (USDC)
? Bureau of Alcohol, Tobacco, and Firearms (ATF)
? U.S. Department of Labor (USDL)
Of those listed above, EPA and OSHA are the two most likely to have an
impact on the entire industry. As environmental concerns continue to rise, such
as soil and water pollution, the EPA will be monitoring both farms and plants
very closely to see that any expansions or changes will not negatively impact
the environment. Although this can be an economic burden to the industry in
some instances, it can also help in protection and safety of products produced.
A similar point can be made for OSHA, as this agency not only is interested
in protecting the safety of workers and the workplace but also in protecting prod-
ucts from potential contamination.
In addition to these federal agencies, there may also be similar state and
local agencies that will not only be enforcing federal laws and regulations but
also their own additions and variations, especially in environmental protection.
Dairy producers as well as processors need to be aware of the various laws and
regulations that so carefully control what they do and how they do it even though
at times this can seem a bit overwhelming.
The U.S. dairy industry, through all of its regulatory concerns and frustra-
tions, continues to demonstrate its ability to produce and process the safest and
most wholesome dairy products possible.
Regulatory Control of Milk and Dairy Products 641
VII. FUTURE OF DAIRY REGULATION
The issue of food safety will remain the number one concern for dairy regulatory
control agencies as well as for the industry itself. It is, for example, becoming
more important to the industry to determine what microorganisms are present
and their likely origin than just to determine the total number present, as in current
regulations. Therefore development of a strong HACCP-based program from the
farm to the consumer will be important in dealing with this type of need for new
and different information. This in turn will impact on the future of dairy regula-
tions, meaning more involvement of the dairy industry in its own regulation, a
definite change from the current system. Both state and federal regulatory pro-
grams will begin to change from the physical type inspection to more of an
auditing type of oversight to verify that a product produced and processed can be
documented as ‘‘safe.’’ This type of ‘‘risk’’-based system will provide a means
for the industry to document to the oversight agencies, its ability to detect problems
related to food safety, and make corrections before distribution and sale of its
products. Although much of the food industry has already moved in the direction
of HACCP, it will be a bigger step for regulatory agencies to adjust to this change.
With the expanding significance of global trade, the need for a more univer-
sal food code will be paramount in the near future. The Food and Agriculture
Organization (FAO) and the World Health Organization (WHO) have set up a
Codex Alimentarius Commission and Subsidiary Bodies that presents a unique
opportunity for all countries to join the international community in formulating
food standards and working toward their global implementation. Development
of the dairy portion of the Codex has been in process for some time and will be of
significance in governing the hygienic processing practices and recommendations
relating to compliance with dairy product standards that can be adopted globally.
The FDA, USDA, and other government and industry representatives have been
participating on Codex committees and as members of the Commission to repre-
sent the interests of the United States. The future of international trade will be
dependent on the successful completion of this effort, as will protection of public
health and fair practices in the future of global food trade.
Movement to such a system should also aid in consolidation of many of
the regulatory activities by multiple agencies, as everyone’s ultimate goal is to
be able to document the quality and safety of all food products. With HACCP-
based industry and regulatory programs that foster cooperation between the in-
dustry and its oversight agencies and development of an international food code,
there should continue to be a strengthening of consumer confidence in dairy prod-
ucts, as well as all food products no matter where they are produced or processed.
Dairy regulatory programs of the future will likely continue to develop
along the lines of cooperation and consolidation to promote the continued empha-
sis toward a global assurance of food safety.
642 Coleman
REFERENCES
Boosinger J. The History and Accomplishments of the National Conference on Interstate
Milk Shipments. Frankfort, KY: National Conference on Interstate Milk Shipments,
1983.
Cunniff P, ed. Official Methods of Analysis of AOAC International. 16th ed. 4th rev.
Gaithersburg, MD: Association of Analytical Chemists, 1998.
International Association for Food Protection. Dairy, Food, and Environmental Sanitation.
Des Moines, IA: IAFP, monthly publication.
International Association of Food Industry Suppliers, The 3-A Story. McLean, VA: Inter-
national Association of Food Industry Suppliers, 1999.
Marshall RT, ed. Standard Methods for the Examination of Dairy Products. 16th ed. Wash-
ington, DC: American Public Health Association, 1992.
Sinclair U. The Jungle. New York, NY: Bantam Books, 1981.
U.S. Department of Agriculture, Agricultural Marketing Service. Milk for Manufacturing
Purposes and its Production and Processing, Recommended Requirements. Wash-
ington, DC: US Government Printing Office, 1996.
U.S. Department of Agriculture, Agricultural Marketing Service. General Specifications
for Dairy Plants Approved for USDA Inspection and Grading Service. Washington,
DC: US Government Printing Office, 1995.
U.S. Department of Health and Human Services, Food and Drug Administration. Code
of Federal Regulations, Title 21. Washington, DC: US Government Printing Office,
1999.
U.S. Public Health Service. Evaluation of Milk Laboratories, 1995 revision. Washington,
DC: U.S. Department of Health and Human Services, Public Health Service, Food
and Drug Administration, 1995.
U.S. Public Health Service. A Food Labeling Guide, 1999 revision. Washington, DC: US
Department of Health and Human Services, Public Health Service, Food and Drug
Administration, 1999.
U.S. Public Health Service. Grade A Condensed and Dry Milk Ordinance, 1995 revision.
Washington, DC: US Department of Health and Human Services, Public Health
Service, Food and Drug Administration, 1995.
U.S. Public Health Service. Grade A Pasteurized Milk Ordinance, Publication No. 229,
1999 revision. Washington, DC: US Department of Health and Human Services,
Public Health Service, Food and Drug Administration, 1999.
U.S. Public Health Service. A Brief History of U.S. Food and Cosmetic Acts and Regula-
tions Administered by FDA. Washington, DC: US Department of Health and Hu-
man Services, Public Health Service, Food and Drug Administration, Center for
Food Safety and Applied Nutrition, 1987.
U.S. Public Health Service. IMS List, Sanitation Compliance and Enforcement Ratings
of Interstate Milk Shippers, Quarterly publication. Washington, DC: US Depart-
ment of Health and Human Services, Public Health Service, Food and Drug Admin-
istration, 1999.
U.S. Public Health Service. Methods for Making Sanitation Ratings of Milk Shippers,
Regulatory Control of Milk and Dairy Products 643
1999 revision. Washington, DC: US Department of Health and Human Services,
Public Health Service, Food and Drug Administration, 1999.
U.S. Public Health Service. Milk Pasteurization Controls and Tests, 4th ed. Washington,
DC: US Department of Public Health and Human Services, Public Health Service,
Food and Drug Administration, State Training Branch, 1993.
U.S. Public Health Service. Procedures Governing the Cooperative State-Public Health
Service/Food and Drug Administration Program for Certification of Interstate Milk
Shippers, 1999 revision. Washington, DC: US Department of Health and Human
Services, Public Health Service, Food and Drug Administration, 1999.
U.S. Public Health Service. Standards for the Fabrication of Single Service Containers and
Closures, 1999 revision. Washington, DC: US Department of Health and Human
Services, Public Health Service, Food and Drug Administration, 1999.
Vetter JL, Food Laws and Regulations, Manhattan, KS: American Institute of Baking,
1996.
17
Testing of Milk and Milk Products
Charles H. White
Mississippi State University
Mississippi State, Mississippi
I. INTRODUCTION
Microbiological testing in the dairy plant is critical to ensure that raw milk, other
ingredients, and finished products are of high quality. Such testing also serves
to verify the adequacy of Hazard Analysis Critical Control Point (HACCP) proce-
dures. Testing for pathogens is normally not done in the dairy plant, but samples
are sent to a laboratory located far enough from the plant to preclude introduction
of unwanted microorganisms through manipulations in the laboratory (see Chaps.
13, 15, and 16).
This chapter lists the chemical, microbiological, and physical tests that
might be done on incoming raw milk and considers the specific microbial aspects
of raw milk quality. Also discussed are testing of raw milk and raw ingredients,
line sampling, and tests for predicting shelf life of products, testing of various
types of dairy products, and the future of testing of milk and milk products.
II. RAW MILK QUALITY
A. General
There are many ways to measure the quality of raw milk. Some of the tests that
are done by dairy processing plants either before or after unloading a tanker of
milk include the following:
1. Standard plate count (SPC)
2. Direct microscopic count (DMC)
645
646 White
3. Freezing point determination (cryoscope)
4. Presence of inhibitory substances (antibiotic screening test)
5. Sensory evaluation
6. Preliminary incubation (PI–SPC)
7. Direct microscopic somatic cell count (DMSCC)
8. Acid degree value (ADV)
9. Laboratory pasteurization count (LPC)
10. Thermoduric spore count
11. Fat content
12. Total solids content (can also include protein content)
13. Sediment test
14. Presence of aflatoxins
15. Temperature
In addition, the weight (total quantity of milk) of the tanker is obtained to
ensure proper payment to dairy farmers and to ensure that the processing plant
is receiving all the milk for which it is making payment. However, compositional
and chemical quality factors are always important.
Some of the aforementioned tests should be done before unloading the
tanker. There is a definite time restraint involved with receiving and unloading
a tank load of milk; however, the processor, not the producer, is the customer
and should take a reasonable amount of time to obtain satisfactory results from
the tests selected. It is recommended that the following tests be done on each
tanker load of raw milk before unloading: DMC (until a more definitive test can
be done in the same amount of time—bioluminescence may be this test), antibi-
otic screening test, cryoscope for added water, temperature, and sensory evalua-
tion, which should involve checking the odor of the tanker followed by heating
the milk and rapid cooling to taste the sample.
Compositional tests (e.g., tests for fat and total solids) should be done on
every tanker of milk, although not necessarily before unloading. If the tanker
load of milk is from independent producers, tests for abnormal milk, such as
DMSCC, are also needed. Most other tests can be used as troubleshooting tests
if there is a shelf life problem.
Some tests are good for troubleshooting purposes. If shelf life problems
are of concern, the first step would be to verify the quality of the raw milk. An
example would be to use the laboratory pasteurization count (LPC) as a way of
determining whether or not there are a significant number of thermoduric bacteria
present. As a general rule, if the LPC exceeds 500 cfu/mL, a major thermoduric
problem exists in the raw milk supply.
Another problem which still occurs is that of ‘‘ropy’’ milk. Alcaligenes visco-
lactis is considered to be the primary cause of this defect. Other bacteria can cause
varying degrees of ropiness in milk. This particular defect is extremely unpleasant
to the consumer and must be detected and prevented by the processor. The major
Testing of Milk and Milk Products 647
cause of ropiness is improperly cleaned equipment at the dairy farm. This can
either be in the milking parlor or in the bulk storage tank. Most of the bacteria
causing ropiness are gram negative and are destroyed by pasteurization; however,
just as we have concerns with cross contamination (from raw to pasteurized/pack-
aging area) with Listeria monocytogenes and other potential milkborne pathogens,
if Alcaligenes gets into the plant, a major problem can result.
Although the flavor of ropy milk normally is not distinguishable from normal
milk, the long threads, or rope, can be pronounced and unforgettable. Johnson
(Johnson P., Randolph Assoc, Apr. 2000) described a procedure for testing for ropy
milk (if ropiness is a problem, raw milk from every raw tanker should be tested).
1. Incubate sample at 15.5–18.3°C (60–65°F) for 12–24 h. Temperatures
as high as 21°C (70°F) may be used, but interference from acid-producing bacte-
ria may be experienced.
2. Following incubation, insert a needle (match stick, small-bore pipette,
etc., will do) at several locations on the surface, and slowly withdraw it.
3. Any strings
1
/4-inch or longer would be considered to be a positive test
for ropiness (Johnson P., Randolph Assoc, 2000).
The number of dairy farms has been decreasing steadily to the point where
most of the dairy farmers in business (just as with the processors) take their jobs
very seriously. As a result, the quality of raw milk is very good. This is not to imply
that all raw milk is of excellent quality and cannot be improved. In 1982, Zall et al.
summarized results of the SPC, psychrotrophic bacteria count (PBC), and ADV
tests of raw milk held at 6.7°C for 0, 3, or 6 days. A summary of their results follows:
Day of storage at 6.7°C
a
Test (mean) 0 3 6
SPC 4.92
b
7.36 8.39
PBC 4.45 6.77 8.46
ADV 0.80 1.38 4.89
a
Summarized from Zall et al. (1982).
b
Counts expressed in log numbers.
The above data indicate the practical importance of the legal limit of hold-
ing raw milk no more than 72 h. At 3 days’ storage, the PBC had increased to
a level which produces significant amounts of heat-stable proteases and lipases.
This occurrence can be especially damaging to cheese processors. In addition,
the ADV had increased to a point at which rancidity could be detected. This
rancid flavor cannot be eliminated; rather the intensity continues to increase. At-
tempts to camouflage this off-flavor are futile; if the milk with a high ADV was
to be added to chocolate ice cream mix, the resulting chocolate ice cream would
have a rancid flavor.
648 White
Figure 1 QA technician determining estimate of somatic cell numbers in raw milk using
the latest instrument. (Photograph courtesy of Mayfield Dairies and Dean Foods Company,
Athens, TN.)
There was a substantial increase in bacterial numbers regardless of type
whether mesophilic or psychrotrophic. The legal SPC standard for raw milk is
100,000 cfu/mL (individual producer) or 300,000 cfu/mL (commingled) milk.
Individual raw milk can consistently be produced with less than 10,000 cfu/mL.
Counts in tanker loads of milk vary from less than 10,000 to greater than
1,000,000 cfu/mL. The count in most raw milk (tanker loads) currently being
received at fluid milk plants in the United States ranges from 30,000 to 70,000
cfu/mL.
The changes in the standard for the DMSCC from 1,000,000 to 750,000
cells/mL indicate an improvement in raw milk quality. Although there is no
rule about increased bacterial numbers with increased somatic cell counts, this
correlation does appear to exist. Within the next few years, it is likely that this
standard will be reduced even further; for example, to 500,000/mL. (Figs. 1–6.)
Testing of Milk and Milk Products 649
Figure 2 QA technician measuring freezing point of milk to check for added water.
(Photograph courtesy of Mayfield Dairies and Dean Foods Company, Athens, TN.)
B. Raw Milk Microflora (see also Chapter 2)
According to one recent study (Celestino et al., 1996), gram-positive bacteria are
present in raw milk in much smaller numbers than gram-negative species. These
workers reported on numbers of Pseudomonas as well as other gram-negative
and gram-positive bacteria in both farm bulk tanks and in creamery and plant
silos. In farm bulk tanks, regardless of temperature, pseudomonads represented
more than 80% of all bacterial isolates. The gram-positive bacteria in milk at the
farm bulk tank in this study represented no more than 1% of the total. When the
milk was commingled in creamery silos, the pseudomonads represented approxi-
Figure 3 QA technician measuring fat content of raw milk using Babcock method—
note safety equipment required (apron, gloves, goggles). (Photograph courtesy of Mayfield
Dairies and Dean Foods Company, Athens, TN.)
Figure 4 Automated method of fat and total solids measurement for milk and milk
products. (Photograph courtesy of Mayfield Dairies and Dean Foods Company, Athens,
TN.)
Figure 5 QA/receiving technician screens incoming raw milk for antibiotics/inhibitory
substances. (Photograph courtesy of Mayfield Dairies and Dean Foods Company, Athens,
TN.)
Figure 6 QA technician doing DMC on incoming raw milk. (Photograph courtesy of
Mayfield Dairies and Dean Foods Company, Athens, TN.)
652 White
mately 70% of the microflora. The gram-positive bacteria increased to 9.0% to
14.1%, depending on temperature. Members of the family Enterobacteriaceae
represented up to 15% of the total microflora of milk in the creamery silos.
Celestino et al. (1996) made a most significant conclusion: ‘‘As the quality
of pasteurized milk improves because of reduction in levels of postpasteuriza-
tion contamination, the presence of a heat-resistant psychrotrophic bacteria in
the milk supply will assume greater importance.’’ Of these, spore-forming
microorganisms such as Bacillus are the most important. Work in Griffiths’
laboratory was reported by these researchers, which indicated that higher heat
treatments applied to the milk (70°C rather than 60°C) tended to decrease spore
counts, presumably because of the activation of spores, which could subsequently
germinate and divide. Using this as evidence, they cautioned that an increase in
pasteurization temperature does not necessarily result in an increased shelf life.
This has been the tendency of many processors over the past 15 years (since
Listeria and Salmonella became known to the dairy industry).
C. Spore Formers
It might be concluded that the higher the quality of raw milk, the higher will be the
incidence of gram-positive spore-forming bacteria. According to Martin (1974),
Bacillus species account for 95% of the total spore-forming bacteria in milk, with
Clostridium species comprising the remaining 5%. He indicated that, in the
United States, 43% of Bacillus organisms are B. licheniformis and 37% are B.
cereus; however, in other countries, B. cereus is predominant. The data in Table
1 (Martin, 1981) indicate that spore-forming bacteria are expected to be present
in almost all raw milk supplies. As the dairy processing industry becomes more
involved with extended shelf life (ESL) products, the problem with spore-forming
bacilli will probably increase. Thus, an aerobic spore count (80°C for 12 min
followed by rapid cooling and plating on plate count agar (PCA) with incubation
of plates at 32°C for 48 hours) will become a vital microbiological test for raw
milk.
D. Psychrotrophic Bacteria
A simple definition of psychrotrophic bacteria is those bacteria that can grow
fairly rapidly at refrigeration temperatures. A psychrotroph is unlike a true psy-
chrophile, which is a bacterium whose optimal growth temperature is 10°Cor
less. There are not many psychrophiles encountered in the dairy industry. In raw
milk, the larger the percentage of psychrotrophic bacteria, the greater the number
of problems encountered by the dairy processor using such raw milk. A typical
psychrotroph (e.g., a pseudomonad) could conservatively have a generation time
(the length of time a bacterial population requires to double in numbers) of 9 h
Testing
of
Milk
and
Milk
Products
653
Table 1 Standard Plate Counts and Aerobic Spore Counts of Raw Milk
a
Mesophilic Thermophilic
spore spore counts
counts
No. of Average No. of
samples SPC Average positive Average
Class SPC range (per mL) analyzed (per mL) (per mL) samples (per mL)
I H1102150,000 19 32,000 400 16 46
II H1135050,000 to H11021200,000 36 98,000 400 35 45
III H11350200,000 to H110211,000,000 48 580,000 710 40 55
IV H113501,000,000 to H110215,000,000 73 2,300,000 760 60 41
a
Spore counts were determined after heating milk at 80°C for 10 min. Mesophilic counts were determined by a pour plate procedure; thermophilic counts
by a most probable number dilution tube technique.
Source:16
th
International Dairy Congress Proceedings. 1962, pp. 295–304, as reported by Martin (1981).
654 White
or less at 7°C. Thus, if a load of milk contains 100,000 cfu/mL with 70% of the
microflora being psychrotrophic, then, within 36 h at 7°C, the counts could ex-
ceed 1,000,000 cfu/mL. This large number can produce large amounts of prote-
ases and lipases, which can cause serious quality problems for processed prod-
ucts.
In a dated but excellent review of psychrophilic bacteria, Witter (1961)
indicated that the choice of the word psychrophile was unfortunate, because the
root name implied ‘‘cold-loving.’’ Many people still use the term psychrophile
when psychrotroph is what is intended. The key to recognizing the difference is
in the optimal growth temperature range. Psychrotrophs have an optimal growth
temperature in the range of 21°Cto28°C, whereas, as previously discussed, a
true psychrophile has a much lower optimal growth temperature. Most of the
bacteria that cause problems to the dairy processor are of the psychrotrophic type,
which means that, as the temperature is allowed to increase, the generation time
is reduced and more psychrotrophs are produced (see Chap. 2).
Witter (1961) indicated that the natural sources of the predominant psychro-
philic (psychrotrophic) bacteria are water and soil. Because water and soil are
both present in abundance on dairy farms, it is not surprising to find that these
psychrotrophs work their way into the milk supply. Hence, it is incumbent upon
all segments of the dairy industry to work at keeping equipment clean (as a means
of reducing the number of psychrotrophs gaining entrance into the milk) and
temperatures as low as possible to retard growth of the psychrotrophs that do get
into milk. Witter (1961) also indicated that, at the lower temperatures, from 7°C
to 0°C (their minimum growth temperature), the decrease in growth rate was
dramatic. Thus, even though the legal limit for holding milk is 7°C, the closer
to 0°C that the milk can be held, the higher will be its quality from the standpoint
of growth of psychrotrophic bacteria.
For the reasons just outlined, there is a need to monitor the psychrotrophic
population of incoming raw milk. Most measurements are by SPC or DMC, both
of which measure total bacterial numbers; those capable of growth at 32°C are
measured by the SPC. The PI-SPC (milk is held at 13°C for 18 h before it is
plated) is one way of estimating the psychrotrophic nature of the microflora. The
milk could be incubated for 24–48 h and then plated (SPC). Regardless, it is
very important for the dairy processor to have an idea of the psychrotrophic
quality of the raw milk, particularly in cheese making. White and Marshall (1973)
found that flavor scores were significantly lower for Cheddar cheese made from
milk containing a protease from a pseudomonad when compared with control
cheese. Witter (1961) indicated that pseudomonads (the primary psychrotrophic/
psychrophilic group) possess certain characteristics that make them important to
milk and other foods. Some of these characteristics are (a) ability to use a wide
variety of carbon compounds for energy and inability to use most carbohydrates,
(b) ability to produce a variety of products that affect flavor, (c) ability to use
Testing of Milk and Milk Products 655
simple nitrogenous foods, (d) ability to synthesize their own growth factors or
vitamins, and (e) proteolytic and lipolytic activity.
Because a high psychrotrophic load can adversely affect the quality of vari-
ous dairy products, especially cheese and extended–shelf life products, it be-
hooves the processor to routinely monitor the psychrotrophic population of in-
coming loads of raw milk.
E. Proteases
Because psychrotrophic bacteria can produce both lipases and proteases, it is
important to understand the activity of the various enzymes that can be liberated
into the milk. Many of the proteases tend to be extremely heat stable, which can
result in defects during extended refrigerated storage of milk. Adams et al. (1975)
studied heat-resistant proteases produced in milk by psychrotrophic bacteria.
They found all of the psychrotrophs obtained from raw milk produced proteases
that survived at 149°C for 10 s. They reported that 70–90% of raw milk samples
contained psychrotrophs capable of producing these heat-resistant proteases.
White and Marshall (1973) reported on a heat-stable protease that retained 71%
of its original activity after being heated at 71.4°C for 60 min. Also, the enzyme
hydrolyzed milk protein at 4°C.
In another study, Adams et al. (1976) isolated 10 gram-negative psychro-
trophs from raw milk that readily attacked raw milk proteins. They reported that
κ- and β-casein were most susceptible to attack by these psychrotrophs, although
they indicated that some of the isolates also attacked whey proteins. They further
stated that the proteolysis did not require large populations of psychrotrophs; 10–
20% decrease in κ-casein during 2 days at 5°C accompanied growth of one isolate
to a population of only 10,000/mL. Guinot-Thomas et al. (1995) studied proteoly-
sis of raw milk during storage at 4°C. They specifically looked at the effect of
plasmin and microbial proteinases. Their study demonstrated the greater impor-
tance of microbial proteinases than of plasmin at this temperature. Also, they
reported that hydrolysis of caseins by microbial proteinases affected mainly the
κ-casein fraction, colloidal calcium, and consequently casein micelles. They con-
cluded that this effect will be noted even more as the number of psychrotrophs
becomes higher. Rollema et al. (1989) compared different methods for detecting
these bacterial proteolytic enzymes in milk. This was a study in which two fluo-
rescamine assays, a trinitrobenzene sulfonic acid (TNBS) assay, an azocoll assay,
a hide powder azure (HPA) assay, and an enzyme-linked immunosorbent assay
(ELISA) were tested for their effectiveness in detection of proteolytic enzymes
from six strains of psychrotrophic bacteria. These workers concluded that the
TCA-soluble tyrosine and the thin-layer caseinate diffusion assay are too insensi-
tive to be used for quality control of dairy products. They stressed that a good
correlation between the proteolytic activity determined with an assay and the
656 White
keeping quality of the product is a prerequisite for applicability of the assay
for quality control of dairy products. Their preliminary study indicated that this
requirement could be reasonably satisfied by the fluorescamine, TNBS, and azo-
coll assays.
III. MICROBIOLOGICAL TESTING OF RAW MILK
AND RAW INGREDIENTS
A. Raw Milk (see also Chap. 2)
Because the microbiological quality of raw milk does not improve during storage,
it is critical that the processor evaluate the raw milk to ensure that only high-
quality milk is accepted. With regard to microorganisms, the following informa-
tion must be known:
1. Total count or aerobic plate count. Classically, this is determined by
the use of the SPC procedure. In legal matters concerning acceptability of an
incoming tanker of milk or milk from an individual producer, the SPC is the
standard to which other screening tests are compared.
2. DMC. In this procedure, as outlined in Standard Methods for the Exam-
ination of Dairy Products (Marshall, 1992), results can be obtained within 15
min by a trained laboratory technician. Dead as well as living cells are counted,
so the DMC should result in a slightly higher count than the SPC. The big advan-
tage is that results may be obtained before milk is unloaded into the processing
facility. This allows for much better microbiological control over incoming raw
fluid dairy products. The problem that many people encounter when initially us-
ing the DMC is that they try to be too ‘‘fine’’ with the results; for example, they
may try to distinguish between a count of 40,000 and 45,000 instead of just using
the DMC to detect the very high count loads. The DMC was not designed to
reflect minor differences in numbers of bacteria; rather, in this instance, the test
is strictly used to determine whether a tanker load of milk, cream, or condensed
skim milk is of sufficiently high microbiological quality to be unloaded into the
plant.
3. Psychrotrophic estimates. There are many types of bacteria in raw
milk. It is critical to know what percentage of the population is of a psychro-
trophic nature. The standard psychrotrophic bacteria count (PBC) requires incu-
bation of the plate for 10 days at 7°C (Marshall, 1992). This length of time is
commercially unacceptable to determine the psychrotrophic population of raw
milk. Various elevated incubation temperatures (e.g., incubation of plates at 18°C
or 21°C using PCA) give an estimate of the psychrotrophic population. Incubating
raw milk (cream or condensed skim milk) for 24–36 h at 7°C followed by SPC
incubation also gives some idea as to the number of psychrotrophs present.
Testing of Milk and Milk Products 657
4. PI-SPC. Johns (1960) first described this method for evaluating raw
milk quality. His method involved incubating raw milk at 12.8°C (55°F) for
18 h. Following this preliminary incubation, a conventional plate count was done.
This method was thought to identify milk that had been subjected to less than
desirable sanitary conditions at the farm level. Maxcy and Liewen (1989) found
that preliminary incubation at the recommended temperature (12.8°C) did not
have a selective effect for specific groups of microorganisms. Thus, apparently,
the PI-SPC procedure is not extremely reliable as a means of evaluating raw milk
quality. Certainly, the time involved for this procedure minimizes its effective-
ness in screening raw milk supplies.
5. Coliforms. According to Standard Methods for the Examination of
Dairy Products (Marshall, 1992), coliforms are a group of bacteria that comprise
all aerobic and facultatively anaerobic, gram-negative, non–spore-forming rods
able to ferment lactose and produce acid and gas at 32°Cor35°C within 48 h.
Typically, coliforms are used as a measure of sanitary conditions in the pro-
cessing and packaging of pasteurized dairy products. Coliforms are destroyed by
pasteurization; hence, any coliforms found in the pasteurized product indicate
postpasteurization contamination.
Coliforms may also be of value in checking raw milk. There is no legal
standard for the numbers of coliforms that might be present in raw dairy ingredi-
ents. It is suggested that a value of 100 coliforms per milliliter be used as an
initial screening tool for raw milk. The procedure used would be the same as
that outlined in Standard Methods (Marshall, 1992). As with pasteurized milk,
coliforms are ‘‘indicator organisms.’’ This simply means that if coliforms are
present, conditions may be suitable for the presence of enteric pathogens, such
as Salmonella.
6. Adenosine triphosphate bioluminescence assays. In an excellent over-
view of how ATP bioluminescence can be used in the food industry, Griffiths
(1996) agrees with other researchers (Bautista et al., 1992; Griffiths et al., 1991;
Reybroeck and Schram, 1995; Sutherland et al., 1994) that these assays may be
used successfully for determination of microbial loads in raw milk within 10
min. Griffiths (1996) described that the milk is incubated in the presence of
a somatic cell-lysing agent and then filtered through a bacteria-retaining mem-
brane. The microorganisms retained on the filter are then lysed with the lysate
being assayed for ATP activity. He stressed that microbial populations down to
10
4
cfu/mL can be detected with a greater precision than with the SPC.
