205
Why Do Some Genes Maintain
More Than One Common Allele
in a Population?
When Mendel did his crosses of pea plants, he knew what a
pea plant was supposed to look like: a small plant with green
leaves, purple flowers, and smooth seeds. But if all pea plants
were like that, he would never have been able to sort out the
rules of heredity—in a cross of green peas with green peas,
there would have been no visible differences to reveal the
3:1 pattern of gene segregation. The variant alleles that
Mendel employed in his studies—yellow leaves, white flow-
ers, wrinkled seeds—were rare “accidents” maintained in
seed collections for their novelty. In nature, such unusual
kinds of peas had never been encountered by Mendel.
By the time Mendel’s work was rediscovered in 1900,
Darwin had provided a ready explanation of why alterna-
tive alleles seemed to be rare in natural populations. Nat-
ural selection was simply scouring the population, cleansing
it in each generation of less fit alternatives. While recombi-
nation can complicate the process in interesting ways
among sexual organisms like peas, asexual organisms like
bacteria were predicted to be very sensitive to the effects of
selection. Left to do its work, natural selection should
crown as winner in bacterial population the best allele of
each gene, producing a uniform population.
Why do populations contain variants at all? In 1932 the
famous geneticist Herman Muller formulated what has come
to be called the “classical model,” explaining gene variation
in natural populations of asexual organisms as a temporary,
transient condition, new variations arising by random muta-
tion only to be established or eliminated by selection. Except
for the brief periods when populations are undergoing this
periodic cleansing, they should remain genetically uniform.
The removal of variants was proposed to be a very
straightforward process. During the periodic cleansing pe-
riods envisioned by Muller, his classical model operates
under a “competitive exclusion” principle first proposed by
Gause: whenever a new variant appears, it is weighed in the
balance by natural selection, and either wins or loses.
There are no ties. One version of the gene becomes univer-
sal in the population, and the other is eliminated.
Muller’s classical model thus makes a very straightfor-
ward prediction: in nature, most populations of asexual
organisms should be genetically uniform most of the time.
However, this is not at all what is observed. Natural popu-
lations of most species, including asexual ones like bacteria,
appear to have lots of common variants—they are said to
be “polymorphic.”
So where are all of these variants coming from? Varia-
tion in the environment, either spatial or temporal, can be
used to explain how some polymorphisms arise. Selection
favors one form at a particular place and time, a different
form at a different place or time. In a nutshell, varying
selection can encourage polymorphism.
Is that all there is to it? Is it really impossible for more
than one variant to become common in a population, if the
population lives in a constant uniform environment, an en-
vironment that does not vary from one place to another or
from one time to another? Theory says so.
Biologists that study microbial communities have begun
to report that bacteria are not aware of Muller’s theory.
Bacterial cultures started from a single cell living in simple
unstructured environments rapidly become polymorphic.
There is a way to reconcile theory and experiment. Per-
haps the variant individuals in the population are interact-
ing with one another. Muller’s theory assumes that every
individual undergoes an independent trial by selection. But
what if that’s not so? What if different kinds of individuals
help each other out? Stable coexistence of variants in a
population might be possible if interactions between them
contribute to the welfare of both (what a biologist calls mu-
tualism) or favors one (what a biologist calls commensal-
ism). In essence, cooperation would be counterbalancing
the effects of competition.
Part
.04 μm
IV
Reproduction and Heredity
These bacterial cells are dividing.As the population grows,
gene variants arise by mutation. Do the new variants persist, or
are they eliminated by natural selection?
Real People Doing Real Science
The Experiment
To investigate this intriguing possibility, Julian Adams
and co-workers at the University of Michigan set out to
see if polymorphism for metabolic abilities would de-
velop spontaneously in bacteria growing in a uniform
environment.
For a bacterial subject they chose Escherichia coli
(E. coli), a widely studied bacterium whose growth under
laboratory conditions is well understood. Cultures of
Escherichia coli can be maintained in chemostat culture
for many hundreds of generations. A chemostat is a large
container holding liquid culture medium. A little bit of
the liquid is continuously removed, and an equal amount
of fresh culture medium added to replace what leaves.
The growth of the E. coliculture is limited by the amount
of glucose remaining in the culture medium to feed the
growing cells.
Researchers inoculated a glucose-limited chemostat cul-
ture media with the E. colistrain JA122, and maintained the
continuous culture for 773 generations. A sample was
taken from the chemostat after 773 generations and ana-
lyzed for the presence of new strains of E. coli. Any varia-
tion among the cells in the sample would indicate that
polymorphism had arisen.
To detect metabolic variation within the sample of
growing cells, Adams’s team analyzed the rate of glucose
uptake and the concentration of acetate, among other
variables. By examining such biochemical parameters,
the researchers could determine if the different strains
were filling different metabolic “niches”—that is, using
the metabolic environment in different ways. Metabolic
niches were characterized by looking at the normal prod-
ucts of aerobic fermentation, acetate and glycerol, which
appear in the growth medium as a by-product of E. coli
metabolism.
To further classify the strains, batch cultures containing
two strains were established to analyze interactions be-
tween the two groups.
The Results
Three distinct variants were detected in the 773-generation
E. coli, each being maintained at stable levels in the contin-
uously growing culture. Clearly polymorphism can appear
within an initially uniform bacterial population growing in
a simple homogeneous environment.
When mixed together and allowed to compete, one
strain does not drive the other two to extinction, as theory
had predicted. Instead, the three new strains, CV101,
CV103, and CV116, all persist (see graph aabove).
The three strains were then analyzed to see how they
differed. CV103 exhibited the highest rate of glucose up-
take and produced the most acetate (an end product of glu-
cose aerobic fermentation). Is this difference important?
To see, the CV103 strain was co-cultured with CV101.
They maintained stable growth levels, which indicated that
the contribution of the third strain, CV116, was not re-
quired to maintain their growth.
What is the difference between CV101 and CV103?
CV101 could grow in culture filtrate of CV103 but in the
reverse situation, CV103 could not grow. This indicates
that CV103 secretes a substance upon which CV101 can
grow. Is CV101 utilizing the acetate produced by CV103
as its carbon source?
To test this possibility, CV101 and CV103 were grown
together in media with acetate as the only carbon source.
The results from this experiment are shown in graph b
above and indicate that CV101 thrives on an acetate carbon
source, while CV103 does not and requires an additional
carbon source such as glucose.
These results indicate that two of the strains are main-
tained in polymorphism at stable levels because they have
evolved different adaptations that allow them to coexist by
filling different niches. One strain (CV101) is maintained
in the population because it is able to use a metabolic by-
product released by another strain (CV103).
Generations
0.4
0.6
0.8
Frequency in population
Population growth (A
420
nm)1.0
10 20 30
0.2
0.0
Time (hours)
0.02
0.04
0.06
10 20 30 40
0.00
CV101 strain
CV103 strain
CV116 strain
(b)(a)
CV101 strain
Acetate media
CV103 strain
Maintaining stable polymorphism.(a) Three new strains emerge in culture and are maintained. (b) Two strains are grown on media
containing acetate. The strain CV103 was found to excrete acetate, while the strain CV101 was found to thrive in media with acetate as the
sole source of carbon. Population growth is measured by an increase in the turbidity of the liquid medium; turbidity is measured as an
increase in light absorbance at a wavelength of 420 nm (A
420
nm).
To explore this experiment further,
go to the Virtual Lab at
www.mhhe.com/raven6/vlab4.mhtml
207
11
How Cells Divide
Concept Outline
11.1 Bacteria divide far more simply than do
eukaryotes.
Cell Division in Prokaryotes. Bacterial cells divide by
splitting in two.
11.2 Chromosomes are highly ordered structures.
Discovery of Chromosomes. All eukaryotic cells contain
chromosomes, but different organisms possess differing
numbers of chromosomes.
The Structure of Eukaryotic Chromosomes. Proteins
play an important role in packaging DNA in chromosomes.
11.3 Mitosis is a key phase of the cell cycle.
Phases of the Cell Cycle. The cell cycle consists of three
growth phases, a nuclear division phase, and a cytoplasmic
division stage.
Interphase: Preparing for Mitosis. In interphase, the
cell grows, replicates its DNA, and prepares for cell
division.
Mitosis. In prophase, the chromosomes condense and
microtubules attach sister chromosomes to opposite poles
of the cell. In metaphase, chromosomes align along the
center of the cell. In anaphase, the chromosomes separate;
in telophase the spindle dissipates and the nuclear envelope
reforms.
Cytokinesis. In cytokinesis, the cytoplasm separates into
two roughly equal halves.
11.4 The cell cycle is carefully controlled.
General Strategy of Cell Cycle Control. At three points
in the cell cycle, feedback from the cell determines whether
the cycle will continue.
Molecular Mechanisms of Cell Cycle Control. Special
proteins regulate the “checkpoints” of the cell cycle.
Cancer and the Control of Cell Proliferation. Cancer
results from damage to genes encoding proteins that
regulate the cell division cycle.
A
ll species of organisms—bacteria, alligators, the weeds
in a lawn—grow and reproduce. From the smallest of
creatures to the largest, all species produce offspring like
themselves and pass on the hereditary information that
makes them what they are. In this chapter, we begin our
consideration of heredity with an examination of how cells
reproduce (figure 11.1). The mechanism of cell reproduc-
tion and its biological consequences have changed signifi-
cantly during the evolution of life on earth.
FIGURE 11.1
Cell division in bacteria.It’s hard to imagine fecal coliform
bacteria as beautiful, but here is Escherichia coli,inhabitant of the
large intestine and the biotechnology lab, spectacularly caught in
the act of fission.
cells are much larger than bacteria, and their genomes con-
tain much more DNA. Eukaryotic DNA is contained in a
number of linear chromosomes, whose organization is much
more complex than that of the single, circular DNA mole-
cules in bacteria. In chromosomes, DNA forms a complex
with packaging proteins called histones and is wound into
tightly condensed coils.
Bacteria divide by binary fission. Fission begins in the
middle of the cell. An active partitioning process ensures
that one genome will end up in each daughter cell.
208 Part IV Reproduction and Heredity
Cell Division in Prokaryotes
In bacteria, which are prokaryotes and lack a nucleus, cell
division consists of a simple procedure called binary fission
(literally, “splitting in half”), in which the cell divides into
two equal or nearly equal halves (figure 11.2). The genetic
information, or genome, replicates early in the life of the cell.
It exists as a single, circular, double-stranded DNA mole-
cule. Fitting this DNA circle into the bacterial cell is a re-
markable feat of packaging—fully stretched out, the DNA
of a bacterium like Escherichia coli is about 500 times longer
than the cell itself.
The DNA circle is attached at one point to the cytoplas-
mic surface of the bacterial cell’s plasma membrane. At a
specific site on the DNA molecule called the replication ori-
gin, a battery of more than 22 different proteins begins the
process of copying the DNA (figure 11.3). When these en-
zymes have proceeded all the way around the circle of
DNA, the cell possesses two copies of the genome. These
“daughter” genomes are attached side-by-side to the plasma
membrane.
The growth of a bacterial cell to about twice its initial
size induces the onset of cell division. A wealth of recent ev-
idence suggests that the two daughter chromosomes are ac-
tively partitioned during this process. As this process pro-
ceeds, the cell lays down new plasma membrane and cell
wall materials in the zone between the attachment sites of
the two daughter genomes. A new plasma membrane grows
between the genomes; eventually, it reaches all the way into
the center of the cell, dividing it in two. Because the mem-
brane forms between the two genomes, each new cell is as-
sured of retaining one of the genomes. Finally, a new cell
wall forms around the new membrane.
The evolution of the eukaryotes introduced several addi-
tional factors into the process of cell division. Eukaryotic
11.1 Bacteria divide far more simply than do eukaryotes.
FIGURE 11.2
Fission (40,000H11547).Bacteria divide by a process of simple cell
fission. Note the newly formed plasma membrane between the
two daughter cells.
Replication
origin
FIGURE 11.3
How bacterial DNA replicates.The replication of the circular DNA molecule (blue) that constitutes the genome of a bacterium begins at
a single site, called the replication origin. The replication enzymes move out in both directions from that site and make copies (red) of each
strand in the DNA duplex. When the enzymes meet on the far side of the molecule, replication is complete.
Discovery of Chromosomes
Chromosomes were first observed by the German embryol-
ogist Walther Fleming in 1882, while he was examining the
rapidly dividing cells of salamander larvae. When Fleming
looked at the cells through what would now be a rather
primitive light microscope, he saw minute threads within
their nuclei that appeared to be dividing lengthwise. Flem-
ing called their division mitosis, based on the Greek word
mitos,meaning “thread.”
Chromosome Number
Since their initial discovery, chromosomes have been found
in the cells of all eukaryotes examined. Their number may
vary enormously from one species to another. A few kinds of
organisms—such as the Australian ant Myrmecia, the plant
Haplopappus gracilis, a relative of the sunflower that grows in
North American deserts; and the fungus Penicillium—have
only 1 pair of chromosomes, while some ferns have more
than 500 pairs (table 11.1). Most eukaryotes have between
10 and 50 chromosomes in their body cells.
Human cells each have 46 chromosomes, consist-
ing of 23 nearly identical pairs (figure 11.4). Each of
these 46 chromosomes contains hundreds or thou-
sands of genes that play important roles in determin-
ing how a person’s body develops and functions. For
this reason, possession of all the chromosomes is es-
sential to survival. Humans missing even one chro-
mosome, a condition called monosomy, do not sur-
vive embryonic development in most cases. Nor does
the human embryo develop properly with an extra
copy of any one chromosome, a condition called tri-
somy. For all but a few of the smallest chromosomes,
trisomy is fatal, and even in those few cases, serious
problems result. Individuals with an extra copy of the
very small chromosome 21, for example, develop
more slowly than normal and are mentally retarded, a
condition called Down syndrome.
All eukaryotic cells store their hereditary information in
chromosomes, but different kinds of organisms utilize
very different numbers of chromosomes to store this
information.
Chapter 11 How Cells Divide 209
11.2 Chromosomes are highly ordered structures.
FIGURE 11.4
Human chromosomes.This photograph (950×) shows human
chromosomes as they appear immediately before nuclear division.
Each DNA molecule has already replicated, forming identical
copies held together by a constriction called the centromere.
Table 11.1 Chromosome Number in Selected Eukaryotes
Total Number of Total Number of Total Number of
Group Chromosomes Group Chromosomes Group Chromosomes
FUNGI
Neurospora(haploid) 7
Saccharomyces(a yeast) 16
INSECTS
Mosquito 6
Drosophila 8
Honeybee 32
Silkworm 56
PLANTS
Haplopappus gracilis 2
Garden pea 14
Corn 20
Bread wheat 42
Sugarcane 80
Horsetail 216
Adder’s tongue fern 1262
VERTEBRATES
Opossum 22
Frog 26
Mouse 40
Human 46
Chimpanzee 48
Horse 64
Chicken 78
Dog 78
The Structure of Eukaryotic
Chromosomes
In the century since discovery of chromosomes, we have
learned a great deal about their structure and composition.
Composition of Chromatin
Chromosomes are composed of chromatin, a complex of
DNA and protein; most are about 40% DNA and 60%
protein. A significant amount of RNA is also associated
with chromosomes because chromosomes are the sites of
RNA synthesis. The DNA of a chromosome is one very
long, double-stranded fiber that extends unbroken through
the entire length of the chromosome. A typical human
chromosome contains about 140 million (1.4 × 10
8
) nu-
cleotides in its DNA. The amount of information one
chromosome contains would fill about 280 printed books of
1000 pages each, if each nucleotide corresponded to a
“word” and each page had about 500 words on it. Further-
more, if the strand of DNA from a single chromosome
were laid out in a straight line, it would be about 5 cen-
timeters (2 inches) long. Fitting such a strand into a nu-
cleus is like cramming a string the length of a football field
into a baseball—and that’s only 1 of 46 chromosomes! In
the cell, however, the DNA is coiled, allowing it to fit into
a much smaller space than would otherwise be possible.
Chromosome Coiling
How can this long DNA fiber coil so tightly? If we gently
disrupt a eukaryotic nucleus and examine the DNA with an
electron microscope, we find that it resembles a string of
beads (figure 11.5). Every 200 nucleotides, the DNA du-
plex is coiled around a core of eight histone proteins, form-
ing a complex known as a nucleosome. Unlike most
proteins, which have an overall negative charge, histones
are positively charged, due to an abundance of the basic
amino acids arginine and lysine. They are thus strongly at-
tracted to the negatively charged phosphate groups of the
210 Part IV Reproduction and Heredity
Supercoil
within chromosome
Chromosomes
Coiling
within
supercoil
Chromatin
Chromatin fiber
Nucleosome
DNA
Central
histone
DNA double helix (duplex) DNA
FIGURE 11.5
Levels of eukaryotic
chromosomal
organization.
Nucleotides assemble into
long double strands of
DNA molecules. These
strands require further
packaging to fit into the
cell nucleus. The DNA
duplex is tightly bound to
and wound around
proteins called histones.
The DNA-wrapped
histones are called
nucleosomes.The
nucleosomes then
coalesce into chromatin
fibers, ultimately coiling
around into supercoils that
make up the form of
DNA recognized as a
chromosome.
DNA. The histone cores thus act as “magnetic forms” that
promote and guide the coiling of the DNA. Further coiling
occurs when the string of nucleosomes wraps up into
higher order coils called supercoils.
Highly condensed portions of the chromatin are called
heterochromatin. Some of these portions remain perma-
nently condensed, so that their DNA is never expressed.
The remainder of the chromosome, called euchromatin, is
condensed only during cell division, when compact packag-
ing facilitates the movement of the chromosomes. At all
other times, euchromatin is present in an open configura-
tion, and its genes can be expressed. The way chromatin is
packaged when the cell is not dividing is not well under-
stood beyond the level of nucleosomes and is a topic of in-
tensive research.
Chromosome Karyotypes
Chromosomes may differ widely in appearance. They vary
in size, staining properties, the location of the centromere (a
constriction found on all chromosomes), the relative length
of the two arms on either side of the centromere, and the
positions of constricted regions along the arms. The partic-
ular array of chromosomes that an individual possesses is
called its karyotype (figure 11.6). Karyotypes show marked
differences among species and sometimes even among indi-
viduals of the same species.
To examine a human karyotype, investigators collect a
cell sample from blood, amniotic fluid, or other tissue and
add chemicals that induce the cells in the sample to di-
vide. Later, they add other chemicals to stop cell division
at a stage when the chromosomes are most condensed and
thus most easily distinguished from one another. The
cells are then broken open and their contents, including
the chromosomes, spread out and stained. To facilitate
the examination of the karyotype, the chromosomes are
usually photographed, and the outlines of the chromo-
somes are cut out of the photograph and arranged in
order (see figure 11.6).
How Many Chromosomes Are in a Cell?
With the exception of the gametes (eggs or sperm) and a
few specialized tissues, every cell in a human body is
diploid (2n). This means that the cell contains two nearly
identical copies of each of the 23 types of chromosomes,
for a total of 46 chromosomes. The haploid (1n) gametes
contain only one copy of each of the 23 chromosome types,
while certain tissues have unusual numbers of chromo-
somes—many liver cells, for example, have two nuclei,
while mature red blood cells have no nuclei at all. The two
copies of each chromosome in body cells are called homol-
ogous chromosomes, or homologues (Greek homologia,
“agreement”). Before cell division, each homologue repli-
cates, producing two identical sister chromatids joined at
the centromere, a condensed area found on all eukaryotic
chromosomes (figure 11.7). Hence, as cell division begins, a
human body cell contains a total of 46 replicated chromo-
somes, each composed of two sister chromatids joined by
one centromere. The cell thus contains 46 centromeres and
92 chromatids (2 sister chromatids for each of 2 homo-
logues for each of 23 chromosomes). The cell is said to
contain 46 chromosomes rather than 92 because, by con-
vention, the number of chromosomes is obtained by count-
ing centromeres.
Eukaryotic genomes are larger and more complex than
those of bacteria. Eukaryotic DNA is packaged tightly
into chromosomes, enabling it to fit inside cells.
Haploid cells contain one set of chromosomes, while
diploid cells contain two sets.
Chapter 11 How Cells Divide 211
FIGURE 11.6
A human karyotype.The individual chromosomes that make up
the 23 pairs differ widely in size and in centromere position. In
this preparation, the chromosomes have been specifically stained
to indicate further differences in their composition and to
distinguish them clearly from one another.