Griffiths (1996) described the work of Pahuski et al. (1991), which involved
a ‘‘concentrating’’ reagent, Enliten, that clarifies milk and allows removal of
microorganisms by centrifugation. These workers indicated that a combination
of this treatment along with an ATP assay enabled detection of microbial levels
down to 2 H11003 10
4
cfu/mL within 6–7 min.
658 White
B. Dairy Ingredients
Many dairy ingredients other than raw milk are received by dairy and food pro-
cessing plants. Some of these products include nonfat dry milk, whey powder,
whey protein concentrates and isolates, condensed skim milk, condensed whole
milk, sweetened condensed skim milk, and whole milk, cream, and butter. These
ingredients must also be tested to ensure their overall quality and that they meet
established microbiological criteria. The SPC and the coliform count using violet
red bile agar (VRBA) are outlined in Standard Methods for the Examination
of Dairy Products (Marshall, 1992). This compilation of accepted methods is
descriptive with regard to sampling and the quantity of ingredient required for
appropriate analysis. Representative samples of each incoming batch should be
tested to ensure acceptability. When receiving dried products, a statistically valid
number of samples should be obtained. Various sampling procedures have been
used by companies, with the military standard MIL-STD-105D being a well-
accepted method for determining the number of samples to be taken. A rough
approximation for sampling is based on the following formula (does not take
into account degree of severity).
Number of samples H11005
√batch size
10
The number of samples should be randomly drawn to ensure representative sam-
pling and testing of the entire batch.
C. Nondairy Ingredients
Many ingredients other than dairy products are brought into dairy processing
plants. Examples of such products include fruits, nuts, stabilizers, emulsifiers, fat
replacers, sucrose and other sweeteners, and spices. The key to ensuring the qual-
ity of all ingredients, especially nondairy ingredients, lies with the requirement
of a product specification sheet. Each supplier that provides products to a dairy
processing plant should provide an individual product specification sheet for each
item sold to that company. The specification sheet, which should be updated
annually, should contain a description of the product as well as guidelines that
the product must meet. Microbiological testing should be outlined on the product
specification sheet. This includes the type of tests to be done and either the
method outlined or a reference to the procedure to be followed. The specification
should ensure that ingredients have been tested for specified pathogens and are
known to be ‘‘pathogen free.’’ Again, the SPC and the coliform count are com-
monly used procedures in evaluating the quality of many of these ingredients.
Counts are typically related to the grade of product being received. Samples must
Testing of Milk and Milk Products 659
be obtained as soon as the products arrive so accurate and prompt microbial
analysis can be accomplished.
The following is an outline of microbiological testing that should be done
on incoming raw dairy ingredients and nondairy ingredients, as recommended
by myself and H. E. Randolph (personal communication, 1996).
Microbiological testing of raw milk
Suggested
standard
Test (cfu/mL)
1. Direct microscope count—every tanker (before unloading) 200,000
2. Coliform (violet red bile agar)—every tanker (backtrack to
individual producer if necessary) 100
3. Standard plate count (PCA)—silos daily 100,000
4. PI-SPC (18 h at 12.8°C)—silos daily (backtrack if necessary) 300,000
The PPC or the PI-SPC is especially critical for cheese operations, because the
presence of proteases from psychrotrophic bacteria can adversely affect yield as
well as quality of these concentrated products.
IV. LINE SAMPLING/TESTING
One of the most important aspects of microbiological testing of milk and milk
products is line sampling. If only the finished product is tested, then it is only
known whether the finished product is ‘‘good’’ or ‘‘bad’’; however, if the shelf
life of the product is less than desirable, it is not known where the postpasteuriza-
tion contamination occurred. To gain such information is the purpose of line
sampling. In a fluid milk operation, line samples should be obtained at the follow-
ing locations:
1. At or immediately after the high-temperature, short-time pasteurizer.
This is done to ensure that neither the regenerative plates nor cooling
plates have pinhole leaks.
2. Preceding pasteurized milk storage tanks. This verifies the cleanliness
of the pasteurized milk lines leading from the pasteurizer to storage
tanks.
3. Line sample leading from the pasteurized milk storage tanks. This is
done to ensure cleanliness of the storage tank itself.
4. Immediately preceding entry of the milk into the separate fillers.
660 White
By checking each of these locations, postpasteurization contamination can be
pinpointed.
Because most dairy processing plants have welded pipelines and do not
disassemble all of their piping, the method for obtaining aseptic line samples
becomes critical. One very efficient way of obtaining good samples is by use of
the QMI Aseptic Sampler (Food and Dairy Quality Management, Inc., QMI, St.
Paul, MN). The aseptic samplers are inserted into stainless steel elbows for ease
of sample extraction. Even though virtually any size sample can be taken, a mini-
mum of 50 mL and preferably 60 mL should be used. There is a greater chance
of detecting microorganisms that could be detrimental to product shelf life from
a larger sample.
Regular grommets can also be inserted and then a syringe and needle can
be used to extract samples of similar size. Samples in the syringes can be used
for any number of microbiological evaluations. The primary bacterial types of
concern in these samples are coliforms and psychrotrophic bacteria. To enhance
enumeration of psychrotrophic bacteria, a step commonly used is to incubate the
sample (in the syringe) at 21°C for 18 h. Following this preincubation, the sample
can either be plated for SPC or for coliforms (VRBA). The preliminary incubation
is not absolutely necessary, but it does enhance enumeration of any psychrotrophs
or heat-injured coliforms that might be present. A SPC on the fresh milk is virtu-
ally meaningless. Thus, the different options to consider with regard to microbio-
logical evaluation of line samples are: (a) fresh milk coliform count—VRBA,
(b) PI-VRBA, (c) PI-SPC, and (d) PI plus any other selective media designed to
enumerate psychrotrophic bacteria, such as PI H11001 CVT (crystal violet tetrazolium
agar).
After counts are obtained (counts should be viewed as the same as for any
finished fluid product), gram stains of preparations from colonies on plates can
be made to determine whether the microorganisms appearing in ‘‘spoiled’’ prod-
ucts are similar to those observed in line sampling. This can be a direct indication
of the presence of bacteria that are reducing shelf life.
V. SHELF LIFE–PREDICTING TESTS FOR FLUID
MILK–TYPE PRODUCTS AND ESTIMATION
OF ACTUAL PRODUCT SHELF LIFE
The term shelf life can be used interchangeably with the term keeping quality,
which is defined as the time a product remains acceptable in flavor after packag-
ing. The question then becomes, What is an acceptable shelf life for fluid milk
products. Before answering this question, the temperature at which the product
is held when shelf life testing is done must be specified. The temperature most
commonly used is 7°C (45°F), which is chosen because it approximates the tem-
Testing of Milk and Milk Products 661
perature of dairy cases in supermarkets and the home refrigerator (Bishop and
White, 1985; White, 1991). Also, as has previously been pointed out (Bishop
and White, 1985), in all shelf life prediction studies, the ‘‘potential’’ shelf life
is actually what is being measured, because the experimental sample stored in a
cooler in the laboratory is not subjected to the rigors of distribution and transpor-
tation.
Almost all tests that are designed to predict the shelf life of dairy products
are based on detection of gram-negative psychrotrophic bacteria (especially the
pseudomonads). These microorganisms cause most shelf life problems, especially
in fluid milk and cottage cheese. Regardless of the method, the key (White, 1991)
to predicting the shelf life of milk and milk products is that the method must be
rapid—reliable and meaningful results must be obtained within 72 h and ideally
within 24 h.
In addition, results of tests to predict shelf life must be compared or corre-
lated with the actual product shelf life. Thus, to determine whether or not a partic-
ular test to predict shelf life is effective, the actual product shelf life must be
assessed. The actual product shelf life is determined by holding the samples at
7°C and testing them every day until an off-flavor develops. The shelf life is then
estimated as the day the off-flavor developed minus 1. To minimize the number
of times the container is opened and closed, the products do not need to be tasted
until after day 10 (assuming that the product had a shelf life of 10 days or more).
It is important in determining basic product shelf life to use the same container,
because each filler head (on a gallon filler) can yield significantly different results.
In selecting samples from a filler, it is good to rotate the samples obtained so
that, over a given period, all filler heads can be sampled.
Correlation between the results of shelf life prediction and actual product
shelf life at 7°C can be ranked using the following scale: excellent, H110220.90; good,
0.80–0.89; fair, 0.70–0.79 (Bishop, 1988, 1993; White, 1991). Because of low
initial numbers of bacteria in freshly pasteurized milk, most shelf life testing
consists of preincubating the product (in its original container) at 21°C for 18 h
followed by some rapid bacteria-detection method (White, 1991, 1993, 1996).
The Moseley Keeping Quality Test consists of incubating the finished prod-
uct in its original carton at 7°C for 5–7 days followed by doing the SPC. This
test has been used for many years by dairy processors as a way of evaluating
the ‘‘staying power’’ of their products. The big drawback is the length of time
required for results; that is, 7–9 days before actual counts are obtained. As newer
tests to predict shelf life are developed, the tendency is for dairy processors using
the Moseley Keeping Quality Test to correlate results of the new test with those
of their regular test. This is not the way to evaluate a new test. The results of
any test to predict shelf life should be correlated with actual product shelf life,
not with the results of another test. Erroneous conclusions may be drawn. Thus,
the best testing protocol is a preliminary incubation of the product so any psychro-
662 White
trophs present can be enumerated rapidly. Many time and temperature combina-
tions have been evaluated, but the one set of conditions that seems to optimize
outgrowth and enumeration of the psychrotrophs is incubation for 18 h at 21°C.
Therefore, the preliminary incubation (PI) mentioned in the remainder of this
chapter represents 18 h at 21°C.
Some of the proven methods to predict shelf life are as follows:
1. Moseley Keeping Quality Test.
2. PI plus various plating methods: PI H11001 SPC (incubation of plates at
32°C for 48 h); PI H11001 mPBC (incubation of plates at 21°C for 25 h)
(mPBCH11005modified psychrotrophic bacteria count on PCA); PIH11001CVT
(1 L of PCA containing 1 mL of a 0.1% crystal violet solution followed
by sterilization, cooling, and addition of 2,3,5-triphenyl tetrazolium
chloride [TTC]) (plates are incubated at 21°C for 48 h) (Marshall,
1992); PI H11001 VRBA (incubation of plate at 32°C for 24 h).
3. Bioluminescence.
4. Catalase detection.
5. Limulus amoebocyte lysate (LAL) assay. This procedure involves de-
tection of endotoxins produced specifically by gram-negative bacteria
(White, 1993).
6. Impedance microbiology.
7. Dye reduction (HR1, HR2) (H. E. Randolph, personal communication,
1996).
8. Reflectance colorimetry (the LABSMART System, Gary H. Richard-
son, Logan, UT). This is a tristimulus reflectance colorimeter that mon-
itors dye pigment changes caused by microbial activity.
These methods reflect the most current information about the basics of shelf life
prediction techniques. However, no one procedure is ideally suited for every plant
application.
Bishop and White (1985) used PI H11001 impedance detection time (IDT) to
successfully predict the shelf life of fluid milk. For fluid milk products, the PI
H11001 IDT yielded the highest correlation (r H11005 0.94) between test result and actual
product shelf life at 7°C. By comparison, the correlation obtained for the Moseley
Keeping Quality Test was r H11005 0.75. Because of the 7–9 days required before
results are available from the Moseley test and because fluid milk products have
a shelf life of approximately 14–21 days at 7°C, there is no question which test
would be of more value to the processor. Any of the tests discussed that can give
results within 72 h are of more value not only in predicting shelf life but also
in controlling the sanitary operation of the plant. Fung (1994), in an excellent
overview of rapid detection methods, described 10 attributes of an ideal rapid or
automated microbiological assay system for food:
Testing of Milk and Milk Products 663
1. Accuracy: especially sensitive for false-negative results
2. Speed: accurate results within 4 h
3. Cost: designed for each application
4. Acceptability: must be ‘‘official’’
5. Simplicity: ideally, ‘‘dip-stick’’ technology
6. Training: adequate for test or kit
7. Reagents and supplies: stability, consistency, availability
8. Company reputation: performance of product is critical
9. Technical service: rapid and thorough
10. Space requirements: should not take up a whole laboratory
Most of the tests discussed meet most of these criteria.
Another method is described by Bishop (1988) as the Virginia Tech
Shelf-Life Method (VTSLM), which involves a preliminary incubation (21°C)
followed by simple plating. He describes this method as being reliable, accu-
rate, relatively rapid, economical, and familiar to laboratory personnel. He ad-
vocates aseptically transferring 10 mL of a pasteurized fluid milk product into
a sterile test tube and incubating the tube and its contents at 21°C for 18 h. The
sample is then mixed well and diluted 1:1000 with the diluted sample being
plated on PCA and incubated at 21°C for 25–48 h. He indicated that this
method provides an estimate of the growth potential of psychrotrophic bacteria
that may be present in the sample. The time variation for the plate incubation
indicates the difference between agar and 3M-Petrifilm methods. If PCA is
used, add 50 ppm of a filter sterilized solution of 2,3,5-triphenyl tetrazolium
chloride (TTC) to the melted and cooled (44–46°C) agar before pouring plates.
Only the red colonies should be counted. Counts can then be extrapolated to
indicate estimated shelf life. Shelf life categorization by VTSLM (Bishop, 1988,
1993) follows:
Petrifilm/agar Estimated
count Total count shelf life
(cfu/plate) (cfu/mL) (days)
H113491 H113491,000 H1135014
1–200 1,000–200,000 10–14
H11350200 H11350200,000 H1134910
By continuing to do the test to predict shelf life on a regular basis and reacting
to the results, confidence can be instilled from quality assurance and production
standpoints. Most spoilage of fluid milk–type products occurs from presence of
664 White
pseudomonads and related gram-negative bacteria. The tests discussed tend to
emphasize detection and enumeration of gram-negative rods.
Gut?′errez et al. (1997) reported on generating monoclonal antibodies
against live cells of Pseudomonas fluorescens, which were used in an indirect
ELISA format to detect Pseudomonas spp. and related psychrotrophic bacteria
in refrigerated milk. The researchers indicated that development of an ELISA
technique using these specific antibodies would facilitate rapid screening of re-
frigerated milk for detection of high concentrations of bacterial cells. They re-
ported a good correlation (r H11005 0.96) between the colony numbers of psychro-
trophic bacteria from commercial milk samples maintained at 4°C by the SPC
method and the ELISA technique. These authors stressed the advantages of the
indirect ELISA technique as being its versatility, simplicity, and speed.
There is still somewhat of an art in predicting the shelf life of dairy prod-
ucts. Because there is no one perfect test for all needs, processors must carefully
select the one or two tests that best fit into their overall quality assurance program.
The key points (White, 1991, 1996) regarding prediction of shelf life are as fol-
lows:
1. Know the actual potential shelf life of the products as measured at 7°C
(45°C).
2. Select the test to predict shelf life that best fits the total program.
3. Routinely do the tests and develop a history, categorizing the results.
4. Ensure top management commitment to define a course of action in
case product failure is projected by the tests.
VI. MICROBIOLOGICAL TESTING OF MILK
AND NONCULTURED PRODUCTS
A. Fluid Milk Products
Shelf life becomes critical for fluid milk products. Shelf life of pasteurized milk
has been defined (White, 1991) as the time between packaging and when the
milk becomes unacceptable to consumers. Because the actual product shelf life
is between 10 and 21 days at 7°C, rapid shelf life prediction tests, as discussed
previously, become critical. Dairy processors generally do a good job of cleaning
and sanitizing; thus the number of contaminating bacteria (psychrotrophs) is so
small that some form of preincubation is required to obtain numbers large enough
for rapid detection tests to enumerate them.
For the reasons just stated, the following are recommended for microbio-
logical testing of fluid milk–type products:
1. Estimation of coliforms. At a minimum, a coliform (VRBA) test should
be done on representative samples of all fresh products. H. E. Randolph (personal
Testing of Milk and Milk Products 665
communication, 1996) and I agree that a better test would be a ‘‘stress’’ coliform
test wherein the product is incubated at 21°C for 18 hours followed by coliform
estimation on VRBA. According to Standard Methods for Examination of Dairy
Products (Marshall, 1992), plates are incubated at 32°C and counted after 24 h
of incubation (Figs. 7 and 8). The PI-VRBA allows for outgrowth of heat-injured
coliforms, which might not show up on a coliform count made directly on fresh
products. Petrifilm or VRBA agar in regular Petri dishes may be used. Whereas
VRBA agar is normally used for detection of coliforms, PI allows for detection
of some psychrotrophic types that may be present.
Figure 7 Coliform plating (using the Petrifilm system) being conducted by QA techni-
cian. (Photograph courtesy of Mayfield Dairies and Dean Foods Company, Athens,
TN.)
666 White
Figure 8 QA technician checks for presence of coliforms in finished products. (Photo-
graph courtesy of Mayfield Dairies and Dean Foods Company, Athens, TN.)
2. Shelf life prediction tests. Any of the shelf life prediction tests dis-
cussed previously may be used. Specifically, it is recommended to use one of
the following: PI H11001 SPC (18 h at 21°C plus 48 h of plate incubation at 32°C);
PI H11001 CVT (product incubation for 18 h at 21°C followed by incubation of crystal
violet tetrazolium agar for 48 h at 21°C); PI H11001 other rapid detection methods,
for example, PI H11001 bioluminescence, PI H11001 impedance detection, and PI H11001 reflec-
tance colorimetry. These other systems can be very effective and accurate in
predicting shelf life. Because of the cost of some of the systems, it may be ne-
cessary to use them for more than one test, such as for raw milk evaluation,
equipment cleanliness, and culture viability in addition to shelf-life prediction.
Smithwell and Kailasapathy (1995) described a rapid test for detection of
psychrotrophs wherein milk is mixed with a selective agent (benzalkonium
chloride) and a bacterial indicator (tetrazolium salt) and incubated at 30°C. The
researchers indicated that gram-positive bacterial growth is suppressed by the
benzalkonium chloride, and they stipulated that, if gram-negative bacteria are
present, they grow and multiply. Once the numbers reached approximately 10
7
/
mL, the tetrazolium salt is reduced and the color of the milk changes from white
to red. This is similar to the HR1-HR2 test described by H. E. Randolph (personal
communication, 1996). The authors caution that the time required for this color
Testing of Milk and Milk Products 667
reaction to occur depends on the amount of milk examined and the level and
activity of bacteria present. These reduction-type tests lack the sophistication of
some of the other test methods, but they do have the major benefit of being visible
so shelf life tests can be observed by plant employees. This increases the interest
by plant personnel in the sanitary processing and packaging of their fluid milk
products.
3. Sensory evaluation of representative samples of fresh product. Milk
from all fillers and all labels should be tasted fresh. Samples can be combined
to minimize the total number of samples that need to be discarded.
4. Sensory evaluation at end of shelf life. Samples need to be tasted at
some point at or beyond the code date. This time can be extended as shelf
life of the product improves. Many dairies express this type of evaluation in terms
of a certain percentage of products that are good (or bad) after a certain number
of days at 7°C (45°F). Ideally, 100% of the products would be good when evalu-
ated at day 21. As a rule, the number of days in which 90% or more of the
products remain good can be used. Thus, a dairy may start out testing after 10
days at 7°C until success is achieved on a continual basis in 90% or more products
being good. Subsequently, the sensory evaluation may be gradually moved to
anywhere from 14 to 21 days until continual success is noted. If new shelf life
problems occur, evaluations may have to revert to a shorter time to achieve satis-
factory results.
The quality of the raw milk, as discussed previously, is still a very important
issue. Celestino et al. (1996) indicated that storage of bulk raw milk resulted in
increased numbers of lipolytic and proteolytic bacteria. They found that, on the
average, the number of psychrotrophs as a proportion of the total plate count
increased from 47% to 80% after 2 days of storage at 4°C. Thus, finished product
quality can definitely be affected if raw milk is stored for too long a time (legally
no more than 72 h, ideally no more than 48 h) (see Chapter 2).
B. Cottage Cheese—Noncultured Dressing
In evaluating the microbiological quality of cottage cheese, the places where
cottage cheese could become contaminated (from a keeping quality standpoint)
must be considered. There are only three things that consistently cause shelf life
problems to the cottage cheese industry:
1. Wash water. The wash water must have proper pH and chlorine level.
2. Dressing. The cream dressing, whether for full-fat, low-fat, or nonfat
cottage cheese, affects the quality of the finished product. If the dress-
ing contains many psychrotrophic bacteria, the desired shelf life will
not be obtained. This is especially true in dressings to which no culture
has been added.
668 White
3. Packaging operation. The blending of curds and dressing and filling of
cottage cheese cartons constitute excellent opportunities during which
psychrotrophic bacteria can gain entry into the finished product. Great
care must be exercised to ensure that only cleaned and sanitized food
contact surfaces are being used.
These three areas hold true whether the cottage cheese operation is very
small with all operations other than packaging being handled within the cheese
vat or whether the operation is large with separate washer coolers, blenders, and
packaging machines. Thus, samples should routinely be taken to ensure the mi-
crobial quality of each of these areas. First, daily samples of the wash water
should be obtained and plated for coliforms and psychrotrophic bacteria (by any
of the methods discussed previously). Second, daily samples should be obtained
of the dressing and tested to ensure microbiological quality. Again, both coliform
and psychrotrophic testing should be done. Third, a statistically valid number of
samples should be used to evaluate finished product quality. (See previous discus-
sion of this subject in this chapter; see also Chapter 11.)
In other words, cottage cheese with noncultured dressing should be handled
very similarly to fluid milk products. If cultured dressing is used, the primary
test to use is a coliform (VRBA) test on the fresh product.
With regard to how cottage cheese should be sampled, Standard Methods
for Examination of Dairy Products (Marshall, 1992) prescribes the use of a sterile
blender-container on a balance and tared to which 11 g of cottage cheese are
added aseptically along with 99 mL of warmed (40–45°C), sterile 2% sodium
citrate solution. The sample is blended for 2 min, after which the product is
diluted (if needed) and plated. Also, a Stomacher might be used (11 g of sample
and 99 mL of diluent) to blend the cheese sample.
Another method used by some dairies for microbiological examination of
cottage cheese is simply plating the dressing found in the container of finished
product. This works for some freshly dressed cheeses, but many cheeses do not
have enough dressing from which separate extractions can be made. In these
instances, blending the cheese either in a sterile blender or in a Stomacher is
necessary.
C. Frozen Dairy Desserts
The microbiological evaluation of frozen dairy desserts consists of two basic
parts: (a) ingredients and mix samples and (b) finished product. Some of the
ingredients used in ice cream that should be tested microbiologically include fluid
dairy products, dry dairy products (especially nonfat dry milk and whey powder),
fruits, nuts, colors, flavors, stabilizers, and emulsifiers (see also Chap. 4).
Testing of Milk and Milk Products 669
Fruits and nuts may be weighed (Marshall, 1992) into wide-mouth contain-
ers (11-g portions should be used) to which 99 mL of dilution water is added.
The mixture is soaked for 5 min, shaken vigorously, and plated. The recom-
mended tests to be used for these type products are:
1. Coliform count on fresh samples.
2. Yeast and mold counts (see Standard Methods for Examination of
Dairy Products [Marshall, 1992]). Probably the most commonly used
medium for yeast and mold counts is acidified potato dextrose agar.
These plates must be incubated at 25°C for 5 days with counted plates
having between 15 and 150 colonies.
3. SPC.
All fluid milk products, including fluid milk, cream, and condensed skim
and whole milk, are plated as described previously.
Stabilizers and emulsifiers should be plated using 1 g in 99 mL of dilution
water (Marshall, 1992). The sample is shaken vigorously for 15 s and allowed
to hydrate at 20–40°C for up to 20 min. The product is then plated for SPC and
coliform count (VRBA).
For finished products, a statistically valid number of samples representing
each type of product and each label change should be obtained. Finished product
samples should be thawed at a temperature of up to 40°C for no more than 15
min (Marshall, 1992). A coliform count on fresh product is a good indication of
whether sanitary methods were used in processing and handling the mix and
finished product. Psychrotrophs can also be a problem. White and Marshall
(1973) indicated that heat-stable enzymes produced by typical psychrotrophs
could cause a measurable effect on ice cream mix that approached significance
from a sensory evaluation standpoint (see Chap. 4).
D. Butter
By definition, butter must contain at least 80% milk fat. It seems, then, that the
microbiological quality of butter is not as critical as it is with other dairy products,
yet microorganisms can and do survive and grow quite well in butter and related
products. White and Marshall (1973) evaluated the effect of heat-stable proteases
on several dairy products, including butter. They did not find any significant
effect of the proteases. This is not surprising, because butter contains only about
1% protein. Microorganisms with high lipolytic activity would be expected to
have a greater effect on high-fat products. Standard Methods for Examination of
Dairy Products (Marshall, 1992) lists the following tests that can be done on
butter or margarine-type products: SPC, coliform count (VRBA), proteolytic
count, psychrotrophic count, lipolytic count, Enterococcus count, and yeast and
670 White
mold counts. Furthermore, I and other authors (R. Baer, personal communication,
1997; R. L. Richter, personal communication, 1997) recommend the following
tests be done routinely in a creamery operation (all counts should be reported on
a per gram of butter basis):
1. SPC (1:1000 dilution as recommended by Standard Methods for Exam-
ination of Dairy Products [SM]).
2. Coliform count (VRBA-1:2-1:10 dilution-SM).
3. Lipolytic count (1:100 dilution-SM).
4. Yeast and mold count (1:2-1:10 dilution-SM). Wilster (1957) recom-
mended a standard of 50 yeast and molds per gram of melted butter.
This seems high for present-day circumstances (see Chapter 5).
E. Dry Milk and Whey Products
Dry dairy ingredients are used in a wide variety of products, including other food
products as well as dairy products. The quality of the finished products can be
affected by the quality of these milk ingredients. Nonfat dry milk adds many
desirable properties to dairy foods; however, these desirable properties are mini-
mized when inferior powders are used. The same may be said of the use of
sweet whey powder and especially the newer whey protein concentrates and whey
protein isolates. These ingredients may be purchased in various amounts, but
typically the product arrives in 40- to 50-lb bags or even in totes.
With regard to microbiological analyses, most dairies are performing the
SPC and coliform count (VRBA). Three to 5 mL of agar overlay may be used
on surfaces of solidified plates before incubation if spreading of colonies is a
problem when these products are tested (Marshall, 1992). With a dried prod-
uct that has obviously been exposed to some heat treatment, the presence of
spore-forming bacilli can be common. Also, the DMC may be used to evaluate
incoming samples of nonfat dry milk and whey products. Typically, this analysis
is done by making a 1:10 dilution (11 g of product in 99 mL dilution water) of
the sample before it is examined microscopically. Standard Methods for Exami-
nation of Dairy Products (Marshall, 1992) recommends the use of 2% sodium
citrate solution in making these 1:10 dilutions if certain samples dissolve less
readily. The reports would show as DMC/g of NDM or whey powder (see
Chap. 3).
F. Ultra-High–Temperature Products
With a commercially sterile product, the presence of any microorganisms able
to grow under conditions of product storage is considered detrimental to the shelf
Testing of Milk and Milk Products 671
life of the product. Also, because the product normally is held at ambient tempera-
tures, any slight contamination during the aseptic packaging process will damage
the product.
Bockelmann (1989) indicated that, under current circumstances, the reject
rate for ultra-high temperature (UHT)–type products is approximately 1 defective
(unsterile) unit per 100,000 produced packages. To improve beyond this point,
for example, to achieve a reject rate of 1/100,000,000, would be impossible be-
cause of construction limits of the equipment (Bockelmann, 1989). He stated that
for UHT plants in use at that time, sterilization effects of between 10 and 12
could be assumed. He said that of 10
10
–10
12
bacteria spores fed into the process,
1 spore would survive, and that the microbiological end result of such a process
was dependent on (a) the sterilization effect of the UHT process and (b) the
bacterial spore count in the raw product.
Thus, the number of bacterial spores present in raw milk is of definite
importance when dealing with a ‘‘sterile’’ finished product. According to Stan-
dard Methods for Examination of Dairy Products (Marshall, 1992), 200 mL of
raw milk should be placed in a sterile Erlenmeyer flask with a screwcap lid. The
milk should be heated to 80°C for 12 min and then cooled immediately in an
ice bath and plated on PCA with added starch and plates incubated at 32°C for
48 h. Even though the plates could be incubated at 7°C for 10 days for psychro-
trophic spore counts, the mesophilic spore count as just outlined should provide
more meaningful information on UHT-type products.
For finished product testing, Standard Methods for Examination of Dairy
Products (Marshall, 1992) recommends swabbing the outside surface of the fin-
ished product container with 70% alcohol. The needle of a sterile, single-service
hypodermic syringe should then be inserted through the package wall and the
appropriate amount of sample removed. Because the product is thought to be
sterile, precise measurements are normally not needed, because any contamina-
tion is considered bad.
Bockelmann (1989) used the sterilization effect and the maximum accept-
able defect rate as a means of establishing the following proposed standard for
spore counts in raw materials such as raw milk:
Standard spore count in raw materials (UHT
sterilization effect: approximately 11; maximum
acceptable defect rate: 1:1000)
No. surviving
per milliliter Aim Action Limit
10 min, 80°C H11021100 H110021,000 H1100210,000
10 min, 100°C H1102110 H11002100 H110021,000
672 White
With regard to packaging material for UHT products, Bockelmann (1989)
indicated the infection rate resulting from the manufacturing process of these
packaging materials to be insignificant (i.e., 0.5 microorganism/100 cm
2
), about
3–5% of the bacteria were identified as Bacillus spores.
Bernard (1983) made several observations on some of the other microbio-
logical considerations for testing aseptic processing and packaging systems. He
indicated that, before establishing appropriate times, temperatures, and exposure
concentrations to provide for commercial sterility, appropriate test organisms
must be determined for each particular sterilization medium. Some of the test
organisms for the different sterilization media are as follows:
Sterilization
medium Bacillus spp.
Superheated system B. stearothermophilus (1518)
B. polymyxa (PSO)
H
2
O
2
and heat B. subtilis strain A
H
2
O
2
and UV B. subtilis strain A
In addition to the sensory and physical/chemical testing done on UHT fin-
ished products, microbiological testing is also critical. Edwards (1983) indicated
that SPCs and coliform counts, among other tests, of aseptically processed prod-
ucts done immediately after packaging are ineffective as quality control proce-
dures because of the extremely low number of viable organisms present in an
unsterile container and due to the very low numbers of unsterile containers. He
said that, to provide a more effective and more rapid method of detecting these
low numbers of viable organisms, samples are typically incubated at an elevated
temperature (e.g., 35°C [95°F]) to allow for rapid growth of most microorganisms
that might be present. He stressed that incubation time may vary depending on
product characteristics and types of tests to be used to detect nonsterility. It is
necessary to incubate UHT samples at an elevated temperature (e.g., 35°C) for
approximately 1–3 days. Even if bacteria have been substantially heat injured,
this time-temperature combination allows for outgrowth of any survivors. Also,
this combination facilitates early detection of enzymes, especially the proteases.
Edwards (1983) indicated that there are two types of samples that should
be obtained: (a) aimed samples and (b) random or timed samples. Aimed samples
are obtained when the risk of contamination is greater than during normal opera-
tions such as during start-up and splices. Evaluation consists of container integrity
tests and product incubation. Random or timed samples are obtained during nor-
mal operation. Evaluation of these samples consists of container integrity tests,
product incubation, and shelf life monitoring.
Testing of Milk and Milk Products 673
These samples should be obtained at different locations such as after the
packaging machine, after the downstream equipment, and from the warehouse
(Edwards, 1983). If nonsterility is observed, resampling of the product should
be done from that period, with evaluation by container integrity tests and product
incubation. The defect rate in the aseptic processing and packaging systems,
which Edwards (1983) said was the most common, was 1 in 10,000, and some
of the sources of nonsterility were inadequate heat treatments of the product,
inadequate equipment sterilization, contamination of equipment after steriliza-
tion, inadequate package sterilization, contamination of package after steriliza-
tion, faulty package material, nonhermetical seal, improper machine adjustment,
damage from downstream equipment, and damage from handling and shipping
(see also Chap. 2).
VII. MICROBIOLOGICAL TESTING OF CULTURED
DAIRY PRODUCTS
In this discussion, cultured dairy products include cultured milk (buttermilk),
cultured or acidified cottage cheese, cultured or acidified sour cream, and yogurt.
A total count or SPC is not suitable for measuring the microbiological quality
of these products, because a viable bacterial culture has been added to each of
them. Even for noncultured cottage cheese dressings, an SPC on fresh product
is meaningless because of the low numbers of microorganisms present after pas-
teurization. Thus, the coliform count (VRBA) is the primary microbiological test
that is used in evaluating cultured dairy products.
For any of the cultured milks (e.g., whole, low-fat, or skim buttermilk),
the coliform count may be determined by plating 1:1 on VRBA. With regard to
cottage cheese, ideally, the product should be blended in a sterile blender. Stan-
dard Methods for Examination of Dairy Products (Marshall, 1992) recommends
the use of a sterile spatula to aseptically transfer 11 g of cottage cheese into the
sterile blender, which had been preweighed. Then, 99 mL of warmed (40–45°C),
sterile 2% sodium citrate solution is added. The product is then thoroughly mixed
for 2 min. The product is then plated with 1 mL of the blended 1:10 dilution
being transferred to a VRBA plate (or Petrifilm).
As discussed previously, an alternative method used by some dairy plant
laboratories to test for the presence of coliforms in cottage cheese is simply to
plate the dressing directly out of the cottage cheese carton. This can be somewhat
difficult, especially if the cottage cheese is relatively dry. Blending yields more
consistent results.
Goel et al. (1971) evaluated the duration that coliforms would survive
in yogurt, buttermilk, sour cream, and cottage cheese during refrigerated stor-
age. They noted a marked decrease in numbers of most coliforms tested in
674 White
yogurt, buttermilk, and sour cream after 24 h of storage at 7.2°C. Hence, there
is a definite need to test for the presence of coliforms in these type products
within 24 h of manufacture and packaging. With cottage cheese, there was less
of a decrease in numbers of coliforms than for the other cultured dairy prod-
ucts. Barber and Fram (1955) cautioned that coliform-like colonies on VRBA
should be confirmed for yogurt and other products containing fruit or added
sweetener.
Also, yeast and mold counts are done by some dairies on some of the
cultured dairy products. These counts could be done on buttermilk, cottage
cheese, or yogurt. Many times yogurt develops a yeast or mold problem as op-
posed to any bacterial-related shelf life–ending problems. Standard Methods
for Examination of Dairy Products (Marshall, 1992) lists the following media
to be used for yeast and mold enumerations: (a) acidified potato dextrose
agar, (b) yeast extract–dextrose–chloramphenicol agar, and (c) dichloran–Rose
Bengal–chloramphenicol (DRBC) agar. In addition, Petrifilm provides a yeast
and mold agar that is used by many dairy laboratories.
The most common flavor criticism of cottage cheese, sour cream, and
buttermilk-type products is that they ‘‘lack flavor’’ or are ‘‘flat.’’ Because the
incubation time or temperature has not allowed the culture of bacteria to produce
sufficient flavor, the resulting product tends to have a flat flavor. Because of
this, the presence of any contaminating microorganisms, especially coliform, or
psychrotroph-type bacteria, or yeast and molds, can cause relatively slight off-
flavors to become more pronounced because of the absence of competing desir-
able flavor notes. Extreme effort should be made to enhance bacterial starter (e.g.,
acid and diacetyl) activity to the point where desirable flavors may be noted in
products such as sour cream and buttermilk (see also Chap. 9).
VIII. MICROBIOLOGICAL TESTING OF RIPENED CHEESES
Natural cheeses, regardless of variety, readily support growth of many micro-
organisms even though moisture content, salt content, pH, and other composi-
tional factors vary from cheese to cheese. Cheeses may contain pathogenic bacte-
ria (e.g., Listeria monocytogenes, Staphylococcus aureus, Salmonella (see Chaps.
11 and 13). This is the exception and not the rule, because cheese is a concentrated
dairy product, and if all ‘‘make’’ procedures have been followed and good manu-
facturing practices adhered to, the probability of foodborne pathogens being pres-
ent is remote. This is true of Cheddar cheese, for example, as long as the pH in
the finished product is controlled (H110215.3).
Standard Methods for Examination of Dairy Products (Marshall, 1992)
recommends any one of three procedures to mix a cheese sample for subsequent
microbiological analysis:
Testing of Milk and Milk Products 675
1. Transfer 11 g of cheese into 99 mL of sterile aqueous 2% sodium
citrate at 40–45°C. The cheese is then blended for 2 minutes and plated
either direct (1:10) or with further dilutions.
2. Weigh 1H110060.01 g into a presterilized 177-mL Whirl-Pak bag (NASCO,
Inc., Fort Atkinson, WI). The cheese is then macerated, after which
9 mL of 2% sodium citrate at 40°C is added. The bag is closed with
the contents rolled and then plated.
3. Eleven grams of cheese and 99 mL of diluent are mixed in a Stomacher
400 (Dynatech Laboratories, Inc., Alexandria, VA). The cheese is
blended for 2 min then plated.
Microbiological tests that are done on hard cheese may vary from one pro-
cessor to another; however, the coliform count and the Staphylococcus count
should be done. Staphylococcus counts are especially critical when there is an
abnormally high pH value. It is recommended that a Staphylococcus count be
automatically done on any Cheddar-type cheese with a pH greater than 5.2.
Interpretation of the coliform count is the same as for any dairy product,
that is, a high count indicates unsanitary conditions involved in processing and
packaging the product. As discussed previously, coliforms are ‘‘indicator organ-
isms.’’ This means that the occurrence of coliforms indicates that conditions are
suitable for the presence of enteric pathogens. This does not mean that pathogens
are definitely present but that the cheese was handled in a manner that allows
enteric pathogens to be present. Coliforms are important indicators, and hence
this test should not be ignored.
IX. FUTURE OF MICROBIOLOGICAL TESTING
OF DAIRY PRODUCTS
There is a tremendous amount of work being done regarding development of
rapid detection methods for total numbers of both bacteria and specific organisms,
primarily pathogens. Karwoski (1996) and Fung (1994, 1995) discussed different
areas of research in food microbiology, and a summary follows of what these
two investigators have reported:
1. Sample preparation: Two useful instruments in this area are the Stom-
acher and the Gravimetric Diluter (Spiral Biotech, Bethesda, MD).
2. Total viable cell count: Various alternatives include the following
(White, 1996): Automated spiral plating method (Spiral Biotech,
Bethesda, MD): Isogrid System (QA Laboratories, Ltd., San Diego,
CA) (all colonies have square shape, reported to be easier to count;
Petrifilm (3M Co., St. Paul, MN); Redigel System (RCR Scientific,
Inc., Goshen, IN); and Direct epifluorescent filter technique (DEFT)
676 White
slides read by systems such as the Bio-Fos Automated Microbiology
System (FOS Electric, Denmark).
3. Differential cell count.
4. Pathogenic organisms.
5. Enzymes and toxins.
6. Metabolites and biomass.
In an article dealing with microbiological testing in the dairy industry,
White (1996) summarized some of the methods that Fung had reviewed. Some
of these methods are as follows:
1. Microbial ATP detection: Bioluminescence (Celsis, Evanston, IL; Co-
gent Technologies, Ltd., Cincinnati, OH) as a screening tool for ac-
cepting raw milk shows great promise. Reybroeck and Schram (1995)
outlined a test that took less than 6 min. They described this method
as being very useful as a sensitive and rapid semiautomatic method
for fast microbiological screening of raw milk on arrival at a dairy
plant.
2. Impedance detection in foods (Bactometer, bioMe′rieux, Vitek, Inc.,
Hazelwood, MO; Malthus System, Crawley, UK).
3. Omnispec Bioactivity Monitor System (Wescor, Inc., Logan, UT): A
tristimulus reflectance colorimeter monitors dye pigment changes
caused by microbial activity. The LABSMART System highlights this
use of reflectance colorimetry.
4. Catalase test: This test is very useful in detecting strongly catalase-
positive bacteria, such as pseudomonads.
5. Many miniaturized diagnostic kits for identification of microorganisms
(e.g., API, Enterotube, R/B, Minitek, MicroID, and IDS).
6. Genetic techniques (Fung, 1995): DNA/RNA probes are a sensitive
method for detection of pathogens (e.g., Listeria and Salmonella detec-
tion using The Gene-Trak Assay System [Gene-Trak Systems, Fra-
mingham, MA]). Sensitivity 1 H11003 10
5
organisms per milliliter broth
(Giese, 1995). Wolcott (1991) indicated that polymerase chain reaction
(PCR) has become the preferred method for amplifying DNA. This
enables detection of target microorganisms in hours rather than days.
This procedure has tremendous potential in all areas of food microbiol-
ogy, including dairy microbiology. The BAX System (Dupont Experi-
mental Station, Wilmington, DE) for screening Salmonella is one ex-
ample.
7. Enzyme-linked immunosorbent assay (ELISA), systems produced in
the United States by Organon Teknika (Durham, NC), use monoclonal
antibodies as a diagnostic test, especially for foodborne pathogens. De-
velopment of the ELISA technique using monoclonal antibodies spe-
Testing of Milk and Milk Products 677
cific to Pseudomonas and related psychrotrophic bacteria as outlined
by Gut?′errez et al. (1997) shows great promise.
8. Vitek Immuno Diagnostic Assay System (VIDAS): A multiparametric
immunoanalysis system that uses the enzyme-linked fluorescent immu-
noassay (ELFA) method. All intermediate steps are automated (Fung,
1994).
There continues to be a need for methods that can rapidly detect the pres-
ence of certain types of bacteria. Personnel at a dairy plant must be able to deter-
mine whether equipment is clean, to screen rapidly all incoming raw ingredients,
and to predict rapidly (H1102124 h) the shelf life of finished products. By monitoring
raw ingredients, monitoring the processing and packaging environment, and pro-
viding a more limited testing of finished products, a dairy processor becomes
much more proactive in eliminating safety and quality hazards.
Other innovations such as addition of carbon dioxide to milk and other
dairy products such as cottage cheese serve to extend the shelf life of the products
(Hotchkiss and Chen, 1996; Sierra et al., 1996). Certain questions have been
raised that relate to packaging for such products (e.g., high-barrier films being
required to retain the CO
2
).
Thus, much has changed in the testing of milk and milk products by dairy
processors. Environmental samples for pathogens are commonly being sent to
commercial testing laboratories, more sophisticated equipment is being found in
the laboratories, and many of the laboratories are becoming larger because of
consolidation and takeovers of smaller operations. However, one significant fact
cannot be forgotten: For the dairy industry continually to provide safe, long-
lasting products to the American consumer, rapid, accurate, and reliable testing
must be done. It is extremely important for management to react to the data
provided by this testing. As confidence is gained by quality assurance personnel
and production management, the American consumer will continue to receive
dairy products that are as good and safe as products produced anywhere in the
world.
REFERENCES
Adams DM, Barach JT, Speck ML. Heat resistant protease produced in milk by psychro-
trophic bacteria of dairy origin. J Dairy Sci 58:828, 1975.
Adams DM, Barach JT, Speck ML. Effect of psychrotrophic bacteria from raw milk on
milk proteins and stability of milk proteins to ultrahigh temperature treatment. J
Dairy Sci 59:823, 1976.
Babel FJ. Activity of bacteria and enzymes in raw milk held at 4.0°C (abstr). J Dairy Sci
36:562, 1953.
678 White
Barach JT, Adams DM, Speck ML. Low temperature inactivation in milk of heat-resistant
proteases from psychrotrophic bacteria. J Dairy Sci 59:391, 1976.
Barber FW, Fram H. The problem of false coliform counts on fruit ice cream. J Milk
Food Technol 18:88–90, 1955.
Bautista DA, McIntyre L, Laleye L, Griffiths MW. The application of ATP biolumines-
cence for the assessment of milk quality and factory hygiene. J Rapid Methods
Automat Microbiol 1:179–193, 1992.
Bernard D. Microbiological considerations of testing aseptic processing and packaging
systems. In: Proceeding: Capitalizing on Aseptic. NFPA Conference, Washington,
DC, 1983.
Bishop JR. Establish a dairy product quality assessment program. 3M, Oct. 1988.
Bishop JR. Estimating shelf-life: A basic part of total dairy quality assurance. UW Dairy
Pipeline 5(2):1, 1993.
Bishop JR, White CH. Estimation of potential shelf-life of pasteurized fluid milk utilizing
bacterial numbers and metabolites. J Food Prot 48:663, 1985.
Bishop JR, White CH. Assessment of dairy product quality and potential shelf-life: a
review. J Food Prot 49:739, 1986.
Bockelmann BV. Quality control of aseptically packaged food products. In: Reuter H, ed.
Aseptic Packaging of Food. Lancaster, PA: Technomic Publishing, 1989, pp 237–
243.
Byrne RD Jr, Bishop JR, Boling JW. Estimation of potential shelf-life of pasteurized fluid
milk utilizing a selective preliminary incubation. J Food Prot 52:805, 1989.
Celestino EL, Lyer M, Roginski H. The effects of refrigerated storage on the quality of
raw milk. Aust J Dairy Technol 51:59, 1996.
Champagne CP, Laing RR, Roy D, Mafu AA, Griffiths MW. Psychrotrophs in dairy prod-
ucts: their effects and their control. Crit Rev Food Sci Nutr 34:1, 1994.
Edwards J. Q. A. Programs for processors and packages: low acid foods. In: Proceedings:
Capitalizing on Aseptic. NFPA Conference, Washington, DC, 1983.
Flickinger B. Plant sanitation comes to life: an evaluation of ATP-bioluminescence sys-
tems for hygiene monitoring. Food Qual 2(Jun–Jul):22, 1996.
Fung DYC. Rapid methods and automation in food microbiology: a review. Food Rev
Int 10:357, 1994.
Fung DYC. What’s needed in rapid detection of foodborne pathogens. Food Technol
49(6):64, 1995.
Giese J. Rapid microbiological testing kits and instruments. Food Technol 49(7):64,
1995.
Goel MC, Kulshrestha DC, Marth EH, Francis DW, Bradshaw JG, Read RB Jr. Fate of
coliforms in yogurt, buttermilk, sour cream, and cottage cheese during refrigerated
storage. J Milk Food Technol 34:54, 1971.
Griffiths MW. The role of ATP-bioluminescence in the food industry: new light on old
problems. Food Technol 50:62, 1996.
Griffiths MW, McIntyre L, Sully M, Johnson I. Enumeration of bacteria in raw milk.
In: Stanley PE, Kricka LJ, eds. Bioluminescence and Chemiluminescence, Current
Concepts. Chichester, UK: Wiley, 1991, pp 479–482.
Griffiths MW, Phillips JD. The application of the pre-incubation test in commercial dairies.
Aust J Dairy Technol 4:171–179, 1986.
Testing of Milk and Milk Products 679
Guinot-Thomas P, Al-Ammoury M, LeRoux Y, Laurent F. Study of proteolysis during
storage of raw milk at 4°C: effect of plasmin and microbial proteinases. Int Dairy
J 5:685, 1995.
Gut?′errez R, Gonza′lez I, Garc?′a T, Carrera E, Sanz B, Hernandes PE, Martin R. Mono-
clonal antibodies and an indirect ELISA for detection of psychrotrophic bacteria
in refrigerated milk. J Food Prot 60:23, 1997.
Hotchkiss J, Chen JH. Microbiological effects of the direct addition of CO
2
to pasteurized
milk (abstr). J Dairy Sci 79(suppl 1):87, 1996.
Johns CK. Preliminary incubation for raw milk samples. J Milk Food Technol 23:137,
1960.
Johnson P., Randolph Associates, 2000.
Karwoski M. Automated direct and indirect methods in food microbiology: A literature
review. Food Rev Int 12:155, 1996.
Marshall RT, ed. Standard Methods for the Examination of Dairy Products. 16th ed. Wash-
ington, DC: American Public Health Association, 1992.
Martin JH. Significance of bacterial spores in milk. J Milk Food Technol 37:794,
1974.
Martin JH. Heat resistant mesophilic microorganisms. J Dairy Sci 64:149, 1981.
Maxcy RB, Liewen MB. Function of preliminary incubation of raw milk samples for
quality control. J Dairy Sci 72:1443, 1989.
Pahauski E, Martin L, Stebritz K, Priest J, Dimond R. Rapid concentration procedure for
microorganisms in raw milk. J Food Prot 54:813, 1991.
Prosser JI, Killham K, Glover LA, Rattray EAS. Luminescence-based systems for detec-
tion of bacteria in the environment. Crit Rev Biotechnol 16:157, 1996.
Reybroeck W, Schram E. Improved filtration method to assess bacteriological quality of
raw milk based on bioluminescence of adenosine triphosphate. Neth Milk Dairy J
49:1, 1995.
Rollema HS, McKellar RC, Sorhaug T, Suhren G, Zadow JG, Law BA, Poll JK, Stepaniak
L, Vagias G. Comparison of different methods for the detection of bacterial proteo-
lytic enzymes in milk. Milchwissenschaft 44:491, 1989.
Sierra I, Prodanoy M, Calvo M, Olano A, Vidal-Valverde C. Vitamin stability and growth
of psychrotrophic bacteria in refrigerated raw milk acidified with carbon dioxide.
J Food Prot 59:1305–1310, 1996.
Smithwell N, Kailasapathy K. Psychrotrophic bacteria in pasteurized milk. Problems with
shelf-life. Aust J Dairy Technol 50:28–31, 1995.
Sutherland AD, Bell C, Limond A, Deakin J, Hunter EA. The Biotrace method for estimating
bacterial numbers in milk by bioluminescence. J Soc Dairy Technol 47:117, 1994.
White CH. The art and science of predicting shelf-life. Dairy Field 4:24–25, 1991.
White CH. Yogurt and fermented milk drinks. Presented at International Symposium on
Dairy Science and Technology, Canilec, Mexico, 1992.
White CH. Rapid methods for estimation and prediction of shelf-life for milk and dairy
products. J Dairy Sci 76:3126, 1993.
White CH. Microbiological testing in the dairy industry. Food Testing Anal 2(Aug–Sept):
22, 1996.
White CH, Marshall RT. Reduction of shelf-life of dairy products by a heat-stable protease
from Pseudomonas fluorescens P26. J Dairy Sci 56:849, 1973.
680 White
Wilster GH. Practical Buttermaking. 8th ed. Corvalis, OR/OSC Cooperative Association,
1957, pp 9, 230.
Witter LD. Psychrophilic bacteria: A review. J Dairy Sci 44:983, 1961.
Wolcott MJ. DNA-based rapid detection methods for the detection of foodborne patho-
gens. J Food Prot 54:387, 1991.
Zall RR, Chen JH, Murphy SC. Effects of heating and storing milk in milk plants before
pasteurization. Cult Dairy Prod J 17(4):5–9, 1982.
18
Treatment of Dairy Wastes
W. L. Wendorff
University of Wisconsin–Madison
Madison, Wisconsin
I. INTRODUCTION
Dairy plants process a wide variety of products including milk, cheese, butter,
ice cream, yogurt, nonfat dry milk, whey, and lactose. The volume and composi-
tion of dairy wastes from each plant depends on the types of products produced,
waste minimization practices, types of cleaners used, and water management in
the plant. Because most dairy plants process several milk products, waste streams
may vary widely from day to day. The main source of dairy effluents are those
arising from the following:
1. Spills and leaks of products or by-products
2. Residual milk or milk products in piping and equipment before
cleaning
3. Wash solutions from equipment and floors
4. Condensate from evaporation processes
5. Pressings and brines from cheese manufacture
Dairy plant operators may choose from a wide variety of methods for treat-
ing dairy wastes from their plants. This may range from land application for
small plants to operation of biological wastewater treatment systems for larger
plants. Some dairy plants may pretreat the effluents and discharge them to a
municipal wastewater treatment plant. Dairy wastes are segregated and treated
separately from sanitary wastes generated in employee facilities. The objectives
of treating dairy wastes are to (a) reduce the organic content of the wastewater,
(b) remove or reduce nutrients that could cause pollution of receiving surface
681
682 Wendorff
waters or groundwater, and (c) remove or inactivate potential pathogenic micro-
organisms or parasites.
The level of treatment needed for dairy wastewater for each plant is dictated
by the environmental regulations applicable to the location of the dairy plant.
The Environmental Protection Agency (EPA) establishes general regulations con-
cerning discharges to surface waters and groundwater. Each state environmental
regulatory agency is responsible for ensuring compliance with those regula-
tions. Each plant must have a discharge permit for each outfall discharging to
surface waters. The limits within that permit depend on the flow and type of
surface water into which the treated wastewater is discharged. If a plant dis-
charges wastewater to municipal sewers for treatment, the municipal treatment
system may require pretreatment of high-strength wastes to bring the waste load
down to domestic sewage strength. This allows for proper treatment of wastewa-
ter before it is discharged to surface water. For land applications, state regulatory
agencies dictate hydraulic loadings and maximum levels of toxic substances that
can be landspread on each unit of land.
II. DAIRY PLANT EFFLUENTS
A. Quantity of Dairy Wastes
Wastes from manufacture of milk products contain milk solids in various concen-
trations. Up to 5% of the milk received by a dairy plant may be lost in waste
discharges from the plant (Carawan et al., 1979; Harper and Blaisdell, 1971;
Harper et al., 1985). Typical product losses for fluid milk and ice cream plants
are listed in Table 1. With increased environmental restrictions, dairy plants have
instituted waste minimization procedures to reduce the loss of milk solids and
improve use of milk by-products (Danalewich et al., 1998; Harper and Carawan,
1978; Harper et al., 1985; Wendorff, 1995). These water and waste management
programs also emphasize water conservation practices in plants to reduce the
overall volume of dairy wastes that need to be treated.
B. Composition of Dairy Wastes
Because more than 95% of the waste load from dairy plants comes from milk
or milk products, it is of value to know the average composition of these products
(Table 2). Milk solids are primarily composed of fats, proteins, and carbohy-
drates. Other constituents in dairy wastewater may include sweeteners, gums,
flavoring, salt, cleaners, and sanitizers.
Biochemical oxygen demand (BOD) is the amount of dissolved oxygen
(DO) consumed by microorganisms for biochemical oxidation of organic solids
in wastewater. The analytical procedure for determining BOD measures dissolved
Treatment of Dairy Wastes 683
Table 1 Product Losses for Fluid Milk and Ice Cream
Processing Plant
Product losses
Process Fluid milk (%) Ice cream (%)
Receiving 0.23 0.20
Separation 0.75 —
Clarification 0.08 —
Milk storage 0.44 0.28
Standardizing — 0.08
Blending — 0.10
Pasteurization 0.58 1.00
Pasteurized storage 0.25 0.40
Flavoring and fruit — 0.30
Freezing — 0.50
Filling 0.50 0.75
Conveying 0.10 0.40
Hardening — 0.04
Storage 0.10 0.04
Miscellaneous 0.30 0.04
Total 3.33 4.13
Source: Harper et al. (1985).
Table 2 Average Composition of Milk and Milk Products (100 g)
Total
organic
Product Fat (g) Protein (g) Lactose (g) solids (g)
Skim milk 0.08 3.5 5.0 8.56
2% Milk 2.0 4.2 6.0 12.2
Whole milk 3.5 3.5 4.9 11.1
Half and half 11.7 3.2 4.6 19.5
Heavy cream 40.0 2.2 3.1 45.3
Chocolate milk 3.5 3.4 5.0 18.5
Churned buttermilk 0.3 3.0 4.6 8.0
Cultured buttermilk 0.1 3.6 4.3 10.0
Sour cream 18.0 3.0 3.6 24.6
Yogurt 3.0 3.5 4.0 10.8
Evaporated milk 8.0 7.0 9.7 27.0
Ice cream 10.0 4.5 6.8 41.3
Whey 0.3 0.9 4.9 6.3
Source: Harper and Blaisdell (1971).
684 Wendorff
oxygen consumed by a seeded, diluted wastewater sample incubated at 20°C for
5 days (American Public Health Association, 1992). One gram of milk fat has
a BOD of 0.89 g, whereas milk protein, lactose, and lactic acid have BOD values
of 1.03, 0.65, and 0.63 g, respectively. The range of BOD values for various
milks and milk products is given in Table 3. Roughly, 1 kg of BOD in dairy
wastewater represents 9 kg of whole milk. Chemical oxygen demand (COD) is
the amount of oxygen necessary to oxidize the organic carbon completely to
CO
2
,H
2
O, and ammonia. The COD is measured colorimetrically after refluxing
a sample of wastewater in a mixture of chromic and sulfuric acid (American
Public Health Association, 1992). If the BOD/COD ratio of wastewater is less
than 0.5, then the organic solids in the waste are not easily biodegraded. The
BOD/COD ratio for dairy wastes has been reported to range from 0.50 to 0.78
(Brown and Pico, 1979; Danalewich et al., 1998; Harper et al., 1985; Marshall,
1978).