Sister
chromatids
Homologous
chromosomes
Centromere
FIGURE 11.7
The difference between homologous chromosomes and sister
chromatids.Homologous chromosomes are a pair of the same
chromosome—say, chromosome number 16. Sister chromatids
are the two replicas of a single chromosome held together by the
centromeres after DNA replication.
Phases of the Cell Cycle
The increased size and more complex organization of eu-
karyotic genomes over those of bacteria required radical
changes in the process by which the two replicas of the
genome are partitioned into the daughter cells during cell
division. This division process is diagrammed as a cell
cycle,consisting of five phases (figure 11.8).
The Five Phases
G
1
is the primary growth phase of the cell. For many or-
ganisms, this encompasses the major portion of the cell’s
life span. S is the phase in which the cell synthesizes a
replica of the genome. G
2
is the second growth phase, in
which preparations are made for genomic separation.
During this phase, mitochondria and other organelles
replicate, chromosomes condense, and microtubules
begin to assemble at a spindle. G
1
, S, and G
2
together
constitute interphase, the portion of the cell cycle be-
tween cell divisions.
M is the phase of the cell cycle in which the microtubu-
lar apparatus assembles, binds to the chromosomes, and
moves the sister chromatids apart. Called mitosis, this
process is the essential step in the separation of the two
daughter genomes. We will discuss mitosis as it occurs in
animals and plants, where the process does not vary much
(it is somewhat different among fungi and some protists).
Although mitosis is a continuous process, it is traditionally
subdivided into four stages: prophase, metaphase, anaphase,
and telophase.
C is the phase of the cell cycle when the cytoplasm di-
vides, creating two daughter cells. This phase is called
cytokinesis. In animal cells, the microtubule spindle
helps position a contracting ring of actin that constricts
like a drawstring to pinch the cell in two. In cells with a
cell wall, such as plant cells, a plate forms between the di-
viding cells.
Duration of the Cell Cycle
The time it takes to complete a cell cycle varies greatly
among organisms. Cells in growing embryos can com-
plete their cell cycle in under 20 minutes; the shortest
known animal nuclear division cycles occur in fruit fly
embryos (8 minutes). Cells such as these simply divide
their nuclei as quickly as they can replicate their DNA,
without cell growth. Half of the cycle is taken up by S,
half by M, and essentially none by G
1
or G
2
. Because ma-
ture cells require time to grow, most of their cycles are
much longer than those of embryonic tissue. Typically, a
dividing mammalian cell completes its cell cycle in about
24 hours, but some cells, like certain cells in the human
liver, have cell cycles lasting more than a year. During
the cycle, growth occurs throughout the G
1
and G
2
phases (referred to as “gap” phases, as they separate S
from M), as well as during the S phase. The M phase
takes only about an hour, a small fraction of the entire
cycle.
Most of the variation in the length of the cell cycle
from one organism or tissue to the next occurs in the G
1
phase. Cells often pause in G
1
before DNA replication
and enter a resting state called G
0
phase; they may re-
main in this phase for days to years before resuming cell
division. At any given time, most of the cells in an ani-
mal’s body are in G
0
phase. Some, such as muscle and
nerve cells, remain there permanently; others, such as
liver cells, can resume G
1
phase in response to factors re-
leased during injury.
Most eukaryotic cells repeat a process of growth and
division referred to as the cell cycle. The cycle can vary
in length from a few minutes to several years.
212 Part IV Reproduction and Heredity
11.3 Mitosis is a key phase of the cell cycle.
G
2
S
G
1
C
Metaphase
Prophase
Anaphase
Telophase
M
Interphase (G
1
, S, G
2
phases)
Mitosis (M)
Cytokinesis (C)
FIGURE 11.8
The cell cycle.Each wedge represents one hour of the 22-hour
cell cycle in human cells growing in culture. G
1
represents the
primary growth phase of the cell cycle, S the phase during which a
replica of the genome is synthesized, and G
2
the second growth
phase.
Interphase: Preparing for Mitosis
The events that occur during interphase, made up of the G
1
,
S, and G
2
phases, are very important for the successful com-
pletion of mitosis. During G
1
, cells undergo the major por-
tion of their growth. During the S phase, each chromosome
replicates to produce two sister chromatids, which remain at-
tached to each other at the centromere. The centromere is
a point of constriction on the chromosome, containing a
specific DNA sequence to which is bound a disk of protein
called a kinetochore. This disk functions as an attachment
site for fibers that assist in cell division (figure 11.9). Each
chromosome’s centromere is located at a characteristic site.
The cell grows throughout interphase. The G
1
and G
2
segments of interphase are periods of active growth, when
proteins are synthesized and cell organelles produced. The
cell’s DNA replicates only during the S phase of the cell cycle.
After the chromosomes have replicated in S phase, they
remain fully extended and uncoiled. This makes them invis-
ible under the light microscope. In G
2
phase, they begin the
long process of condensation, coiling ever more tightly.
Special motor proteins are involved in the rapid final conden-
sation of the chromosomes that occurs early in mitosis. Also
during G
2
phase, the cells begin to assemble the machinery
they will later use to move the chromosomes to opposite
poles of the cell. In animal cells, a pair of microtubule-
organizing centers called centrioles replicate. All eukary-
otic cells undertake an extensive synthesis of tubulin, the
protein of which microtubules are formed.
Interphase is that portion of the cell cycle in which the
chromosomes are invisible under the light microscope
because they are not yet condensed. It includes the G
1
,
S, and G
2
phases. In the G
2
phase, the cell mobilizes its
resources for cell division.
Chapter 11 How Cells Divide 213
Metaphase
chromosome
Kinetochore
Kinetochore
microtubules
Centromere
region of
chromosome
Chromatid
FIGURE 11.9
Kinetochores.In a metaphase chromosome, kinetochore
microtubules are anchored to proteins at the centromere.
A Vocabulary of
Cell Division
chromatin The complex of DNA and
proteins of which eukaryotic chromosomes
are composed.
chromosome The structure within cells
that contains the genes. In eukaryotes, it
consists of a single linear DNA molecule as-
sociated with proteins. The DNA is repli-
cated during S phase, and the replicas sepa-
rated during M phase.
cytokinesis Division of the cytoplasm of a
cell after nuclear division.
euchromatin The portion of a chromo-
some that is extended except during cell di-
vision, and from which RNA is transcribed.
heterochromatin The portion of a chro-
mosome that remains permanently con-
densed and, therefore, is not transcribed
into RNA. Most centromere regions are
heterochromatic.
homologues Homologous chromosomes;
in diploid cells, one of a pair of chromo-
somes that carry equivalent genes.
kinetochore A disk of protein bound to
the centromere and attached to micro-
tubules during mitosis, linking each chro-
matid to the spindle apparatus.
microtubule A hollow cylinder, about 25
nanometers in diameter, composed of sub-
units of the protein tubulin. Microtubules
lengthen by the addition of tubulin subunits
to their end(s) and shorten by the removal
of subunits.
mitosis Nuclear division in which repli-
cated chromosomes separate to form two
genetically identical daughter nuclei. When
accompanied by cytokinesis, it produces
two identical daughter cells.
nucleosome The basic packaging unit of
eukaryotic chromosomes, in which the
DNA molecule is wound around a cluster of
histone proteins. Chromatin is composed of
long strings of nucleosomes that resemble
beads on a string.
binary fission Asexual reproduction of a
cell by division into two equal or nearly
equal parts. Bacteria divide by binary
fission.
centromere A constricted region of a
chromosome about 220 nucleotides in
length, composed of highly repeated DNA
sequences (satellite DNA). During mitosis,
the centromere joins the two sister chro-
matids and is the site to which the kineto-
chores are attached.
chromatid One of the two copies of a
replicated chromosome, joined by a single
centromere to the other strand.
Mitosis
Prophase: Formation of the Mitotic Apparatus
When the chromosome condensation initiated in G
2
phase
reaches the point at which individual condensed chromo-
somes first become visible with the light microscope, the
first stage of mitosis, prophase, has begun. The condensa-
tion process continues throughout prophase; consequently,
some chromosomes that start prophase as minute threads
appear quite bulky before its conclusion. Ribosomal RNA
synthesis ceases when the portion of the chromosome bear-
ing the rRNA genes is condensed.
Assembling the Spindle Apparatus. The assembly of
the microtubular apparatus that will later separate the
sister chromatids also continues during prophase. In ani-
mal cells, the two centriole pairs formed during G
2
phase
begin to move apart early in prophase, forming between
them an axis of microtubules referred to as spindle fibers.
By the time the centrioles reach the opposite poles of the
cell, they have established a bridge of microtubules called
the spindle apparatus between them. In plant cells, a
similar bridge of microtubular fibers forms between op-
posite poles of the cell, although centrioles are absent in
plant cells.
During the formation of the spindle apparatus, the nu-
clear envelope breaks down and the endoplasmic reticulum
reabsorbs its components. At this point, then, the micro-
tubular spindle fibers extend completely across the cell,
from one pole to the other. Their orientation determines
the plane in which the cell will subsequently divide,
through the center of the cell at right angles to the spindle
apparatus.
In animal cell mitosis, the centrioles extend a radial
array of microtubules toward the plasma membrane when
they reach the poles of the cell. This arrangement of mi-
crotubules is called an aster. Although the aster’s func-
tion is not fully understood, it probably braces the centri-
oles against the membrane and stiffens the point of
microtubular attachment during the retraction of the
spindle. Plant cells, which have rigid cell walls, do not
form asters.
Linking Sister Chromatids to Opposite Poles. Each
chromosome possesses two kinetochores, one attached to
the centromere region of each sister chromatid (see fig-
ure 11.9). As prophase continues, a second group of mi-
crotubules appears to grow from the poles of the cell to-
ward the centromeres. These microtubules connect the
kinetochores on each pair of sister chromatids to the two
poles of the spindle. Because microtubules extending
from the two poles attach to opposite sides of the cen-
tromere, they attach one sister chromatid to one pole and
the other sister chromatid to the other pole. This
arrangement is absolutely critical to the process of mito-
sis; any mistakes in microtubule positioning can be disas-
trous. The attachment of the two sides of a centromere
to the same pole, for example, leads to a failure of the sis-
ter chromatids to separate, so that they end up in the
same daughter cell.
Metaphase: Alignment of the Centromeres
The second stage of mitosis, metaphase, is the phase
where the chromosomes align in the center of the cell.
When viewed with a light microscope, the chromosomes
appear to array themselves in a circle along the inner cir-
cumference of the cell, as the equator girdles the earth (fig-
ure 11.10). An imaginary plane perpendicular to the axis of
the spindle that passes through this circle is called the
metaphase plate. The metaphase plate is not an actual struc-
ture, but rather an indication of the future axis of cell divi-
sion. Positioned by the microtubules attached to the kine-
tochores of their centromeres, all of the chromosomes line
up on the metaphase plate (figure 11.11). At this point,
which marks the end of metaphase, their centromeres are
neatly arrayed in a circle, equidistant from the two poles of
the cell, with microtubules extending back towards the op-
posite poles of the cell in an arrangement called a spindle
because of its shape.
214 Part IV Reproduction and Heredity
Chromosome
Centrioles
Metaphase
plate
Aster
Spindle
fibers
FIGURE 11.10
Metaphase.In metaphase, the chromosomes array themselves in
a circle around the spindle midpoint.
Chapter 11 How Cells Divide 215
CYTOKINESIS
? plant cells: cell plate forms, dividing
daughter cells
? animal cells: cleavage furrow forms
at equator of cell and pinches inward
until cell divides in two
Prophase
? nuclear membrane
disintegrates
? nucleolus disappears
? chromosomes condense
? mitotic spindle begins to form
between centrioles
? kinetochores begin to mature
and attach to spindle
Metaphase
? kinetochores attach chromosomes
to mitotic spindle and align them
along metaphase plate at equator
of cell
Anaphase
? kinetochore microtubules shorten,
separating chromosomes to
opposite poles
? polar microtubules elongate,
preparing cell for cytokinesis
Telophase
? chromosomes reach poles of cell
? kinetochores disappear
? polar microtubules continue to
elongate, preparing cell for
cytokinesis
? nuclear membrane re-forms
? nucleolus reappears
? chromosomes decondense
Nucleolus
Nucleus
Cytoplasm
Cell wall
Microtubules
Cell nucleus
Condensed
chromosomes
Chromosomes
Centromere
and
kinetochore
Mitotic
spindle
Mitotic spindle
microtubules
Chromosomes
aligned on
metaphase plate
Kinetochore
microtubules
Polar
microtubules
Chromatids
Spindle
microtubules (pink)
Cell plate
Daughter nuclei
and nucleoli
Microtubule
FIGURE 11.11
Mitosis and cytokinesis.Mitosis (separation of the two genomes) occurs in four stages—prophase, metaphase, anaphase, and telophase—
and is followed by cytokinesis (division into two separate cells). In this depiction, the chromosomes of the African blood lily, Haemanthus
katharinae, are stained blue, and microtubules are stained red.
Anaphase and Telophase: Separation of the
Chromatids and Reformation of the Nuclei
Of all the stages of mitosis, anaphase is the shortest and
the most beautiful to watch. It starts when the centromeres
divide. Each centromere splits in two, freeing the two sister
chromatids from each other. The centromeres of all the
chromosomes separate simultaneously, but the mechanism
that achieves this synchrony is not known.
Freed from each other, the sister chromatids are pulled
rapidly toward the poles to which their kinetochores are at-
tached. In the process, two forms of movement take place
simultaneously, each driven by microtubules.
First, the poles move apart as microtubular spindle fibers
physically anchored to opposite poles slide past each other,
away from the center of the cell (figure 11.12). Because an-
other group of microtubules attach the chromosomes to
the poles, the chromosomes move apart, too. If a flexible
membrane surrounds the cell, it becomes visibly elongated.
Second, the centromeres move toward the poles as the mi-
crotubules that connect them to the poles shorten. This
shortening process is not a contraction; the microtubules
do not get any thicker. Instead, tubulin subunits are re-
moved from the kinetochore ends of the microtubules by
the organizing center. As more subunits are removed, the
chromatid-bearing microtubules are progressively disas-
sembled, and the chromatids are pulled ever closer to the
poles of the cell.
When the sister chromatids separate in anaphase, the
accurate partitioning of the replicated genome—the es-
sential element of mitosis—is complete. In telophase, the
spindle apparatus disassembles, as the microtubules are
broken down into tubulin monomers that can be used to
construct the cytoskeletons of the daughter cells. A nu-
clear envelope forms around each set of sister chromatids,
which can now be called chromosomes because each has
its own centromere. The chromosomes soon begin to un-
coil into the more extended form that permits gene ex-
pression. One of the early group of genes expressed are
the rRNA genes, resulting in the reappearance of the
nucleolus.
During prophase, microtubules attach the
centromeres joining pairs of sister chromatids to
opposite poles of the spindle apparatus. During
metaphase, each chromosome is drawn to a ring along
the inner circumference of the cell by the
microtubules extending from the centromere to the
two poles of the spindle apparatus. During anaphase,
the poles of the cell are pushed apart by microtubular
sliding, and the sister chromatids are drawn to
opposite poles by the shortening of the microtubules
attached to them. During telophase, the spindle is
disassembled, nuclear envelopes are reestablished, and
the normal expression of genes present in the
chromosomes is reinitiated.
216 Part IV Reproduction and Heredity
Metaphase Late anaphase
Pole Overlapping microtubules Pole Overlapping microtubules PolePole 2 μm
FIGURE 11.12
Microtubules slide past each other as the chromosomes separate.In these electron micrographs of dividing diatoms, the overlap of the
microtubules lessens markedly during spindle elongation as the cell passes from metaphase to anaphase.
Cytokinesis
Mitosis is complete at the end of telophase. The eukaryotic
cell has partitioned its replicated genome into two nuclei
positioned at opposite ends of the cell. While mitosis was
going on, the cytoplasmic organelles, including mitochon-
dria and chloroplasts (if present), were reassorted to areas
that will separate and become the daughter cells. The repli-
cation of organelles takes place before cytokinesis, often in
the S or G
2
phase. Cell division is still not complete at the
end of mitosis, however, because the division of the cell
proper has not yet begun. The phase of the cell cycle when
the cell actually divides is called cytokinesis. It generally
involves the cleavage of the cell into roughly equal halves.
Cytokinesis in Animal Cells
In animal cells and the cells of all other eukaryotes that lack
cell walls, cytokinesis is achieved by means of a constricting
belt of actin filaments. As these filaments slide past one an-
other, the diameter of the belt decreases, pinching the cell
and creating a cleavage furrow around the cell’s circumfer-
ence (figure 11.13a). As constriction proceeds, the furrow
deepens until it eventually slices all the way into the center
of the cell. At this point, the cell is divided in two (figure
11.13b).
Cytokinesis in Plant Cells
Plant cells possess a cell wall far too rigid to be squeezed in
two by actin filaments. Instead, these cells assemble mem-
brane components in their interior, at right angles to the
spindle apparatus (figure 11.14). This expanding membrane
partition, called a cell plate, continues to grow outward
until it reaches the interior surface of the plasma mem-
brane and fuses with it, effectively dividing the cell in two.
Cellulose is then laid down on the new membranes, creat-
ing two new cell walls. The space between the daughter
cells becomes impregnated with pectins and is called a
middle lamella.
Cytokinesis in Fungi and Protists
In fungi and some groups of protists, the nuclear mem-
brane does not dissolve and, as a result, all the events of mi-
tosis occurs entirely within the nucleus. Only after mitosis
is complete in these organisms does the nucleus then divide
into two daughter nuclei, and one nucleus goes to each
daughter cell during cytokinesis. This separate nuclear di-
vision phase of the cell cycle does not occur in plants, ani-
mals, or most protists.
After cytokinesis in any eukaryotic cell, the two daughter
cells contain all of the components of a complete cell.
While mitosis ensures that both daughter cells contain a
full complement of chromosomes, no similar mechanism
ensures that organelles such as mitochondria and chloro-
plasts are distributed equally between the daughter cells.
However, as long as some of each organelle are present in
each cell, the organelles can replicate to reach the number
appropriate for that cell.
C`ytokinesis is the physical division of the cytoplasm of
a eukaryotic cell into two daughter cells.
Chapter 11 How Cells Divide 217
(b)FIGURE 11.13
Cytokinesis in animal cells.
(a) A cleavage furrow forms around a dividing sea urchin egg
(30×). (b) The completion of cytokinesis in an animal cell. The
two daughter cells are still joined by a thin band of cytoplasm
occupied largely by microtubules.
Cell wall Nuclei
Vesicles containing membrane
components fusing to form cell plate
FIGURE 11.14
Cytokinesis in plant cells.In this photograph and companion
drawing, a cell plate is forming between daughter nuclei. Once
the plate is complete, there will be two cells.
General Strategy of Cell
Cycle Control
The events of the cell cycle are coordinated in much the
same way in all eukaryotes. The control system human cells
utilize first evolved among the protists over a billion years
ago; today, it operates in essentially the same way in fungi
as it does in humans.
The goal of controlling any cyclic process is to adjust
the duration of the cycle to allow sufficient time for all
events to occur. In principle, a variety of methods can
achieve this goal. For example, an internal “clock” can be
employed to allow adequate time for each phase of the
cycle to be completed. This is how many organisms con-
trol their daily activity cycles. The disadvantage of using
such a clock to control the cell cycle is that it is not very
flexible. One way to achieve a more flexible and sensitive
regulation of a cycle is simply to let the completion of
each phase of the cycle trigger the beginning of the next
phase, as a runner passing a baton starts the next leg in a
relay race. Until recently, biologists thought this type of
mechanism controlled the cell division cycle. However,
we now know that eukaryotic cells employ a separate, cen-
tralized controller to regulate the process: at critical
points in the cell cycle, further progress depends upon a
central set of “go/no-go” switches that are regulated by
feedback from the cell.
This mechanism is the same one engineers use to con-
trol many processes. For example, the furnace that heats
a home in the winter typically goes through a daily heat-
ing cycle. When the daily cycle reaches the morning
“turn on” checkpoint, sensors report whether the house
temperature is below the set point (for example, 70°F). If
it is, the thermostat triggers the furnace, which warms
the house. If the house is already at least that warm, the
thermostat does not start up the furnace. Similarly, the
cell cycle has key checkpoints where feedback signals
from the cell about its size and the condition of its chro-
mosomes can either trigger subsequent phases of the
cycle, or delay them to allow more time for the current
phase to be completed.