Some minor constituents, such as phosphorus and chloride, are also very
important in the treatment of dairy wastes. Phosphorus is the element that limits
plant and algal growth in surface waters. Discharge of any significant levels of
phosphorus in waste effluents to surface waters can lead to decreased water qual-
ity in lakes and streams. Milk and milk by-products can contribute significant
quantities of phosphorus to dairy wastes. The phosphorus content of milk is ap-
proximately 1000 mg/L, whereas whey contains 450 to 575 mg/L (Wendorff,
1991; Wendorff and Matzke, 1993). Salty whey and brines can contribute sig-
nificant levels of chloride to dairy wastewater. Chloride concentrations in excess
of 400 mg/L in effluents discharged to streams can result in chronic toxicity to
Table 3 Reported BOD
5
Values and Percentage Contribution of Milk Components
to Product BOD
5
% Contribution to BOD
5
by
BOD
5
Milk
Product (mg/L) Milkfat Protein Lactose
Skim milk 67,000 6.3 49.3 44.5
Whole milk 104,000 17.8 43.3 39.0
Half and half 156,000 62.4 19.7 17.9
Heavy cream 399,000 89.2 5.7 5.0
Churned buttermilk 68,000 4.2 48.2 46.7
Evaporated milk 208,000 34.6 35.0 30.6
Ice cream 292,000 30.7 15.9 15.2
Whey 34,000 5.9 20.6 70.8
Source: Harper and Blaisdell (1971).
Treatment of Dairy Wastes 685
sensitive water insects such as Daphnia magna. Because chloride cannot be re-
moved with biological or chemical treatments, waste minimization is the only
method for reducing chloride in dairy wastes (Wendorff, 1995).
III. TREATMENT OF MILK WASTE
Wastes from processing milk products are almost entirely composed of organic
material in solution or colloidal suspension, although some larger suspended sol-
ids may be present in wastewater from cheese or casein manufacturing plants.
Sand and other foreign material is present in limited amounts as a result of floor
or truck washes. Because milk waste contains very little suspended matter, pre-
liminary settling of solids does not result in any appreciable reduction of BOD.
However, a screen and grit chamber with 0.95-cm mesh wire screen is recom-
mended to remove large particles to prevent clogging of pipes and pumps in the
treatment system. This is especially important if the waste is to be pumped with
high-pressure pumps, as in spray irrigation. After preliminary treatment in the
screen and grit chamber, the waste should be pumped to an equalization tank.
With wide variations in wastewater flow, strength, temperature, and pH, some
reaction time is required to allow neutralization of acid and alkaline cleaning
compounds and to allow for complete reaction of residual oxidants from cleaning
solutions with organic solids of dairy waste. Ideally, a minimum of 6–12 h of
equalization should be provided to allow for waste stabilization. The equilibrated
waste can then be treated with one of the following systems or a combina-
tion of treatment systems: (a) land application, (b) treatment ponds or lagoons,
(c) activated sludge, (d) biological filtration, or (e) anaerobic digestion.
A. Land Application
Because many dairy plants are located in rural areas, land application of process
wastewater and waste by-products may be the simplest and most economical
means of treating dairy wastes. Wastewater may be applied in a ridge and furrow
system or by spray irrigation. Pollutants in the dairy wastewater are removed by
a combination of physical and biological processes. The soil serves as an effective
filter to physically remove particulate and colloidal material from process wastes.
The upper 12–15 cm of soil can remove as much as 30–40% of the BOD and
COD (Law et al., 1969).
Soluble organic compounds in dairy wastewater and particulate material
filtered by the soil are degraded by heterotrophic microorganisms in soil. Table
4 lists the range of numbers for major groups of microorganisms in a fertile
agricultural soil of midwest United States. Major genera of bacteria in soils in-
clude Arthrobacter, Bacillus, Achromobacter, Flavobacterium, and Pseudomo-
686 Wendorff
Table 4 Relative Number of Soil Flora and Fauna
Commonly Found in Surface Soils
a
Number
Organisms per m
3
per gram
Microflora
Bacteria 10
13
–10
14
10
8
–10
9
Actinomycetes 10
12
–10
13
10
7
–10
8
Fungi 10
10
–10
11
10
5
–10
6
Algae 10
9
–10
10
10
4
–10
5
Microfauna
Protozoa 10
9
–10
10
10
4
–10
5
Nematoda 10
6
–10
7
10–10
2
Other fauna 10
3
–10
5
Earthworms 30–300
a
Generally considered 15 cm deep, but in some instances (e.g., earth-
worms), a greater depth is used.
Source: Brady (1990).
nas (Goodfellow, 1968). Soil microorganisms are contained within biofilms ab-
sorbed to colloids or soil particles (Metting, 1993).
1. Biochemical Oxygen Demand Removal
Under aerobic conditions, soil microorganisms degrade the organic pollutants
completely to CO
2
and BOD removal should be more than 99%. If the concentra-
tion of BOD or the volume of wastewater is too great for the soil capacity, anaero-
bic conditions may result. Spyridakis and Welch (1976) reported that anaerobic
conditions in the soil surface result in a low rate of biological activity and, thus,
a tendency for sludge accumulation, production of ferrous sulfide, or accumula-
tion of polysaccharides. Allison (1947) demonstrated that soil clogging was a
result of biochemical activity by microorganisms within soil and not the result
of filling soil spaces with sludge from wastewater. Lactose and milk proteins are
easily decomposed by anaerobic soil bacteria. However, fats and oils are more
resistant to decomposition and tend to accumulate in soil under anaerobic condi-
tions. By providing periods of rest between applications to allow soil to dry,
clogging problems disappear and aerobic conditions return to the soil surface.
Treatability of a large volume of low BOD waste may be limited by the percola-
tion capacity of soil, whereas a small volume of waste with high BOD is more apt
to be limited by the oxidative capacity of microorganisms and sorptive capacity of
organic matter in soil (Spyridakis and Welch, 1976).
Treatment of Dairy Wastes 687
Parkin and Marshall (1976) reported application rates for dairy plant waste-
water of 130 m
3
/ha to 1500 m
3
/ha (1 hectare H11005 2.49 acres) on New Zealand
pasture land. A rest period of 10–60 days was used to allow soil bacteria to
decompose the effluent and soil to dry out. Guichet et al. (1991) reported applica-
tion rates of 45 mm of liquid per month for wastewater sludge from a butter and
cheese processing plant in France. They observed rapid decomposition of lactose
in sludge, but reported a gradual accumulation of lipids in treated soil. A regular
application of dairy wastewater sludge to soil for 25 years resulted in a twofold
increase in the level of organic matter in soil. The additional moisture and added
buffering of pH from dairy waste greatly improved mineralization of organic
matter in soil (Guichet et al., 1991).
2. Nitrogen and Phosphorus Removal
Nitrogen from dairy wastes is removed by sedimentation of protein absorbed to
soil and volatilization of ammonia, uptake by crops, and biological denitrification
(Lance, 1972). Milk proteins may be degraded by proteolytic soil bacteria or
microflora present in milk waste from the dairy plant. Ammonia from protein
breakdown is biologically oxidized to nitrate by a process known as nitrification.
Nitrification is a two-step process whereby ammonia is first converted to
nitrite and then to nitrate. Conversion of ammonia to nitrite is accomplished by
Nitrosomonas sp., whereas conversion of nitrite to nitrate is completed by Ni-
trobacter sp. Nitrification can also be brought about by certain heterotrophs, in-
cluding fungi such as Aspergillus flavus, some species of Penicillium, and bacte-
ria (e.g., Arthrobacter) (Hattori, 1973). Other heterotrophic bacteria, such as
Achromobacter, Corynebacterium, Agrobacterium, and Alcaligenes, can convert
ammonia to nitrite. Nitrification requires aerobic conditions, because gaseous ox-
ygen is involved in the reaction. Nitrification of ammonia releases hydrogen ions,
resulting in acidification of the soil.
Nitrogen uptake by plants generally does not exceed 60–70% of added
inorganic fertilizers. Only with careful management of organic nitrogen sources,
such as milk proteins, can increased nitrogen uptake by crops be experienced. The
remaining nitrate in soil may be lost by leaching to groundwater or by biological
denitrification. Denitrification occurs when nitrate is reduced to nitrogen gas un-
der anaerobic conditions in soil. Doran et al. (1985) reported that 66–69% of
nitrogen in dairy wastes was lost through denitrification in ridge and furrow sys-
tems.
Phosphorus in dairy wastes is removed by adsorption to soil particles,
chemical precipitation, and uptake by crops. Generally, phosphorus is effectively
removed in the upper 0.3–0.6 m of soil (Spyridakis and Welch, 1976). Soils have
very reactive surfaces containing iron, aluminum, and calcium, which readily
form insoluble phosphates. Normally, the content of organic phosphorus in a
688 Wendorff
soil is higher than that of inorganic phosphorus. Mineralization of phosphorus
in organic matter results through action of bacteria, actinomycetes, and fungi.
Up to 50% of phosphorus from organic fertilizers can be effectively removed by
crops (Fried and Broeshart, 1967).
High-strength dairy wastes such as whey, whey permeate, and antibiotic-
contaminated milk can effectively be used as sources of plant nutrients for ag-
ricultural crops (Kelling and Peterson, 1981; Peterson et al., 1979; Wendorff,
1989). Sharrat et al. (1962) pointed out that nitrification of organic nitrogen from
whey proteins was controlled by the carbon to nitrogen (C:N) ratio of whey. If
the C:N ratio of whey is too great, nitrogen is incorporated into cells of microbes
and so is unavailable to plants for some time. Conversely, if the C:N ratio is
small, microbes, through nitrification, convert much of the nitrogen in whey to
nitrate within several weeks. Nitrate determinations on soil receiving whey indi-
cated that organic nitrogen in whey was readily converted to nitrates during the
first and second seasons after application. Sharratt et al. (1959) reported increased
growth of bluegrass the second year after application of whey. They credited this
extra production to slow breakdown of nitrogen compounds in whey. Whey and
whey permeate also contain high concentrations of phosphorus, which can be
used for plant growth (Peterson et al., 1979; Wendorff and Matzke, 1993). Most
phosphorus in whey is inorganic phosphorus, which is readily available for plant
uptake.
High levels of soluble salts in whey and whey permeate may limit applica-
tion rates to certain soils and crops. Some salt-sensitive crops such as soybeans,
green beans, and red clover are susceptible to leaf burn and application rates
should not exceed 13 mm/yr (Kelling and Peterson, 1981). Chloride levels in
whey greatly exceed the drinking water standard of 250 mg/L, and application
rates should be restricted to no more than 26,000 L/ha/yr to avoid leaching of
significant levels of chloride to groundwater (Matzke and Wendorff, 1993; Wen-
dorff, 1993).
3. Removal of Microorganisms
Unlike domestic wastewater, dairy plant wastewater and dairy wastes do not con-
tain significant levels of human pathogens that may be of concern when irrigating
processed food crops. Extensive field observations indicate that bacteria and vi-
ruses are efficiently removed from wastewater as it percolates through soil. Re-
moval of bacteria by soils is inversely proportional to the particle size of soils.
Viruses may be transported to greater depths in soil than bacteria because of their
smaller size (Drewry and Eliassen, 1968). However, percolation through even
the coarsest soil will remove bacteria and viruses within 1–2 m (McGauhey,
1968). The potential leaching of bacteria or viruses from sludge or wastewater
to groundwater is minimal (Bitton, 1994).
Treatment of Dairy Wastes 689
B. Treatment Ponds or Lagoons
Dairy plants in rural areas with insufficient farmland available for land applica-
tion may be able to use ponds or lagoons for economical treatment of dairy
wastes. A pond or lagoon normally consists of a shallow basin designed for treat-
ment of dairy wastewater without extensive equipment and controls. The three
types of ponds used are aerobic, facultative, and anaerobic.
1. Aerobic Ponds
Aerobic ponds are generally 0.5–2.0 m deep, and contents are mechanically
mixed and aerated to allow penetration of sunlight necessary for growth of algae.
The algae produce oxygen through photosynthesis and use waste products from
the bacteria involved in the biological breakdown of milk wastes. At 20°C, a
BOD removal of 85% can be experienced with an aeration period of 5 days
(Bitton, 1994). Pickett (1988) reports retention times of up to 90 days for waste-
water from a cheese plant.
2. Facultative Ponds
Facultative ponds are the most common type of treatment ponds for high-strength
dairy wastes. Treatment is achieved by action of aerobic, anaerobic, and faculta-
tive microorganisms as outlined in Fig. 1. In the upper zone, oxygen is supplied
by photosynthetic green and blue-green algae. The algae also take up some of
the nitrogen and phosphorus from dairy wastes. In the aerobic zone, heterotrophic
Figure 1 Microbial activities in a waste treatment pond.
690 Wendorff
bacteria degrade organic matter in dairy wastes and produce CO
2
and micronutri-
ents needed by algae. Some of the typical bacteria involved in this process include
genera such as Pseudomonas, Achromobacter, and Flavobacterium (Sterritt and
Lester, 1988). Dead bacteria and algae settle to the bottom of the pond and are
degraded by anaerobic microorganisms. During anaerobic decomposition, meth-
ane, hydrogen sulfide, carbon dioxide, and nitrogen may be released to the atmo-
sphere. Although some carbon is lost with escape of CO
2
or CH
4
, most of it is
converted to microbial biomass. Zooplankton (rotifera, cladocera, and copepoda)
feed on bacterial and algal cells (Bitton, 1994). However, unless sludge is periodi-
cally removed from the base of the pond, little carbon reduction is obtained with
facultative ponds. BOD removals of up to 90% can be obtained in facultative
ponds depending on climatic conditions. Although the aerobic phase of treatment
is fairly tolerant of temperature variations, the anaerobic phase is very sensitive,
with activity almost ceasing at or below 17°C (Sterritt and Lester, 1988). Reten-
tion time in facultative ponds ranges from 5 to 30 days.
3. Anaerobic Ponds
Anaerobic ponds are generally used to pretreat dairy wastes with high protein
and fat levels or for stabilizing settled solids. Organic matter is biodegraded and
gases such as CH
4
,CO
2
, and H
2
S are produced. To reduce effectively the BOD
in anaerobic effluent, an aerobic process must follow to allow aerobic micro-
organisms to use up the residual breakdown products. The typical retention time
for anaerobic treatment ponds ranges from 20 to 50 days (Metcalf and Eddy,
Inc., 1991).
C. Activated Sludge
Activated sludge is one of the most popular methods for treating dairy wastes.
The process consists of aerobic oxidation of organic matter to CO
2
,H
2
O, NH
3
,
and cell biomass followed by sedimentation of activated sludge. A portion of the
activated sludge is returned to the aeration tank to continue the treatment cycle
(Fig. 2).
1. Activated Sludge Microorganisms
Activated sludge contains a large mass of various microorganisms plus organic
and inorganic particles. The concentration of biomass in the aeration or contact
tank is normally called the mixed liquor suspended solids (MLSS). Bacteria make
up the largest portion of activated sludge in the aeration process. Bitton (1994)
noted that more than 300 strains of bacteria thrive in activated sludge. Bacteria
are primarily responsible for oxidation of organic matter and formation of poly-
saccharides and other polymeric materials that aid in flocculation of the microbial
Treatment of Dairy Wastes 691
Figure 2 The conventional activated sludge treatment system.
biomass. Table 5 lists some bacterial genera found in activated sludge. Estimates
of aerobic bacterial counts in activated sludge are approximately 10
10
/g of MLSS
or 10
7
–10
8
/mL (Sterritt and Lester, 1988). Hanel (1988) stated that the active
fraction of bacteria in activated sludge flocs represents only 1%–3% of total
bacteria present. This indicates that the major portion of activated sludge is actu-
ally dead cells and extracellular material. Activated sludge does not normally
favor growth of yeast, algae, or fungi.
Protozoa may represent up to 5% of the MLSS. Protozoa are predators of
bacteria in activated sludge; they help reduce effluent suspended solids and solu-
ble BOD. Sterritt and Lester (1988) estimated approximately 5 H11003 10
4
protozoa
in typical activated sludge. Most protozoa present in activated sludge are ciliates,
Table 5 Bacterial Genera Found
in Activated Sludge
Major genera Minor genera
Zoogloea Aeromonas
Pseudomonas Aerobacter
Comomonas Micrococcus
Flavobacterium Spirillum
Alcaligenes Acinetobacter
Brevibacterium Gluconobacter
Bacillus Cytophaga
Achromobacter Hyphomicrobium
Corynebacterium
Sphaerotilus
Source: Sterritt and Lester (1988).
692 Wendorff
although ameba and flagellates may also be present under certain conditions. The
predominant genera of ciliates in activated sludge are Opercularia, Vorticella,
Aspidisca, Carchesium, and Chilodonella. Protozoa are also responsible for a
significant reduction of pathogenic bacteria and viruses in activated sludge. Re-
ductions of Escherichia coli, and coxsackievirus, and poliovirus in excess of 90%
have been reported (Sterritt and Lester, 1988).
Rotifers are multicellular organisms that are present in aging activated
sludge. Their role includes removal of freely suspended bacteria and aiding in
floc formation by producing fecal pellets surrounded by mucus (Curds and
Hawkes, 1975). The four most common genera of rotifers present in activated
sludge include Philodina, Habrotrocha, Notommata, and Lecane.
2. Conventional Process
In the conventional activated sludge process, dairy wastewater is introduced into
the aeration tank along with a portion of activated sludge from the clarifier. Air
is incorporated into the waste mixture with diffusers or mechanical aerators. The
air serves two purposes in the aeration tank: first, to supply oxygen to aerobic
microorganisms and, second, to keep the activated sludge floc thoroughly mixed
with incoming wastewater to allow maximal efficiency in oxidation of organic
matter. Key parameters controlling operation of the activated sludge process are
rate of (a) aeration in the tank, (b) return of activated sludge to the aeration tank,
and (c) waste or excess sludge discharged from the treatment system. Normal
detention time for conventional activated sludge treatment of municipal or low-
strength wastewater is 4–8 h (Bitton, 1994). However, dairy wastewaters may
require longer detention times, 15–40 h, to reduce BODs to an acceptable level
(Jones, 1974). This type of process is called an extended aeration system. Jones
(1974) reported that BOD removal efficiencies in excess of 90% are attainable
for dairy wastewaters with extended aeration treatment. Bangsbo-Hansen (1978)
also reported that effluent standards of 20 mg of BOD/L could be met if
BOD of incoming dairy wastewater was between 700 and 1200 mg/L. Orhon
et al. (1993) indicated that effluent COD cannot be biologically reduced below
85 mg/L, regardless of sludge age, due to generation of residual fractions.
3. Contact Stabilization Process
Another modification of the activated sludge treatment is a three-step process
known as the contact stabilization process (Fig. 3). This process allows for a 30-
min detention time in the contact tank in which microorganisms obtain their food.
Sludge containing the organisms and their food is separated in the clarifier.
Sludge that is to be returned to the contact tank is first sent to an aerated stabiliza-
tion tank for 4–8 h during which time microorganisms finish digesting their food.
By aerating only sludge that is being returned to the initial contact tank, less tank
Treatment of Dairy Wastes 693
Figure 3 Activated sludge system with contact stabilization.
space and less air are required. This system produces less sludge and is better
suited for shock loading. Fang (1991) reported that BOD of dairy wastewater
could be reduced by 99% and total Kjeldahl nitrogen by 91% after a total deten-
tion time of 19.8 h in this type of system.
4. Sequencing Batch Reactor Process
The most popular activated sludge treatment uses sequencing batch reactors
(SBRs). As shown in Fig. 4, the SBR process is a single-tank fill-and-draw system
that provides for activated sludge aeration, settling, effluent withdrawal, and
sludge recycling. Usually, a plant has two or more SBR tanks; thus allowing for
the filling of one tank while the other is going through the reaction sequence.
Once the tank is filled, wastewater is mixed, without aeration, to allow uptake
of soluble fermentation products. The aeration step provides for oxidation of
organic matter in wastewater. Activated sludge is then settled and treated effluent
is drawn off to complete the cycle. This process normally operates over longer
detention times than conventional activated sludge systems and allows for wide
variations in strength of waste. Schulte (1988) reported that elimination of clari-
fiers and sludge pump stations, along with flexibility and adaptability to auto-
mated process control, made the SBR process more cost effective on creamery
wastewater than other activated sludge processes. COD removals of 91–97% and
sludge with good settling properties were obtained from dairy wastes treated in
a SBR with a cycle time of 24 h (Eroglu et al., 1992).
5. Nitrogen and Phosphorus Removal
In removing nitrogen from dairy wastewater with activated sludge processes,
nitrogen must first be removed by nitrification (see Sec. III.A.2) followed by
694 Wendorff
Figure 4 Treatment steps using a Sequencing Batch Reactor (SBR).
denitrification. Growth of Nitrosomonas and Nitrobacter sp. in activated sludge
depends on BOD of mixed liquor and retention time of sludge. The growth rate
of nitrifiers is slower than that of heterotrophs in activated sludge, so an aged
sludge is needed for conversion of ammonia to nitrate. Hawkes (1983) reports
that nitrification is expected at a sludge age of more than 4 days. Nitrification
proceeds well in a two-stage activated sludge system in which BOD is removed
in the first stage and nitrifiers complete nitrification in the second stage (U.S.
Environmental Protection Agency, 1977). To remove nitrate from waste effluent,
denitrification must occur under anaerobic or anoxic conditions before treated
effluent is discharged to surface waters. This can be accomplished by using a
three-stage activated sludge system in which BOD reduction takes place in the
first, nitrification in the second, and denitrification in the third stage. An ideal
environment for denitrification is provided by the absence of dissolved oxygen
and the presence of a readily degradable organic substrate (Kolarski and Nyhuis,
1995). Methanol or settled sewage serves as carbon source for denitrifiers (Curds
and Hawkes, 1983).
Phosphorus removal in activated sludge systems usually requires a combi-
nation of anaerobic and aerobic stages in the process. Facultative organisms in
the initial anaerobic zone produce acetate and fermentation products from soluble
Treatment of Dairy Wastes 695
BOD of the waste. Microorganisms able to remove high levels of phosphorus
use these fermentation products and store them with the aid of energy from hydro-
lysis of stored polyphosphates during the anaerobic period. During the aerobic
stage of the process, stored products are depleted and soluble phosphorus is
taken up, with excess amounts being stored as polyphosphates (Buchan, 1981).
Fuhs and Chen (1975) identified bacteria of the Acinetobacter genus as high-
phosphorus–storing microbes active in activated sludge systems. The high-
phosphorus–containing sludge must be completely removed from effluent to
ensure compliance with effluent phosphorus limitations. In some instances,
alum or ferric chloride may be added to effluent before the secondary clarifier
to remove additional soluble phosphorus before final discharge of treated effluent
(U.S. Environmental Protection Agency, 1987).
6. Flocculation
Settling of sludge in the clarifier usually proceeds best when the microbial growth
rate is slow and nutrient concentrations are very low. Extracellular polysaccha-
rides and slimes produced by Zoogloea ramigera and other activated sludge or-
ganisms play a leading role in bacterial flocculation and floc formation (Norberg
and Enfors, 1982). Good sludge settling and BOD removal occurs at high MLSS
concentrations. Microbial flocculation can be enhanced with addition of polyelec-
trolytes, alum, or iron salts as coagulants (Bitton, 1994).
Poor settling of sludges may be observed if excess production of exopoly-
saccharides by bacteria occurs in activated sludge. This nonfilamentous bulking
may be corrected with chlorination (Chudoba, 1989). Filamentous bulking may
be caused by excessive growth of filamentous bacteria such as Sphaerotilus sp.
(Sterritt and Lester, 1988) or Nostocoida limicola (Goronszy, 1990). A low level
of dissolved oxygen in the aeration tank is the primary factor contributing to
growth of this filamentous bacterium in activated sludge (Lau et al., 1984; Martin
and Zall, 1985).
D. Biological Filtration
1. Trickling Filter
Biological filters, such as trickling or percolating filters, are one of the earliest
types of biological waste treatment. In a biological filter, the biofilm is attached
to a support substance such as gravel, stones, or plastic materials. As wastewater
is pumped over the biofilm, it oxidizes organic matter and removes nutrients such
as nitrogen and phosphorus.
A basic trickling filter is composed of a tank containing a filter medium
to a depth of 1.0–2.5 m, a wastewater distributor that applies the waste solution
evenly over the medium bed, and a final clarifying tank to remove sludge and
696 Wendorff
Figure 5 Trickling filter waste treatment system.
solids sloughing off the filter medium (Fig. 5). In some instances, wastewater is
recirculated through the system to provide for added dissolved oxygen to primary
influent and greater removal of BOD (U.S. Environmental Protection Agency,
1977). The two most important factors affecting microbial growth on the support
medium are flow rate of wastewater and size and geometrical configuration of
support material. In the initial startup of the filter, the medium surface is colonized
by gram-negative bacteria followed by filamentous bacteria. The biofilm formed
on support material is called a zoogleal film and is composed of bacteria, fungi,
algae, protozoa, and other life forms such as rotifers, nematodes, snails, and insect
larvae (Bitton, 1994). Some of the bacterial genera active in trickling filters are
Flavobacterium, Pseudomonas, Achromobacter, and filamentous bacteria such
as Sphaerotilus (Sterritt and Lester, 1988). Growth conditions on the outer surface
of the biofilm are aerobic but the inner portion of the biofilm next to support
material tends to be anaerobic.
Trickling filters are categorized by the loading rate to the filter medium.
Low-rate trickling filters (H1102140 kg BOD/100 m
3
/day) allow for nitrification and
more complete removal of nutrients from wastewater. High-rate filters (60–160
kg BOD/100 m
3
/day) rarely have nitrification take place and have lower treat-
ment efficiencies (U.S. Environmental Protection Agency, 1975). BOD removal
Treatment of Dairy Wastes 697
by trickling filters is approximately 85% for low-rate filters and 65–75% for high-
rate filters (U.S. Environmental Protection Agency, 1977).
2. Rotating Biological Contactor
One biofilm reactor that operates much as the trickling filter is the rotating biolog-
ical contactor (RBC). The RBC unit consists of a horizontal shaft with disks of
medium that are rotated through primary effluent. Because only about 40% of
the medium is submerged, the biofilm growing on the medium obtains its food
from effluent and oxygen from air above the solution. Increased rotation of disks
improves oxygen transfer and enhances contact between biofilm and wastewater
(March et al., 1981). The biofilm on RBC is composed of a diverse mixture of
eubacteria, filamentous bacteria, protozoa, and metazoa. Alleman et al. (1982)
identified Beggiatoa spp. as primary bacteria in the outer aerobic layer of the
biofilm and Desulfovibrio, a sulfate-reducing bacterium, in the inner anaerobic
layer. Advantages of the RBC are shorter treatment times, lower cost of operation,
and production of a readily dewatered sludge that settles easily (Weng and Molof,
1974). For high-strength dairy wastes, Surampalli and Baumann (1992) reported
that the first section of the RBC must be enlarged to provide sufficient dissolved
oxygen for adequate reduction of BOD. For effective nitrification, the second
stage of the RBC must have an increased rotational speed to promote growth of
nitrifying bacteria. Using a moving bed biofilm reactor, Rusten et al. (1992)
showed a 85% COD removal from dairy wastewater at an organic loading rate
of 500 g COD/m
3
h.
E. Anaerobic Digestion
Anaerobic digestion has been used to stabilize waste treatment sludges for many
years. However, in recent years, it has also been designed to treat high-strength
dairy wastes. In anaerobic breakdown of dairy wastewater, lactose is first fer-
mented to lactic acid and fats and proteins are hydrolyzed to organic acids, amino
acids, aldehydes, and alcohols. Second, the intermediate organic compounds are
converted to methane and CO
2
. Because anaerobic digestion does not require
oxygen for decomposition of organic material, operating costs for treatment are
greatly reduced from that of aerobic treatments. However, it is a much slower
treatment process that is more susceptible to toxic upsets (Bitton, 1994).
1. Conventional Process
A typical anaerobic digester is shown in Fig. 6. The anaerobic digester is a large
fermentation tank in which fermentation, sludge settling, sludge digestion, and
gas collection take place simultaneously. Many dairy plants use a two-stage sys-
tem in which the first stage is complete mixing of the contents of a fermentation
698 Wendorff
Figure 6 Two-stage anaerobic digester for dairy wastewater.
tank and the second stage is a digester in which the contents are allowed to
stratify. The two-stage anaerobic process allows for higher loading rates and
shorter hydraulic retention times (Ghosh et al., 1985). In anaerobic treatment of
wastewater, fermentation of sugars, amino acids, and fatty acids is primarily car-
ried out by strict and facultative anaerobic bacteria such as Bacteroides, Bifido-
bacterium, Clostridium, Lactobacillus, and Streptococcus (Sterritt and Lester
1988). Production of methane from fermentation intermediate compounds is ac-
complished by methanogenic bacteria, which are strict anaerobes. Approximately
two-thirds of the methane is derived from acetate conversion by acetotrophic
methanogens and the other one-third is the result of carbon dioxide reduction by
hydrogen (Mackie and Bryant, 1981). Methanogens are difficult to grow in pure
culture, but Balch et al. (1979) developed a classification scheme for some species
involved in this process. Perle et al. (1995) reported that milkfat was inhibitory
to methanogenic bacteria, and dairy effluents should be treated by anaerobic di-
gestion only after the milk fat concentration was less than 100 mg/L. They also
indicated that anaerobic cultures at the startup of anaerobic digestion should be
acclimatized to casein to ensure proper degradation of casein in the process.
Methanogenic bacteria are also sensitive to acidic conditions with complete inhi-
bition below pH 6 (Britton, 1994). With efficient operation of one- or two-stage
anaerobic digesters, dairy plants should experience BOD reductions of 78–95%
(Fang, 1991; Guiot et al., 1995). Biogas from the digester contains up to 67–
75% methane (Eroglu et al., 1992; Lebrato et al., 1990).
Treatment of Dairy Wastes 699
2. Upflow Anaerobic Filter
Upflow anaerobic filters operate much like trickling filters, but growth conditions
for microbes are anaerobic. The primary effluent is pumped into the base of the
reactor containing a support medium for growth of the biofilm. Upward flow of
wastewater keeps suspended solids in solution. In some instances, support mate-
rial is replaced with sand to form a fluidized-bed reactor. This type of reactor is
effective for low-strength wastes (COD of H11021600 mg/L) (Speece, 1983). Ander-
son et al. (1994) indicated that, to obtain high organic loading rates on anaerobic
upflow filters, a porous medium must be used in the column to allow for sufficient
biomass development. Temperature of effluent is important for proper fermenta-
tion and production of biogas. Viraraghavan and Kikkeri (1990) reported average
COD removals in three anaerobic filters were 92, 85, and 78% at 30, 21, and
12°C, respectively. The volume of biogas generated was lower at lower tempera-
tures but the percentage of methane in biogas was higher at lower temperatures.
Under efficient operation, anaerobic filters reduce dairy wastewater BODs by
90–97% and produce biogas with 54–75% methane (Kaiser and Dague, 1994;
Sammaiah et al., 1991). Backman et al. (1985) identified the three steps in anaero-
bic digestion of dairy wastes as liquefaction, acid formation, and methane forma-
tion. They reported the limiting step at lower organic loadings was the acid forma-
tion step, whereas at higher organic loadings, limiting steps were liquefaction
and acid formation.
3. Upflow Anaerobic Sludge Blanket
The upflow anaerobic sludge blanket (USAB) digester consists of a tank with a
bottom layer of packed sludge, a sludge blanket, and an upper liquid layer. Waste-
water flows up through the sludge blanket of active biomass. Settler screens sepa-
rate sludge from treated effluent and biogas is collected at the top of the digester
(Lettinga et al., 1980). Granular sludge aggregates that form contain three layers
of bacteria (MacLeod et al., 1990). The inner layer contains Methanothrix-like
cells that act as nucleation centers. The middle layer contains bacterial rods that
include both H
2
-producing acetogens and H
2
-consuming organisms. The outer-
most layer contains a mixture of fermentative and H
2
-producing bacteria. Dairy
wastes function well in the UASB process, because granulation of sludge is fa-
vored by soluble carbohydrates (Wu et al., 1987). Kato et al. (1994) reported
that for dairy wastes with a COD below 2000 mg/L, acidification instead of
methanogenesis was the rate-limiting step in COD reduction. However, Elliott
et al. (1991) found that when treating a high-strength waste such as whey
permeate, the rate of acid production was too rapid and acetate and propionate
accumulated to concentrations that were inhibitory to methanogenic bacteria.
Rico-Gutierrez et al. (1991) indicated that some addition of alkali may be neces-
sary in the startup of the reactor to maintain buffering capacity until a mature
700 Wendorff
bacterial population is established and methanogenesis is proceeding in a uniform
manner. COD removal efficiencies of 60–97% were achieved at organic loading
rates of 7–30 kg COD/m
3
/day (Ozturk et al., 1993; Samson et al., 1984).
IV. TREATED DAIRY EFFLUENTS
Effluents from waste treatment systems must be sufficiently reduced in BOD
and biological nutrients (e.g., P, NH
3
) that discharge to surface waters does not
significantly affect aquatic life. Environmental regulatory agencies specify limits
for composition of effluents discharged to each type of stream or watershed. To
reduce the volume of dairy wastewater to be treated and reduce treatment costs,
careful attention must be given to minimizing losses of milk and milk products
in the dairy plant. With good product conservation and selection of an effective
waste treatment process, dairy plant operators should be able to operate profitably
and meet environmental requirements.
REFERENCES
Alleman JE, Veil JA, Canaday JT. Scanning electron microscope evaluation of rotating
biological contactor biofilm. Water Res 16:543, 1982.
Allison LW. Effect of microorganisms on permeability of soil under prolonged submer-
gence. Soil Sci 63:439, 1947.
American Public Health Association. In: Greenberg AE, Clesceri LS, Eaton AD, eds.
Standard Methods for the Examination of Water and Wastewater. 18th ed. Washing-
ton, DC: American Public Health Association, 1992.
Anderson GK, Kasapgil B, Ince O. Comparison of porous and non-porous media in upflow
anaerobic filters when treating dairy wastewater. Water Res 28:1619, 1994.
Backman RC, Blanc FC, O’Shaughnessy JC. The treatment of dairy wastewater by the
anaerobic up-flow packed bed reactor. Proceedings of 40th Purdue Industrial Waste
Conference, West Lafayette, IN, 1985, p 361.
Balch WE, Fox GE, Magnum LJ, Woese CR, Wolfe RS. Methanogenesis: reevaluation
of a unique biological group. Microbiol Rev 143:260, 1979.
Bangsbo-Hansen D. Dairy wastewater. Nordeuropaeisk-Mejeri-Tidsskrift 44:101, 1978.
Bitton G. Wastewater Microbiology. New York: Wiley, 1994.
Brady NC. The Nature and Properties of Soils. New York: Macmillan, 1990.
Brown HB, Pico RF. Characterization and treatment of dairy wastes in the municipal
treatment system. Proceedings of 34th Purdue Industrial Waste Conference, West
Lafayette, IN, 1979, p 326.
Buchan L. The location and nature of accumulated phosphorus in seven sludges from
activated sludge plants which exhibited enhanced phosphorus removal. Water SA
7:1, 1981.
Treatment of Dairy Wastes 701
Carawan RE, Jones VA, Hansen AP. Wastewater characterization in a multiproduct dairy.
J Dairy Sci 62:1243, 1979.
Chudoba J. Activated sludge-bulking control. In: Cheremisinoff PN, ed. Encyclopedia of
Environmental Control Technology. Vol. 3. Wastewater Treatment Technology.
Houston, TX: Gulf Publishing, 1989, p 171.
Curds CR, Hawkes HA. Ecological Aspects of Used-Water Treatment. Vol. 2. London:
Academic Press, 1983.
Danalewich JR, Papagiannis TG, Belyea RL, Tumbleson ME, Raskin L. Characterization
of dairy waste streams, current treatment practices, and potential for biological nu-
trient removal. Wat Res 32:3555, 1998.
Doran FJ, Sauer DK, Boyle WC, Berthouex PM. Nitrogen transformations and reduction
by ridge and furrow land treatment of dairy waste. Proceedings of 40th Purdue
Industrial Waste Conference, West Lafayette, IN, 1985, p 405.
Drewry WA, Eliassen R. Virus movement in ground water. J Water Poll Control Fed 40:
R257, 1968.
Elliott JM, Parkin KL, Johnson EA. Biomethanation of cheese whey permeate by anaero-
bic digestion using a sewage sludge inoculum. Final Res Report, Department of
Food Science, Madison, WI: University of Wisconsin, 1991.
Eroglu V, Ozturk I, Demir I, Akca L, Kadir A. Sequencing batch and hybrid anaerobic
reactors treatment of dairy wastes. Proceedings of 46th Purdue Industrial Waste
Conference, West Lafayette, IN, 1992, p 413.
Fang HHP. Pretreatment of wastewater from a whey processing plant using activated
sludge and anaerobic processes. J Dairy Sci 74:2015, 1991.
Fried M, Broeshart H. The Soil-Plant System. New York: Academic Press, 1967.
Fuhs GW, Chen M. Microbial basis for phosphate removal in the activated sludge process
for the treatment of wastewater. Microbiol Ecol 2:119, 1975.
Ghosh S, Ombregt JP, Pipyn P. Methane production from industrial wastes by two-phase
anaerobic digestion. Water Res 19:1083, 1985.
Goodfellow M. Properties and composition of the bacterial flora of a pine forest soil. J
Soil Sci 19:154, 1968.
Goronszy MC. Batch reactor treatment of dairy wastewaters: A case history. Proceedings
of 44th Purdue Industrial Waste Conference, West Lafayette, IN, 1990, p 795.
Guichet J, Jambu P, Dinel H. Changes in the organic matter of a Rendzina soil caused
by wastewater sludge disposals from dairy processing plants. Pedologie 41:149,
1991.
Guiot SR, Safi B, Frigon JC, Mercier P, Mulligan C, Tremblay R, Samson R. Performance
of a full-scale novel multiplate anaerobic reactor treating cheese whey effluent.
Biotechnol Bioeng 45:398, 1995.
Hanel L. Biological Treatment of Sewage by the Activated Sludge Process, Chichester,
UK: Ellis Horwood, 1988.
Harper WJ, Blaisdell JL. Proceedings of Second National Symposium on Food Processing
Wastes, Water Pollution Control Res. Series 12060. Doc NO EP 1.16:12060, pp
509–545. Washington, DC: Environmental Protection Agency, 1971.
Harper WJ, Carawan RE. Approaches to minimizing water usage and wastes in dairy
plants. Int Dairy Fed Bull Doc 104. Brussels, Belgium: International Dairy Federa-
tion, 1978, p 53.
702 Wendorff
Harper WJ, Delaney RAM, Igbeka IA, Parkin ME, Schiffermiller WE, Ross TE, Williams
RA. Strategies for water and waste reduction in dairy food plants. EPA/600/2-85/
076. Washington, DC: Environmental Protection Agency, 1985.
Hattori T. Microbial Life in the Soil. New York: Marcel Dekker, 1973.
Jones HR. Pollution Control in the Dairy Industry. Park Ridge, NJ: Noyes Data Corp,
1974.
Kaiser SK, Dague RR. The temperature-phased anaerobic biofilter process. Water Sci
Technol 29:213, 1994.
Kato MT, Field JA, Kleerebezem R, Lettinga G. Treatment of low strength soluble waste-
waters in UASB reactors. J Ferment Bioeng 77:679, 1994.
Kelling KA, Peterson AE. Using whey on agricultural land—a disposal alternative. UW
Extension Bull A3098. Madison, WI: University of Wisconsin, 1981.
Kolarski R, Nyhuis G. The use of sequencing batch reactor technology for the treatment of
high-strength dairy processing waste. Proceedings of 50th Purdue Industrial Waste
Conference, West Lafayette, IN, 1995, p 485.
Lance JC. Nitrogen removal by soil mechanisms. Water Poll Control Fed 44:1352,
1972.
Lau AO, Strom PF, Jenkins D. Growth kinetics of Sphaereotilus natans and a floc former
in pure and dual continuous culture. J Water Pollut Control Fed 56:41, 1984.
Law JP Jr, Thomas RE, Myers LH. Nutrient removal from cannery wastes by spray irriga-
tion of grassland. FWPCA, 16080-11/69. Washington, DC: U.S. Department of the
Interior, 1969.
Lebrato J, Perez-Rodriguez JL, Maqueda C, Morillo E. Cheese factory wastewater treat-
ment by anaerobic semicontinuous digestion. Resources Conserv Recycling 3:193,
1990.
Lettinga G, van Velsen AFM, Hobma SW, de Zeeuw W, Klapwijk A. Use of upflow sludge
blanket (USB) reactor concept for biological wastewater treatment, especially for
anaerobic treatment. Biotechnol Bioeng 22:699, 1980.
Mackie DM, Bryant MP. Metabolic activity of fatty acid-oxidizing bacteria and the contri-
bution of acetate, propionate, butyrate and CO
2
to methanogenesis in cattle waste
at 40 and 60°C. Appl Environ Microbiol 41:1363, 1981.
MacLeod FA, Guiot SR, Costerton JW. Layered structure of bacterial aggregates in an
upflow anaerobic sludge bed and filter reactor. Appl Environ Microbiol 56:1598,
1968.
March D, Benefield L, Bennett E, Linstedt D, Hartman R. Coupled trickling filter-rotating
biological contactor nitrification process. J Water Pollut Control Fed 53:1469, 1981.
Marshall KR. The characteristics of effluents from New Zealand dairy factories. Int Dairy
Fed Bull Doc 104. Brussels, Belgium: International Dairy Federation, 1978, p 123.
Martin JH, Zall RR. Dairy processing wastewater bioaugmentation—an evaluation of ef-
fectiveness. Proceedings of 40th Purdue Industrial Waste Conference, West La-
fayette, IN, 1985, p 413.
Matzke S, Wendorff WL. Chloride in cheese manufacturing wastes to be landspread on
agricultural land. Bioresource Technol 46:251, 1993.
McGauhey PH. Manmade contamination hazards. Ground Water 6(3):10, 1968.
Metcalf and Eddy, Inc. Wastewater Engineering: Treatment, Disposal and Reuse. New
York: McGraw-Hill, 1991.
Treatment of Dairy Wastes 703
Metting JB Jr. Structure and physiological ecology of soil microbial communities. In: Soil
Microbial Ecology. New York: Marcel Dekker, 1993, p 3.
Norberg AB, Enfors SO. Production of extracellular polysaccharide by Zooglea ramigera.
Appl Environ Microbiol 44:1231, 1982.
Orhon D, Gorgun E, Germirli F, Artan N. Biological treatability of dairy wastewaters.
Water Res 27:625, 1993.
Ozturk I, Eroglu V, Ubay G, Demir I. Hybrid upflow anaerobic sludge blanket reactor
(HUASBR) treatment of dairy effluents. Water Sci Tech 28:77, 1993.
Parkin MF, Marshall KR. Land disposal of dairy factory effluent by spray irrigation. Int
Dairy Fed Bull Doc 104. Brussels, Belgium: International Dairy Federation, 1978,
p 151.
Perle M, Kimchie S, Shelef G. Some biochemical aspects of the anaerobic degradation
of dairy wastewater. Water Res 29:1549, 1995.
Pickett M. F&A Dairy Products finds efficient wastewater system. Dairy Field 171(5):26,
1988.
Peterson AE, Walker WG, Watson KS. Effect of whey application on chemical properties
of soils and crops. J Agric Food Chem 27:654, 1979.
Rico-Gutierrez JL, Garcia-Encina PA, Fernandez-Polanco F. Anaerobic treatment of
cheese-production wastewater using a UASB reactor. Bioresource Technol 37:271,
1991.
Rusten B, Odegaard H, Lundar A. Treatment of dairy wastewater in a novel moving bed
biofilm reactor. Water Sci Tech 26:703, 1992.
Sammaiah P, Sastry CA, Murty DVS. Dairy wastewater treatment using an anaerobic
contact filter. Indian J Environ Prot 11:418, 1991.
Samson R, Van den Berg B, Peters R, Hade C. Dairy waste treatment using industrial-
scale fixed-film and upflow sludge bed anaerobic digesters: Design and start-up
experience. Proceedings of 39th Purdue Industrial Waste Conference, West La-
fayette, IN, 1985, p 235.
Schulte SR. SBR treatment of food process wastewater. Proceedings of 1988 Food
Processing Waste Conference, Georgia Institute of Technology, Atlanta, GA,
1988.
Sharratt WJ, Peterson AE, Calbert HE. Whey as a source of plant nutrients and its effect
on the soil. J Dairy Sci 42:1126, 1959.
Sharratt WJ, Peterson AE, Calbert HE. Effect of whey on soil and plant growth. Agron
J 54:359, 1962.
Speece RE. Anaerobic biotechnology for industrial waste treatment. Environ Sci Technol
17:416A, 1983.
Spyridakis DE, Welch EB. Treatment processes and environmental impacts on waste ef-
fluent disposal on land. In: Sanks RL, Asano T, eds. Land Treatment and Disposal
of Municipal and Industrial Wastewater. Ann Arbor, MI: Ann Arbor Science Pub-
lishers, 1976, p 45.
Sterritt RM, Lester JN. Microbiology for Environmental and Public Health Engineers.
London: E & FN Spon, 1988.
Surampalli RY, Baumann ER. RBC kinetics in treating domestic and industrial dairy
wastewater under low and high organic loading conditions. Water Pollut Res J Can-
ada 27:665, 1992.
704 Wendorff
U.S. Environmental Protection Agency. Process Design Manual for Nitrogen Control.
Washington, DC: Office of Technology Transfer, 1975.
U.S. Environmental Protection Agency. Wastewater Treatment Facilities for Sewered
Small Communities. Report EPA/625/1-77/009, 1977.
U.S. Environmental Protection Agency. Phosphorus Removal. Design Manual EPA/625/
1-87/001, 1987.
Viraraghavan T, Kikkeri SR. Effect of temperature on anaerobic filter treatment of dairy
wastewater. Water Sci Technol 22:191, 1990.
Wendorff WL. Landspreading whey permeate: watch the parameters. UW Dairy Pipeline
1(1):1, 1989.
Wendorff WL. Phosphorus in dairy wastes—a real challenge. UW Dairy Alert, Nov. 15,
1991. Madison, WI: University of Wisconsin, 1991.
Wendorff WL. Revised guidelines for landspreading whey and whey permeate. UW Dairy
Alert, June 1, 1993. Madison, WI: University of Wisconsin, 1993.
Wendorff WL. Managing chloride and phosphorus by minimizing wastes. UW Dairy Pipe-
line 7(4):1, 1995.
Wendorff WL, Matzke S. Phosphorus in major varieties of whey produced in Wisconsin.
Dairy Food Environ Sanit 13:166, 1993.
Weng CN, Molof AH. Nitrification in the biological fixed film RBC. J Water Pollut Con-
trol Fed 46:1674, 1974.
Wu W, Hu J, Gu X, Zhao Y, Zhang H. Cultivation of anaerobic granular sludge with
aerobic activated sludge as seed. Water Res 21:789, 1987.
705
Index
Abomasum, 4
Acetobacter, 101, 392
Achromobacter, 61, 67, 101, 357, 685,
687, 690, 696
Acidaminococcus fermentans,34
Acid-anionic surfactant sanitizers:
advantages, 575
affect starter cultures, 185
disadvantages, 575
properties, 575
Acid degree value (ADV) test, 647
Acid injury, lactic acid bacteria, 304, 310
Acidophilus milk:
manufacture, 316
sweet, 317
therapeutic properties, 316
Acinetobacter, 61, 67, 360
Actinomyces spp., 66
Activated sludge treatment of dairy
wastes:
activated sludge microorganisms, 690
bacteria in, 691
contact stabilization process, 692–693
conventional process, 692
extended aeration system, 692
flocculation, 695
nitrogen and phosphorus removal, 693
[Activated sludge treatment of dairy
wastes]
parameters controlling operation,
692
protozoa, 691–692
rotifers, 692
sequencing batch reactor process, 693
Activity of starter cultures, 190, 191
Adjunct starter cultures, 191, 192, 355,
370
Aerobic spore count, 66, 653, 671–672
Aerococcus, 243, 244
Aeromonas, 61, 67, 599
Aeromonas hydrophila:
dairy plants, 94
milk and milk products, 60
psychrotrophic, 60
Aerosols, 62, 63
Aflatoxin:
acute toxicity, 416
B
1
, 6, 7, 414
B
2
, 6, 7, 414
carcinogen, 416
dairy products, 417–418
description of, 414–415
detection methods, 415–416
excretion in milk, 417
706 Index
[Aflatoxin]
hazard component in HACCP, 599
M
1
, 6, 7, 414
M
2
,6,7
milk and products, 6
nuts, 104
prevention, 418
public health concern, 500
stability, 418
synthesis, 415
Agrobacterium, 687
Air:
microbiological quality, 141
source of contaminants, 350
Alcaligenes, 61, 357, 358, 687
Alcaligenes viscolactis,67
ropy milk, 646
ropy milk test, 647
Alloiococcus, 243
Alternaria, 101, 501
Alveoli, 7
American Dairy Products Institute, 85,
88, 620
Anaerobic digestion to treat dairy
wastes:
anaerobic bacteria, 698
conventional process, 697–698
methanogenic bacteria, 698
two-stage process, 698
upflow anaerobic filter, 699
upflow anaerobic sludge blanket,
699–700
Anaerovibrio lipolytica,26
Annatto:
cheese colorant, 378
pink defect, 378
Antibiotics (see also Drug residues):
affect starter cultures, 184, 185
Bacillus stearothermophilus test for,
184
hazard component in HACCP, 599
raw milk, 6, 351
Anticarcinogenic activity:
probiotics, 332
yogurt, 332
Arthrobacter, 365, 685, 687
Aspergillus, 101, 374, 501
Aspergillus flavus,6
aflatoxin production, 414, 500
nitrification, 687
Apergillus nomius, 6, 414, 500
Aspergillus oryzae, 394
Aspergillus parasiticus, 6, 414, 500
Aspidisca, 692
Atopobium, 243
Baby Swiss Cheese
eyes, 362
starter cultures, 362
Bacillus, 61, 67, 85, 101, 106, 137, 138,
353, 652, 685
Bacillus anthracis:
causes anthrax, 419
closely related Bacillus cereus, 420
milk and milk products, 60
Bacillus botulinus, 425
Bacillus cereus:
characteristics of, 419
diarrheal enterotoxin, 420
emetic toxin, 420
evaporated milk spoilage, 82
growth in milk, 423
hazard component in HACCP, 599
in the environment, 422
milk and milk products, 60, 652
psychrotrophic strains, 60, 419
shed in milk, 422
spoilage of milk and cream, 419
testing for, 420
toxin assays, 420
toxins produced, 420
Bacillus cereus food poisoning:
outbreaks, 421
prevention, 424
symptoms, 421
Bacillus coagulans,82
Bacillus licheniformis, 82, 652
Bacillus macerans,82
Bacillus polymyxa, 148, 370, 672
Bacillus stearothermophilus,82
Delvotest-P, 444
disc assay, 444
Index 707
[Bacillus stearothermophilus]
test for antibiotics in milk, 184, 444
test for sterilization, 672
Bacillus subtilis, 82, 251, 259, 278,
672
Bacillus thuringiensis, 420
Bacterial chromosome:
chromosomal mapping, 261
comparative genomics, 262
pulsed-electric field gel electrophore-
sis, 261
Bacterial standards:
aseptically processed products, 63, 622
coloring materials, 106
condensed and dry milk products, 86
fruit flavorings, 103
ice cream, 116
pasteurized cream for butter, 146
pasteurized milk, 63, 622
raw milk, 6, 64, 350, 622, 648
syrups, 100
water for washing butter, 140
whey products, 90
yogurt, 303
Bacteriocins:
acidocin, 188
applications, 189, 190
caseicin, 80, 186, 188
commercial preparations, 189, 190
dextranicin, 189
diplococcin, 188
enterocin B, 186
helveticin, 186, 188
jenseniin, 189
lacticin, 7, 147, 186, 188, 481
lactin, 188
lactocin, 186, 188
lactococcin A, 186, 188
mesenterocin, 189
Microgard, 190
nisin, 186, 188
pediocin, 189
propionicin, 189
reuterin, 329
role in probiotics, 329
thermophilin, 189
[Bacteriocins]
various, 187
Bacteriophages:
characteristics of infection, 179
culture rotation, 181
defense mechanisms, 266
description, 263
evolution, 265–266
genetically modified resistant strains,
181, 282
genomes, 264–265
genomic analysis, 267
host range, 175
intron, 259
lytic, 264–265
lytic cycle, 175–177
morphology/taxonomy, 173–175
origin, 264
phage-host interactions, 175–178
phage inhibitory media, 180
phage-resistant cultures, 180–181,
266, 282
preventing infection, 179
prophage, 264
pseudolysogeny, 177–178
resistance in lactic acid bacteria,
178–179
in rumen, 18
sources in dairy plant, 182
survival, 179
taxonomy, 263
temperate, 264–265, 279
temperate cycle, 177
transduction, 268
virulent, 253
Bacterium coli commune, 447
Bacterium enteritidis, 465
Bacterium enterocolitica, 487
Bacteroides, 698
Bactofugation, 71, 353
Bactoscan, 64
Bakery products, 104
Beer, 388
Beer-like beverages, 388
Beggiatoa spp., 697
Beta-galactosidase production, 393, 394
708 Index
Beta-nitropropionic acid, 501
Bifidobacterium:
acidophilus milk, 317
anaerobic waste digestion, 698
characteristics, 158–159
controls serum cholesterol, 334
enumeration, 161, 304
inhibits organisms, 328
probiotic use, 111, 159, 302, 327
yogurt, 304, 310, 336
Bifidobacterium animalis, probiotic use,
159
Bifidobacterium bifidum:
added to ice cream mix, 111
probiotic use, 159
reduced viral shedding, 329
yogurt, 310
Bifidobacterium breve, yogurt, 310
Bifidobacterium, infantis, yogurt, 310
Bifidobacterium longum:
enhances immune system, 330
probiotic use, 159
yogurt, 310
Biochemical oxygen demand (BOD):
analytical procedure, 682–683
BOD/COD ratio, 684
defined, 682
milk soil, 555
values of products, 684
whey, 385–386
Biofilms, 62
cheese spoilage, 373
on equipment, 350, 373
rotating biological contactor, 697
trickling filter, 696
Biological filtration to treat dairy
wastes:
biofilm, 696–697
categories, 696
nitrification, 696
rotating biological contactor, 697
trickling filter, 695–697
zoogleal film, 696
Blue-veined cheese:
flavor, 160, 235, 360
Listeria monocytogenes, 465
[Blue-veined cheese]
manufacture, 359
penicillia, 160, 235
ripening, 360, 371
Staphylococcus aureus, 486
Botryodiploidin (mycotoxin), produced
by P. paneum, 160
Botrytis, 101
Botulism:
fatality rate, 427
outbreaks, 427–429
prevention, 430
symptoms, 427
treatment, 427
Bovine spongiform encephalopathy, 496
arisen from scrapie, 48
incidence, 48
prion, 48
symptoms, 48
transferred to humans, 48
Brevibacterium, characteristics of genus,
158
Brevibacterium linens:
adjunct culture, 191, 235
characteristics, 158
metabolism, 235, 236
produces inhibitory compounds, 186
surface-ripened cheeses, 158, 365
Brick cheese:
behavior of enteropathogenic E. coli,
452
flavor development, 235
Listeria monocytogenes, 465
manufacture, 364
reduced fat, 370
ripening, 365
smear, 365
Staphylococcus aureus, 486
sweet, 365–366
Brie cheese:
botulism, 428
enteropathogenic E. coli illness, 450
flavor, 160, 235
Listeria monocytogenes, 464
manufacture of, 361
penicillia, 160, 235
Index 709
[Brie cheese]
ripening, 362
Salmonella, 476
Yersinia enterocolitica, 494
Brix, 99
Brucella:
description, 44–45
hazard component in HACCP, 599
milk and milk products, 60
tests for infections, 45
Brucella abortus:
cattle, 431
causes brucellosis in cattle, 44
characteristics, 431
primary isolation, 432
Brucella melitensis:
characteristics, 431
infects sheep and goats, 44
sheep and goats, 431
sheep milk cheese, 433
Brucella ovis, infects sheep, 44
Brucella suis, swine, 431
Brucellosis:
Bang’s disease, 431
control, 45
gradual onset form, 432
major public health concern, 398
Malta fever, 431
outbreaks, 432–434
prevention, 435
severity, 432
sudden onset form, 432
symptoms, 44, 431, 432
treatment, 432
undulant fever, 431
Builders (detergent):
acid, 557, 559
alkaline, 557–558
enzymes, 557, 560
oxidizers, 561
water conditioners, 560–561
Butter:
boat, 142
brines for salting, 141
brucellae in, 434
churning, 139
[Butter]
composition, 127–128
consumption volumes, 127–128
continuous churn, 129
diphtheria, 405
few health problems, 399
food poisoning outbreaks, 142
freezing, 145
hazard analysis critical control points,
145
history, 127
large moisture droplets, 140
manufacture, 129–137
microbial control, 144–145
microbial tests, 669–670
moisture droplets in, 137, 139, 140,
144
mottling, 140
Mycobacterium bovis, 409
NIZO method, 138
packaging, 141
quality assurance, 145
ripened cream, 128
salting, 140
spoilage, 143
staphylococcal poisoning, 478, 482–
483
Staphylococcus aureus, 485
sweet cream, 128
typhoid fever, 410–411, 413
unsalted, 145
washing, 140
whey cream, 129
whipped, 142, 146
working of, 137, 139
Butyrvibrio fibrosolvens, 28, 37
Cacao beans fermented, 100
Camel, 2
Camembert cheese:
aflatoxin, 418
Brucella abortus in, 435
E. coli O157:H7 survival in, 457
enteropathogenic E. coli behavior in,
451
flavor, 160, 235
710 Index
[Camembert cheese]
Listeria monocytogenes, 464
manufacture, 361
penicillin, 160, 235
ripening, 362, 371
survival of Mycobacterium bovis,
409
Campylobacter:
characteristics of, 436
incidence in milk, 440
isolation and identification, 436–
437
raw milk-associated outbreaks, 398
sensitive to environment, 441
survival in milk, 440–441
Campylobacter coli, 436
Campylobacter fetus ssp. fetus, 436
Campylobacter hypointestinals, 436
Campylobacteriosis:
complications, 437
diagnosis of, 438
major public health concern, 398
oral infective dose, 437
outbreaks, 438–440
prevention, 441
symptoms, 437
treatment, 438
Campylobacter jejuni:
bovine intestinal tract, 440
characteristics of, 436
hazard component in HACCP, 599
isolation and identification, 436–
437
milk and milk products, 60, 97
oral infective dose, 437
shed by cows, 440
Campylobacter lari, 436
Campylobacter upsaliensis, 436
Candida, 99, 360, 362, 365, 375
Candida kefir, 317, 390
Carbon dioxide:
cottage cheese preservation, 358
milk preservative, 72
Carchesium, 692
Carnobacterium, 243–244, 246
Casein micelles, 348–349
Cellulose:
cellulolytic species populations, 22
digestion, 20
hydrolytic products, 21
nature of, 19
plant cell walls, 19, 20
Centrifugation, 71, 353
Champagne, 388
Cheddar cheese:
aflatoxin, 418
Bacillus cereus in, 424
bitter flavor, 162
calcium lactate crystals, 379
Campylobacter survival in, 441
desirable properties of starter cul-
tures, 162
E. coli 0157:H7 survival in, 457
flavor, 163, 229
histamine poisoning, 499
homofermentative lactic starter, 211, 245
Listeria monocytogenes, 465
manufacture, 366
molds, 374
outbreaks of illness, 399
pink defect, 378
proteolysis, 162–163
psychrotrophic bacteria caused de-
fects in, 654
reduced fat, 369
ripening, 162, 372
Salmonella in, 476, 477
salmonellosis, 473
staphylococcal poisoning, 482
Staphylococcus aureus, 485
survival of Mycobacterium bovis, 409
toxigenic molds, 501
typhoid fever, 412–413
Yersinia enterocolitica, 493
Cheese (see also individual cheese vari-
eties):
acid curd, 349–350
aflatoxin, 418
Bacillus cereus food poisoning, 421–
422
blue-mold cheeses, 359–361
botulism, 428
Index 711
[Cheese]
brucellosis, 432–435
Camembert/Brie, 361–362
Campylobacter, 441
Cheddar cheese, 366
Citrobacter freundii, 495
cleaning/sanitizing of production facil-
ities, 565
Colby and sweet brick, 365–366
contaminants, 354
cottage, 356–358
defects, 372–379
defects from thermoduric bacteria,
353
desired characteristics, 346
drug residues, 445
encephalitis (tickborne), 504
enterohemorrhagic Escherichia coli
0157:H7, 452–458
enteropathogenic Escherichia coli,
447–452
flavor, 355, 371–372
histamine poisoning, 498–499
history, 345
infectious hepatitis, 499
listeriosis, 458–466
microbiological testing, 674–675
microbiology, 354–355
Muenster and Havarti, 365–366
mycotoxins, 500–501
outbreaks of illness, 399
Parmesan/Romano, 368–369
pasta filata cheeses, 367–368
problems, 345
process, spreads, cold-pack, 370–371
quality affected by milk, 350–351
reduced fat, 369–370
rennet curd, 347–349
ripening (maturation), 346, 354, 371–
372
scarlet fever, 406
shigellosis, 503
staphylococcal poisoning, 478–486
Streptococcus zooepidemicus, 504
surface ripened, 364–365
survival of Mycobacterium bovis, 409
[Cheese]
typhoid fever, 410–413
with eyes, 362–364, 375
yersiniosis, 486–494
Cheese defects:
assessment, 372–374
calcium lactate crystals, 379
discoloration, 378–379
gas, 375–378
molds, 374
yeasts, 374–375
Cheese making:
acid curd cheese, 349–350
acid development, 348–349
adjunct cultures, 355
affected by somatic cell counts, 68
clarification of milk, 351
coagulum formation, 346, 348
direct acid addition, 349
guidelines, 345
heat treatment of milk, 352–353
rennet curd cheese, 347–349
ripening, 371–372
role of protein metabolism of starter,
228–229
standardization of milk, 351–352
Cheese spreads, 370
botulism, 428, 430
recall, 403
Chemical oxygen demand:
BOD/COD ratio, 684
defined, 684
measuring, 684
Chemostat, 10
Chilodonella, 692
Chlorine sanitizers:
advantages, 573
affect starter cultures, 185, 305
characteristics of compounds, 572
chemistry, 571
Cryptosporidium is resistant, 497
disadvantages, 573
free available chlorine, 571
hypochlorous acid content, 572
oxidizers in detergents, 561
properties, 571
712 Index
Chocolate:
milk, 72
powder, 72
Cholesterol, serum:
assimilated by Lactobacillus acido-
philus, 333
bile acids deconjugated, 333–334
reduced by probiotics, 333
Chymosin, 347
Ciliates, 692
Citrate metabolism:
cultured buttermilk, 311
diacetyl contributes to flavor, 230,
311
diacetyl synthesis, 230
enhancing diacetyl formation, 232–
233
fermentation pathway, 231
Lactococcus lactis spp. lactis biovar.