Architecture of the Control System
Three principal checkpoints control the cell cycle in eu-
karyotes (figure 11.15):
Cell growth is assessed at the G
1
checkpoint. Lo-
cated near the end of G
1
, just before entry into S phase,
this checkpoint makes the key decision of whether the
cell should divide, delay division, or enter a resting stage
(figure 11.16). In yeasts, where researchers first studied
this checkpoint, it is called START. If conditions are fa-
vorable for division, the cell begins to copy its DNA,
initiating S phase. The G
1
checkpoint is where the more
complex eukaryotes typically arrest the cell cycle if envi-
ronmental conditions make cell division impossible, or if
the cell passes into G
0
for an extended period.
The success of DNA replication is assessed at the
G
2
checkpoint. The second checkpoint, which occurs
at the end of G
2
, triggers the start of M phase. If this
checkpoint is passed, the cell initiates the many molecu-
lar processes that signal the beginning of mitosis.
Mitosis is assessed at the M checkpoint. Occurring
at metaphase, the third checkpoint triggers the exit from
mitosis and cytokinesis and the beginning of G
1
.
The cell cycle is controlled at three checkpoints.
218 Part IV Reproduction and Heredity
11.4 The cell cycle is carefully controlled.
G
2
M
S
G
2
checkpoint M checkpoint
G
1
checkpoint
G
1
C
FIGURE 11.15
Control of the cell cycle.Cells use a centralized control system
to check whether proper conditions have been achieved before
passing three key “checkpoints” in the cell cycle.
proceed to S?
pause?
withdraw to Go?
FIGURE 11.16
The G
1
checkpoint.
Feedback from the
cell determines
whether the cell cycle
will proceed to the S
phase, pause, or
withdraw into G
0
for
an extended rest
period.
Molecular Mechanisms of Cell
Cycle Control
Exactly how does a cell achieve central control of the divi-
sion cycle? The basic mechanism is quite simple. A set of
proteins sensitive to the condition of the cell interact at the
checkpoints to trigger the next events in the cycle. Two key
types of proteins participate in this interaction: cyclin-
dependent protein kinases and cyclins (figure 11.17).
The Cyclin Control System
Cyclin-dependent protein kinases (Cdks) are enzymes
that phosphorylate (add phosphate groups to) the serine
and threonine amino acids of key cellular enzymes and
other proteins. At the G
2
checkpoint, for example, Cdks
phosphorylate histones, nuclear membrane filaments, and
the microtubule-associated proteins that form the mitotic
spindle. Phosphorylation of these components of the cell
division machinery initiates activities that carry the cycle
past the checkpoint into mitosis.
Cyclins are proteins that bind to Cdks, enabling the
Cdks to function as enzymes. Cyclins are so named because
they are destroyed and resynthesized during each turn of
the cell cycle (figure 11.18). Different cyclins regulate the
G
1
and G
2
cell cycle checkpoints.
The G
2
Checkpoint. During G
2
, the cell gradually accu-
mulates G
2
cyclin (also called mitotic cyclin). This cyclin
binds to Cdk to form a complex called MPF (mitosis-pro-
moting factor). At first, MPF is not active in carrying the
cycle past the G
2
checkpoint. But eventually, other cellular
enzymes phosphorylate and so activate a few molecules of
MPF. These activated MPFs in turn increase the activity of
the enzymes that phosphorylate MPF, setting up a positive
feedback that leads to a very rapid increase in the cellular
concentration of activated MPF. When the level of acti-
vated MPF exceeds the threshold necessary to trigger mito-
sis, G
2
phase ends.
MPF sows the seeds of its own destruction. The
length of time the cell spends in M phase is determined
by the activity of MPF, for one of its many functions is to
activate proteins that destroy cyclin. As mitosis proceeds
to the end of metaphase, Cdk levels stay relatively con-
stant, but increasing amounts of G
2
cyclin are degraded,
causing progressively less MPF to be available and so ini-
tiating the events that end mitosis. After mitosis, the
gradual accumulation of new cyclin starts the next turn of
the cell cycle.
The G
1
Checkpoint. The G
1
checkpoint is thought to
be regulated in a similar fashion. In unicellular eukaryotes
such as yeasts, the main factor triggering DNA replication
is cell size. Yeast cells grow and divide as rapidly as possi-
ble, and they make the START decision by comparing
the volume of cytoplasm to the size of the genome. As a
cell grows, its cytoplasm increases in size, while the
amount of DNA remains constant. Eventually a threshold
ratio is reached that promotes the production of cyclins
and thus triggers the next round of DNA replication and
cell division.
Chapter 11 How Cells Divide 219
Cyclin
Cyclin-dependent kinase
(Cdk)
FIGURE 11.17
A complex of two proteins
triggers passage through
cell cycle checkpoints.Cdk
is a protein kinase that
activates numerous cell
proteins by phosphorylating
them. Cyclin is a regulatory
protein required to activate
Cdk; in other words, Cdk
does not function unless
cyclin is bound to it.
Trigger mitosis
MPF
G
2
checkpoint
G
1
checkpoint
G
1
cyclin
Mitotic
cyclin
Cdk
Trigger DNA replication
G
1
G
2
S
M
Start kinase
M-phase-promoting factor
C
P
P
FIGURE 11.18
How cell cycle control works. As the cell cycle passes through
the G
1
and G
2
checkpoints, Cdk becomes associated with
different cyclins and, as a result, activates different cellular
processes. At the completion of each phase, the cyclins are
degraded, bringing Cdk activity to a halt until the next set of
cyclins appears.
Controlling the Cell Cycle in
Multicellular Eukaryotes
The cells of multicellular eukaryotes are not free to make
individual decisions about cell division, as yeast cells are.
The body’s organization cannot be maintained without se-
verely limiting cell proliferation, so that only certain cells
divide, and only at appropriate times. The way that cells in-
hibit individual growth of other cells is apparent in mam-
malian cells growing in tissue culture: a single layer of cells
expands over a culture plate until the growing border of
cells comes into contact with neighboring cells, and then
the cells stop dividing. If a sector of cells is cleared away,
neighboring cells rapidly refill that sector and then stop di-
viding again. How are cells able to sense the density of the
cell culture around them? Each growing cell apparently
binds minute amounts of positive regulatory signals called
growth factors, proteins that stimulate cell division (such
as MPF). When neighboring cells have used up what little
growth factor is present, not enough is left to trigger cell
division in any one cell.
Growth Factors and the Cell Cycle
As you may recall from chapter 7 (cell-cell interactions),
growth factors work by triggering intracellular signaling
systems. Fibroblasts, for example, possess numerous recep-
tors on their plasma membranes for one of the first growth
factors to be identified: platelet-derived growth factor
(PDGF). When PDGF binds to a membrane receptor, it
initiates an amplifying chain of internal cell signals that
stimulates cell division. PDGF was discovered when inves-
tigators found that fibroblasts would grow and divide in tis-
sue culture only if the growth medium contained blood
serum (the liquid that remains after blood clots); blood
plasma (blood from which the cells have been removed
without clotting) would not work. The researchers hypoth-
esized that platelets in the blood clots were releasing into
the serum one or more factors required for fibroblast
growth. Eventually, they isolated such a factor and named
it PDGF. Growth factors such as PDGF override cellular
controls that otherwise inhibit cell division. When a tissue
is injured, a blood clot forms and the release of PDGF trig-
gers neighboring cells to divide, helping to heal the wound.
Only a tiny amount of PDGF (approximately 10
–10
M) is
required to stimulate cell division.
Characteristics of Growth Factors. Over 50 different
proteins that function as growth factors have been isolated
(table 11.2 lists a few), and more undoubtedly exist. A spe-
cific cell surface receptor “recognizes” each growth factor,
its shape fitting that growth factor precisely. When the
growth factor binds with its receptor, the receptor reacts by
triggering events within the cell (figure 11.19). The cellular
selectivity of a particular growth factor depends upon
which target cells bear its unique receptor. Some growth
220 Part IV Reproduction and Heredity
Table 11.2 Growth Factors of Mammalian Cells
Growth Range of
Factor Specificity Effects
Epidermal growth
factor (EGF)
Erythropoietin
Fibroblast growth
factor (FGF)
Insulin-like
growth factor
Interleukin-2
Mitosis-promoting
factor (MPF)
Nerve growth
factor (NGF)
Platelet-derived growth
factor (PDGF)
Transforming growth
factor β(TGF-H9252)
Broad
Narrow
Broad
Broad
Narrow
Broad
Narrow
Broad
Broad
Stimulates cell proliferation in many tissues; plays a key role in
regulating embryonic development
Required for proliferation of red blood cell precursors and their
maturation into erythrocytes (red blood cells)
Initiates the proliferation of many cell types; inhibits maturation
of many types of stem cells; acts as a signal in embryonic
development
Stimulates metabolism of many cell types; potentiates the effects
of other growth factors in promoting cell proliferation
Triggers the division of activated T lymphocytes
during the immune response
Regulates entrance of the cell cycle into the M phase
Stimulates the growth of neuron processes during neural
development
Promotes the proliferation of many connective tissues and some
neuroglial cells
Accentuates or inhibits the responses of many cell types to other
growth factors; often plays an important role in cell differentiation
factors, like PDGF and epidermal growth factor (EGF), af-
fect a broad range of cell types, while others affect only
specific types. For example, nerve growth factor (NGF)
promotes the growth of certain classes of neurons, and ery-
thropoietin triggers cell division in red blood cell precur-
sors. Most animal cells need a combination of several dif-
ferent growth factors to overcome the various controls that
inhibit cell division.
The G
0
Phase. If cells are deprived of appropriate
growth factors, they stop at the G
1
checkpoint of the cell
cycle. With their growth and division arrested, they remain
in the G
0
phase, as we discussed earlier. This nongrowing
state is distinct from the interphase stages of the cell cycle,
G
1
, S, and G
2
.
It is the ability to enter G
0
that accounts for the in-
credible diversity seen in the length of the cell cycle
among different tissues. Epithelial cells lining the gut di-
vide more than twice a day, constantly renewing the lin-
ing of the digestive tract. By contrast, liver cells divide
only once every year or two, spending most of their time
in G
0
phase. Mature neurons and muscle cells usually
never leave G
0
.
Two groups of proteins, cyclins and Cdks, interact to
regulate the cell cycle. Cells also receive protein signals
called growth factors that affect cell division.
Chapter 11 How Cells Divide 221
NucleusCytoplasm
Cell division
Nuclear membrane
Growth factor
Protein kinase
cascade
myc
Rb
Nuclear pores
Rb
myc
Chromosome
Cdk
Cell surface
receptor
P
P
P
P
P
FIGURE 11.19
The cell proliferation-signaling pathway.Binding of a growth factor sets in motion a cascading intracellular signaling pathway
(described in chapter 7), which activates nuclear regulatory proteins that trigger cell division. In this example, when the nuclear protein Rb
is phosphorylated, another nuclear protein (myc) is released and is then able to stimulate the production of Cdk proteins.
Cancer and the Control of Cell
Proliferation
The unrestrained, uncontrolled growth of cells, called
cancer, is addressed more fully in chapter 18. However,
cancer certainly deserves mention in a chapter on cell di-
vision, as it is essentially a disease of cell division—a fail-
ure of cell division control. Recent work has identified one
of the culprits. Working independently, cancer scientists
have repeatedly identified what has proven to be the same
gene! Officially dubbed p53 (researchers italicize the gene
symbol to differentiate it from the protein), this gene
plays a key role in the G
1
checkpoint of cell division. The
gene’s product, the p53 protein, monitors the integrity of
DNA, checking that it is undamaged. If the p53 protein
detects damaged DNA, it halts cell division and stimu-
lates the activity of special enzymes to repair the damage.
Once the DNA has been repaired, p53 allows cell division
to continue. In cases where the DNA is irreparable, p53
then directs the cell to kill itself, activating an apoptosis
(cell suicide) program (see chapter 17 for a discussion of
apoptosis).
By halting division in damaged cells, p53 prevents the
development of many mutated cells, and it is therefore con-
sidered a tumor-suppressor gene (even though its activities
are not limited to cancer prevention). Scientists have found
that p53 is entirely absent or damaged beyond use in the
majority of cancerous cells they have examined! It is pre-
cisely because p53 is nonfunctional that these cancer cells
are able to repeatedly undergo cell division without being
halted at the G
1
checkpoint (figure 11.20). To test this, sci-
entists administered healthy p53 protein to rapidly dividing
cancer cells in a petri dish: the cells soon ceased dividing
and died.
Scientists at Johns Hopkins University School of Medi-
cine have further reported that cigarette smoke causes mu-
tations in the p53 gene. This study, published in 1995, rein-
forced the strong link between smoking and cancer
described in chapter 18.
222 Part IV Reproduction and Heredity
DNA damage is caused
by heat, radiation, or
chemicals.
DNA repair enzyme
p53 allows cells with
repaired DNA to divide.
Stage 1
DNA damage is caused
by heat, radiation, or
chemicals.
Stage 1
The p53 protein fails to stop
cell division and repair DNA.
Cell divides without repair to
damaged DNA.
Stage 2
Damaged cells continue to divide.
If other damage accumulates, the
cell can turn cancerous.
Stage 3
Cell division stops, and p53 triggers
enzymes to repair damaged region.
Stage 2
p53 triggers the destruction of cells
damaged beyond repair.
Cancer
cell
ABNORMAL p53
NORMAL p53
FIGURE 11.20
Cell division and p53 protein.Normal p53 protein monitors DNA, destroying cells with irreparable damage to their DNA. Abnormal
p53 protein fails to stop cell division and repair DNA. As damaged cells proliferate, cancer develops.
Growth Factors and Cancer
How do growth factors influence the cell cycle? As you
have seen, there are two different approaches, one positive
and the other negative.
Proto-oncogenes. PDGF and many other growth fac-
tors utilize the positive approach, stimulating cell divi-
sion. They trigger passage through the G
1
checkpoint by
aiding the formation of cyclins and so activating genes
that promote cell division. Genes that normally stimulate
cell division are sometimes called proto-oncogenes because
mutations that cause them to be overexpressed or hyper-
active convert them into oncogenes (Greek onco, “can-
cer”), leading to the excessive cell proliferation that is
characteristic of cancer. Even a single mutation (creating
a heterozygote) can lead to cancer if the other cancer-
preventing genes are nonfunctional. Geneticists, using
Mendel’s terms, call such mutations of proto-oncogenes
dominant.
Some 30 different proto-oncogenes are known. Some
act very quickly after stimulation by growth factors.
Among the most intensively studied of these are myc, fos,
and jun, all of which cause unrestrained cell growth and
division when they are overexpressed. In a normal cell,
the myc proto-oncogene appears to be important in regu-
lating the G
1
checkpoint. Cells in which myc expression is
prevented will not divide, even in the presence of growth
factors. A critical activity of myc and other genes in this
group of immediately responding proto-oncogenes is to
stimulate a second group of “delayed response” genes, in-
cluding those that produce cyclins and Cdk proteins (fig-
ure 11.21).
Tumor-suppressor Genes. Other growth factors utilize
a negative approach to cell cycle control. They block pas-
sage through the G
1
checkpoint by preventing cyclins from
binding to Cdk, thus inhibiting cell division. Genes that
normally inhibit cell division are called tumor-suppressor
genes. When mutated, they can also lead to unrestrained
cell division, but only if both copies of the gene are mutant.
Hence, these cancer-causing mutations are recessive.
The most thoroughly understood of the tumor-suppressor
genes is the retinoblastoma (Rb) gene. This gene was orig-
inally cloned from children with a rare form of eye cancer
inherited as a recessive trait, implying that the normal
gene product was a cancer suppressor that helped keep
cell division in check. The Rb gene encodes a protein pre-
sent in ample amounts within the nucleus. This protein
interacts with many key regulatory proteins of the cell
cycle, but how it does so depends upon its state of phos-
phorylation. In G
0
phase, the Rb protein is dephosphory-
lated. In this state, it binds to and ties up a set of regula-
tory proteins, like myc and fos, needed for cell
proliferation, blocking their action and so inhibiting cell
division (see figure 11.19). When phosphorylated, the Rb
protein releases its captive regulatory proteins, freeing
them to act and so promoting cell division. Growth fac-
tors lessen the inhibition the Rb protein imposes by acti-
vating kinases that phosphorylate it. Free of Rb protein
inhibition, cells begin to produce cyclins and Cdk, pass
the G
1
checkpoint, and proceed through the cell cycle.
Figure 11.22 summarizes the types of genes that can cause
cancer when mutated.
The progress of mitosis is regulated by the interaction
of two key classes of proteins, cyclin-dependent protein
kinases and cyclins. Some growth factors accelerate the
cell cycle by promoting cyclins and Cdks, others
suppress it by inhibiting their action.
Chapter 11 How Cells Divide 223
0 8 16 24Time (h)
CG
0
G
2
G
1
SM
Growth
factor
Levels of
myc protein
FIGURE 11.21
The role of myc in triggering cell division.The addition of a
growth factor leads to transcription of the mycgene and rapidly
increasing levels of the myc protein. This causes G
0
cells to enter
the S phase and begin proliferating.
Growth
factor
receptor
More per cell in
many breast cancers
Ras
protein
Activated by mutations
of ras in 20–30%
of all cancers
Src
kinase
Activated by mutations
in 2–5% of all cancers
Rb
protein
Mutated in 40%
of all cancers
p53
protein
Mutated in 50%
of all cancers
Key proteins associated
with human cancers
Growth
factor
receptor
Ras
protein
Src
kinase
p53
protein
Rb
protein
Cell cycle
checkpoints
Mammalian cell
Cytoplasm
Nucleus
FIGURE 11.22
Mutations cause cancer.Mutations in genes encoding key
components of the cell division-signaling pathway are responsible
for many cancers. Among them are proto-oncogenes encoding
growth factor receptors, such as ras protein, and kinase enzymes,
such as src, that aid ras function. Mutations that disrupt tumor-
suppressor proteins, such as Rb and p53, also foster cancer
development.
224 Part IV Reproduction and Heredity
Chapter 11
Summary Questions Media Resources
11.1 Bacteria divide far more simply than do eukaryotes.
? Bacterial cells divide by simple binary fission.
? The two replicated circular DNA molecules attach to
the plasma membrane at different points, and fission
is initiated between those points.
1.How is the genome
replicated prior to binary fission
in a bacterial cell?
? Eukaryotic DNA forms a complex with histones and
other proteins and is packaged into chromosomes.
? In eukaryotic cells, DNA replication is completed
during the S phase of the cell cycle, and during the
G
2
phase the cell makes its final preparation for
mitosis.
? Along with G
1
, these two phases constitute the
portion of the cell cycle called interphase, which
alternates with mitosis and cytokinesis.
2.What are nucleosomes
composed of, and how do they
participate in the coiling of
DNA?
3.What are the differences
between heterochromatin and
euchromatin?
4.What is a karyotype? How
are chromosomes distinguished
from one another in a
karyotype?
11.2 Chromosomes are highly ordered structures.
? The first stage of mitosis is prophase, during which
the mitotic spindle apparatus forms.
? In the second stage of mitosis, metaphase, the
chromosomes are arranged in a circle around the
periphery of the cell.
? At the beginning of the third stage of mitosis,
anaphase, the centromeres joining each pair of sister
chromatids separate, freeing the sister chromatids
from each other.
? After the chromatids physically separate, they are
pulled to opposite poles of the cell by the
microtubules attached to their centromeres.
? In the fourth and final stage of mitosis, telophase, the
mitotic apparatus is disassembled, the nuclear
envelope re-forms, and the chromosomes uncoil.
? When mitosis is complete, the cell divides in two, so
that the two sets of chromosomes separated by
mitosis end up in different daughter cells.
5.Which phases of the cell
cycle is generally the longest in
the cells of a mature eukaryote?
6.What happens to the
chromosomes during S phase?
7.What changes with respect
to ribosomal RNA occur during
prophase?
8.What event signals the
initiation of metaphase?
9.What molecular mechanism
seems to be responsible for the
movement of the poles during
anaphase?
10.Describe three events that
occur during telophase.
11.How is cytokinesis in animal
cells different from that in plant
cells?
11.3 Mitosis is a key phase of the cell cycle.
? The cell cycle is regulated by two types of proteins,
cyclins and cyclin-dependent protein kinases, which
permit progress past key “checkpoints” in the cell
cycle only if the cell is ready to proceed further.
? Failures of cell cycle regulation can lead to
uncontrolled cell growth and lie at the root of cancer.
12.What aspects of the cell
cycle are controlled by the G
1
,
G
2
, and M checkpoints? How
are cyclins and cyclin-dependent
protein kinases involved in cell
cycle regulation at checkpoints?