diacetylactis, 230
Leuconostoc, 230
transport, 232
Citrobacter,61
Citrobacter freundii:
dairy foods, 495
gastroenteritis, 495
symptoms, 495
verotoxin production, 495
Cladosporium, 143, 374, 501
Clarification-milk, 71
Cleaned-in-place procedures, 62, 554,
594
Cleaned-out-of-place, 554, 594
Cleaning procedures:
by-product and further processing,
566
cheese production, 565
dairy farms, 562
plant-pasteurized milk, 564
plant-raw milk handling, 563
Cleaning process:
cleaning equation, 552
cleaning in place, 554, 594
cleaning out of place, 554, 594
environmental considerations, 555
foam, gel, thin-film cleaning, 553
[Cleaning process]
hand/manual cleaning, 553, 594
nature of soils, 548
spray/high pressure cleaning, 553
surfaces, 552
water, 550
Clostridium aminophilum,29
Clostridium botulinum:
cheese spread, 403
description of, 425
hazard component in HACCP,
599
in environment, 429
inhibited by nisin, 188
milk and milk products, 60
neurotoxin groups, 426
neurotoxins, 425
process cheese, 370
testing for, 426
testing for toxin, 426–427
toxin, 425
type E is psychrotrophic, 60
Clostridium butyricum, process cheese,
370
Clostridium formicoaceticum, 393
Clostridium perfringens:
hazard component in HACCP,
599
milk and milk products, 60
Clostridium species:
anaerobic waste treatment, 698
in cream, 137–138
in dry milks, 85
gas in cheese, 377
inhibited by lacticin, 188
in milk, 61, 652
polymerase chain reaction, 355
in rumen, 13
silage, 350
spores survive pasteurization, 353
Clostridium sporogenes:
inhibited by carbon dioxide, 358
inhibited by thermophilin, 189
process cheese, 370
Clostridium sticklandii,29
Clostridium thermocellum,21
Index 713
Clostridium tyrobutyricum:
gas in cheese, 376–377
inhibited by thermophilin, 189
process cheese, 370
sodium nitrate to control, 353
stinker cheese, 364
Coagulants:
activity of, 348
calf rennet, 347
chymosin, 347
other rennets, 347
Code of Federal Regulations, Title 21,
138, 638
Colby cheese:
behavior of enteropathogenic E. coli,
451–452
calcium lactate crystals, 379
description, 365
manufacture, 366
pink defect, 378
ripening, 366
typhoid fever, 412
Yersinia enterocolitica, 493
Cold-pack cheese:
defects, 370
manufacture, 370
Salmonella, 477
Cold-shock proteins, 96
Coliform count, 65, 68, 95, 116, 119,
120, 657, 664, 669–670, 673, 675
Coliforms:
butter, 669, 670
in cheese, 352, 675
contaminate starter cultures, 314
cottage cheese contaminants, 357,
668
defined, 117
dry milk and whey products, 670
fecal, 450, 453
fluid milk products, 664
fruit flavorings, 103
gas in cheese, 376
ice cream, 95, 116, 669
killed by pasteurization, 117
Limburger cheese, 365
off-flavors in cultured buttermilk, 314
[Coliforms]
pasteurized cream, 146
raw milk, 61, 62, 657
spoilage of milk, 66
survival in cultured dairy products,
673–674
test for, 117
water, 552
Colorant, 106–107
Colostrum, 7
Commercial sterility, 81
Compendium of Methods for the Micro-
biological Examination of Foods,
118
Condensed milk, 77
ice cream ingredient, 98
microbial spoilage, 78–79
processing scheme, 78
uses, 78
Condensed whey products, 77
Confections, 104
Conjugated linoleic acid
antiatherogen, 37
anticarcinogen, 37
immunomodulating activity, 37
milkfat as source, 37
produced by bacterial action, 37
Corynebacterium, 61, 353, 687
Corynebacterium bovis,61
Corynebacterium diphtheriae, 404, 405,
495
Corynebacterium pseudotuberculosis,
495
Corynebacterium spp., milk and milk
product, 60
Corynebacterium ulcerans:
raw milk, 495
symptoms, 495
toxins produced, 495
Cottage cheese:
behavior of enteropathogenic E. coli,
452
botulism, 428
brucellosis, 434
Campylobacter survival, 441
causes of shelf-life problems, 667–668
714 Index
[Cottage cheese]
coliform survival in, 673–674
defect, 356
E. coli 0157:H7, 457
flavor, 357
floating curd, 358
homofermentative lactic starter,
211
listeriosis, 461
manufacture, 356
Mycobacterium bovis, 409
pasteurized milk, 352
preservation, 358
psychrotrophic contaminants, 357
Salmonella, 476
spoilage bacteria, 357, 668
tests, 668
Coulomiers cheese, enteropathogenic E.
coli illness, 450
Coxiella burnetii:
carriers of, 501
causes Q-fever, 501
dairy-related illness, 398
milk and milk products, 60, 502
milk pasteurization, 68, 352, 502
Cream:
Bacillus cereus food poisoning, 419
bacterial standards, 146
brucellosis, 434
half and half, 73
heavy, 73
microbiology, 137–138
pasteurization, 135
ripened cream butter, 128
ripening, 138
sour, 314–316
spoilage, 61
sweet cream butter, 128
whey cream, 129, 142
whipping, 72–73
Cream cheese:
defects, 349
listeriosis, 461
manufacture, 349
Mycobacterium bovis, 409
Cre`me fra??che, 314
Creutzfeldt-Jakob disease:
caused by prion, 495
new variant, 496
Crohn’s disease, 500
associated with M. paratuberculosis,
44
Cryptococcus, 101
Cryptosporidiosis:
gastroiontestinal infection, 496–497
raw milk, 497
symptoms, 497
Cryptosporidium:
cryptosporidiosis, 496, 497
dairy related illness, 398
in environment, 497
hazard component in HACCP, 599
recall of products, 403
resistant to sanitizers, 497
Culinary steam, 70
Cultured buttermilk:
citric acid fermentation, 311
coliform survival in, 673–674
defects, 313–314
desirable properties of starter cul-
tures, 164
E. coli 0157:H7 survival in, 457
exopolysaccharides, 164
flavor, 164, 311
green apple flavor, 164
Listeria monocytogenes, 464
manufacture of, 312
starter cultures used, 312–313
Cultured dairy products—microbiologi-
cal testing:
coliform count, 673
coliform survival in, 673–674
yeast and mold count, 674
Cyclopiazonic acid:
Camembert cheese, 501
produced by aspergilli, 501
produced by P. camemberti, 160, 501
Dairy animal:
digestive tract, 4
Holstein, 2
lactation schedule, 2
Index 715
[Dairy animal]
populations, 2
production, 2–3
Dairy chemistry, 346
Dairy farm inspection, 624–625
Dairy foods—associated illnesses:
aflatoxin, 414–418
Bacillus cereus food poisoning, 418–
424
botulism, 424–430
brucellosis, 430–435
campylobacteriosis, 435–441
Citrobacter freundii, 495
Corynebacterium ulcerans, 495
Creutzfeldt-Jakob disease, 495, 596
Cryptosporidiosis, 496, 497
current concerns, 413–494
diphtheria, 404
drug residues, 442–447
encephalitis (tickborne), 504
enterohemorrhagic Escherichia coli
0157:H7, 452–458
enteropathogenic Escherichia coli,
447–452
Haverhill fever, 497, 498
histamine poisoning, 498, 499
historical concerns, 403–413
infectious hepatitis, 499, 500
Johne’s and Crohn’s diseases, 500
listeriosis, 458–465
mycotoxins, 500, 502
outbreaks, 397, 400, 401, 402
salmonellosis, 465–478
scarlet fever/septic sore throat, 405,
406
shigellosis, 502, 503
staphylococcal poisoning, 478–486
Streptococcus zooepidemicus, 503
toxoplasmosis, 504–505
tuberculosis, 407, 408
typhoid fever, 410–413
uncommon and suspected concerns,
494–405
yersiniosis, 486–494
Dairy processing plants:
buildings and surroundings, 589
[Dairy processing plants]
calibration of equipment, 593
chlorination of water, 590
cleaning procedures, 563–566
composition of products, 685
drainage and sewage systems, 589
employee hygiene, 144, 593–594
equipment design and installation,
592
equipment performance and mainte-
nance, 592
equipment test report, 628–629
floor baths, 94
floor drains, 94
floor mats, 94
floors, walls, and ceilings, 589
hand washing, 590
Hazard Analysis Critical Control
Point, 598–599
hazard components, 599–600
hygienic practices, 94, 144, 589
ice, 591
inspection report, 626–627
land, 588
lighting, 589
model HACCP programs, 607–611
monitoring devices, 592, 593
personnel training, 593, 594
pest control program, 595
premises, 588–591
preventive maintenance, 593
processing areas, 590
product losses, 683
raw materials, ingredients, 591
recalls, 95, 117, 595–597, 639–640
receiving and storage, 591–592
return or damaged product, 592
sources of bacteriophages, 182
steam, 591
storage and transport conditions, 592
traffic patterns, 589, 590
washrooms, 590
water control program, 590
water treatment chemicals, 591
written sanitation program, 594–595
Dairy Product Safety Initiative, 94
716 Index
Dairy regulations (see also Regulatory
controls):
adulterated dairy foods, 399
Codex Alimentarius Commission,
598, 641
Code of Federal Regulations, Title
21, 638
evaluation of milk laboratories, 630,
632, 634
Factory Inspection Act of 1953, 614
Fair Packaging and Labeling Act of
1966, 638–639
farm inspection, 624–625
Federal Food, Drug and Cosmetic
Act, 637–638
Food and Drug Administration, 616,
619, 639–640
future of, 641
Grade A Condensed and Dry Milk Or-
dinance, 623
history, 614–615
local health departments, 614
National Conference on Interstate
Milk Shipments, 615–620
Nutrition Labeling and Education Act
of 1990, 638
Occupational Safety and Health Ad-
ministration, 640
Pasteurized Milk Ordinance, 620
recalls, 95, 117, 639, 640
risk-based system, 641
sanitation ratings of milk supplies, 634
standards to prevent botulism, 430
3-A sanitary standards, 636, 637
U.S. Dept. of Agriculture, 614–615,
635
waste treatment, 682, 700
zero-tolerance for L. monocytogenes,
399
Dairy wastes:
BOD/COD ratio, 684
BOD values of products, 684
chloride, 684–685
composition, 682–683
discharge permit, 682
discharge to surface waters, 700
[Dairy wastes]
environmental regulations, 682, 700
nitrogen removal, 687, 693–694
objectives of treatment, 681–682
phosphorus in, 684, 687–688, 693–694
product losses, 683
quantity, 682
reduce volume, 700
sources, 681, 683
Dairy waste treatment
activated sludge, 690–695
anaerobic digestion, 697–700
biological filtration, 695–697
land application, 685–688
ponds or lagoons, 689–690
screen and grit chamber, 685
Daphnia magna, 695
Dastrichia,17
Debaromyces hansenii, 360, 362, 365,
375
Desulfovibrio, 697
Detergent ingredients:
builders, 556, 557, 559–561
fillers, 561–562
miscellaneous, 562
surfactants, 555–556
Diphtheria:
butter, 405
complications, 404
dairy workers, 405
description, 404
diphtheria antitoxin, 404–405
diphtheroid toxin, 404
ice cream, 405
immunization programs, 405
raw milk, 397–398, 405, 613
symptoms, 404
treatment, 404–405
yogurt, 405
Diplodinia,17
Dolosigranulum, 243
Drug residues:
allergenic drugs, 443–444
antibiotic-resistant pathogens, 445
aplastic anemia, 444
beta-lactam antibiotics, 442
Index 717
[Drug residues]
carcinogens, 444
detection methods, 443–444
disease treatment, 442
excretion in milk, 442
occurrence, 445–446
other antibiotics, 443
prevention, 446–447
resistance to heat, 442–443
risks of, 444–445
starter cultures affected, 445
sulfamethazine, 443
sulfonamides, 443
suppress immune system, 444
withdrawal period, 442
Dry milks:
Bachillus cereus food poisoning, 419,
421–424
bacterial standards, 85–86
drying processes, 83
few health problems, 399
history, 82–83
ice cream ingredient, 98
instant-type products, 84
manufacture, 83–84
microbiology, 85, 87
nonfat dry milk processing, 84
products, 83
salmonellosis, 472, 475
solubility index value, 84
Staphylococcus aureus, 485
testing, 670
whey protein nitrogen test, 84
yersiniosis, 490–491
Dry whey products, 77 (see also Whey)
history, 87
products, 87
testing, 670
D-value, 70
Edam cheese, eyes, 362
Edwards medium, 65
Eggs and egg products, 104
contamination, 105
egg white, 105
egg yolk, 104
[Eggs and egg products]
pasteurized egg yolk, 104
Electrodialysis, whey, 88
Electroporation, 276, 277
Embden-Meyerhoff pathway, 208–209,
211, 213, 217
Encephalitis (tickborne):
cheese, 504
raw milk, 504
symptoms, 504
Entamoeba histolytica, milk and milk
products, 60
Enterobacter,61
Enterobacter aerogenes:
cottage cheese contaminant, 357
diacetyl reductase, 314
oxidizes diacetyl, 358
Enterobacter agglomerans, 357
Enterococcus, 106, 153
butter, 669
characteristics, 158
in cheese, 244
cheese spoilage, 375
enumeration, 161
foodborne illness, 158
spots on cheese, 378
starter cultures, 158
stinker cheese, 364
survive pasteurization, 353
taxonomy, 244
Enterococcus faecalis:
characteristics, 158
group II intron, 260
low-fat spreads, 147
misti doi, 320
Enterococcus faecium:
characteristics, 158
low-fat spreads, 147
produces bacteriocin, 186
spoilage of low-fat spreads, 148
Enteropathogenic Escherichia coli:
catagories of, 144
characteristics of, 447–448
in cheese, 450–451
methods to isolate and detect, 448–449
toxin defection, 448, 449
718 Index
Enteropathogenic Escherichia coli ill-
ness:
cheese, 450
indistinguishable from shigellosis,
449
infantile diarrhea, 449
outbreaks, 449–450
prevention, 452
raw milk, 450
symptoms, 449
traveler’s diarrhea, 449
Entodinium,17
Environmental Protection Agency:
dairy wastes, 682
role in dairy industry, 640
sanitizer control, 564, 567
Enzymes, heat-stable, 64–65, 67, 98
Epifluorescence microscope, 64, 305
Eremococcus, 243
Ergot alkaloids, 501
Escherichia,61
Escherichia coli (see also Enteropatho-
genic Escherichia coli):
butter, 146
Camembert/Brie cheese, 362
colorants, 106
controlled by Bifidobacterium, 330
controlled by Lactobacillus acido-
philus, 329, 337
cottage cheese contaminant, 357
group II intron, 260
hazard component in HACCP, 599
inhibited by propionicin, 189
lactose permease, 216
milk and milk products, 60
plasmids, 247
raw milk, 98
recalls of products, 399
shuttle vector, 278
survives spray drying, 85, 87
syrup, 100
Escherichia coli 0157:H7:
cattle major reservoir, 45
low infectious dose, 45
pathogenicity, 46
prevalence in cattle herds, 45, 46
Escherichia coli 0157:H7 (enterohemorr-
hagic):
characteristics, 453
dairy foods, 457
destroyed by pasteurization, 457
early outbreaks, 452–453
hazard component in HACCP,
599
hemolytic uremic syndrome, 398,
454
hemorrhagic colitis, 454
methods to isolate and detect, 453,
454
milk and milk products, 60
outbreaks related to dairy foods, 455,
456
prevention, 458
serogroups, 453
starter cultures, 457
survival in yogurt, 457
testing for, 120
threat to dairy industry, 398
thrombotic thrombocytopenic pur-
pura, 454, 455
verotoxins, 453
Escherichia faecalis, 246, 261, 262,
271, 273
Ethanol production:
Carbery process, 390–391
cofermentation process, 391–
392
Evaluation of milk laboratories:
certification of laboratories, 630
evaluation form, 632–633
sampling and personnel, 630
split samples, 634
Evaporated milk, 77
flat-sour spoilage, 82
history, 79–80
manufacture, 80–81
microbiology, 81–82
nisin added, 72
products, 80
staphylococcal poisoning, 482
Exopolysaccharide:
cultured buttermilk, 313
Index 719
[Exopolysaccharide]
heteropolysaccharide, 166
impacts resistance to freezing, 108–
109
increasing synthesis, 236
produced by lactococci, 154
produced by leuconostocs, 155
producing lactic bacteria and phage,
181
production-transfer of genes, 253
sour cream, 164
yogurt, 165–167, 310
Factory Inspection Act of 1953, 614
Fair Packing and Labeling Act of 1966,
638–639
Farm bulk milk tanks, 68, 562
Fat globule membrane, 66
Fatty acid sanitizers:
advantages, 575
disadvantages, 576
properties, 575
Federal Food, Drug and Cosmetic Act,
637, 638
Fermented milks:
acidophilus milk, 316–317
consumption, 302
cultured buttermilk, 311–314
dahi, 319, 320
enumeration of lactic acid bacteria,
303–305
ghee, 320
history, 301
inhibition of culture organisms, 305
kefir, 317
kishk, 321
koumiss, 317–318
laban khad, 321
laban rayab, 321
laban zeer, 321
labneh, 321
microorganisms used to make, 302–
303
misti doi, 320
skyr, 318, 319
srikhand, 320
[Fermented milks]
types, 306
viili, 318
ymer, 318
yogurt, 307–311
zabady, 321
Fermented whey beverages:
gefilus, 389
rivella, 389
Feta cheese:
Bacillus cereus food poisoning, 421
Staphylococcus aureus, 486
Yersinia enterocolitica, 493
Fibrobacter succinogenes,20–23
Filtration, milk, 71
Flavobacterium, 60, 67, 357, 685, 690,
696
Flavorings:
chocolate, 100
extracts, 100
Foamy bloat, 32–33
Food and Drug Administration, 614
NCIMS agreement, 616
NCIMS proposals to, 619
role in recalls, 639, 640
transferred from USDA, 614
Foodborne illnesses (see Dairy foods—
associated illnesses, and also indi-
vidual illnesses)
Food, Drug, and Cosmetic Act of 1938,
399, 614
Food labeling laws, 637, 639
Freezing of dairy desserts:
cold-shock proteins, 96
concentration of dissolved substances,
95
cryohydric point, 96
eutectic points, 96
freezing point, 96
freezing process, 115–116
intracellular ice crystals, 96
kills bacteria, 106
latent heat of fusion, 96
pH, 96
rate of temperature decrease, 96
survival of microorganisms, 95–96
720 Index
Frozen yogurt, 93
composition, 97, 107–110
freezing, 96
manufacture, 107–110
probiotic nature, 110
properties, 107–110
recalls, 95
testing, 668
Fruits:
candied, 103
fresh and frozen, 101
processed, 102
Fungi (see also Molds, and Yeasts):
in milk and milk products, 60
osmophilic, 99
populations, 19
roles, 19
in rumen, 18, 19
Fusarium, 101, 374, 501
Gemella, 243
Genetic elements, 245–267
bacterial chromosomes, 261–263
bacteriophages, 263–267
comparative genomics, 262–264
plasmid DNA, 245–252
plasmid replication, 246–252
rolling circle plasmid replication,
247–251
theta plasmid replication, 251–
252
transposable elements, 252–261
Genetic improvement of lactic acid bac-
teria:
diacetyl production, 282–283
enhanced phage resistance, 282
Gene transfer mechanisms:
conjugation, 269–276, 282
DNA mobilization, 273–276
electroporation, 276–277
food-grade gene cloning systems,
280
gene delivery systems, 278
integrative gene cloning, 279–280
mating pair formation, 271–273
[Gene transfer mechanisms]
pheromones/sex factors, 271–273
protoplast fusion, 268–269
replicative vectors, 278–279
transduction, 268
transformation, 276–280
Geotrichum, 101, 143, 501
Geotrichum candidum:
Camembert/Brie cheese, 362
cheese spoilage, 375
surface-ripened cheeses, 365
viili, 318
Giardia lamblia, milk and milk prod-
ucts, 60
Globicatella, 243
Gluconobacter, 101, 392
Goats, 2, 6
Goat’s milk:
campylobacteriosis, 440
cryptosporidiosis, 497
encephalitis (tickborne), 504
Q-fever, 502
staphylococcal poisoning, 482–483
toxoplasmosis, 505
Goat’s milk cheese:
brucellosis, 433
Listeria monocytogenes, 465
Gorgonzola cheese:
flavor, 160, 235
penicillia, 160, 235, 359
Gouda cheese:
defect, 364
eyes, 362
histamine poisoning, 499
homofermentative lactic starter, 211,
245
molds, 374
reduced fat, 370
ripening, 364
Staphlococcus aureus, 486
Grade A Condensed and Dry Milk ordi-
nance, 623
Grass tetany, 33–34
Gruye`re cheese:
Brucella abortus in, 435
histamine poisoning, 499
Index 721
Habrotrocha, 692
Havarti cheese:
description, 365
manufacture of, 366
ripening, 366
Haverhill fever:
complications, 498
raw milk, 498
symptoms, 498
Hazard Analysis and Critical Control
Point (HACCP) program:
control microorganisms, 587
employee education and training,
606–607
hazard components, 599–600
history, 597–598
implementation, 600–606
model programs, 607–611
prerequisite program, 587–597
principles, 598–599
Helicobacter pylori, controlled by Lacto-
bacillus acidophilus, 329
Hemicelluloses, 22
Hepatitis A (infectious hepatitis):
dairy-related illness, 398
hazard component in HACCP, 599
strawberries, 101
symptoms, 499
Hindgut fermentations, 37–38
Hispanic cheese, no growth of E. coli
0157:H7, 457
Histamine poisoning:
outbreaks, 499
symptoms, 498
Honey:
butter, 145
ice cream, 100
Horse:
koumiss from mare milk, 317–318
milk source, 2
Hot water sanitizing:
advantages, 577
disadvantages, 577
properties, 576
Hydrogen transfer—rumen:
anaerobic metabolism, 26
[Hydrogen transfer—rumen]
homoacetogens, 28
methanogens, 26–27
sulfate-reducing bacteria, 28
Hydrophobic grid membrane filter, most
probable count, 64
Ice cream:
Bacillus cereus food poisoning, 419,
424
coliforms, 95
composition, 95–97
diphtheria, 405
environmental contaminants, 94
freezing, 96, 115
frozen storage, 115
industry standards, 116
infectious hepatitis, 499
ingredients, 97–107
microbiological quality, 95
microbiological test methods, 118–
120, 668–669
microbiology, 93
novelties, 113
outbreak of illness increases, 399
processing, 113–114
recalls, 95
regulatory controls, 116–118
Salmonella Enteritidis, 95, 473, 475
scarlet fever, 406
serving, 116
staphylococcal poisoning, 478, 482–
483
Staphylococcus aureus, 485
typhoid fever 399, 411–413
Immune response:
control of intestinal infections, 330
enhanced by probiotics, 330
Impedance/conductance method, 64
Implementation of HACCP:
conduct a hazard analysis (step 5)
(principle 1), 601–602
corrective actions (step 9) (principle
5), 604
critical control points (step 6) (princi-
ple 2), 602–603
722 Index
[Implementation of HACCP]
critical limits (step 7) (principle 3),
603
describe dairy food and distribution
method (step 2), 600
develop and a verify flow diagram
(step 4), 601
evaluating and revising HACCP sys-
tems (step 12), 605
gain management commitment and as-
semble team, (step 1), 600
identify intended use and potential
consumers (step 3), 601
monitoring/inspection (step 8) (princi-
ple 4), 603–604
records (step 10), (principle 6), 604
verification (step 11) (principle 7),
605, 645
Indian cultured milks:
dahi, 319
ghee, 320
misti doi, 320
srikhand, 320
Infectious diseases of dairy animals:
bovine spongiform encephalopathy,
48
brucellosis, 44–45
enteropathogenic Escherichia coli,
45–46
Johne’s disease, 43–44
major diseases, 39
mastitis, 38–41
paratuberculosis, 43–44
tuberculosis, 41–43
viral diseases, 46–47
Interactions of starter cultures, 191
amensalism, 192
commensalism, 192
competition, 192
mutualism, 192
parasitism, 192
International Dairy Foods Association,
620
Intestinal tract organisms:
antimicrobial substances, 329
bacteriocins, 329
[Intestinal tract organisms]
competitive exclusion, 330, 337
controlled by probiotics, 328
controlled in livestock, 337
immune response, 330
Iodine sanitizers (iodophors):
advantages, 573
bacterial efficacy, 574
disadvantages, 573–574
effect on starter cultures, 185
production, 573
properties, 573
Isotricha,17
Johne’s disease:
association with Crohn’s disease, 500
control, 44
symptoms, 43, 44, 500
Kefir:
alcohol present, 302
bodrost production, 389
defects, 317
grains, 317
manufacture, 317
starter organisms, 317
Klebsiella,61
Kluyveromyces lactis, 360
Kluyveromyces marxianus:
beta-galactosidase production, 394
Camembert/Brie cheese, 362
cheese spoilage, 375
ethanol production, 390, 392
Kojic acid, 501
Koumiss:
culture organisms, 318
manufacture, 317–318
therapeutic purposes, 317
Laboratory pasteurized count, 65–66
Lachnospira multipara,24
Lactic acid bacteria (see also individual
genera and species):
acid injury, 304
acidophilus milk, 316, 317
activity tests, 190, 191
Index 723
[Lactic acid bacteria (see also individual
genera and species)]
adjunct cultures, 191, 192
amino acid/peptide transport systems,
224, 225
antibiotics in milk, 184, 185
bacteriophage genomes, 264, 267
bacteriophage resistance, 178, 179
bacteriophages, 173–182, 263
benefits as probiotics, 328–335
blue-mold cheese starter, 359
bodrost, 389
in Camembert/Brie cheeses, 361
characteristics of bacteriophage infec-
tion, 179
characteristics needed for probiotic
cultures, 335–336
in Cheddar cheese, 366
cheese ripening, 371
cheeses with eyes, 362–364
chemical sanitizers, 185
citrate metabolism, 230–233
in Colby and sweet brick cheeses,
366
commercial preparations, 171–173
conjugation, 269–276
contaminated culture, 314
cottage cheese starter, 356, 358
cultured buttermilk, 312, 313
dahi, 319
desirable properties, 162–167
discovery of fermentation, 244
DNA mobilization, 273–276
electroporation, 276, 277
Embden-Meyerhoff pathway, 208
enterococci, 158
enumeration, 160–162, 303, 304, 305
external pH control, 170
flavor adjuncts—cheese, 229, 230
food-grade gene cloning systems, 280
freeze-dried cultures, 172
frozen concentrated cultures, 172,
galactose metabolism, 218–220
gene delivery systems, 278
general characteristics, 152, 153, 207,
243
[Lactic acid bacteria (see also individual
genera and species)]
genetically modified, 192, 193, 194
genetic elements, 245–267
genetic improvement, 280–283
genetics-why study, 244, 245
gene transfer mechanisms, 267–280
genomics, 263
growth media formulations, 168, 169
heterofermentative, 208, 210, 220
histamine formation, 498–499
homofermentative, 208, 209, 211, 220
incubation conditions, 171
inhibitors in raw milk, 182–184
integrative gene cloning, 279, 280
interactions of cultures, 191, 192
internal pH control, 170, 171
kefir, 317
koumiss, 317, 318
lactobacilli, 155, 156, 157
lactococci, 153, 154
lactose permease, 211, 216, 218
lactose phosphotransferase system,
211–213, 218
Leloir pathway, 219, 220
leuconostocs, 154, 155
mating pair formation, 271–273
metabolic engineering, 236
Middle Eastern fermented milks,
321
misti doi, 320
Muenster and Havarti cheeses, 366
natural habitat, 153
nutritional requirements, 167, 168
in Parmesan/Romano cheeses, 368–
369
in pasta filata cheeses, 367–368
peptidases, 225–228
peptidases in cheese making and rip-
ening, 228, 229
phage inhibitory media, 168, 180
phage-resistant cultures, 180, 181
pH control during propagation, 168,
170, 171
pheromones/sex factors, 271–273
phospholsetolase pathway, 208, 210
724 Index
[Lactic acid bacteria (see also individual
genera and species)]
probiotics for livestock, 336–338
produce inhibitory compounds, 185–
190
proteinase system, 222–224
protein metabolism, 222–228
protoplast fusion, 268, 269
pyruvate-alternative routes, 220–222
regulation of phosphotransferase sys-
tem, 213, 216
replicative vectors, 278, 279
skyr, 318, 319
sour cream, 314, 315
spray-dried cultures, 173
streptococci, 154
in surface-ripened cheeses, 364
taxonomy, 153, 243, 244
transduction, 268
transformation, 276–280
viili, 318
ymer, 318
yogurt, 308–310
Lactic acid production, 392
Lactic acidosis, 31–32
Lactobacillus, 61, 67, 152–153 (see
also individual species):
adjunct culture, 191, 355, 370, 372
anaerobic waste treatments, 698
calcium lactate crystals, 379
characteristics of genus, 155–156
cheese ripening, 372
electroporation, 277
enumeration, 304
facultatively heterofermentative, 155,
372
galactose fermentation, 218
gas in cheese, 376
histamine formation, 498–499
homofermentative, 155
insertion sequence elements, 256
kefir, 317
lactose metabolism, 218
lactose permease, 211, 218
Middle Eastern fermented milks, 321
nutritional requirements, 167
[Lactobacillus]
obligately heterofermentative, 155
plasmids, 247
sex factor, 272
survive pasteurization, 353
taxonomy, 243
Lactobacillus acidophilus:
acidophilus milk, 316–317
added to ice cream mix, 111
anticarcinogenic activity, 332
assimilates cholesterol, 111
beneficial for lactose maldigestors,
331–332
cold-shock proteins, 96
controls calf scours, 338
controls Escherichia coli, 329
controls Helicobacter pylori, 329
controls Salmonella, 328, 337
dahi, 319
deconjugates bile acids, 333
enumeration, 161
genome, 236
genome sequencing, 262
histamine production, 499
increases feed efficiency, 338
inhibit growth of organisms, 328
lactic acid production, 392
lactoperoxidase, 183, 306
probiotic, 303, 327
produces acidocin, 188
produces lactin, 188
reduces serum cholesterol, 333
sweet acidophilus milk, 317
yogurt, 165, 336
Lactobacillus casei:
adjunct, 229
anticarcinogenic activity, 332
bacteriophage, 253, 264
cheese ripening, 372
controls diarrhea, 329
dahi, 319
enhances immune response, 330
enumeration, 304
facultatively heterofermentative, 155
fermented milk, 316
gas in cheese, 377
Index 725
[Lactobacillus casei]
genetically modified, 193
hypocholesterolemic activity, 334
inhibits growth of organisms, 328
lactic acid production, 392
phosphotransferase system, 215, 218
probiotic, 327
produces caseicin, 188
Lactobacillus casei spp. rhamnosum,
389
Lactobacillus delbrueckii ssp. bulgar-
icus:
added to ice cream, 111
adjunct, 229
anticarcinogenic activity, 332
bacteriophage, 175
beneficial for lactose maldigestors,
331
dahi, 319
enumeration, 160–161, 304
frozen yogurt, 107, 108, 110
galactose, not fermented, 219–220
histamine production, 499
homofermentative, 155, 208
inactive against E. coli O157:H7, 457
koumiss, 318
lactic acid production, 392
lactoperoxidase, 306
lactose permease, 216
Metchnikoff’s theory, 327
mozzarella cheese, 163
Muenster cheese, 366
Parmesan/Romano cheeses, 368
pasta filata cheese, 367
pH control during propagation, 168
pink ring in cheese, 378
produces lacticin, 188
starter culture, 152
survives freezing, 111
Swiss and baby Swiss cheeses, 362
yogurt, 164–165, 166, 309, 310
Lactobacillus delbruekii spp. lactis:
bacteriophage, 175
group I intron, 259
homofermentative, 155
starter culture, 152
Lactobacillus gasseri, transduction,
268
Lactobacillus helveticus:
adjunct, 229
dahi, 319
galactose fermented, 216
gas in cheese, 378
histamine production, 499
homofermentative, 155, 208
lactic acid production, 392
lactose permease, 216
Leloir pathway, 219, 220
mozzarella cheese, 163
NIZO butter making method, 139
Parmesan/Romano cheeses, 368
pasta filata cheese, 367
plasmids, 251
polymerase chain reaction, 355
produces helveticin, 188
produces lactocin, 188
starter culture, 152
Swiss and baby Swiss cheeses, 362
Swiss cheese, 164
Lactobacillus kefir:
obligatory heterofermentative, 155
in kefir cultures, 155, 317
Lactobacillus kefirogranum, 317
Lactobacillus lactis, Swiss and baby
Swiss cheeses, 362
Lactobacillus plantarum:
cheese ripening, 372
gas in cheese, 377
interaction with propionibacteria,
191
produces pediocin, 189
Lactobacillus rahmnosus, added to ice
cream, 111
Lactobacillus reuteri:
added to ice cream, 111
fermented milk, 317
probiotic, 327
produces reuterin, 329
Lactobacillus sake, plasmids, 251
Lactobacillus salivarius:
transduction, 268
controls salmonellae, 337
726 Index
Lactococcus (see also individual spe-
cies):
bacteriophage, 177
bacteriophage resistance, 178
calcium lactate crystals, 379
Colby and sweet brick cheese, 366
description of genus, 153–154
enumeration, 160–161, 304
Havarti cheese, 366
histamine formation, 498
lactoperoxidase, 183
Leloir pathway, 219
Middle Eastern fermented milks, 321
nutritional requirements, 167
pH control during propagation, 168,
170–171
pheromone, 272
properties desired for Cheddar
cheese, 162
proteolytic enzymes, 153
proteolytic system, 223
sensitivity to sanitizers, 185
sex factor, 272
surface-ripened cheeses, 364
Swiss cheese, 164
tagatose pathway, 212
taxonomy, 243
Lactococcus lactis:
adjuncts, 229
bacteriophages, 263–264
blue mold cheese, 359
casein source of nitrogen, 223
chromosome maps, 261
conjugation, 269–275
electroporation, 277
exopolysaccharide production, 253
galactose metabolism repressed, 214
genome, 236, 276
genome sequencing, 262
genome size, 261
genomic analysis, 252
group II intron, 260
heterologous gene expression system,
267
homofermentative, 208
insertion sequence elements, 256
[Lactococcus lactis]
interspecific polymorphisms, 262
lac operon, 215
lactic acid production, 392, 393
lactose metabolism gene, 215
lactose phosphotransferase system, 211
lost acid-producing ability, 246
mating pair formation, 273
misti doi, 320
Parmesan/Romano cheese, 368
phage resistance, 266–267, 270
plasmids, 247, 251–252
protoplast fusion, 269
Swiss and baby Swiss cheese, 362
temperate bacteriophage intron, 259
theta plasmid replication, 251
transduction, 268
transposons, 257
Lactococcus lactis ssp. cremoris:
bacteriophage, 175
characteristics, 154
Cheddar cheese, 366
cold-shock proteins, 96
cottage cheese, 356
cream ripening, 138–139
cultured buttermilk, 164, 312–313
dahi, 319
exopolysaccharide, 313
genetically modified, 193
genetic studies, 245
inhibits enteropathogenic E. coli,
451
little effect on E. coli 0157:H7, 457
polymerase chain reaction, 355
produces diplococcin, 188
sour cream, 164
viile, 318
Lactococcus lactis ssp. hordniae, 245
Lactococcus lactis ssp. lactis:
adjunct culture, 191
bacteriophage, 175
characteristics, 154
controls E. coli 0157:H7, 457
cottage cheese, 356
cream ripening, 138, 139
cultured buttermilk, 164, 312–313
Index 727
[Lactococcus lactis ssp. lactis]
dahi, 319
exopolysaccharide synthesis, 236, 313
gas in cheese, 377
genetically modified, 193
genetic studies, 245
histamine formation, 499
inhibits enteropathogenic E. coli,
451
produces lacticin, 188
produces nisin, 188, 430
sour cream, 164
Lactococcus lactis ssp. lactis biovar. dia-
cetylactis:
blue mold cheeses, 359
characteristics, 154
cottage cheese, 357–358
cream ripening, 138–139
cultured buttermilk, 164, 312
dahi, 319
diacetyl reductase, 314
diacetyl synthesis, 230–231
eye formation, 362
floating curd, 358
genetically modified, 193
Havarti cheese, 366
produces lactococcin, 188
sour cream, 164
viili, 318
ymer, 318
Lactococcus lactis ssp. lactis biovar.
maltigenes, 66, 143
Lactose:
fermented, 66
synthesis, 8
whey product, 386
Lactose digestion:
acidophilus milk beneficial, 331
improved by probiotics, 330–332
Lactobacillus acidophililus beneficial,
331–332
lactose maldigestors, 330–331, 335
yogurt beneficial, 331
Lactose phosphotransferase system,
211–213
regulation, 213–216
Lactosphera, 243
Land application of dairy waste:
application rates, 687
bacteria and viruses removed, 688
BOD removal, 686
heterotrophic microorganisms, 685,
687
nitrification, 687–688
nitrogen and phosphorus removal,
687
nitrogen uptake by plants, 687
percolation capacity of soil, 686
phosphorus, 687–688
removal of microorganisms, 688
soil bacteria, 685–686
Lecane, 692
Leloir pathway, 219–220
Leuconostoc (see also individual spe-
cies):
bacteriophage, 177
blue mold cheese, 359
characteristics of genus, 154
cottage cheese, 358
diacetyl synthesis, 230
electroporation, 277
enumeration, 160, 161
eye formation, 362
gas in cheese, 376
growth affected by milk composition,
191
Havarti cheese, 366
insertion sequence elements, 256
kefir, 317
lactose permease, 211, 218
Leloir pathway, 219
nutritional requirements, 168
plasmids, 247
produce bacteriocins, 189
sex factor, 272
starter culture, 152
taxonomy, 153, 243
Leuconostock citrovorum, 155
Leuconostoc lactis:
characteristics, 155
galactose fermented, 220
Leloir pathway, 220
728 Index
Leuconostoc mesenteroides ssp. cre-
moris:
characteristics, 155
cream ripening, 138–139
cultured buttermilk, 164, 312
dextran, 166
sour cream, 164
viili, 318
ymer, 318
Leuconostoc mesenteroides ssp. dextrani-
cum, produces dextranicin, 189
Leuconostoc mesenteroides ssp. mesen-
teroides, produces mesenterocin,
189
Leuconostoc paramesenteroides, diace-
tyl synthesis, 230
Lignin, 24
Limburger cheese:
botulism, 428
flavor compounds, 365
inoculum, 349
manufacture, 364–365
ripening, 365, 371
smear, 365
spread, 428
Line sampling/testing, 659–660
Listeria, 94, 141:
affected by bacteriocins, 187
cheese, 397
inhibited by lacticin, 188
pasteurized milk, 652
Listeria innocua:
butter, 142
dairy plants, 94
Listeria ivanovia, causes infections, 458
Listeria monocytogenes, 117
affected by bacteriocins, 186, 189
blue mold cheeses, 361
butter, 142, 146
causes infections, 458
characteristics of, 458, 459
cheese, 399, 466, 674
dairy plants, 94, 120
growth in fluid milk products, 72, 73
hazard component in HACCP, 599
ice cream, 117
[Listeria monocytogenes]
inhibited by carbon dioxide, 358
inhibited by leuconostoc bacteriocins,
189
inhibited by pediocin, 189
Limburger cheese, 365
low fat spreads, 148
mastitis, 40
methods to isolate and detect, 459
milk and milk products, 60
milk quality affected, 61
monitoring, 145
pathogens shed into milk, 61
psychrotrophic, 60
raw milk, 61, 98
recalls of products, 399, 458
resistant to cold temperatures, 96, 118
sources in raw milk, 98
zero tolerance, 458
Listeria seeligeri, causes infections, 458
Listeriosis:
outbreaks, 460–463
prevention, 465
susceptible segments of population,
460
symptoms, 460
treatments, 460
Mad cow disease (see Bovine spongi-
form encephalopathy)
Malted milk powder, Bacillus cereus
food poisoning, 422
Margarine:
definition, 146
manufacture, 147
spoilage, 148
Mastitis:
antibiotics to treat, 442
bovine somatotropin, 41
causative agents, 40
chronic, 41
clinical, 38
contagious, 39
environmental, 39
milk composition changed, 40–41
subclinical, 39
Index 729
Megasphaera elsdenii, 26, 31–32, 36
Melissococcus, 243
Methanobreveibacter smithii,27
Methanogenic bacteria, 698
Mexican cheese, brucellosis, 433,
435
Mexican-style cheese:
listeriosis, 461
salmonellosis, 474
Microbacterium, 61, 353
Microbiological testing—fluid milk
products:
coliform count, 664
sensory evaluation at end of shelf-
life, 667
sensory evaluation of fresh product,
667
shelf-life prediction tests, 666–667
Microbiological testing—future of,
675–677
Microbiological testing—ingredients,
658
Microbiological testing—raw milk and
ingredients:
adenosine triphosphate biolumines-
cence, 657
aerobic plate count, 656, 659
coliforms, 657, 659
direct microscript count, 656, 659
preliminary incubation, 657, 659
psychrotrophic estimates, 656
ropy milk test, 646–647
tests on each tanker of milk, 646
Micrococcus, 61, 85, 105–106, 158,
353, 365
Micrococcus caseolyticus, 365
Micrococcus freudenreichii, 365
Microfiltration, 71
Microgard, 190, 358
Middle Eastern cultured milks:
kishk, 321
laban khad, 321
laban rayab, 321
laban zeer, 321
labneh, 321
zabady, 321
Milk:
aflatoxin, 6, 7, 414–418
agglutinins, 182–184
antibiotic residues, 6, 351
antibiotics in, 184–185, 305
Bacillus cereus food poisoning, 418–
424
bacterial testing, 63–66
biosynthesis, 7–8
botulism, 424–430
brucellosis, 430–435
campylobacteriosis, 435–441
casein attacked by psychrotrophs, 655
casein degraded, 222
casein micelles, 348–349
certified, 397, 613
cheese quality, 350, 351
Citrobacter freundii, 495
clarification, 351
cleaning procedures, 562–564
colostrum, 7
composition, 8–9, 347
composition affects starter cultures,
191
compositional tests, 649
composition and rumen fermentation,
35–37
concentrated and dry milk products,
77
contamination sources, 61–62, 350–
351
control of microorganisms in, 68–72
Corynebacterium ulcerans, 495
Creutzfeldt-Jakob disease, 495–496
cryptosporidiosis, 496–497
diphtheria, 404–405
drug residues, 442–447
encephalitis (tickborne), 504
enterohemorrhagic Escherichia coli
0157:H7, 452–458
enteropathogenic Escherichia coli,
447–452
flavored products, 72, 461
flow diagram, 610
future of microbiological testing,
675–677
730 Index
[Milk]
grade A, 615
HACCP description chart, 611
Haverhill fever, 497–498
hazard analysis chart, 608–609
heat treatment, 352–353
illnesses, 397
infectious hepatitis, 499–500
inhibitors of starter cultures, 182–
184, 305–306
Johne’s disease, 500
lactoferrin, 182, 184
lactoperoxidase system, 182–183, 306
legal definition, 5
listeriosis, 458–465
lysozyme, 182, 184
manufacturing grade, 77, 615, 635
microflora, 59, 649–656
mycotoxins, 500–501
Pasteurized Milk Ordinance, 620–623
pathogens in, 60, 613
postpasteurization contamination, 62–
63
precursors, 8
production of, 397
Q-fever, 501–502
quality affected by bacterial growth,
66–68
quality affected by mastitis, 351
quality tests, 645–648
raw-bacterial standards, 6, 63, 350
ropy, 646–647
salmonellosis, 465–478
scarlet fever/septic sore throat, 406
sediment, 62
shelf-life predicting tests, 660–664
shigellosis, 502, 503
spoilage, 61
standardization, 351
staphylococcal poisoning, 478–486
Streptococcus zooepidemicus, 503
toxoplasmosis, 504–505
tuberculosis, 407–408
typhoid fever, 410–413
unflavored products, 72–73
yersiniosis, 486–494
Milkfat:
anticarcinogenic activities, 37
butyric acid, 37
conjugated linoleic acid, 37
synthesis, 9
Milk hauler:
certified for milk sampling, 630
hauler report, 631
Milk protein:
synthesis, 9
precipitation, 66
Milk shake, campylobacteriosis,
440
Mimosine poisoning, 35, 37
Mold-ripened cheese (see also individ-
ual varieties), typhoid fever, 412
Molds (see also Fungi):
butter, 141, 143, 669
cause cheese defects, 374
cheese ripening, 354
cheese spoilage, 350
cottage cheese, 358
cultured dairy products, 674
frozen dairy desserts, 669
fruit, 101, 103
milk and milk products, 60
mycotoxin production, 6
pasteurized cream, 146
potassium sorbate, 358, 374
raw milk, 61
spoilage of milk, 66
syrups, 100
toxigenic products recalled, 403
water activity, 143
Moniliformin, 501
Mozzarella cheese:
baking, 368
defects, 368
desirable properties of starter cul-
tures, 163
galactose present, 217, 219
Listeria monocytogenes, 465
low galactose, 217, 220
manufacture, 367
mesophilic starter, 354
nonenzymatic browning, 217
Index 731
[Mozzarella cheese]
pasteurized milk, 352
proteolysis, 163
Salmonella, 476–477
slits, 376
Staphylococcus aureus, 486
starters, 211
Mucor, 101, 374, 501
Muenster cheese:
description, 365
flavor development, 235
manufacture, 366
reduced fat, 370
ripening, 366
survival of Mycobacterium bovis, 409
Mycobacterium:
cause tuberculosis, 41
description, 42, 43
Mycobacterium avium, 406
Mycobacterium bovis:
bovine tuberculosis, 42
characteristics, 43
dairy products, 409
description of, 406–407
human infections, 42
milk and milk products, 60
milkborne transmission, 408
raw milk, 408
reservoirs, 42
survival in cheese, 409
wild animals, 409
Mycobacterium paratuberculosis:
Crohn’s disease, 500
description of, 44, 500
heat resistance, 500
Johne’s disease, 43, 500
milk and milk products, 60
Mycobacterium pseudotuberculosis, 500
Mycobacterium tuberculosis:
characteristics, 43, 407
isolated in 1882, 41
milk and milk products, 60
raw milk, 61
Mycophenolic acid, 501
Mycoplasma bovis,61
Mycoplasma spp., mastitis, 40
Mycotoxins, 6 (see also individual
toxins)
hazard component in HACCP, 599
nuts, 104
produced by various molds, 501
Natamycin, 374
National Conference on Interstate Milk
Shipments:
agreement with FDA, 616
biennial conference, 618–620
councils, 618–619
executive board, 617–618
General Assembly, 619
proposals to FDA, 619
National Milk Producers Federations,
620
Neocallimastix frontalils,18
Neufcha?tel cheese, botulism, 428
Nisin:
controls Clostridium botulinum, 430
dahi, 320
evaporated milk additive, 82
ice cream additive, 118
milk preservative, 72
process cheese, 370
transposons, 257–258
Nitrification, 687–688, 694, 696
Nitrobacter sp., 687, 694
Nitrosomonas sp., 687, 694
NIZO butter making method, 138
Nonfat dry milk (see Dry milks)
Norwalk virus, dairy-related illness, 398
Nostocoida limicola, 695
Notommata, 692
Novelties, frozen, 113
Nutrition Labeling and Education Act of
1990, 638
Nuts, 103
hazelnut conserve, botulism, 429
Occupational Safety and Health Admin-
istration, 640
Oenococcus, 243, 247, 261, 272
Official Methods of Analysis, 118, 630
732 Index
Oligosaccharides:
enhance growth of Bifidobacterium,
339
fructo-oligosaccharides, 339
galacto-oligosaccharides, 339
inulin, 339
prebiotics, 338, 339
Omasum, 4
Opercularia, 692
Oxalate poisoning, 34, 35
Oxalobacter formigenes,35
Packaging:
butter, 141
receiving and storage, 591
Parasites:
dairy-related illness, 398
hazard component in HACCP, 599
Paratuberculosis (see Johne’s disease)
Parmesan cheese:
aflatoxin, 418
defined, 368
flavor, 229
lipase, 369
manufacture, 368
molds, 374
pink ring, 378
Pasteurella X, 487
Pasteurization:
cleaning/sanitizing of equipment, 566
Coxiella burnetii,68
cream for butter making, 135, 138
denounced, 398
destroys psychrotrophic bacteria, 97
effectiveness, 352
frozen dessert mixes, 114
heating methods, 70
laminar flow, 114
purpose, 68
required for some cheese milk, 352
Reynolds number, 114
times and temperatures, 69
Pasteurized milk (see also Milk):
cheese making, 352
process cleaning procedures, 564
spoilage, 61
Pasteurized Milk Ordinance, 6, 63, 65,
69
adopted by states and territories, 620
bacteriological and other standards,
622
history, 614, 615
losing grade A status, 620
National Conference on Interstate
Milk Shipments, 615–620
organizations and contents, 621
regulating document, 620
related documents and programs, 623,
630, 634–635
role of national associations, 620
Patulin:
produced by P. carneum, 160
produced by P. paneum, 160
produced by P. roqueforti, 501
Pectic materials, 22–24
Pectin gel plate count, 64
Pediococcus:
bacteriophage, 177
calcium lactate crystals, 379
in cheese, 244
genetically modified, 193
sex factor, 272
taxonomy, 243
Pediococcus pentosaceous, plasmids,
251
Penicillic acid, 501
Penicillium, 101, 143, (see also individ-
ual species)
characteristics of genus, 160
cheese flavor, 160, 235
cheese spoilage, 374
mycotoxins, 160, 501
nitrification, 687
Penicillium camemberti:
adjunct culture, 191
Camembert/Brie cheese, 160, 235,
361–362
cyclopiazonic acid, 160, 501
metabolism, 235, 362
Penicillium carne:
produces patulin, 160
related to P. roqueforti, 160
Index 733
Penicillium caseicolum, Camembert/
Brie cheese, 160
Penicillium commune:
cheese contaminant, 160, 374
toxin producer, 160
Penicillium glaucum, 359
Penicillium paneum:
produces botryodiploidin, 160
produces patulin, 160
Penicillium roqueforti:
blue-veined cheeses, 235, 359
metabolism, 235, 360
mycotoxins produced, 501
Peptidases, 225–228
aminopeptidases, 226–228
dipeptidases, 226–227
endopeptidases, 226–227
exopeptidases, 226
tripeptidases, 226–227
Peptostreptococcus anaerobius,29
Peracetic acid sanitizers, affect starter
cultures, 185
Peroxyacetic acid sanitizers:
advantages, 576
disadvantages, 576
properties, 576
Personnel training—HACCP:
access controlled, 594
hand washing, 593
personal cleanliness, 594
production personnel, 593, 607
senior management, 607
team members, 606
Petrifilm aerobic count, 64, 119
Pheromones, 271–272
Philodina, 692
Phosphated whey medium, 389
Phosphoketolase pathway, 208, 210
Pichia, 99, 375
Plant toxicoses:
grass tetany, 33–34
mimosine poisoning, 35, 37
oxalate poisoning, 34–35
Plasmid:
DNA, 245–252
encoded properties of lactics, 248–249
[Plasmid]
replication, 246–252
rolling circle replication, 247–251
theta replication, 251–252
Plate loop count, 64
Polioencephalomalacia, 33
Polymerase chain reaction, 120, 355
Ponds/lagoons to treat dairy wastes:
aerobic ponds, 689
anaerobic ponds, 690
facultative ponds, 689
microbial activities, 689
Potassium sorbate:
butter, 145
cold-pack cheese, 371
cottage cheese, 358
E. coli 0157:H7, 457
mold control, 374
source of 1,3-pentadiene, 374
Prebiotics:
enhance growth of Bifidobacterium,
339
inulin, 339
oligosaccharides, 338–339
Preliminary incubation count, 65–66
Prerequisite program—HACCP
equipment performance and mainte-
nance, 592
personnel training, 593–594
premises, 588–591
recalls, 595–597
receiving and storage, 591–592
review existing programs, 588
sanitation, 594–595
Prevotella rumnicola, 24, 28–29
Prion, 495
causes bovine spongiform encephalop-
athy, 48
defined, 48
Probiotics:
anticarcinogenic properties, 332
antimicrobials produced, 329
bacteria, 36
bacteriocins produced, 329
benefits to consumers, 110, 328–335
bifidobacteria, 159
734 Index
[Probiotics]
Bifidobacterium, 302, 303, 327
characteristics needed by cultures,
335–336
competitive exclusion, 330, 337
controlling undesirable intestinal or-
ganisms, 328, 337
controls serum cholesterol, 333
enterococci, 158
food supplements, 111
for cattle, 36, 37
frozen yogurt, 93
health claims, 335
improvement of immune response, 330
improvement of lactose digestion,
330–332
Lactobacillus acidophilus, 303, 327
Lactobacillus reuteri, 327
livestock, 336, 337
Streptotococcus thermophilus, 327
yeast, 36, 327, 337–338
yogurt, 303, 327
Process cheese:
contaminants, 370
defined, 370
Propionate pathway, 234
Propionibacterium (see also individual
species):
bacteriophage, 177
characteristics of genus, 157
differentiation of species, 157
enumeration, 161
gas in cheese, 376–377
histamine formation, 499
interaction with lactobacilli, 191
metabolism, 233–234
probiotic, 327
propionate pathway, 234
used to make cheese, 157
Propionibacterium acidipropionici, char-
acteristics, 157
Propionibacterium freudenreichii ssp.