11.4 The cell cycle is carefully controlled.
http://www.mhhe.com/raven6e http://www.biocourse.com
? Cell Division
Introduction
? Prokaryotes
? Scientists on Science:
Ribozymes
? Art Activity: Mitosis
Overview
? Art Activity: Plant
Cell Mitosis
? Mitosis
? Mitosis
? Student Research:
Nuclear Division in
Drosophila
? Chromosomes
? Exploration:
Regulating the cell
cycle
225
12
Sexual Reproduction
and Meiosis
Concept Outline
12.1 Meiosis produces haploid cells from diploid cells.
Discovery of Reduction Division. Sexual reproduction
does not increase chromosome number because gamete
production by meiosis involves a decrease in chromosome
number. Individuals produced from sexual reproduction
inherit chromosomes from two parents.
12.2 Meiosis has three unique features.
Unique Features of Meiosis. Three unique features of
meiosis are synapsis, homologous recombination, and
reduction division.
12.3 The sequence of events during meiosis involves
two nuclear divisions.
Prophase I. Homologous chromosomes pair intimately,
and undergo crossing over that locks them together.
Metaphase I. Spindle microtubules align the
chromosomes in the central plane of the cell.
Completing Meiosis. The second meiotic division is like
a mitotic division, but has a very different outcome.
12.4 The evolutionary origin of sex is a puzzle.
Why Sex? Sex may have evolved as a mechanism to repair
DNA, or perhaps as a means for contagious elements to
spread. Sexual reproduction increases genetic variability by
shuffling combinations of genes.
M
ost animals and plants reproduce sexually. Gametes
of opposite sex unite to form a cell that, dividing re-
peatedly by mitosis, eventually gives rise to an adult body
with some 100 trillion cells. The gametes that give rise to
the initial cell are the products of a special form of cell divi-
sion called meiosis (figure 12.1), the subject of this chapter.
Far more intricate than mitosis, the details of meiosis are
not as well understood. The basic process, however, is
clear. Also clear are the profound consequences of sexual
reproduction: it plays a key role in generating the tremen-
dous genetic diversity that is the raw material of evolution.
FIGURE 12.1
Plant cells undergoing meiosis (600×). This preparation of
pollen cells of a spiderwort, Tradescantia, was made by freezing
the cells and then fracturing them. It shows several stages of
meiosis.
number of chromosomes in each cell would become impos-
sibly large. For example, in just 10 generations, the 46
chromosomes present in human cells would increase to
over 47,000 (46 × 2
10
).
The number of chromosomes does not explode in this
way because of a special reduction division that occurs
during gamete formation, producing cells with half the
normal number of chromosomes. The subsequent fusion
of two of these cells ensures a consistent chromosome
number from one generation to the next. This reduction
division process, known as meiosis, is the subject of this
chapter.
The Sexual Life Cycle
Meiosis and fertilization together constitute a cycle of re-
production. Two sets of chromosomes are present in the
somatic cells of adult individuals, making them diploid
cells (Greek diploos, “double” + eidos, “form”), but only one
set is present in the gametes, which are thus haploid
(Greek haploos, “single” + ploion, “vessel”). Reproduction
that involves this alternation of meiosis and fertilization is
called sexual reproduction. Its outstanding characteristic
is that offspring inherit chromosomes from two parents
(figure 12.2). You, for example, inherited 23 chromosomes
from your mother, contributed by the egg fertilized at your
conception, and 23 from your father, contributed by the
sperm that fertilized that egg.
226 Part IV Reproduction and Heredity
Discovery of Reduction Division
Only a few years after Walther Fleming’s discovery of
chromosomes in 1882, Belgian cytologist Pierre-Joseph van
Beneden was surprised to find different numbers of chro-
mosomes in different types of cells in the roundworm As-
caris. Specifically, he observed that the gametes (eggs and
sperm) each contained two chromosomes, while the so-
matic (nonreproductive) cells of embryos and mature indi-
viduals each contained four.
Fertilization
From his observations, van Beneden proposed in 1887 that
an egg and a sperm, each containing half the complement
of chromosomes found in other cells, fuse to produce a sin-
gle cell called a zygote. The zygote, like all of the somatic
cells ultimately derived from it, contains two copies of each
chromosome. The fusion of gametes to form a new cell is
called fertilization, or syngamy.
Reduction Division
It was clear even to early investigators that gamete forma-
tion must involve some mechanism that reduces the num-
ber of chromosomes to half the number found in other
cells. If it did not, the chromosome number would double
with each fertilization, and after only a few generations, the
12.1 Meiosis produces haploid cells from diploid cells.
Haploid egg
Diploid zygote
Haploid sperm
FIGURE 12.2
Diploid cells carry chromosomes from two
parents. A diploid cell contains two versions of
each chromosome, one contributed by the haploid
egg of the mother, the other by the haploid sperm
of the father.
Somatic Tissues. The life cycles of all sexually reproduc-
ing organisms follow the same basic pattern of alternation
between the diploid and haploid chromosome numbers
(figures 12.3 and 12.4). After fertilization, the resulting zy-
gote begins to divide by mitosis. This single diploid cell
eventually gives rise to all of the cells in the adult. These
cells are called somatic cells, from the Latin word for
“body.” Except when rare accidents occur, or in special
variation-creating situations such as occur in the immune
system, every one of the adult’s somatic cells is genetically
identical to the zygote.
In unicellular eukaryotic organisms, including most pro-
tists, individual cells function as gametes, fusing with other
gamete cells. The zygote may undergo mitosis, or it may
divide immediately by meiosis to give rise to haploid indi-
viduals. In plants, the haploid cells that meiosis produces
divide by mitosis, forming a multicellular haploid phase.
Certain cells of this haploid phase eventually differentiate
into eggs or sperm.
Germ-Line Tissues. In animals, the cells that will eventu-
ally undergo meiosis to produce gametes are set aside from
somatic cells early in the course of development. These cells
are often referred to as germ-line cells. Both the somatic
cells and the gamete-producing germ-line cells are diploid,
but while somatic cells undergo mitosis to form genetically
identical, diploid daughter cells, gamete-producing germ-
line cells undergo meiosis, producing haploid gametes.
Meiosis is a process of cell division in which the number
of chromosomes in certain cells is halved during gamete
formation. In the sexual life cycle, there is an
alternation of diploid and haploid generations.
Chapter 12 Sexual Reproduction and Meiosis 227
Haploid (n)
Gametes
Sperm (n) Egg (n)
Diploid (2n)
Diploid (2n)
multicellular organism
Diploid (2n)
zygote
Diploid (2n)
germ-line cells
Meiosis
Mitosis
Gamete
formation
Germ cell
formation
Mitosis
Haploid
(n) cells
Haploid (n)
multicellular organism
Fertilization
FIGURE 12.3
Alternation of generations. In sexual reproduction,
haploid cells or organisms alternate with diploid
cells or organisms.
Male
(diploid)
2n
Meiosis
Grows into
adult male or
adult female
Sperm
(haploid) n
Diploid (2n)
Zygote
(diploid) 2n
Fertilization
Female
(diploid)
2n
Meiosis
Haploid (n)
Egg
(haploid) n
FIGURE 12.4
The sexual life cycle. In animals, the completion of meiosis is
followed soon by fertilization. Thus, the vast majority of the life
cycle is spent in the diploid stage.
Unique Features of Meiosis
The mechanism of cell division varies in important details
in different organisms. This is particularly true of chromo-
somal separation mechanisms, which differ substantially in
protists and fungi from the process in plants and animals
that we will describe here. Meiosis in a diploid organism
consists of two rounds of division, mitosis of one. Although
meiosis and mitosis have much in common, meiosis has
three unique features: synapsis, homologous recombina-
tion, and reduction division.
Synapsis
The first unique feature of meiosis happens early during
the first nuclear division. Following chromosome replica-
tion, homologous chromosomes, or homologues (see chapter 11),
pair all along their length. The process of forming these
complexes of homologous chromosomes is called synapsis
Homologous Recombination
The second unique feature of meiosis is that genetic ex-
change occurs between the homologous chromosomes while they
are thus physically joined (figure 12.5a). The exchange
process that occurs between paired chromosomes is called
crossing over. Chromosomes are then drawn together
along the equatorial plane of the dividing cell; subse-
quently, homologues are pulled by microtubules toward
opposite poles of the cell. When this process is complete,
the cluster of chromosomes at each pole contains one of
the two homologues of each chromosome. Each pole is
haploid, containing half the number of chromosomes pres-
ent in the original diploid cell. Sister chromatids do not
separate from each other in the first nuclear division, so
each homologue is still composed of two chromatids.
Reduction Division
The third unique feature of meiosis is that the chromosomes
do not replicate between the two nuclear divisions, so that at the
end of meiosis, each cell contains only half the original
complement of chromosomes (figure 12.5b). In most re-
spects, the second meiotic division is identical to a normal
mitotic division. However, because of the crossing over
that occurred during the first division, the sister chromatids
in meiosis II are not identical to each other.
Meiosis is a continuous process, but it is most easily stud-
ied when we divide it into arbitrary stages. The stages of
meiosis are traditionally called meiosis I and meiosis II. Like
mitosis, each stage is subdivided further into prophase,
metaphase, anaphase, and telophase (figure 12.6). In meio-
sis, however, prophase I is more complex than in mitosis.
In meiosis, homologous chromosomes become
intimately associated and do not replicate between the
two nuclear divisions.
228 Part IV Reproduction and Heredity
12.2 Meiosis has three unique features.
SYNAPSIS
Homologue Homologue
Region of close
association, where
crossing over
occurs
(a)
Centromere
Sister
chromatids
REDUCTION
DIVISION
Diploid
germ-line
cell
Haploid gametes
Chromosome
duplication
Meiosis I
Meiosis II
(b)
FIGURE 12.5
Unique features of meiosis. (a) Synapsis draws homologous
chromosomes together, creating a situation where the two
chromosomes can physically exchange parts, a process called
crossing over. (b) Reduction division, by omitting a chromosome
duplication before meiosis II, produces haploid gametes, thus
ensuring that chromosome number remains stable during the
reproduction cycle.
Chapter 12 Sexual Reproduction and Meiosis 229
Cell division
Cell
division
Cell
division
Synapsis and
crossing over
Pairing of
homologous chromosomes
Chromosome
replication
Chromosome
replication
Paternal homologue
Maternal homologue
MEIOSIS MITOSIS
ME
I
O
SIS
I
MEI
O
SI
S
I
I
FIGURE 12.6
A comparison of meiosis and mitosis. Meiosis involves two nuclear divisions with no DNA replication between them. It thus produces
four daughter cells, each with half the original number of chromosomes. Crossing over occurs in prophase I of meiosis. Mitosis involves a
single nuclear division after DNA replication. It thus produces two daughter cells, each containing the original number of chromosomes.
Prophase I
In prophase I of meiosis, the DNA coils tighter, and indi-
vidual chromosomes first become visible under the light
microscope as a matrix of fine threads. Because the DNA
has already replicated before the onset of meiosis, each of
these threads actually consists of two sister chromatids
joined at their centromeres. In prophase I, homologous
chromosomes become closely associated in synapsis, ex-
change segments by crossing over, and then separate.
An Overview
Prophase I is traditionally divided into five sequential
stages: leptotene, zygotene, pachytene, diplotene, and dia-
kinesis.
Leptotene. Chromosomes condense tightly.
Zygotene. A lattice of protein is laid down between
the homologous chromosomes in the process of synap-
sis, forming a structure called a synaptonemal complex
(figure 12.7).
Pachytene. Pachytene begins when synapsis is com-
plete (just after the synaptonemal complex forms; figure
12.8), and lasts for days. This complex, about 100 nm
across, holds the two replicated chromosomes in precise
register, keeping each gene directly across from its part-
ner on the homologous chromosome, like the teeth of a
zipper. Within the synaptonemal complex, the DNA du-
plexes unwind at certain sites, and single strands of
DNA form base-pairs with complementary strands on
the other homologue. The synaptonemal complex thus
provides the structural framework that enables crossing
over between the homologous chromosomes. As you
230 Part IV Reproduction and Heredity
12.3 The sequence of events during meiosis involves two nuclear divisions.
Chromosome
homologues
Synaptonemal
complex
FIGURE 12.7
Structure of the synaptonemal complex. A portion of the
synaptonemal complex of the ascomycete Neotiella rutilans, a cup
fungus.
Interphase Leptotene Zygotene Pachytene Diplotene followed by diakinesis
Chromatid 1
Chromatid 2
Chromatid 3
Chromatid 4
Disassembly
of the
synaptonemal
complex
Formation
of the
synaptonemal
complex
Chromatid 1
Chromatid 2
Chromatid 3
Chromatid 4
Paternal
sister
chromatids
Maternal
sister
chromatids
Time
Crossing over can occur
between homologous
chromosomes
FIGURE 12.8
Time course of prophase I. The five stages of prophase I represent stages in the formation and subsequent disassembly of the
synaptonemal complex, the protein lattice that holds homologous chromosomes together during synapsis.
will see, this has a key impact on
how the homologues separate later
in meiosis.
Diplotene. At the beginning of
diplotene, the protein lattice of the
synaptonemal complex disassem-
bles. Diplotene is a period of in-
tense cell growth. During this pe-
riod the chromosomes decondense
and become very active in tran-
scription.
Diakinesis. At the beginning of
diakinesis, the transition into
metaphase, transcription ceases
and the chromosomes recondense.
Synapsis
During prophase, the ends of the
chromatids attach to the nuclear envelope at specific sites.
The sites the homologues attach to are adjacent, so that the
members of each homologous pair of chromosomes are
brought close together. They then line up side by side, ap-
parently guided by heterochromatin sequences, in the
process called synapsis.
Crossing Over
Within the synaptonemal complex, recombination is
thought to be carried out during pachytene by very large
protein assemblies called recombination nodules. A nod-
ule’s diameter is about 90 nm, spanning the central element
of the synaptonemal complex. Spaced along the synaptone-
mal complex, these recombination nodules act as large
multienzyme “recombination machines,” each nodule
bringing about a recombination event. The details of the
crossing over process are not well understood, but involve a
complex series of events in which DNA segments are ex-
changed between nonsister or sister chromatids. In hu-
mans, an average of two or three such crossover events
occur per chromosome pair.
When crossing over is complete, the synaptonemal com-
plex breaks down, and the homologous chromosomes are
released from the nuclear envelope and begin to move away
from each other. At this point, there are four chromatids
for each type of chromosome (two homologous chromo-
somes, each of which consists of two sister chromatids).
The four chromatids do not separate completely, however,
because they are held together in two ways: (1) the two sis-
ter chromatids of each homologue, recently created by
DNA replication, are held near by their common cen-
tromeres; and (2) the paired homologues are held together
at the points where crossing over occurred within the
synaptonemal complex.
Chiasma Formation
Evidence of crossing over can often be seen under the light
microscope as an X-shaped structure known as a chiasma
(Greek, “cross”; plural, chiasmata; figure 12.9). The pres-
ence of a chiasma indicates that two chromatids (one from
each homologue) have exchanged parts (figure 12.10). Like
small rings moving down two strands of rope, the chias-
mata move to the end of the chromosome arm as the ho-
mologous chromosomes separate.
Synapsis is the close pairing of homologous
chromosomes that takes place early in prophase I of
meiosis. Crossing over occurs between the paired DNA
strands, creating the chromosomal configurations
known as chiasmata. The two homologues are locked
together by these exchanges and they do not disengage
readily.
Chapter 12 Sexual Reproduction and Meiosis 231
FIGURE 12.9
Chiasmata. This micrograph shows two distinct crossovers, or chiasmata.
FIGURE 12.10
The results of crossing over. During crossing over, nonsister
(shown above) or sister chromatids may exchange segments.
Metaphase I
By metaphase I, the second stage of meiosis I, the nuclear
envelope has dispersed and the microtubules form a spin-
dle, just as in mitosis. During diakinesis of prophase I,
the chiasmata move down the paired chromosomes from
their original points of crossing over, eventually reaching
the ends of the chromosomes. At this point, they are
called terminal chiasmata. Terminal chiasmata hold the
homologous chromosomes together in metaphase I, so
that only one side of each centromere faces outward from
the complex; the other side is turned inward toward the
other homologue (figure 12.11). Consequently, spindle
microtubules are able to attach to kinetochore proteins
only on the outside of each centromere, and the cen-
tromeres of the two homologues attach to microtubules
originating from opposite poles. This one-sided attach-
ment is in marked contrast to the attachment in mitosis,
when kinetochores on both sides of a centromere bind to
microtubules.
Each joined pair of homologues then lines up on the
metaphase plate. The orientation of each pair on the spin-
dle axis is random: either the maternal or the paternal ho-
mologue may orient toward a given pole (figure 12.12).
Figure 12.13 illustrates the alignment of chromosomes dur-
ing metaphase I.
Chiasmata play an important role in aligning the
chromosomes on the metaphase plate.
232 Part IV Reproduction and Heredity
Metaphase I
Anaphase I
Meiosis I
Chiasmata
Mitosis
Metaphase
Anaphase
Kinetochores of sister
chromatids remain
separate; microtubules
attach to both
kinetochores on
opposite sides of the
centromere.
Microtubules pull sister
chromatids apart.
Chiasmata hold
homologues together.
The kinetochores of
sister chromatids fuse
and function as one.
Microtubules can
attach to only one side
of each centromere.
Microtubules pull the
homologous chromosomes
apart, but sister
chromatids are
held together.
FIGURE 12.11
Chiasmata created by crossing over have a key impact on how chromosomes align in metaphase I. In the first meiotic division, the
chiasmata hold one sister chromatid to the other sister chromatid; consequently, the spindle microtubules can bind to only one side of each
centromere, and the homologous chromosomes are drawn to opposite poles. In mitosis, microtubules attach to both sides of each
centromere; when the microtubules shorten, the sister chromatids are split and drawn to opposite poles.
FIGURE 12.12
Random orientation of chromosomes on the metaphase
plate. The number of possible chromosome orientations equals
2 raised to the power of the number of chromosome pairs. In this
hypothetical cell with three chromosome pairs, eight (2
3
)
possible orientations exist, four of them illustrated here. Each
orientation produces gametes with different combinations of
parental chromosomes.
Chapter 12 Sexual Reproduction and Meiosis 233
Prophase II
Metaphase IIAnaphase II
Interphase
Prophase I
Meiosis I
Meiosis II
Metaphase I
Anaphase I
Telophase I
Telophase II
FIGURE 12.13
The stages of meiosis in a
lily. Note the arrangement
of chromosomes in
metaphase I.
Completing Meiosis
After the long duration of prophase and metaphase, which
together make up 90% or more of the time meiosis I takes,
meiosis I rapidly concludes. Anaphase I and telophase I
proceed quickly, followed—without an intervening period
of DNA synthesis—by the second meiotic division.
Anaphase I
In anaphase I, the microtubules of the spindle fibers
begin to shorten. As they shorten, they break the chias-
mata and pull the centromeres toward the poles, drag-
ging the chromosomes along with them. Because the mi-
crotubules are attached to kinetochores on only one side
of each centromere, the individual centromeres are not
pulled apart to form two daughter centromeres, as they
are in mitosis. Instead, the entire centromere moves to
one pole, taking both sister chromatids with it. When the
spindle fibers have fully contracted, each pole has a com-
plete haploid set of chromosomes consisting of one mem-
ber of each homologous pair. Because of the random ori-
entation of homologous chromosomes on the metaphase
plate, a pole may receive either the maternal or the pater-
nal homologue from each chromosome pair. As a result,
the genes on different chromosomes assort indepen-
dently; that is, meiosis I results in the independent as-
sortment of maternal and paternal chromosomes into
the gametes.
Telophase I
By the beginning of telophase I, the chromosomes have
segregated into two clusters, one at each pole of the cell.
Now the nuclear membrane re-forms around each daugh-
ter nucleus. Because each chromosome within a daughter
nucleus replicated before meiosis I began, each now con-
tains two sister chromatids attached by a common cen-
tromere. Importantly, the sister chromatids are no longer iden-
tical, because of the crossing over that occurred in prophase
I (figure 12.14). Cytokinesis may or may not occur after
telophase I. The second meiotic division, meiosis II, occurs
after an interval of variable length.
The Second Meiotic Division
After a typically brief interphase, in which no DNA synthe-
sis occurs, the second meiotic division begins.
Meiosis II resembles a normal mitotic division. Prophase
II, metaphase II, anaphase II, and telophase II follow in
quick succession.
Prophase II. At the two poles of the cell the clusters
of chromosomes enter a brief prophase II, each nuclear
envelope breaking down as a new spindle forms.