freudenreichii:
characteristics, 157
propionic acid production, 393
used in cheese making, 157
Propionibacterium freudenreichii ssp.
shermanii:
adjunct culture, 191
characteristics, 157
eye formation, 362
metabolism, 233–234
Swiss cheese, 164, 233
used in cheese making, 157
used to produce Microgard, 190, 358
Propionibacterium jensenii:
characteristics, 157
produces jenseniin, 189
spots on cheese, 378
Propionibacterium thoenii:
characteristics, 157
produces propionicin, 189
spots on cheese, 378
Propionic acid production, 393
Protein metabolism—lactic acid bac-
teria:
amino acid transport system, 224–
225
amino peptidases, 226–228
dipeptidases, 226–227
endopeptidases, 226–227
exopeptidases, 226
peptidases, 225
peptide transport system, 224–225
proteinase system, 222–224
role in cheese making and ripening,
228–229
tripeptidases, 226–227
Proteus, 106
Protoza:
activated sludge waste treatment, 691
benefits, 18
cryptosporidiosis, 496–497
entodiniomorphs, 17–18
faunated/defaunated animals, 17–18
fermentative metabolism, 17
grazing on bacteria, 18
holotrichs, 17
in milk and milk products, 60
oligotrichs, 17
in rumen, 17–18
toxoplasmosis, 504–505
Index 735
Provolone cheese:
lipase, 367
manufacture, 367
ripening, 371
Pseudomonas, 61, 73, 98, 101, 105–
106, 141, 314, 350–351, 356, 358,
360, 364, 375, 649, 664, 685, 690,
696
Pseudomonas aeruginosa, milk and
milk products, 60–61
Pseudomonas fluorescens, 61, 67, 72,
96, 143
cottage cheese contaminant, 357
inhibited by propionicin, 189
monoclonal antibodies, 664
Pseudomonas fragi, 61, 67, 143, 357
Pseudomoonas mephitica, 143
Pseudomonas nigrifaciens, 143
Pseudomonas putida, 61, 67, 105, 357
Pseudomonas putrefaciens, 61, 67, 143
Psychrophilic bacteria, 654
Psychrotrophic bacteria:
in butter, 141, 143
Cheddar cheese defects, 654
contaminants of starter cultures, 314
cottage cheese contaminants, 357, 668
in cream, 138
cultured dairy products, 674
defined, 59, 652
in flavored milks, 72
fluid milk products, 665
frozen dairy desserts, 669
heat-stable enzymes, 67, 655
inhibited by starter cultures, 72
monitoring, 654
off-flavors in cultured buttermilk, 314
pathogens in milk and milk products,
60
proteases attack casein, 655
raw milk, 61–62, 65, 98, 351, 652
shelf-life indicators, 661, 663
sources, 654
spore formers, 67, 137
Psychrotrophic plate count, 68, 72, 120,
647, 669
Public Health Service Act, 614
Pure Food and Drug Act of 1906, 614
Pyruvate metabolism, alternative routes,
221–222, 236
Q-fever:
raw milk, 502
symptoms, 501
Quaternary ammonium sanitizers:
advantages, 575
affect starter cultures, 185, 305
disadvantages, 575
properties, 574
Queso blanco cheese:
defects, 350
manufacture, 350
Streptococcus zooepidemicus, 504
Recalls:
cheese, 458
cheese and cheese products, 95, 399
classes, 639
defined, 117, 639
ice cream and frozen yogurt, 95, 458
L. monocytogenes-related, 458
number for dairy foods, 403
regulatory agency, 596
role of FDA, 639, 640
types, 639
voluntary, 399, 639
written procedure, 595
Receiving and storage plant areas:
incoming materials, 591
packaging material, 591
raw materials, ingredients, 591
return or damaged product, 592
storage and transport conditions, 592
Reduced fat cheeses:
flavor, 370
manufacture, 369
ripening, 370, 372
Refrigeration, 68
Regulatory controls (see also Dairy reg-
ulations):
cheese milk, 352
ice cream, 116–118
sanitizers, 564, 567
736 Index
Reindeer, 2
Reticulum, 4
Reverse osmosis, whey, 88
Rhizopus, 101, 143
Ricotta cheese:
defects, 350
manufacture, 350
Romano cheese:
defined, 368
manufacture, 368
pink ring, 378
ripening, 371
Roquefort cheese:
flavor, 160, 235
mycotoxins, 501
penicillia, 160, 359
sheep milk, 359
Roquefortine, 501
Rotavirus, dairy-related illness, 398
Rotifers, 692
Rumen:
bacteria in, 12, 14, 15
bacterial adaptation, 13
bacterial characteristics, 14–15
bacterial populations, 13
bacteriophages in, 18
butyric acid, 37
carbohydrate fermentation in, 16
carbohydrates, nonstructural, 24–25
carbohydrates, structural, 19–24
chemical/physical conditions, 11
conjugated linoleic acid, 37
contents, 5
description, 4
dysfunction, 31–33
environment within, 10–12
faunated/defaunated animals, 17–18
fermentation and milk composition,
35–37
fermentation endproduct ratios con-
trolled, 36
fermentations in, 19–30
fiber digestion increased, 35
fistula, 11
function, 5
fungi in, 18, 19
[Rumen]
hydrogen trasnfer, 26
microbial growth yield, 30–31
microbial population, 12
microbial protein, 30
microbiological methods, 9–10
microbiology, 9–19
nitrogen metabolism, 28–31
probiotics, 36
protein degradation, 28, 29
protein digestion reduced, 36
protein synthesis, 29, 30
protozoa in, 17, 18
ruminal H
2
redirected, 36
volatile fatty acid production, 25–26
Rumen dysfunction:
foamy bloat, 32–33
lactic acidosis, 31–32
polioencephalomalacia, 33
Ruminant animal, essential feature, 1
Ruminobacter amylophilus,24
Ruminococcus,24
Ruminococcus albus, 20, 22–23, 27
Ruminococcus flavefaciens, 20, 22–23
Saccharomyces, 101 (see also individual
species)
Saccharomyces cerevisiae, 392
Saccharomyces kefir, 317
Salmonella (see also individual species):
butter, 146
characteristics, 467
cheese, 399, 445, 476–477, 674
colorants, 106
controlled by lactobacilli, 328, 337
dairy plants, 94
hazard component in HACCP, 599
methods to isolate and detect, 468
milk and milk products, 60
monitoring, 145
pasteurization inactivates, 475
pasteurized cream, 146
pasteurized milk, 652
in raw milk, 61, 474
shed in feces of cattle, 474
Index 737
[Salmonella (see also individual species)]
survives spray drying, 85, 87
syrup, 100
Salmonella Cholerae-suis, 467
Salmonella Dublin:
cheese, 474
colonize udder, 474
hazard component in HACCP, 599
infect bovine mammary gland, 473
in raw milk, 97
Salmonella Enteritidis, 95, 96
classification, 467
cold-shock proteins, 96
controlled by Lactobacillus sali-
varius, 337
eggs, 105, 106
ice cream-associated salmonellosis,
118, 399, 475
Salmonella Heidelberg, 467, 473
Salmonella Javiana, 474
Salmonella Muenster, 473, 474
Salmonella Newbrunswick, 472
Salmonella Oranienburg, 106, 474
Salmonella Paratyphi:
dairy products, 410
hazard component in HACCP, 599
Salmonella Senftenberg 775W, 475
Salmonella Typhi:
carriers of, 412
description of, 410
hazard component in HACCP, 599
pasteurization, 413
shedding, 411
survival in dairy foods, 413
Salmonella Typhimurium:
antibiotic-resistant strain, 445, 472
classification, 467
failed to survive pasteurization, 87
outbreak, 472
strain DT104, 474
Salmonellosis:
cheese, 473–474
clinical confirmation, 469
epidemic, 399
excretion of salmonellae, 468
gastroenteritis, 468
[Salmonellosis]
history, 465, 467
ice cream, 399, 473, 475
localized tissue infections, 469
major public health concern, 398
nonfat dry milk, 472, 475
outbreaks, 467, 469–474
pasteurized milk, 397, 472
prevention, 478
septicemia, 469
symptoms, 468
Sanitation ratings of milk supplies, 634
Sanitizer activity—factors affecting:
concentration, 578
condition and number of organisms,
579–580
hard water, 579
incompatible compounds, 580
organic matter, 578
pH, 579
physical condition of surface, 580
residual activity, 581
stability of product, 579
temperature, 578
time of exposure, 578
type of organism, 579
wetting ability, 579
Sanitizer efficacy validation:
ATP, 582
microbiological, 582
performance monitoring, 582
RODAC plating, 582
visual, 581
Sanitizers:
acid-anionic surfactants, 575
application, 581
approved sanitizing solutions, 568–
570
chlorine and chlorine compounds,
571–573
factors affecting activity, 578–581
fatty acid sanitizers, 575–576
governmental regulations, 564–565
hot water, 576–577
iodophors, 573–574
label directions, 567, 594
738 Index
[Sanitizers]
peroxyacetic acid, 576
quaternary ammonium compounds,
574–575
terms defined, 567
ultraviolet irradiation, 577–578
validation of efficacy, 581–582
Sarcina,85
Scandinavian cultured milks:
ropy texture, 154
skyr, 318, 319
viili, 318
ymer, 318
Scarlet fever:
outbreaks, 405–406
raw milk, 397–399, 613
symptoms, 405
Schizosaccharomyces,99
Scopulariopsis, 374
Selenomas ruminantium, 25, 26, 31–32,
34, 36
Septic sore throat, 405, 406
Serratia marcescens,67
Sheep, 2, 6
infected by Brucella melitensis,44
infected by Brucella ovis,44
Sheep’s milk cheese:
brucellosis, 433
encephalitis (tickborne), 504
staphylococcal poisoning, 473
Shelf-life predicting tests:
attributes of rapid test, 662–663
correlated with product shelf life, 661
fluid milk products, 666–667
methods, 661–663
shelf life/keeping quality defined, 660
Sherbet:
composition, 112
freezing, 96
Shigella:
bacillary dysentery, 502
hazard component in HACCP, 599
Shigella boydii, 502
Shigella dysenteriae:
bacillary dysentery, 502
hazard component in HACCP, 599
vero cytotoxin, 502
Shigella flexneri, 502
Shigella sonnei, 502–503
Shigellosis
cheese, 503
raw milk, 503
symptoms, 502
Sodium benzoate, butter, 145
Soft-ripened cheese, numerous out-
breaks of illness, 399
Soft-unripened cheese, brucellosis,
433
Soils (on dairy equipment):
carbohydrates, 549
lipids, 548
minerals, 549
other, 549, 550
proteins, 548
Soluble sugars/oligomers, 25
Somatic cell count, 68
affects cheese making, 68
standards, 648
Somatic cells, 67, 68, 351
Sorbet:
contamination with milk protein,
112
freezing, 96
manufacture, 112
Sour cream:
coliform survival in, 673, 674
defects, 315
description, 314
desirable properties of starter cul-
tures, 164
E. coli O157:H7 survival in,
457
low-fat and fat-free types, 314–315
manufacture, 315–316
starter cultures for, 314–315
Sphaerotilus, 695, 696
Spices, 107
Spiral plate count, 64
Spreads:
full fat, 146
low fat, 146
reduced fat, 146
spoilage, 148
very low fat, 146
Index 739
Standard Methods for the Examination
of Dairy Products, 82, 85, 89, 118,
119, 304, 630, 657, 658, 665, 668,
669, 670, 671, 673, 674
Standard plate count, 64, 66, 68, 72,
116, 119, 120, 647, 653, 669, 670
Standards for fabrication of single-ser-
vice containers and closures, 630
Staphylococcal enterotoxin:
detection, 481
heat stable, 478
pasteurized cream, 135
produced by species other than S.
aureus, 480
production, 478–479
Staphylococcal food poisoning:
butter, 142–143
dairy foods involved, 478
dry milks, 85
major public health concern, 398
outbreaks, 481–484
prevention, 486
symptoms, 481
Staphylococci, coagulase-negative, 61,
480
Staphylococcus,64
Camembert/Brie cheeses, 362
cheese, 675
inhibited by lacticin, 188
Limburger cheese, 365
Staphylococcus aureus:
blue mold cheese, 360
butter, 142, 146
characteristics, 479, 480
cheese, 399, 445, 674
enterotoxin detection, 481
enterotoxin production, 478–479
hazard component in HACCP, 599
mastitis, 40
methods to isolate, detect and iden-
tify, 480–481
milk and milk products, 60
monitoring, 145
occurrence and survival in dairy
foods, 484–486
raw milk, 61, 62
virulence, 41
Staphylococcus hyicus, 480
Staphylococcus intermedius, 480, 482
Starch, 24
Starter cultures (see also individual gen-
era and species)
acid curd cheese, 349
acidophilus milk, 316–317
activity tests, 190–191
adjunct cultures, 191–192
antibiotics in milk, 184–185, 305, 445
artisinal, 354
bacteriophages, 173–182, 305
bifidobacteria, 158, 159
blue mold cheese, 359
brevibacteria, 158, 234–236
Camembert/Brie cheeses, 361
characteristics of bacteriophage infec-
tion, 179
Cheddar cheese, 366
cheese ripening, 371–372
cheeses with eyes, 362–364
chemical sanitizers, 185, 305
choice of, 353
Colby and sweet brick cheeses, 366
commercial preparations, 171–173
contaminated, 314
cottage cheese, 356, 358
cultured buttermilk, 312–313
dahi, 319
description, 152
desirable properties, 162–167
enterococci, 158
enumeration, 160–162, 303–305
facilities to handle, 305
for cheese making, 353–354
genetically modified, 192–194
growth media formulations, 168–169
history, 151
incubation conditions, 171
inhibit S. aureus, 485
inhibitors in raw milk, 182–184, 306
interactions of cultures, 191–192
kefir, 317
koumiss, 317–318
lactic, 152
lactobacilli, 155–157
lactococci, 153–154
740 Index
[Starter cultures (see also individual gen-
era and species)]
leuconostoc, 154–155
mesophilic lactic, 152, 353–354
misti doi, 320
Muenster and Havarti cheeses, 366
Parmesan/Romano cheeses, 368
pasta filata cheeses, 367
penicillia, 160, 234, 235
pH control during propagation, 168,
170–171
phosphated whey medium, 389
preventing bacteriophage infection,
179–182
produce inhibitory compounds, 185–
190
propagation, 167–171
propionibacteria, 157
skyr, 318–319
sour cream, 314–315
streptococci, 154
surface-ripened cheeses, 364–365
thermophilic lactic, 152
viili, 318
ymer, 318
yogurt, 308–310
Sterigmatocystin, 501
Stilton cheese:
flavor, 160
penicillia, 160, 359
Streptobacillus moniliformis:
causes Haverhill fever, 497
description of, 497
Streptococcus, 61, 64, 67, 85, 153–154,
188, 243, 353, 698 (see also indi-
vidual species)
plasmids, 247
Streptococcus agalactiae, 39, 40
eradication test, 65
mastitis, 40
milk and milk products, 60–61
Streptococcus bovis, 24–25, 28, 31–32
Streptococcus dysagalactiae,61–62
Streptococcus faecalis, 158
Streptococcus faecium, 158
Streptococcus mutans, 246, 262
Streptococcus pneumoniae:
genome sequencing, 262
group II intron, 260
Streptococcus pyogenes:
description of, 405
genome sequencing, 262
milk and milk products, 60
scarlet fever/septic sore throat, 405–
406
Streptococcus salivarius, 154
Streptococcus thermophilus:
added to ice cream, 111
antibiotic sensitivity, 184
bacteriophage(s), 177, 263–264
benefits lactose maldigestors, 331
Camembert/Brie cheeses, 361
characteristics, 154
chromosome map, 261
cold-shock proteins, 96
dahi, 319
electroporation, 277
enumeraction, 160–161, 304
exopolysaccharide, 108–109, 253
frozen yogurt, 107–110
galactose efflux, 217, 219
gas in cheese, 378
genome sequencing, 262
homofermentative, 208
insertion sequence elements, 256
intraspecific polymorphisms, 262
lactoperoxidase, 183, 306
lactose permease, 211, 216
lactose transport and hydrolysis, 216–
218
Leloir pathway genes, 220
little effect on E. coli 0157:H7, 457
misti doi, 320
mozzarella cheese, 163
Muenster cheese, 366
nutritional requirements, 167
Parmesan/Romano cheeses, 368–369
pasta filata cheeses, 367
pH control during propagation, 168
phage resistance, 266
phage with group I intron, 259
plasmids, 246, 247
Index 741
[Streptococcus thermophilus]
possible galactose fermentation, 236
probiotic, 327
produces thermophilin, 189
sex factor, 272
starter culture, 152
Swiss and baby Swiss cheeses, 164, 362
transduction, 268
transposons, 258
used with lactobacilli, 157
yogurt, 164–167, 309–310
Streptococcus uberis,61–62
Streptococcus zooepidemicus:
fresh cheese, 504
mastitis, 503
milk and milk products, 60
raw milk, 503
symptoms of illness, 503
Succiniclasticum ruminis,25
Succinivibrio dextrinosolvens,24
Succinomonas amylolytica,24
Surface-ripened cheeses:
botulism, 429
Brevibacterium linens, 158
flavor, 158
Limburger, 349
listeriosis, 463
Surfactants:
amphoteric, 556
anionic, 555–556
cationic, 555–556
hydrophilic-lipophilic balance, 555
nonionic, 556
Sweetened condensed milk, 77
ice cream ingredient, 98
manufacture, 79
spoilage, 79
uses, 79
Sweeteners:
syrups, 99
honey, 100
microbial standards, 100
Swiss cheese:
aflatoxin, 418
Brucella abortus in, 435
Campylobacter survival, 441
[Swiss cheese]
defect, 364
desirable properties of starter cul-
tures, 163–164
eye formation, 164, 233, 363
flavor, 229, 233
flavor development, 164
galactose use, 164
histamine poisoning, 499
manufacture, 233, 363
mesophilic starter, 354
pink ring, 378
ripening, 363
spots, 278
staphylococcal poisoning, 483
Staphylococcus aureus, 486
starters, 211
toxigenic molds, 501
typhoid fever, 413
Synergistes jonesii,35
Syrups:
Brix, 99
condensate, 99
corn sweeteners, 99
dextrose equivalent, 99
osmophilic yeasts and molds, 99
osmotolerant yeasts, 99
Tagatose pathway, 212
Tetragenococcus, 243, 246
Tetragenococcus halophilus, plasmids,
251
Thermal death rate curve, 70
Thermal death time curve, 70, 353
Thermal resistance—microorganisms:
medium composition, 70
numbers of organisms, 71
pH, 70
thermal buffer, 71
water activity, 70
Thermoduric bacteria:
low-fat spreads, 147
processed products, 65
raw milk, 61
survive pasteurization, 353
742 Index
3-A sanitary standards:
committees, 636
equipment and systems, 636
preparation of standard or accepted
practice, 636–637
standards content, 637
Tilsit cheese:
Brucella abortus in, 435
survival of Mycobacterium bovis, 409
Torula, 99, 317–318
Torula cremoris, 390
Toxoplasma gondii, milk and milk prod-
ucts, 60, 504
Toxoplasmosis:
protozoan infection, 504
raw cow’s and goat’s milk, 505
symptoms, 504
Transposable genetic elements:
conjugative transposons, 256–258
insertion sequences, 253–256
introns (group I and II), 258–260
transposons, 256–258
Trichothecenes, 501
Tuberculosis:
causative agents, 406
control measures, 42
means of spread, 42
nonpulmonary, 408
outbreaks, 407–408
prevention, 409
raw milk, 397–398, 613
reservoirs, 42
symptoms, 407
Typhoid fever:
complications, 411
ice cream, 399
outbreaks, 411–412
prevention, 413
raw milk, 397–399, 410, 613
symptoms, 411
treatment, 411
Udder:
Bacillus cereus, 422
brucellae, 434
microflora, 62
[Udder]
Salmonella Dublin, 474
Salmonella Muenster, 474
tuberculosis of, 407
UHT milk products:
cleaning and sanitizing-processing,
566
packaging materials, 672
processing time and temperature, 69
purpose, 69
reject rate, 671
sampling, 672–673
shelf life, 70, 73
spoilage, 61
spores present, 671–672
testing, 670–671
Ultrafiltration:
milk, 71
whey, 88
Ultrapasteurization:
product shelf life, 70
purpose, 68–69
time and temperature, 69
Ultraviolet irradiation:
advantages, 577
disadvantages, 577–578
properties, 577
U.S. Department of Agriculture
FDA separated, 614
inspection and grading service, 635
manufacturing grade milk, 77, 615,
635
recommended requirements for farms
and plants, 635
Vacherin Mont d’Or cheese
listeriosis, 463
Salmonella, 476
Vagococcus, 243
Veillonella parvula,26
Verticillium, 374
Vibrio parahaemolyticus, inhibited by
propionicin, 189
Vinegar, 392
Viruses:
dairy-related illnesses, 398
Index 743
[Viruses]
disease of dairy cattle, 46–47
effects on milk production, 47
encephalitis (tickborne), 504
hazard component in HACCP, 599
hepatitis A, 101, 398, 499, 599
milk and milk products, 60
removed from dairy wastes, 688
Volatile fatty acids, 4, 5, 12, 13
production-rumen, 25
Vorticella, 692
Water (see also Hot water sanitizing):
chemical standards, 551
chlorination of, 590
control program, 590
cross connections, 590
hardness, 550, 551
hot as sanitizer, 576, 577
ice, 591
impurities in, 550
microbiological standards, 140, 551
microorganisms in, 552
pH, 552
potable, 552, 590
steam, 591
surface, 700
treatment chemicals, 591
washing butter, 140
Water activity:
corn syrups, 99
fungi, 143
honey, 100
nuts, 104
thermal destruction of microbes, 70
Water buffalo, 2
Water conditioners:
chelating agents, 561
inorganic phosphates, 560
organic phosphates, 560–561
polyelectrolytes, 561
salts of organic acids, 561
Water ices:
composition, 112
manufacture, 112
Weiscella, 243, 246
Whey (see also Dry whey products, and
Fermented whey beverages):
beer, 388
beta-galactosidase, 393
biochemical oxygen demand, 684
botschye, 388
calcium magnesium acetate, 393
champagne, 388
chloride in, 688
cleaning and sanitizing of processing
facilities, 566
C:N ratio, 688
composition of products, 88, 386
concentrated, 87
cream, 129, 142
culture media, 389
dairy wastes, 688
dry, 87, 98
ethanol, 390–392
gefilus, 389
lactalbumin, 87
lactic acid, 392
lactose, 88, 386
microbiological standards for prod-
ucts, 89–90
other fermentation products, 394
permeate, 688
phosphorus content, 688
processing, 88, 89
production, 385
products—microbiology, 89–90
propionic acid, 393
protein, 348, 688
protein concentrate, 87, 98, 350, 390
protein isolate, 88
reduced lactose, 87
reduced minerals, 87
removal from cheese, 349
reverse osmosis, 387
rivella, 389
soluble salts, 688
sweet, 350
ultrafiltration, 386–387, 391
vinegar, 392
wine, 387
Wine, 387
744 Index
Yak, 2
Yarrowia lipolytica, 148, 362, 365, 375
Yeasts (see also Fungi):
blue mold cheese, 360
butter, 141, 669
Camembert/Brie cheeses, 362
cheese defects, 374–375
cheese ripening, 354
cheese spoilage, 350
cottage cheese, 358
cultured dairy products, 674
frozen dairy desserts, 669
fruit, 101, 103
gas in cheese, 376
honey, 100
kefir, 317
koumiss, 317, 318
osmophilic, 99
pasteurized cream, 146
potassium sorbate, 358
probiotic, 36, 327, 337, 338
raw milk, 61
skyr, 319
spoilage of milk, 66
spots on cheese, 378
stinker cheese, 364
surface-ripened cheese, 158, 365
syrup, 100
water activity, 143
whey, 387–388, 392, 394
Yersinia enterocolitica:
characteristics, 487–488
cheese, 493
dairy plants, 94, 120
hazard component in HACCP,
599
low-fat spreads, 148
methods to isolate and detect, 488
milk and milk products, 60
psychrotroph, 60, 493
raw milk, 492
shed in feces of dairy cows, 492
yogurt, 494
Yersinia pseudotuberculosis, 487
Yersiniosis:
acute generalized septicemia, 489
[Yersiniosis]
chocolate milk, 489, 490
complications, 489
contaminated milk cartons, 491
dried milk, 490
gastroenteritis, 488
history, 486, 487
outbreaks, 489–492
pasteurized milk, 490, 491, 492
prevention, 494
raw milk, 489, 490
Yogurt (see also Frozen yogurt):
acetaldehyde production, 310
acidification, 64, 165
anticarcinogenic activity, 332
bacterial standards for, 303
bacteria used to make, 302
benefits lactose maldigestors, 331
botulism, 428, 429
coliform survival in, 673
defects, 310–311
desirable properties of starter cul-
tures, 164–167
diphtheria, 405
E. coli 0157:H7 survival in, 457
exopolysaccharides, 165–167, 310
flavor, 165
galactose present, 217, 219
Listeria monocytogenes, 464
manufacture of, 308
probiotic, 327
starter bacteria, 308, 309, 310
starters, 211, 236
supplemented with Lactobacillus acid-
ophilus and Bifidobacterium, 336
texture, 165
therapeutic properties, 303, 310, 327
types, 308
Yersinia enterocolitica, 494
Zearalenone, 501
Zooglea ramigera, 695
Zooplankton, 690
Z-value, 70
Zygosaccharomyces, 99–100
Zymomonas, 101