Metaphase II. In metaphase II, spindle fibers bind to
both sides of the centromeres.
Anaphase II. The spindle fibers contract, splitting the
centromeres and moving the sister chromatids to oppo-
site poles.
Telophase II. Finally, the nuclear envelope re-forms
around the four sets of daughter chromosomes.
The final result of this division is four cells containing
haploid sets of chromosomes (figure 12.15). No two are
alike, because of the crossing over in prophase I. Nuclear
envelopes then form around each haploid set of chromo-
somes. The cells that contain these haploid nuclei may de-
velop directly into gametes, as they do in animals. Alterna-
tively, they may themselves divide mitotically, as they do in
plants, fungi, and many protists, eventually producing
greater numbers of gametes or, as in the case of some
plants and insects, adult individuals of varying ploidy.
During meiosis I, homologous chromosomes move
toward opposite poles in anaphase I, and individual
chromosomes cluster at the two poles in telophase I. At
the end of meiosis II, each of the four haploid cells
contains one copy of every chromosome in the set,
rather than two. Because of crossing over, no two cells
are the same. These haploid cells may develop directly
into gametes, as in animals, or they may divide by
mitosis, as in plants, fungi, and many protists.
234 Part IV Reproduction and Heredity
FIGURE 12.14
After meiosis I, sister chromatids are not identical. So-called
“harlequin” chromosomes, each containing one fluorescent DNA
strand, illustrate the reciprocal exchange of genetic material
during meiosis I between sister chromatids.
Chapter 12 Sexual Reproduction and Meiosis 235
MEIOSIS
Germ-line cell
Haploid gametes
PROPHASE
I
II
TELOPHASE
I II
ANAPHASE
II
I
II I
METAPHASE
FIGURE 12.15
How meiosis works. Meiosis consists of two rounds of cell division and produces four haploid cells.
Why Sex?
Not all reproduction is sexual. In asexual reproduction,
an individual inherits all of its chromosomes from a sin-
gle parent and is, therefore, genetically identical to its
parent. Bacterial cells reproduce asexually, undergoing
binary fission to produce two daughter cells containing
the same genetic information. Most protists reproduce
asexually except under conditions of stress; then they
switch to sexual reproduction. Among plants, asexual re-
production is common, and many other multicellular or-
ganisms are also capable of reproducing asexually. In ani-
mals, asexual reproduction often involves the budding off
of a localized mass of cells, which grows by mitosis to
form a new individual.
Even when meiosis and the production of gametes
occur, there may still be reproduction without sex. The
development of an adult from an unfertilized egg, called
parthenogenesis, is a common form of reproduction in
arthropods. Among bees, for example, fertilized eggs de-
velop into diploid females, but unfertilized eggs develop
into haploid males. Parthenogenesis even occurs among
the vertebrates. Some lizards, fishes, and amphibians are
capable of reproducing in this way; their unfertilized eggs
undergo a mitotic nuclear division without cell cleavage
to produce a diploid cell, which then develops into an
adult.
Recombination Can Be Destructive
If reproduction can occur without sex, why does sex occur
at all? This question has generated considerable discussion,
particularly among evolutionary biologists. Sex is of great
evolutionary advantage for populations or species, which
benefit from the variability generated in meiosis by random
orientation of chromosomes and by crossing over. How-
ever, evolution occurs because of changes at the level of in-
dividual survival and reproduction, rather than at the popu-
lation level, and no obvious advantage accrues to the
progeny of an individual that engages in sexual reproduc-
tion. In fact, recombination is a destructive as well as a con-
structive process in evolution. The segregation of chromo-
somes during meiosis tends to disrupt advantageous
combinations of genes more often than it creates new, bet-
ter adapted combinations; as a result, some of the diverse
progeny produced by sexual reproduction will not be as
well adapted as their parents were. In fact, the more com-
plex the adaptation of an individual organism, the less likely
that recombination will improve it, and the more likely that
recombination will disrupt it. It is, therefore, a puzzle to
know what a well-adapted individual gains from participat-
ing in sexual reproduction, as all of its progeny could main-
tain its successful gene combinations if that individual sim-
ply reproduced asexually.
The Origin and Maintenance of Sex
There is no consensus among evolutionary biologists re-
garding the evolutionary origin or maintenance of sex.
Conflicting hypotheses abound. Alternative hypotheses
seem to be correct to varying degrees in different
organisms.
The DNA Repair Hypothesis. If recombination is often
detrimental to an individual’s progeny, then what benefit
promoted the evolution of sexual reproduction? Although
the answer to this question is unknown, we can gain some
insight by examining the protists. Meiotic recombination is
often absent among the protists, which typically undergo
sexual reproduction only occasionally. Often the fusion of
two haploid cells occurs only under stress, creating a
diploid zygote.
Why do some protists form a diploid cell in response
to stress? Several geneticists have suggested that this oc-
curs because only a diploid cell can effectively repair cer-
tain kinds of chromosome damage, particularly double-
strand breaks in DNA. Both radiation and chemical
events within cells can induce such breaks. As organisms
became larger and longer-lived, it must have become in-
creasingly important for them to be able to repair such
damage. The synaptonemal complex, which in early stages
of meiosis precisely aligns pairs of homologous chromo-
somes, may well have evolved originally as a mechanism
for repairing double-strand damage to DNA, using the
undamaged homologous chromosome as a template to re-
pair the damaged chromosome. A transient diploid phase
would have provided an opportunity for such repair. In
yeast, mutations that inactivate the repair system for dou-
ble-strand breaks of the chromosomes also prevent cross-
ing over, suggesting a common mechanism for both
synapsis and repair processes.
The Contagion Hypothesis. An unusual and interesting
alternative hypothesis for the origin of sex is that it arose as
a secondary consequence of the infection of eukaryotes by
mobile genetic elements. Suppose a replicating transpos-
able element were to infect a eukaryotic lineage. If it pos-
sessed genes promoting fusion with uninfected cells and
synapsis, the transposable element could readily copy itself
onto homologous chromosomes. It would rapidly spread by
infection through the population, until all members con-
tained it. The bizarre mating type “alleles” found in many
fungi are very nicely explained by this hypothesis. Each of
several mating types is in fact not an allele but an “id-
iomorph.” Idiomorphs are genes occupying homologous
positions on the chromosome but having such dissimilar
sequences that they cannot be of homologous origin. These
idiomorph genes may simply be the relics of several ancient
infections by transposable elements.
236 Part IV Reproduction and Heredity
12.3 The evolutionary origin of sex is a puzzle.
The Red Queen Hypothesis. One evolutionary ad-
vantage of sex may be that it allows populations to
“store” recessive alleles that are currently bad but have
promise for reuse at some time in the future. Because
populations are constrained by a changing physical and
biological environment, selection is constantly acting
against such alleles, but in sexual species can never get rid
of those sheltered in heterozygotes. The evolution of
most sexual species, most of the time, thus manages to
keep pace with ever-changing physical and biological
constraints. This “treadmill evolution” is sometimes
called the “Red Queen hypothesis,” after the Queen of
Hearts in Lewis Carroll’s Through the Looking Glass, who
tells Alice, “Now, here, you see, it takes all the running
you can do, to keep in the same place.”
Miller’s Ratchet. The geneticist Herman Miller pointed
out in 1965 that asexual populations incorporate a kind of
mutational ratchet mechanism—once harmful mutations
arise, asexual populations have no way of eliminating them,
and they accumulate over time, like turning a ratchet. Sex-
ual populations, on the other hand, can employ recombina-
tion to generate individuals carrying fewer mutations,
which selection can then favor. Sex may just be a way to
keep the mutational load down.
The Evolutionary Consequences of Sex
While our knowledge of how sex evolved is sketchy, it is
abundantly clear that sexual reproduction has an enormous
impact on how species evolve today, because of its ability to
rapidly generate new genetic combinations. Independent
assortment (figure 12.16), crossing over, and random fertil-
ization each help generate genetic diversity.
Whatever the forces that led to sexual reproduction, its
evolutionary consequences have been profound. No genetic
process generates diversity more quickly; and, as you will
see in later chapters, genetic diversity is the raw material of
evolution, the fuel that drives it and determines its poten-
tial directions. In many cases, the pace of evolution appears
to increase as the level of genetic diversity increases. Pro-
grams for selecting larger stature in domesticated animals
such as cattle and sheep, for example, proceed rapidly at
first, but then slow as the existing genetic combinations are
exhausted; further progress must then await the generation
of new gene combinations. Racehorse breeding provides a
graphic example: thoroughbred racehorses are all descen-
dants of a small initial number of individuals, and selection
for speed has accomplished all it can with this limited
amount of genetic variability—the winning times in major
races ceased to improve decades ago.
Paradoxically, the evolutionary process is thus both
revolutionary and conservative. It is revolutionary in that
the pace of evolutionary change is quickened by genetic
recombination, much of which results from sexual repro-
duction. It is conservative in that evolutionary change is
not always favored by selection, which may instead pre-
serve existing combinations of genes. These conservative
pressures appear to be greatest in some asexually repro-
ducing organisms that do not move around freely and
that live in especially demanding habitats. In vertebrates,
on the other hand, the evolutionary premium appears to
have been on versatility, and sexual reproduction is the
predominant mode of reproduction by an overwhelming
margin.
The close association between homologous
chromosomes that occurs during meiosis may have
evolved as mechanisms to repair chromosomal damage,
although several alternative mechanisms have also been
proposed.
Chapter 12 Sexual Reproduction and Meiosis 237
Paternal gamete
Diploid offspring
Maternal gamete
Homologous pairs
Potential gametes
FIGURE 12.16
Independent assortment increases genetic variability. Independent assortment contributes new gene combinations to the next
generation because the orientation of chromosomes on the metaphase plate is random. In the cells shown above with three chromosome
pairs, eight different gametes can result, each with different combinations of parental chromosomes.
238 Part IV Reproduction and Heredity
Chapter 12
Summary Questions Media Resources
12.1 Meiosis produces haploid cells from diploid cells.
? Meiosis is a special form of nuclear division that
produces the gametes of the sexual cycle. It involves
two chromosome separations but only one
chromosome replication.
1. What are the cellular products
of meiosis called, and are they
haploid or diploid? What is the
cellular product of syngamy
called, and is it haploid or
diploid?
? The three unique features of meiosis are synapsis,
homologous recombination, and reduction division.
2. What three unique features
distinguish meiosis from mitosis?
12.2 Meiosis has three unique features.
? The crossing over that occurs between homologues
during synapsis is an essential element of meiosis.
? Because crossing over binds the homologues
together, only one side of each homologue is
accessible to the spindle fibers. Hence, the spindle
fibers separate the paired homologues rather than the
sister chromatids.
? At the end of meiosis I, one homologue of each
chromosome type is present at each of the two poles of
the dividing nucleus. The homologues still consist of
two chromatids, which may differ from each other as a
result of crossing over that occurred during synapsis.
? No further DNA replication occurs before the second
nuclear division, which is essentially a mitotic division
occurring at each of the two poles.
? The sister chromatids of each chromosome are
separated, resulting in the formation of four daughter
nuclei, each with half the number of chromosomes
that were present before meiosis.
? Cytokinesis typically but not always occurs at this
point. When it does, each daughter nucleus has one
copy of every chromosome.
3. What are synaptonemal
complexes? How do they
participate in crossing over? At
what stage during meiosis are
they formed?
4. How many chromatids are
present for each type of
chromosome at the completion
of crossing over? What two
structures hold the chromatids
together at this stage?
5. How is the attachment of
spindle microtubules to
centromeres in metaphase I of
meiosis different from that
which occurs in metaphase of
mitosis? What effect does this
difference have on the
movement of chromosomes
during anaphase I?
6. What mechanism is
responsible for the independent
assortment of chromosomes?
12.3 The sequence of events during meiosis involves two nuclear divisions.
? In asexual reproduction, mitosis produces offspring
genetically identical to the parent.
? Meiosis is thought to have evolved initially as a
mechanism to repair double-strand breaks in DNA,
in which the broken chromosome is paired with its
homologue while it is being repaired.
? The evolutionary significance of meiosis is that it
generates large amounts of recombination, rapidly
reshuffling gene combinations, producing variability
upon which evolutionary processes can act.
7. What is one of the current
scientific explanations for the
evolution of synapsis?
8. By what three mechanisms
does sexual reproduction
increase genetic variability? How
does this increase in genetic
variability affect the evolution of
species?
12.4 The evolutionary origin of sex is a puzzle.
http://www.mhhe.com/raven6e http://www.biocourse.com
? Art Activity: Meiosis I
? Meiosis
? Meiosis
? Evolution of Sex
? Review of Cell
Division
239
13
Patterns of Inheritance
Concept Outline
13.1 Mendel solved the mystery of heredity.
Early Ideas about Heredity: The Road to Mendel.
Before Mendel, the mechanism of inheritance was not known.
Mendel and the Garden Pea. Mendel experimented
with heredity in edible peas counted his results.
What Mendel Found. Mendel found that alternative
traits for a character segregated among second-generation
progeny in the ratio 3:1. Mendel proposed that information
for a trait rather than the trait itself is inherited.
How Mendel Interpreted His Results. Mendel found
that one alternative of a character could mask the other in
heterozygotes, but both could subsequently be expressed in
homozygotes of future generations.
Mendelian Inheritance Is Not Always Easy to Analyze.
A variety of factors can influence the Mendelian
segregation of alleles.
13.2 Human genetics follows Mendelian principles.
Most Gene Disorders Are Rare. Tay-Sachs disease is
due to a recessive allele.
Multiple Alleles: The ABO Blood Groups. The human
ABO blood groups are determined by three Igene alleles.
Patterns of Inheritance Can Be Deduced from
Pedigrees. Hemophilia is sex-linked.
Gene Disorders Can Be Due to Simple Alterations of
Proteins. Sickle cell anemia is caused by a single amino
acid change.
Some Defects May Soon Be Curable. Cystic fibrosis
may soon be cured by gene replacement therapy.
13.3 Genes are on chromosomes.
Chromosomes: The Vehicles of Mendelian
Inheritance. Mendelian segregation reflects the random
assortment of chromosomes in meiosis.
Genetic Recombination. Crossover frequency reflect
the physical distance between genes.
Human Chromosomes. Humans possess 23 pairs of
chromosomes, one of them determining the sex.
Human Abnormalities Due to Alterations in
Chromosome Number. Loss or addition of
chromosomes has serious consequences.
Genetic Counseling. Some gene defects can be detected
early in pregnancy.
E
very living creature is a product of the long evolu-
tionary history of life on earth. While all organisms
share this history, only humans wonder about the
processes that led to their origin. We are still far from
understanding everything about our origins, but we have
learned a great deal. Like a partially completed jigsaw
puzzle, the boundaries have fallen into place, and much
of the internal structure is becoming apparent. In this
chapter, we will discuss one piece of the puzzle—the
enigma of heredity. Why do groups of people from dif-
ferent parts of the world often differ in appearance (fig-
ure 13.1)? Why do the members of a family tend to re-
semble one another more than they resemble members of
other families?
FIGURE 13.1
Human beings are extremely diverse in appearance.The
differences between us are partly inherited and partly the result
of environmental factors we encounter in our lives.
240 Part IV Reproduction and Heredity
Early Ideas about Heredity:
The Road to Mendel
As far back as written records go, patterns of resemblance
among the members of particular families have been
noted and commented on (figure 13.2). Some familial
features are unusual, such as the protruding lower lip of
the European royal family Hapsburg, evident in pictures
and descriptions of family members from the thirteenth
century onward. Other characteristics, like the occur-
rence of redheaded children within families of redheaded
parents, are more common (figure 13.3). Inherited fea-
tures, the building blocks of evolution, will be our con-
cern in this chapter.
Classical Assumption 1: Constancy of Species
Two concepts provided the basis for most of the thinking
about heredity before the twentieth century. The first is
that heredity occurs within species. For a very long time peo-
ple believed that it was possible to obtain bizarre compos-
ite animals by breeding (crossing) widely different species.
The minotaur of Cretan mythology, a creature with the
body of a bull and the torso and head of a man, is one ex-
ample. The giraffe was thought to be another; its scien-
tific name, Giraffa camelopardalis, suggests the belief that it
was the result of a cross between a camel and a leopard.
From the Middle Ages onward, however, people discov-
ered that such extreme crosses were not possible and that
variation and heredity occur mainly within the boundaries
of a particular species. Species were thought to have been
maintained without significant change from the time of
their creation.
Classical Assumption 2: Direct Transmission
of Traits
The second early concept related to heredity is that traits
are transmitted directly. When variation is inherited by off-
spring from their parents, what is transmitted? The ancient
Greeks suggested that the parents’ body parts were trans-
mitted directly to their offspring. Hippocrates called this
type of reproductive material gonos, meaning “seed.”
Hence, a characteristic such as a misshapen limb was the
result of material that came from the misshapen limb of a
parent. Information from each part of the body was sup-
posedly passed along independently of the information
from the other parts, and the child was formed after the
hereditary material from all parts of the parents’ bodies had
come together.
This idea was predominant until fairly recently. For ex-
ample, in 1868, Charles Darwin proposed that all cells and
tissues excrete microscopic granules, or “gemmules,” that
13.1 Mendel solved the mystery of heredity.
FIGURE 13.2
Heredity is responsible for family resemblance.Family
resemblances are often strong—a visual manifestation of the
mechanism of heredity. This is the Johnson family, the wife and
daughters of one of the authors. While each daughter is different,
all clearly resemble their mother.
FIGURE 13.3
Red hair is inherited.Many different traits are inherited in
human families. This redhead is exhibiting one of these traits.
are passed to offspring, guiding the growth
of the corresponding part in the developing
embryo. Most similar theories of the direct
transmission of hereditary material assumed
that the male and female contributions
blend in the offspring. Thus, parents with
red and brown hair would produce children
with reddish brown hair, and tall and short
parents would produce children of interme-
diate height.
Koelreuter Demonstrates
Hybridization between Species
Taken together, however, these two con-
cepts lead to a paradox. If no variation en-
ters a species from outside, and if the varia-
tion within each species blends in every
generation, then all members of a species
should soon have the same appearance.
Obviously, this does not happen. Individu-
als within most species differ widely from
each other, and they differ in characteris-
tics that are transmitted from generation to
generation.
How could this paradox be resolved? Ac-
tually, the resolution had been provided
long before Darwin, in the work of the
German botanist Josef Koelreuter. In 1760,
Koelreuter carried out successful hy-
bridizations of plant species, crossing dif-
ferent strains of tobacco and obtaining fer-
tile offspring. The hybrids differed in appearance from
both parent strains. When individuals within the hybrid
generation were crossed, their offspring were highly vari-
able. Some of these offspring resembled plants of the hy-
brid generation (their parents), but a few resembled the
original strains (their grandparents).
The Classical Assumptions Fail
Koelreuter’s work represents the beginning of modern
genetics, the first clues pointing to the modern theory of
heredity. Koelreuter’s experiments provided an impor-
tant clue about how heredity works: the traits he was
studying could be masked in one generation, only to
reappear in the next. This pattern contradicts the theory
of direct transmission. How could a trait that is transmit-
ted directly disappear and then reappear? Nor were the
traits of Koelreuter’s plants blended. A contemporary ac-
count stated that the traits reappeared in the third gener-
ation “fully restored to all their original powers and
properties.”
It is worth repeating that the offspring in Koelreuter’s
crosses were not identical to one another. Some resembled
the hybrid generation, while others did not. The alternative
forms of the characters Koelreuter was
studying were distributed among the off-
spring. Referring to a heritable feature as a
character, a modern geneticist would say
the alternative forms of each character were
segregating among the progeny of a mat-
ing, meaning that some offspring exhibited
one alternative form of a character (for ex-
ample, hairy leaves), while other offspring
from the same mating exhibited a different
alternative (smooth leaves). This segrega-
tion of alternative forms of a character, or
traits, provided the clue that led Gregor
Mendel to his understanding of the nature
of heredity.
Knight Studies Heredity in Peas
Over the next hundred years, other inves-
tigators elaborated on Koelreuter’s work.
Prominent among them were English
gentleman farmers trying to improve vari-
eties of agricultural plants. In one such se-
ries of experiments, carried out in the
1790s, T. A. Knight crossed two true-
breeding varieties (varieties that remain
uniform from one generation to the next)
of the garden pea, Pisum sativum (fig-
ure13.4). One of these varieties had pur-
ple flowers, and the other had white flow-
ers. All of the progeny of the cross had
purple flowers. Among the offspring of
these hybrids, however, were some plants with purple
flowers and others, less common, with white flowers. Just
as in Koelreuter’s earlier studies, a trait from one of the
parents disappeared in one generation only to reappear
in the next.
In these deceptively simple results were the makings of a
scientific revolution. Nevertheless, another century passed
before the process of gene segregation was fully appreci-
ated. Why did it take so long? One reason was that early
workers did not quantify their results. A numerical record
of results proved to be crucial to understanding the process.
Knight and later experimenters who carried out other
crosses with pea plants noted that some traits had a
“stronger tendency” to appear than others, but they did not
record the numbers of the different classes of progeny. Sci-
ence was young then, and it was not obvious that the num-
bers were important.
Early geneticists demonstrated that some forms of an
inherited character (1) can disappear in one generation
only to reappear unchanged in future generations;
(2) segregate among the offspring of a cross; and
(3) are more likely to be represented than their
alternatives.
Chapter 13 Patterns of Inheritance 241
FIGURE 13.4
The garden pea, Pisum
sativum.Easy to cultivate and
able to produce many distinctive
varieties, the garden pea was a
popular experimental subject in
investigations of heredity as long
as a century before Gregor
Mendel’s experiments.
Mendel and the Garden Pea
The first quantitative studies of inheritance were carried
out by Gregor Mendel, an Austrian monk (figure 13.5).
Born in 1822 to peasant parents, Mendel was educated in a
monastery and went on to study science and mathematics
at the University of Vienna, where he failed his examina-
tions for a teaching certificate. He returned to the
monastery and spent the rest of his life there, eventually
becoming abbot. In the garden of the monastery (figure
13.6), Mendel initiated a series of experiments on plant hy-
bridization. The results of these experiments would ulti-
mately change our views of heredity irrevocably.
Why Mendel Chose the Garden Pea
For his experiments, Mendel chose the garden pea, the
same plant Knight and many others had studied earlier.
The choice was a good one for several reasons. First, many
earlier investigators had produced hybrid peas by crossing
different varieties. Mendel knew that he could expect to
observe segregation of traits among the offspring. Second,
a large number of true-breeding varieties of peas were
available. Mendel initially examined 32. Then, for further
study, he selected lines that differed with respect to seven
easily distinguishable traits, such as round versus wrinkled
seeds and purple versus white flowers, a character that
Knight had studied. Third, pea plants are small and easy to
grow, and they have a relatively short generation time.
Thus, one can conduct experiments involving numerous
plants, grow several generations in a single year, and obtain
results relatively quickly.
A fourth advantage of studying peas is that the sexual or-
gans of the pea are enclosed within the flower (figure 13.7).
The flowers of peas, like those of many flowering plants,
contain both male and female sex organs. Furthermore, the
gametes produced by the male and female parts of the same
flower, unlike those of many flowering plants, can fuse to
form viable offspring. Fertilization takes place automati-
cally within an individual flower if it is
not disturbed, resulting in offspring
that are the progeny from a single indi-
vidual. Therefore, one can either let
individual flowers engage in self-
fertilization, or remove the flower’s
male parts before fertilization and intro-
duce pollen from a strain with a different
trait, thus performing cross-pollination
which results in cross-fertilization.
242 Part IV Reproduction and Heredity
FIGURE 13.5
Gregor Johann Mendel.Cultivating his plants in the garden of a
monastery in Brunn, Austria (now Brno, Czech Republic), Mendel
studied how differences among varieties of peas were inherited
when the varieties were crossed. Similar experiments had been
done before, but Mendel was the first to quantify the results and
appreciate their significance.
FIGURE 13.6
The garden where Mendel carried out
his plant-breeding experiments.Gregor
Mendel did his key scientific experiments
in this small garden in a monastery.
Mendel’s Experimental Design
Mendel was careful to focus on only a few specific differ-
ences between the plants he was using and to ignore the
countless other differences he must have seen. He also had
the insight to realize that the differences he selected to ana-
lyze must be comparable. For example, he appreciated that
trying to study the inheritance of round seeds versus tall
height would be useless.
Mendel usually conducted his experiments in three
stages:
1. First, he allowed pea plants of a given variety to pro-
duce progeny by self-fertilization for several genera-
tions. Mendel thus was able to assure himself that
the traits he was studying were indeed constant,
transmitted unchanged from generation to genera-
tion. Pea plants with white flowers, for example,
when crossed with each other, produced only off-
spring with white flowers, regardless of the number
of generations.
2. Mendel then performed crosses between varieties
exhibiting alternative forms of characters. For ex-
ample, he removed the male parts from the flower
of a plant that produced white
flowers and fertilized it with
pollen from a purple-flowered
plant. He also carried out the
reciprocal cross, using pollen
from a white-flowered individual
to fertilize a flower on a pea plant
that produced purple flowers (fig-
ure13.8).
3. Finally, Mendel permitted the hy-
brid offspring produced by these
crosses to self-pollinate for several
generations. By doing so, he al-
lowed the alternative forms of a
character to segregate among the
progeny. This was the same exper-
imental design that Knight and
others had used much earlier. But
Mendel went an important step
farther: he counted the numbers of
offspring exhibiting each trait in
each succeeding generation. No
one had ever done that before.
The quantitative results Mendel
obtained proved to be of supreme
importance in revealing the
process of heredity.
Mendel’s experiments with the
garden pea involved crosses between
true-breeding varieties, followed by a
generation or more of inbreeding.
Chapter 13 Patterns of Inheritance 243
Petals
Anther H20040
Carpel H20038
FIGURE 13.7
Structure of the pea flower (longitudinal section).In a pea
plant flower, the petals enclose the male anther (containing
pollen grains, which give rise to haploid sperm) and the female
carpel (containing ovules, which give rise to haploid eggs). This
ensures that self-fertilization will take place unless the flower is
disturbed.
Pollen transferred from
white flower to stigma
of purple flower
Anthers
removed
All purple flowers result
FIGURE 13.8
How Mendel conducted his experiments.Mendel pushed aside the petals of a white
flower and collected pollen from the anthers. He then placed that pollen onto the stigma
(part of the carpel) of a purple flower whose anthers had been removed, causing cross-
fertilization to take place. All the seeds in the pod that resulted from this pollination
were hybrids of the white-flowered male parent and the purple-flowered female parent.
After planting these seeds, Mendel observed the pea plants they produced. All of the
progeny of this cross had purple flowers.
What Mendel Found
The seven characters Mendel studied in his experiments
possessed several variants that differed from one another in
ways that were easy to recognize and score (figure 13.9).
We will examine in detail Mendel’s crosses with flower
color. His experiments with other characters were similar,
and they produced similar results.
The F
1
Generation
When Mendel crossed two contrasting varieties of peas,
such as white-flowered and purple-flowered plants, the
hybrid offspring he obtained did not have flowers of in-
termediate color, as the theory of blending inheritance
would predict. Instead, in every case the flower color of
the offspring resembled one of their parents. It is custom-
ary to refer to these offspring as the first filial
(
filius is
244 Part IV Reproduction and Heredity
Character
Flower
color
Seed
color
Seed
shape
Pod
color
Pod
shape
Flower
position
Plant
height
Dominant vs. recessive trait F
2
generation
Dominant form Recessive form
Ratio
3.15:1
3.01:1
2.96:1
2.82:1
2.95:1
3.14:1
2.84:1
705 224
6022 2001
5474 1850
428 152
882 299
651 207
787 277
Purple White
Yellow Green
Round Wrinkled
Green Yellow
Inflated Constricted
Axial Terminal
Tall Dwarf
X
X
X
X
X
X
X
FIGURE 13.9
Mendel’s experimental results.This table illustrates the seven characters Mendel studied in his crosses of the garden pea and presents
the data he obtained from these crosses. Each pair of traits appeared in the F
2
generation in very close to a 3:1 ratio.
Latin for “son”), or F
1
, generation. Thus, in a cross of
white-flowered with purple-flowered plants, the F
1
off-
spring all had purple flowers, just as Knight and others
had reported earlier.
Mendel referred to the trait expressed in the F
1
plants as
dominant and to the alternative form that was not ex-
pressed in the F
1
plants as recessive. For each of the seven
pairs of contrasting traits that Mendel examined, one of the
pair proved to be dominant and the other recessive.
The F
2
Generation
After allowing individual F
1
plants to mature and self-
pollinate,Mendel collected and planted the seeds from
each plant to see what the offspring in the second filial, or
F
2
, generation would look like. He found, just as Knight
had earlier, that some F
2
plants exhibited white flowers, the
recessive trait. Hidden in the F
1
generation, the recessive
form reappeared among some F
2
individuals.
Believing the proportions of the F
2
types would pro-
vide some clue about the mechanism of heredity, Mendel
counted the numbers of each type among the F
2
progeny
(figure 13.10). In the cross between the purple-flowered
F
1
plants, he counted a total of 929 F
2
individuals (see
figure 13.9). Of these, 705 (75.9%) had purple flowers
and 224 (24.1%) had white flowers. Approximately
1
?4 of
the F
2
individuals exhibited the recessive form of the
character. Mendel obtained the same numerical result
with the other six characters he examined:
3
?4 of the F
2
in-
dividuals exhibited the dominant trait, and
1
?4 displayed
the recessive trait. In other words, the dominant:recessive
ratio among the F
2
plants was always close to 3:1. Mendel
carried out similar experiments with other traits, such as
wrinkled versus round seeds (figure 13.11), and obtained
the same result.
Chapter 13 Patterns of Inheritance 245
FIGURE 13.10
A page from Mendel’s notebook.
FIGURE 13.11
Seed shape: a Mendelian character.One of the differences Mendel
studied affected the shape of pea plant seeds. In some varieties, the
seeds were round, while in others, they were wrinkled.
A Disguised 1:2:1 Ratio
Mendel went on to examine how the
F
2
plants passed traits on to subse-
quent generations. He found that the
recessive
1
?4were always true-breeding.
In the cross of white-flowered with
purple-flowered plants, for example,
the white-flowered F
2
individuals reli-
ably produced white-flowered off-
spring when they were allowed to self-
fertilize. By contrast, only
1
?3 of the
dominant purple-flowered F
2
individ-
uals (
1
?4 of all F
2
offspring) proved
true-breeding, while
2
?3 were not. This
last class of plants produced dominant
and recessive individuals in the third
filial (F
3
) generation in a 3:1 ratio.
This result suggested that, for the en-
tire sample, the 3:1 ratio that Mendel
observed in the F
2
generation was re-
ally a disguised 1:2:1 ratio:
1
?4 pure-
breeding dominant individuals,
1
?2 not-
pure-breeding dominant individuals,
and
1
?4 pure-breeding recessive indi-
viduals (figure 13.12).
Mendel’s Model of Heredity
From his experiments, Mendel was
able to understand four things about
the nature of heredity. First, the
plants he crossed did not produce
progeny of intermediate appearance,
as a theory of blending inheritance
would have predicted. Instead, differ-
ent plants inherited each alternative
intact, as a discrete characteristic that
either was or was not visible in a par-
ticular generation. Second, Mendel
learned that for each pair of alterna-
tive forms of a character, one alterna-
tive was not expressed in the F
1
hy-
brids, although it reappeared in some
F
2
individuals. The trait that “disap-
peared” must therefore be latent
(present but not expressed) in the F
1
individuals. Third, the pairs of alter-
native traits examined segregated
among the progeny of a particular
cross, some individuals exhibiting one
trait, some the other. Fourth, these al-
ternative traits were expressed in the
F
2
generation in the ratio of
3
?4 domi-
nant to
1
?4 recessive. This characteris-
tic 3:1 segregation is often referred to
as the Mendelian ratio.
246 Part IV Reproduction and Heredity
P (parental)
generation
Cross-
fertilize
: :
F
1
generation
F
3
generation
Purple White
3 : 1
3 : 1
1
True-breeding
dominant
1
True-breeding
recessive
Self-fertilize
White
Purple
2
Not-true-breeding
dominant
Purple
F
2
generation
Purple
FIGURE 13.12
The F
2
generation is a disguised 1:2:1 ratio.By allowing the F
2
generation to self-
fertilize, Mendel found from the offspring (F
3
) that the ratio of F
2
plants was one true-
breeding dominant, two not-true-breeding dominant, and one true-breeding recessive.
To explain these results, Mendel proposed a simple
model. It has become one of the most famous models in the
history of science, containing simple assumptions and mak-
ing clear predictions. The model has five elements:
1. Parents do not transmit physiological traits directly to
their offspring. Rather, they transmit discrete infor-
mation about the traits, what Mendel called “factors.”
These factors later act in the offspring to produce the
trait. In modern terms, we would say that information
about the alternative forms of characters that an indi-
vidual expresses is encoded by the factors that it re-
ceives from its parents.
2. Each individual receives two factors that may code for
the same trait or for two alternative traits for a char-
acter. We now know that there are two factors for
each character present in each individual because
these factors are carried on chromosomes, and each
adult individual is diploid. When the individual forms
gametes (eggs or sperm), they contain only one of
each kind of chromosome (see chapter 12); the ga-
metes are haploid. Therefore, only one factor for each
character of the adult organism is contained in the
gamete. Which of the two factors ends up in a partic-
ular gamete is randomly determined.
3. Not all copies of a factor are identical. In modern
terms, the alternative forms of a factor, leading to al-
ternative forms of a character, are called alleles.
When two haploid gametes containing exactly the
same allele of a factor fuse during fertilization to form
a zygote, the offspring that develops from that zygote
is said to be homozygous; when the two haploid ga-
metes contain different alleles, the individual off-
spring is heterozygous.
In modern terminology, Mendel’s factors are called
genes. We now know that each gene is composed of a
particular DNA nucleotide sequence (see chapter 3).
The particular location of a gene on a chromosome is
referred to as the gene’s locus(plural, loci).
4. The two alleles, one contributed by the male gamete
and one by the female, do not influence each other in
any way. In the cells that develop within the new in-
dividual, these alleles remain discrete. They neither
blend with nor alter each other. (Mendel referred to
them as “uncontaminated.”) Thus, when the individ-
ual matures and produces its own gametes, the alleles
for each gene segregate randomly into these gametes,
as described in element 2.
5. The presence of a particular allele does not ensure
that the trait encoded by it will be expressed in an in-
dividual carrying that allele. In heterozygous individ-
uals, only one allele (the dominant one) is expressed,
while the other (recessive) allele is present but unex-
pressed. To distinguish between the presence of an
allele and its expression, modern geneticists refer to
the totality of alleles that an individual contains as the
individual’s genotype and to the physical appearance
of that individual as its phenotype.The phenotype of
an individual is the observable outward manifestation
of its genotype, the result of the functioning of the
enzymes and proteins encoded by the genes it carries.
In other words, the genotype is the blueprint, and the
phenotype is the visible outcome.
These five elements, taken together, constitute Mendel’s
model of the hereditary process. Many traits in humans
also exhibit dominant or recessive inheritance, similar to
the traits Mendel studied in peas (table 13.1).
When Mendel crossed two contrasting varieties, he
found all of the offspring in the first generation
exhibited one (dominant) trait, and none exhibited the
other (recessive) trait. In the following generation,
25% were pure-breeding for the dominant trait, 50%
were hybrid for the two traits and exhibited the
dominant trait, and 25% were pure-breeding for the
recessive trait.
Chapter 13 Patterns of Inheritance 247
Table 13.1 Some Dominant and Recessive Traits in Humans
Recessive Traits Phenotypes Dominant Traits Phenotypes
Albinism
Alkaptonuria
Red-green color
blindness
Cystic fibrosis
Duchenne muscular
dystrophy
Hemophilia
Sickle cell anemia
Lack of melanin pigmentation
Inability to metabolize
homogenistic acid
Inability to distinguish red or green
wavelengths of light
Abnormal gland secretion, leading to
liver degeneration and lung failure
Wasting away of muscles during
childhood
Inability to form blood clots
Defective hemoglobin that causes
red blood cells to curve and stick
together
Middigital hair
Brachydactyly
Huntington’s disease
Phenylthiocarbamide (PTC)
sensitivity
Camptodactyly
Hypercholesterolemia (the most
common human Mendelian
disorder—1 in 500)
Polydactyly
Presence of hair on middle
segment of fingers
Short fingers
Degeneration of nervous
system, starting in middle age
Ability to taste PTC as bitter
Inability to straighten the little
finger
Elevated levels of blood
cholesterol and risk of heart
attack
Extra fingers and toes
How Mendel Interpreted His
Results
Does Mendel’s model predict the results he actually ob-
tained? To test his model, Mendel first expressed it in
terms of a simple set of symbols, and then used the symbols
to interpret his results. It is very instructive to do the same.
Consider again Mendel’s cross of purple-flowered with
white-flowered plants. We will assign the symbol P to the
dominant allele, associated with the production of purple
flowers, and the symbol p to the recessive allele, associated
with the production of white flowers. By convention, ge-
netic traits are usually assigned a letter symbol referring to
their more common forms, in this case “P” for purple
flower color. The dominant allele is written in upper case,
as P; the recessive allele (white flower color) is assigned the
same symbol in lower case, p.
In this system, the genotype of an individual that is true-
breeding for the recessive white-flowered trait would be
designated pp. In such an individual, both copies of the al-
lele specify the white-flowered phenotype. Similarly, the
genotype of a true-breeding purple-flowered individual
would be designated PP, and a heterozygote would be des-
ignated Pp (dominant allele first). Using these conventions,
and denoting a cross between two strains with ×, we can
symbolize Mendel’s original cross as pp × PP.
The F
1
Generation
Using these simple symbols, we can now go back and re-
examine the crosses Mendel carried out. Because a white-
flowered parent (pp) can produce only p gametes, and a
pure purple-flowered (homozygous dominant) parent
(PP) can produce only P gametes, the union of an egg
and a sperm from these parents can produce only het-
erozygous Pp offspring in the F
1
generation. Because the
P allele is dominant, all of these F
1
individuals are ex-
pected to have purple flowers. The p allele is present in
these heterozygous individuals, but it is not phenotypi-
cally expressed. This is the basis for the latency Mendel
saw in recessive traits.
The F
2
Generation
When F
1
individuals are allowed to self-fertilize, the P
and p alleles segregate randomly during gamete forma-
tion. Their subsequent union at fertilization to form F
2
individuals is also random, not being influenced by which
alternative alleles the individual gametes carry. What will
the F
2
individuals look like? The possibilities may be visu-
alized in a simple diagram called a Punnett square,
named after its originator, the English geneticist Reginald
Crundall Punnett (figure 13.13). Mendel’s model, ana-
248 Part IV Reproduction and Heredity
P
Pp
p
P
Pp
ppp p
(a)
(b)
P
Pp
p
Pp
P
Pp
p
Pp
pp
Pp
Pp pp
PpP PP
Pp
p
Gametes
Gametes
FIGURE 13.13
A Punnett square.(a) To make a Punnett square, place the
different possible types of female gametes along one side of a
square and the different possible types of male gametes along the
other. (b) Each potential zygote can then be represented as the
intersection of a vertical line and a horizontal line.
lyzed in terms of a Punnett square, clearly predicts that
the F
2
generation should consist of
3
?4 purple-flowered
plants and
1
?4 white-flowered plants, a phenotypic ratio of
3:1 (figure 13.14).
The Laws of Probability Can
Predict Mendel’s Results
A different way to express Mendel’s result is to say that
there are three chances in four (
3
?4) that any particular F
2
individual will exhibit the dominant trait, and one chance
in four (
1
?4) that an F
2
individual will express the recessive
trait. Stating the results in terms of probabilities allows
simple predictions to be made about the outcomes of
crosses. If both F
1
parents are Pp (heterozygotes), the
probability that a particular F
2
individual will be pp (ho-
mozygous recessive) is the probability of receiving a p ga-
mete from the male (
1
?2) times the probability of receiving
a p gamete from the female (
1
?2), or
1
?4. This is the same
operation we perform in the Punnett square illustrated in
figure 13.13. The ways probability theory can be used to
analyze Mendel’s results is discussed in detail on
page251.
Further Generations
As you can see in figure 13.14, there are really three kinds
of F
2
individuals:
1
?4are pure-breeding, white-flowered indi-
viduals (pp);
1
?2 are heterozygous, purple-flowered individu-
als (Pp); and
1
?4 are pure-breeding, purple-flowered individ-
uals (PP). The 3:1 phenotypic ratio is really a disguised
1:2:1 genotypic ratio.
Mendel’s First Law of Heredity: Segregation
Mendel’s model thus accounts in a neat and satisfying way
for the segregation ratios he observed. Its central assump-
tion—that alternative alleles of a character segregate from
each other in heterozygous individuals and remain dis-
tinct—has since been verified in many other organisms. It
is commonly referred to as Mendel’s First Law of Hered-
ity, or the Law of Segregation. As you saw in chapter 12,
the segregational behavior of alternative alleles has a simple
physical basis, the alignment of chromosomes at random
on the metaphase plate during meiosis I. It is a tribute to
the intellect of Mendel’s analysis that he arrived at the cor-
rect scheme with no knowledge of the cellular mechanisms
of inheritance; neither chromosomes nor meiosis had yet
been described.
Chapter 13 Patterns of Inheritance 249
Purple
(Pp)
Purple
(PP )
Pp p p
P
P
P
p
F
1
generation
F
2
generation
White
(pp)
Purple
(Pp)
Pp
ppPp
PP
PpPp
Pp Pp
Gametes
Gametes
Gametes
Gametes
FIGURE 13.14
Mendel’s cross of pea plants differing in flower color.All of the offspring of the first cross (the F
1
generation) are Ppheterozygotes
with purple flowers. When two heterozygous F
1
individuals are crossed, three kinds of F
2
offspring are possible: PP homozygotes (purple
flowers); Ppheterozygotes (also purple flowers); and pphomozygotes (white flowers). Therefore, in the F
2
generation, the ratio of
dominant to recessive phenotypes is 3:1. However, the ratio of genotypes is 1:2:1 (1 PP: 2 Pp: 1 pp).
The Testcross
To test his model further, Mendel devised a simple and
powerful procedure called the testcross.Consider a purple-
flowered plant. It is impossible to tell whether such a plant
is homozygous or heterozygous simply by looking at its
phenotype. To learn its genotype, you must cross it with
some other plant. What kind of cross would provide the
answer? If you cross it with a homozygous dominant indi-
vidual, all of the progeny will show the dominant pheno-
type whether the test plant is homozygous or heterozygous.
It is also difficult (but not impossible) to distinguish be-
tween the two possible test plant genotypes by crossing
with a heterozygous individual. However, if you cross the
test plant with a homozygous recessive individual, the two
possible test plant genotypes will give totally different re-
sults (figure 13.15):
Alternative 1: unknown individual homozygous
dominant (PP). PP × pp: all offspring
have purple flowers (Pp)
Alternative 2: unknown individual heterozygous (Pp).
Pp × pp:
1
?2of offspring have white flowers
(pp) and
1
?2have purple flowers (Pp)
To perform his testcross, Mendel crossed heterozygous
F
1
individuals back to the parent homozygous for the reces-
sive trait. He predicted that the dominant and recessive
traits would appear in a 1:1 ratio, and that is what he ob-
served. For each pair of alleles he investigated, Mendel ob-
served phenotypic F
2
ratios of 3:1 (see figure 13.14) and
testcross ratios very close to 1:1, just as his model predicted.
Testcrosses can also be used to determine the genotype
of an individual when two genes are involved. Mendel car-
ried out many two-gene crosses, some of which we will dis-
cuss. He often used testcrosses to verify the genotypes of
particular dominant-appearing F
2
individuals. Thus, an F
2
individual showing both dominant traits (A_ B_) might
have any of the following genotypes: AABB, AaBB, AABb,
or AaBb. By crossing dominant-appearing F
2
individuals
with homozygous recessive individuals (that is, A_ B_ ×
aabb), Mendel was able to determine if either or both of the
traits bred true among the progeny, and so to determine
the genotype of the F
2
parent:
AABB trait A breeds true trait B breeds true
AaBB ________________ trait B breeds true
AABb trait A breeds true ________________
AaBb ________________ ________________
250 Part IV Reproduction and Heredity
if PP if Pp
Dominant phenotype
(unknown genotype)
Half of offspring are white;
therefore, unknown flower
is heterozygous.
All offspring are purple;
therefore, unknown
flower is homozygous
dominant.
PPP p
p
p
pp pp
pp
ppPp
Pp
p
p
Pp
PpPp
Pp
Alternative 1 Alternative 2
Homozygous
recessive
(white)
Homozygous
recessive
(white)
?
FIGURE 13.15
A testcross.To determine whether an individual exhibiting a dominant phenotype, such as purple flowers, is homozygous or
heterozygous for the dominant allele, Mendel crossed the individual in question with a plant that he knew to be homozygous recessive, in
this case a plant with white flowers.
Chapter 13 Patterns of Inheritance 251
Probability and
Allele Distribution
The probability that the three children
will be two boys and one girl is:
3p
2
q= 3 ×(
1
?2)
2
×(
1
?2) =
3
?8
To test your understanding, try to esti-
mate the probability that two parents het-
erozygous for the recessive allele producing
albinism (a) will have one albino child in a
family of three. First, set up a Punnett square:
Father’s
Gametes
Aa
Mother’s A AA Aa
Gametes a Aa aa
You can see that one-fourth of the chil-
dren are expected to be albino (aa). Thus,
for any given birth the probability of an al-
bino child is
1
?4. This probability can be sym-
bolized by q. The probability of a nonalbino
child is
3
?4, symbolized by p. Therefore, the
probability that there will be one albino
child among the three children is:
3p
2
q= 3 ×(
3
?4)
2
×(
1
?4) =
27
?64, or 42%
This means that the chance of having
one albino child in the three is 42%.
Many, although not all, alternative alleles
produce discretely different phenotypes.
Mendel’s pea plants were tall or dwarf, had
purple or white flowers, and produced
round or wrinkled seeds. The eye color of a
fruit fly may be red or white, and the skin
color of a human may be pigmented or al-
bino. When only two alternative alleles exist
for a given character, the distribution of
phenotypes among the offspring of a cross is
referred to as a binomial distribution.
As an example, consider the distribution
of sexes in humans. Imagine that a couple
has chosen to have three children. How
likely is it that two of the children will be
boys and one will be a girl? The frequency
of any particular possibility is referred to as
its probability of occurrence. Let p symbol-
ize the probability of having a boy at any
given birth and q symbolize the probability
of having a girl. Since any birth is equally
likely to produce a girl or boy:
p = q =
1
?2
Table 13.A shows eight possible gender
combinations among the three children. The
sum of the probabilities of the eight possible
combinations must equal one. Thus:
p
3
+ 3p
2
q+ 3pq
2
+ q
3
= 1
Table 13.A Binomial Distribution of the Sexes of Children in Human Families
Composition Order
of Family of Birth Calculation Probability
3 boys bbb p × p × pp
3
2 boys and 1 girl bbg p × p × qp
2
q
bgb p × q × pp
2
q 3p
2
q
gbb q × p ×
2
q
1 boy and 2 girls ggb q × q × pp
2
gbg q × p × qpq
2
3pq
2
bgg p × q ×
2
3 girls ggg q × q × qq
3
erozygous individual with one copy of that
allele has the same appearance as a homozy-
gous individual with two copies of it.
gene The basic unit of heredity; a se-
quence of DNA nucleotides on a chromo-
some that encodes a polypeptide or RNA
molecule and so determines the nature of
an individual’s inherited traits.
genotype The total set of genes present
in the cells of an organism. This term is
often also used to refer to the set of alleles
at a single gene.
haploid Having only one set of chromo-
somes. Gametes, certain animals, protists
and fungi, and certain stages in the life cycle
of plants are haploid.
heterozygote A diploid individual carry-
ing two different alleles of a gene on two
homologous chromosomes. Most human
beings are heterozygous for many genes.
homozygote A diploid individual carry-
ing identical alleles of a gene on both ho-
mologous chromosomes.
locus The location of a gene on a
chromosome.
phenotype The realized expression of the
genotype; the observable manifestation of a
trait (affecting an individual’s structure, phys-
iology, or behavior) that results from the bio-
logical activity of the DNA molecules.
recessive allele An allele whose pheno-
typic effect is masked in heterozygotes by
the presence of a dominant allele.
allele One of two or more alternative
forms of a gene.
diploid Having two sets of chromo-
somes, which are referred to as homologues.
Animals and plants are diploid in the dom-
inant phase of their life cycles as are some
protists.
dominant allele An allele that dictates the
appearance of heterozygotes. One allele is
said to be dominant over another if a het-
Vocabulary
of Genetics
Mendel’s Second Law of Heredity:
Independent Assortment
After Mendel had demonstrated that different traits of a
given character (alleles of a given gene) segregate inde-
pendently of each other in crosses, he asked whether dif-
ferent genes also segregate independently. Mendel set out
to answer this question in a straightforward way. He first
established a series of pure-breeding lines of peas that dif-
fered in just two of the seven characters he had studied.
He then crossed contrasting pairs of the pure-breeding
lines to create heterozygotes. In a cross involving differ-
ent seed shape alleles (round, R, and wrinkled, r) and dif-
ferent seed color alleles (yellow, Y, and green, y), all the
F
1
individuals were identical, each one heterozygous for
both seed shape (Rr) and seed color (Yy). The F
1
individu-
als of such a cross are dihybrids, individuals heterozygous
for both genes.
The third step in Mendel’s analysis was to allow the di-
hybrids to self-fertilize. If the alleles affecting seed shape
and seed color were segregating independently, then the
probability that a particular pair of seed shape alleles
would occur together with a particular pair of seed color
alleles would be simply the product of the individual prob-
abilities that each pair would occur separately. Thus, the
probability that an individual with wrinkled green seeds
(rryy) would appear in the F
2
generation would be equal to
the probability of observing an individual with wrinkled
seeds (
1
?4) times the probability of observing one with green
seeds (
1
?4), or
1
?16.
Because the gene controlling seed shape and the gene
controlling seed color are each represented by a pair of
alternative alleles in the dihybrid individuals, four types
of gametes are expected: RY, Ry, rY, and ry. Therefore, in
the F
2
generation there are 16 possible combinations of
alleles, each of them equally probable (figure 13.16). Of
these, 9 possess at least one dominant allele for each gene
(signified R__Y__, where the dash indicates the presence
of either allele) and, thus, should have round, yellow
seeds. Of the rest, 3 possess at least one dominant R allele
but are homozygous recessive for color (R__yy); 3 others
possess at least one dominant Y allele but are homozy-
gous recessive for shape (rrY__); and 1 combination
among the 16 is homozygous recessive for both genes
(rryy). The hypothesis that color and shape genes assort
independently thus predicts that the F
2
generation will
display a 9:3:3:1 phenotypic ratio: nine individuals with
round, yellow seeds, three with round, green seeds, three
with wrinkled, yellow seeds, and one with wrinkled,
green seeds (see figure 13.16).
What did Mendel actually observe? From a total of 556
seeds from dihybrid plants he had allowed to self-fertilize,
he observed: 315 round yellow (R__Y__), 108 round green
(R__yy), 101 wrinkled yellow (rrY__), and 32 wrinkled green
(rryy). These results are very close to a 9:3:3:1 ratio (which
would be 313:104:104:35). Consequently, the two genes
appeared to assort completely independently of each other.
Note that this independent assortment of different genes in
no way alters the independent segregation of individual
pairs of alleles. Round versus wrinkled seeds occur in a
ratio of approximately 3:1 (423:133); so do yellow versus
green seeds (416:140). Mendel obtained similar results for
other pairs of traits.
Mendel’s discovery is often referred to as Mendel’s
Second Law of Heredity, or the Law of Independent
Assortment. Genes that assort independently of one an-
other, like the seven genes Mendel studied, usually do so
because they are located on different chromosomes, which
segregate independently during the meiotic process of ga-
mete formation. A modern restatement of Mendel’s Second
Law would be that genes that are located on different chromo-
somes assort independently during meiosis.
Mendel summed up his discoveries about heredity in
two laws. Mendel’s First Law of Heredity states that
alternative alleles of a trait segregate independently; his
Second Law of Heredity states that genes located on
different chromosomes assort independently.
252 Part IV Reproduction and Heredity
RY
RY Ry rY ry
Ry
rY
ry
RRYY
RRYy
RrYY
RrYy
F
1
generation
F
2
generation
9/16 are round, yellow
3/16 are round, green
3/16 are wrinkled, yellow
1/16 are wrinkled, green
Wrinkled, green
seeds (rryy)
Round, yellow
seeds (RRYY)
X
All round, yellow
seeds (RrYy)
RRYy
RRyy
RrYy
Rryy
RrYY
RrYy
rrYY
rrYy
RrYy
Rryy
rrYy
rryy
Sperm
Eggs
FIGURE 13.16
Analyzing a dihybrid cross.This Punnett square shows the
results of Mendel’s dihybrid cross between plants with round
yellow seeds and plants with wrinkled green seeds. The ratio of
the four possible combinations of phenotypes is predicted to be
9:3:3:1, the ratio that Mendel found.
Mendelian Inheritance Is Not
Always Easy to Analyze
Although Mendel’s results did not receive much notice
during his lifetime, three different investigators indepen-
dently rediscovered his pioneering paper in 1900, 16 years
after his death. They came across it while searching the lit-
erature in preparation for publishing their own findings,
which closely resembled those Mendel had presented more
than three decades earlier. In the decades following the re-
discovery of Mendel, many investigators set out to test
Mendel’s ideas. However, scientists attempting to confirm
Mendel’s theory often had trouble obtaining the same sim-
ple ratios he had reported. Often, the expression of the
genotype is not straightforward. Most phenotypes reflect
the action of many genes that act sequentially or jointly,
and the phenotype can be affected by alleles that lack com-
plete dominance and the environment.
Continuous Variation
Few phenotypes are the result of the action of only one
gene. Instead, most characters reflect the action of poly-
genes, many genes that act sequentially or jointly. When
multiple genes act jointly to influence a character such as
height or weight, the character often shows a range of small
differences. Because all of the genes that play a role in de-
termining phenotypes such as height or weight segregate
independently of one another, one sees a gradation in the
degree of difference when many individuals are examined
(figure 13.17). We call this gradation continuous varia-
tion. The greater the number of genes that influence a
character, the more continuous the expected distribution of
the versions of that character.
How can one describe the variation in a character such
as the height of the individuals in figure 13.17? Individuals
range from quite short to very tall, with average heights
more common than either extreme. What one often does is
to group the variation into categories—in this case, by
measuring the heights of the individuals in inches, round-
ing fractions of an inch to the nearest whole number. Each
height, in inches, is a separate phenotypic category. Plot-
ting the numbers in each height category produces a his-
togram, such as that in figure 13.17. The histogram ap-
proximates an idealized bell-shaped curve, and the variation
can be characterized by the mean and spread of that curve.
Pleiotropic Effects
Often, an individual allele will have more than one effect
on the phenotype. Such an allele is said to be pleiotropic.
When the pioneering French geneticist Lucien Cuenot
studied yellow fur in mice, a dominant trait, he was unable
to obtain a true-breeding yellow strain by crossing individ-
ual yellow mice with each other. Individuals homozygous
for the yellow allele died, because the yellow allele was
pleiotropic: one effect was yellow coat color, but another
was a lethal developmental defect. A pleiotropic allele may
be dominant with respect to one phenotypic consequence
(yellow fur) and recessive with respect to another (lethal
developmental defect). In pleiotropy, one gene affects
many traits, in marked contrast to polygeny, where many
genes affect one trait. Pleiotropic effects are difficult to
predict, because the genes that affect a trait often perform
other functions we may know nothing about.
Pleiotropic effects are characteristic of many inherited
disorders, such as cystic fibrosis and sickle cell anemia, both
discussed later in this chapter. In these disorders, multiple
symptoms can be traced back to a single gene defect. In cys-
tic fibrosis, patients exhibit clogged blood vessels, overly
sticky mucus, salty sweat, liver and pancreas failure, and a
battery of other symptoms. All are pleiotropic effects of a
single defect, a mutation in a gene that encodes a chloride
ion transmembrane channel. In sickle cell anemia, a defect
in the oxygen-carrying hemoglobin molecule causes anemia,
heart failure, increased susceptibility to pneumonia, kidney
failure, enlargement of the spleen, and many other symp-
toms. It is usually difficult to deduce the nature of the pri-
mary defect from the range of a gene’s pleiotropic effects.
Chapter 13 Patterns of Inheritance 253
Number of individuals
30
20
10
0
5'0'' 5'6''
Height
6'0''
FIGURE 13.17
Height is a continuously varying trait. The photo shows
variation in height among students of the 1914 class of the
Connecticut Agricultural College. Because many genes
contribute to height and tend to segregate independently of one
another, the cumulative contribution of different combinations
of alleles to height forms a continuous distribution of possible
height, in which the extremes are much rarer than the
intermediate values.
Lack of Complete Dominance
Not all alternative alleles are fully
dominant or fully recessive in het-
erozygotes. Some pairs of alleles in-
stead produce a heterozygous pheno-
type that is either intermediate
between those of the parents (incom-
plete dominance), or representative of
both parental phenotypes (codomi-
nance). For example, in the cross of red
and white flowering Japanese four o’-
clocks described in figure 13.18, all the
F
1
offspring had pink flowers—indicat-
ing that neither red nor white flower
color was dominant. Does this example
of incomplete dominance argue that
Mendel was wrong? Not at all. When
two of the F
1
pink flowers were
crossed, they produced red-, pink-, and
white-flowered plants in a 1:2:1 ratio.
Heterozygotes are simply intermediate
in color.
Environmental Effects
The degree to which an allele is ex-
pressed may depend on the environ-
ment. Some alleles are heat-sensitive, for example. Traits
influenced by such alleles are more sensitive to temperature
or light than are the products of other alleles. The arctic
foxes in figure 13.19, for example, make fur pigment only
when the weather is warm. Similarly, the ch allele in Hi-
malayan rabbits and Siamese cats encodes a heat-sensitive
version of tyrosinase, one of the enzymes mediating the
production of melanin, a dark pigment. The ch version of
the enzyme is inactivated at temperatures above about
33°C. At the surface of the body and head, the temperature
is above 33°C and the tyrosinase enzyme is inactive, while
it is more active at body extremities such as the tips of the
ears and tail, where the temperature is below 33°C. The
dark melanin pigment this enzyme produces causes the
ears, snout, feet, and tail of Himalayan rabbits and Siamese
cats to be black.
254 Part IV Reproduction and Heredity
F
1
generation
F
2
generation
C
R
C
R
C
R
C
R
C
R
C
W
C
R
C
W
C
R
C
W
C
R
C
W
All C
R
C
W
C
W
C
W
C
W
C
W
1 : 2 : 1
C
R
C
R
:C
R
C
W
:C
W
C
W
Eggs
Sperm
FIGURE 13.18
Incomplete dominance.In a cross between a red-flowered Japanese four o’clock,
genotype C
R
C
R
,and a white-flowered one (C
W
C
W
), neither allele is dominant. The
heterozygous progeny have pink flowers and the genotype C
R
C
W
.If two of these
heterozygotes are crossed, the phenotypes of their progeny occur in a ratio of 1:2:1
(red:pink:white).
(a)
(b)
FIGURE 13.19
Environmental effects on an allele.(a) An arctic fox in winter
has a coat that is almost white, so it is difficult to see the fox
against a snowy background. (b) In summer, the same fox’s fur
darkens to a reddish brown, so that it resembles the color of the
surrounding tundra. Heat-sensitive alleles control this color
change.
Epistasis
In the tests of Mendel’s ideas that
followed the rediscovery of his work,
scientists had trouble obtaining
Mendel’s simple ratios particularly
with dihybrid crosses. Recall that
when individuals heterozygous for
two different genes mate (a dihybrid
cross), four different phenotypes are
possible among the progeny: off-
spring may display the dominant
phenotype for both genes, either one
of the genes, or for neither gene.
Sometimes, however, it is not possi-
ble for an investigator to identify
successfully each of the four pheno-
typic classes, because two or more of
the classes look alike. Such situations
proved confusing to investigators
following Mendel.
One example of such difficulty in
identification is seen in the analysis of
particular varieties of corn, Zea mays.
Some commercial varieties exhibit a
purple pigment called anthocyanin in
their seed coats, while others do not.
In 1918, geneticist R. A. Emerson
crossed two pure-breeding corn vari-
eties, neither exhibiting anthocyanin
pigment. Surprisingly, all of the F
1
plants produced purple seeds.
When two of these pigment-
producing F
1
plants were crossed to
produce an F
2
generation, 56% were
pigment producers and 44% were
not. What was happening? Emerson
correctly deduced that two genes
were involved in producing pigment,
and that the second cross had thus been a dihybrid cross.
Mendel had predicted 16 equally possible ways gametes
could combine. How many of these were in each of the
two types Emerson obtained? He multiplied the fraction
that were pigment producers (0.56) by 16 to obtain 9, and
multiplied the fraction that were not (0.44) by 16 to ob-
tain 7. Thus, Emerson had a modified ratio of 9:7 in-
stead of the usual 9:3:3:1 ratio.
Why Was Emerson’s Ratio Modified? When genes
act sequentially, as in a biochemical pathway, an allele ex-
pressed as a defective enzyme early in the pathway blocks
the flow of material through the rest of the pathway.
This makes it impossible to judge whether the later steps
of the pathway are functioning properly. Such gene inter-
action, where one gene can interfere with the expression
of another gene, is the basis of the phenomenon called
epistasis.
The pigment anthocyanin is the product of a two-step
biochemical pathway:
Enzyme 1 Enzyme 2
Starting molecule–→ Intermediate–→ Anthocyanin
(Colorless) (Colorless) (Purple)
To produce pigment, a plant must possess at least one
functional copy of each enzyme gene (figure 13.20). The
dominant alleles encode functional enzymes, but the reces-
sive alleles encode nonfunctional enzymes. Of the 16 geno-
types predicted by random assortment, 9 contain at least
one dominant allele of both genes; they produce purple
progeny. The remaining 7 genotypes lack dominant alleles
at either or both loci (3 + 3 + 1 = 7) and so are phenotypi-
cally the same (nonpigmented), giving the phenotypic ratio
of 9:7 that Emerson observed. The inability to see the ef-
fect of enzyme 2 when enzyme 1 is nonfunctional is an ex-
ample of epistasis.
Chapter 13 Patterns of Inheritance 255
AB
AB Ab aB ab
Ab
aB
ab
AABB
AABb
AaBB
AaBb
F
2
generation
9/16 purple
7/16 white
F
1
generation
All purple
(AaBb)
X
AABb
AAbb
AaBb
Aabb
AaBB
AaBb
aaBB
aaBb
AaBb
Aabb
aaBb
aabb
Eggs
Sperm
White
(aaBB)
White
(AAbb)
FIGURE 13.20
How epistasis affects grain color.The purple pigment found in some varieties of corn is
the product of a two-step biochemical pathway. Unless both enzymes are active (the plant
has a dominant allele for each of the two genes, Aand B), no pigment is expressed.
Other Examples of Epistasis
In many animals, coat color is the result of epistatic inter-
actions among genes. Coat color in Labrador retrievers, a
breed of dog, is due primarily to the interaction of two
genes. The E gene determines if dark pigment (eumelanin)
will be deposited in the fur or not. If a dog has the geno-
type ee, no pigment will be deposited in the fur, and it will
be yellow. If a dog has the genotype EE or Ee (E_), pigment
will be deposited in the fur.
A second gene, the B gene, determines how dark the
pigment will be. This gene controls the distribution of
melanosomes in a hair. Dogs with the genotype E_bb will
have brown fur and are called chocolate labs. Dogs with the
genotype E_B_ will have black fur. But, even in yellow
dogs, the B gene does have some effect. Yellow dogs with
the genotype eebb will have brown pigment on their nose,
lips, and eye rims, while yellow dogs with the genotype
eeB_ will have black pigment in these areas. The interaction
among these alleles is illustrated in figure 13.21. The genes
for coat color in this breed have been found, and a genetic
test is available to determine the coat colors in a litter of
puppies.
A variety of factors can disguise the Mendelian
segregation of alleles. Among them are the continuous
variation that results when many genes contribute to a
trait, incomplete dominance and codominance that
produce heterozygotes unlike either parent,
environmental influences on the expression of
phenotypes, and gene interactions that produce
epistasis.
256 Part IV Reproduction and Heredity
No dark pigment in fur
ee
eebb eeB_
Yellow fur,
brown nose,
lips, eye rims
Yellow fur,
black nose,
lips, eye rims
Yellow Lab
Dark pigment in fur
E_
E_bb E_B_
Brown fur,
nose, lips,
eye rims
Black fur,
nose, lips,
eye rims
Chocolate Lab Black Lab
FIGURE 13.21
The effect of epistatic interactions on coat color in dogs. The coat color seen in Labrador retrievers is an example of the interaction of
two genes, each with two alleles. The Egene determines if the pigment will be deposited in the fur, and the Bgene determines how dark
the pigment will be.
Random changes in genes, called mutations, occur in any
population. These changes rarely improve the functioning
of the proteins those genes encode, just as randomly chang-
ing a wire in a computer rarely improves the computer’s
functioning. Mutant alleles are usually recessive to other al-
leles. When two seemingly normal individuals who are het-
erozygous for such an allele produce offspring homozygous
for the allele, the offspring suffer the detrimental effects of
the mutant allele. When a detrimental allele occurs at a sig-
nificant frequency in a population, the harmful effect it
produces is called a gene disorder.
Most Gene Disorders Are Rare
Tay-Sachs disease is an incurable hereditary disorder in
which the nervous system deteriorates. Affected children
appear normal at birth and usually do not develop symp-
toms until about the eighth month, when signs of mental
deterioration appear. The children are blind within a year
after birth, and they rarely live past five years of age.
Tay-Sachs disease is rare in most human populations,
occurring in only 1 of 300,000 births in the United States.
However, the disease has a high incidence among Jews of
Eastern and Central Europe (Ashkenazi), and among
American Jews, 90% of whom trace their ancestry to East-
ern and Central Europe. In these populations, it is esti-
mated that 1 in 28 individuals is a heterozygous carrier of
the disease, and approximately 1 in 3500 infants has the
disease. Because the disease is caused by a recessive allele,
most of the people who carry the defective allele do not
themselves develop symptoms of the disease.
The Tay-Sachs allele produces the disease by encoding a
nonfunctional form of the enzyme hexosaminidase A. This
enzyme breaks down gangliosides, a class of lipids occurring
within the lysosomes of brain cells (figure 13.22). As a re-
sult, the lysosomes fill with gangliosides, swell, and eventu-
ally burst, releasing oxidative enzymes that kill the cells.
There is no known cure for this disorder.
Not All Gene Defects Are Recessive
Not all hereditary disorders are recessive. Huntington’s
disease is a hereditary condition caused by a dominant al-
lele that leads to the progressive deterioration of brain cells
(figure 13.23). Perhaps 1 in 24,000 individuals develops the
disorder. Because the allele is dominant, every individual
that carries the allele expresses the disorder. Nevertheless,
the disorder persists in human populations because its
symptoms usually do not develop until the affected individ-
uals are more than 30 years old, and by that time most of
those individuals have already had children. Consequently,
the allele is often transmitted before the lethal condition
develops. A person who is heterozygous for Huntington’s
disease has a 50% chance of passing the disease to his or her
children (even though the other parent does not have the
disorder). In contrast, the carrier of a recessive disorder
such as cystic fibrosis has a 50% chance of passing the allele
to offspring and must mate with another carrier to risk
bearing a child with the disease.
Most gene defects are rare recessives, although some
are dominant.
Chapter 13 Patterns of Inheritance 257
13.2 Human genetics follows Mendelian principles.
Percent of normal enzyme function
100
50
Tay-Sachs
(homozygous
recessive)
Carrier
(heterozygous)
Normal
(homozygous
dominant)
0
FIGURE 13.22
Tay-Sachs disease.Homozygous individuals (left bar) typically
have less than 10% of the normal level of hexosaminidase A (right
bar), while heterozygous individuals (middle bar) have about 50%
of the normal level—enough to prevent deterioration of the
central nervous system.
Age in years
Huntington’s
disease
Percent of total with Huntington's allele
af
fected by the disease
0
0
25
50
75
100
10 20 4030 50 60 70 80
FIGURE 13.23
Huntington’s disease is a dominant genetic disorder.It is
because of the late age of onset of this disease that it persists
despite the fact that it is dominant and fatal.
Multiple Alleles: The ABO
Blood Groups
A gene may have more than two alleles in a population, and
most genes possess several different alleles. Often, no single
allele is dominant; instead, each allele has its own effect,
and the alleles are considered codominant.
A human gene with more than one codominant allele is
the gene that determines ABO blood type. This gene en-
codes an enzyme that adds sugar molecules to lipids on the
surface of red blood cells. These sugars act as recognition
markers for the immune system. The gene that encodes the
enzyme, designated I, has three common alleles: I
B
, whose
product adds galactose; I
A
, whose product adds galac-
tosamine; and i, which codes for a protein that does not add
a sugar.
Different combinations of the three I gene alleles occur
in different individuals because each person possesses two
copies of the chromosome bearing the I gene and may be
homozygous for any allele or heterozygous for any two. An
individual heterozygous for the I
A
and I
B
alleles produces
both forms of the enzyme and adds both galactose and
galactosamine to the surfaces of red blood cells. Because
both alleles are expressed simultaneously in heterozygotes,
the I
A
and I
B
alleles are codominant. Both I
A
and I
B
are
dominant over the i allele because both I
A
or I
B
alleles lead
to sugar addition and the i allele does not. The different
combinations of the three alleles produce four different
phenotypes (figure 13.24):
1. Type A individuals add only galactosamine. They are
either I
A
I
A
homozygotes or I
A
iheterozygotes.
2. Type B individuals add only galactose. They are ei-
ther I
B
I
B
homozygotes or I
B
iheterozygotes.
3. Type AB individuals add both sugars and are I
A
I
B
het-
erozygotes.
4. Type O individuals add neither sugar and are ii ho-
mozygotes.
These four different cell surface phenotypes are called
the ABO blood groups or, less commonly, the Land-
steiner blood groups, after the man who first described
them. As Landsteiner noted, a person’s immune system
can distinguish between these four phenotypes. If a type A
individual receives a transfusion of type B blood, the recip-
ient’s immune system recognizes that the type B blood
cells possess a “foreign” antigen (galactose) and attacks the
donated blood cells, causing the cells to clump, or aggluti-
nate. This also happens if the donated blood is type AB.
However, if the donated blood is type O, no immune at-
tack will occur, as there are no galactose antigens on the
surfaces of blood cells produced by the type O donor. In
general, any individual’s immune system will tolerate a
transfusion of type O blood. Because neither galactose nor
galactosamine is foreign to type AB individuals (whose red
blood cells have both sugars), those individuals may re-
ceive any type of blood.
The Rh Blood Group
Another set of cell surface markers on human red blood
cells are the Rh blood group antigens, named for the rhe-
sus monkey in which they were first described. About 85%
of adult humans have the Rh cell surface marker on their
red blood cells, and are called Rh-positive. Rh-negative
persons lack this cell surface marker because they are ho-
mozygous for the recessive gene encoding it.
If an Rh-negative person is exposed to Rh-positive
blood, the Rh surface antigens of that blood are treated like
foreign invaders by the Rh-negative person’s immune sys-
tem, which proceeds to make antibodies directed against
the Rh antigens. This most commonly happens when an
Rh-negative woman gives birth to an Rh-positive child
(whose father is Rh-positive). At birth, some fetal red blood
cells cross the placental barrier and enter the mother’s
bloodstream, where they induce the production of “anti-
Rh” antibodies. In subsequent pregnancies, the mother’s
antibodies can cross back to the new fetus and cause its red
blood cells to clump, leading to a potentially fatal condition
called erythroblastosis fetalis.
Many blood group genes possess multiple alleles,
several of which may be common.
258 Part IV Reproduction and Heredity
I
A
I
A
I
A
I
B
I
A
i
I
A
I
A
I
B
I
B
I
B
i
I
A
i
I
B
i
ii
I
A
I
A
or
I
B
or
i
or I
B
or i
Possible alleles from female
Possible alleles from male
A AB BBlood types O
FIGURE 13.24
Multiple alleles control the ABO blood groups.Different
combinations of the three Igene alleles result in four different
blood type phenotypes: type A (either I
A
I
A
homozygotes or I
A
i
heterozygotes), type B (either I
B
I
B
homozygotes or I
B
i
heterozygotes), type AB (I
A
I
B
heterozygotes), and type O
(iihomozygotes).
Patterns of Inheritance Can Be
Deduced from Pedigrees
When a blood vessel ruptures, the blood in the immediate
area of the rupture forms a solid gel called a clot. The clot
forms as a result of the polymerization of protein fibers cir-
culating in the blood. A dozen proteins are involved in this
process, and all must function properly for a blood clot to
form. A mutation causing any of these proteins to lose their
activity leads to a form of hemophilia, a hereditary condi-
tion in which the blood is slow to clot or does not clot at all.
Hemophilias are recessive disorders, expressed only
when an individual does not possess any copy of the nor-
mal allele and so cannot produce one of the proteins nec-
essary for clotting. Most of the genes that encode the
blood-clotting proteins are on autosomes, but two (desig-
nated VIII and IX) are on the X chromosome. These two
genes are sex-linked: any male who inherits a mutant allele
of either of the two genes will develop hemophilia because
his other sex chromosome is a Y chromosome that lacks
any alleles of those genes.
The most famous instance of hemophilia, often called the
Royal hemophilia, is a sex-linked form that arose in one of
the parents of Queen Victoria of England (1819–1901; figure
13.25). In the five generations
since Queen Victoria, 10 of her
male descendants have had he-
mophilia. The present British
royal family has escaped the
disorder because Queen Victo-
ria’s son, King Edward VII, did
not inherit the defective allele,
and all the subsequent rulers of
England are his descendants.
Three of Victoria’s nine chil-
dren did receive the defective
allele, however, and they car-
ried it by marriage into many
of the other royal families of
Europe (figure 13.26), where it
is still being passed to future
generations—except in Russia,
where all of the five children of
Victoria’s granddaughter
Alexandra were killed soon
after the Russian revolution in
1917. (Speculation that one
daughter, Anastasia, survived
ended in 1999 when DNA
analysis confirmed the identity
of her remains.)
Family pedigrees can
reveal the mode of
inheritance of a hereditary
trait.
Chapter 13 Patterns of Inheritance 259
FIGURE 13.25
Queen Victoria of England, surrounded by some of her
descendants in 1894.Of Victoria’s four daughters who lived to
bear children, two, Alice and Beatrice, were carriers of Royal
hemophilia. Two of Alice’s daughters are standing behind
Victoria (wearing feathered boas): Princess Irene of Prussia
(right), and Alexandra (left), who would soon become Czarina of
Russia. Both Irene and Alexandra were also carriers of
hemophilia.
George III
Edward
Duke of Kent
Louis II
Grand Duke of Hesse
King
Edward VII
Duke of
Windsor
Queen
Elizabeth II
Prince
Philip
Margaret
Princess
Diana
Prince
Charles
Anne Andrew Edward
William Henry
King
George VI
King
George V
Earl of
Mountbatten
Viscount
Tremation
Alfonso Jamie GonzaloPrince
Sigismond
Prussian
Royal
House
British Royal House
Spanish Royal House
Russian
Royal
House
Henry Anastasia Alexis
? ?
? ?
? ?
?
Waldemar
Queen VictoriaPrince Albert
Frederick
III
I
II
III
IV
V
VI
VII
Generation
Victoria
Alice Alfred Arthur Leopold Beatrice Prince
Henry
HelenaDuke of
Hesse
No hemophilia No hemophilia
German
Royal
House
Juan
King Juan
Carlos
No evidence
of hemophilia
No evidence
of hemophilia
Irene Czar
Nicholas II
Czarina
Alexandra
Earl of
Athlone
Princess
Alice
Queen
Eugenie
Alfonso
King of
Spain
Maurice Leopold
FIGURE 13.26
The Royal hemophilia pedigree.Queen Victoria’s daughter Alice introduced hemophilia into the
Russian and Austrian royal houses, and Victoria’s daughter Beatrice introduced it into the Spanish
royal house. Victoria’s son Leopold, himself a victim, also transmitted the disorder in a third line of
descent. Half-shaded symbols represent carriers with one normal allele and one defective allele; fully
shaded symbols represent affected individuals.
Gene Disorders Can Be Due to
Simple Alterations of Proteins
Sickle cell anemia is a heritable disorder first noted in
Chicago in 1904. Afflicted individuals have defective mol-
ecules of hemoglobin, the protein within red blood cells
that carries oxygen. Consequently, these individuals are
unable to properly transport oxygen to their tissues. The
defective hemoglobin molecules stick to one another,
forming stiff, rod-like structures and resulting in the for-
mation of sickle-shaped red blood cells (figure 13.27). As
a result of their stiffness and irregular shape, these cells
have difficulty moving through the smallest blood vessels;
they tend to accumulate in those vessels and form clots.
People who have large proportions of sickle-shaped red
blood cells tend to have intermittent illness and a short-
ened life span.
The hemoglobin in the defective red blood cells dif-
fers from that in normal red blood cells in only one of
hemoglobin’s 574 amino acid sub-
units. In the defective hemoglobin,
the amino acid valine replaces a glu-
tamic acid at a single position in the
protein. Interestingly, the position
of the change is far from the active
site of hemoglobin where the iron-
bearing heme group binds oxygen.
Instead, the change occurs on the
outer edge of the protein. Why then
is the result so catastrophic? The
sickle cell mutation puts a very non-
polar amino acid on the surface of
the hemoglobin protein, creating a
“sticky patch” that sticks to other
such patches—nonpolar amino acids
tend to associate with one another in
polar environments like water. As
one hemoglobin adheres to another,
ever-longer chains of hemoglobin
molecules form.
Individuals heterozygous for the
sickle cell allele are generally indis-
tinguishable from normal persons.
However, some of their red blood
cells show the sickling characteristic
when they are exposed to low levels
of oxygen. The allele responsible for
sickle cell anemia is particularly
common among people of African descent; about 9% of
African Americans are heterozygous for this allele, and
about 0.2% are homozygous and therefore have the dis-
order. In some groups of people in Africa, up to 45% of
all individuals are heterozygous for this allele, and 6%
are homozygous. What factors determine the high fre-
quency of sickle cell anemia in Africa? It turns out that
heterozygosity for the sickle cell anemia allele increases
resistance to malaria, a common and serious disease in
central Africa (figure 13.28). We will discuss this situa-
tion in detail in chapter 21.
Sickle cell anemia is caused by a single-nucleotide
change in the gene for hemoglobin, producing a protein
with a nonpolar amino acid on its surface that tends to
make the molecules clump together.
260 Part IV Reproduction and Heredity
FIGURE 13.27
Sickle cell anemia.In individuals homozygous for the sickle cell
trait, many of the red blood cells have sickle or irregular shapes,
such as the cell on the far right.
Sickle cell
allele in Africa
1–5%
5–10%
10–20%
P. falciparum
malaria in Africa
Malaria
FIGURE 13.28
The sickle cell allele increases resistance to malaria.The distribution of sickle cell
anemia closely matches the occurrence of malaria in central Africa. This is not a
coincidence. The sickle cell allele, when heterozygous, increases resistance to malaria, a
very serious disease.
Some Defects May Soon Be Curable
Some of the most common and serious gene defects result
from single recessive mutations, including many of the
defects listed in table 13.2. Recent developments in gene
technology have raised the hope that this class of disor-
ders may be curable. Perhaps the best example is cystic
fibrosis (CF), the most common fatal genetic disorder
among Caucasians.
Cystic fibrosis is a fatal disease in which the body cells
of affected individuals secrete a thick mucus that clogs the
airways of the lungs. These same secretions block the
ducts of the pancreas and liver so that the few patients who
do not die of lung disease die of liver failure. There is no
known cure.
Cystic fibrosis results from a defect in a single gene,
called cf, that is passed down from parent to child. One in
20 individuals possesses at least one copy of the defective
gene. Most carriers are not afflicted with the disease; only
those children who inherit a copy of the defective gene
from each parent succumb to cystic fibrosis—about 1 in
2500 infants.
The function of the cf gene has proven difficult to study.
In 1985 the first clear clue was obtained. An investigator,
Paul Quinton, seized on a commonly observed characteris-
tic of cystic fibrosis patients, that their sweat is abnormally
salty, and performed the following experiment. He isolated
a sweat duct from a small piece of skin and placed it in a so-
lution of salt (NaCl) that was three times as concentrated as
the NaCl inside the duct. He then monitored the move-
ment of ions. Diffusion tends to drive both the sodium
(Na
+
) and the chloride (Cl
–
) ions into the duct because of
the higher outer ion concentrations. In skin isolated from
normal individuals, Na
+
and Cl
–
ions both entered the duct,
as expected. In skin isolated from cystic fibrosis individuals,
however, only Na
+
ions entered the duct—no Cl
–
ions en-
tered. For the first time, the molecular nature of cystic fi-
brosis became clear. Cystic fibrosis is a defect in a plasma
membrane protein called CFTR (cystic fibrosis transmem-
brane conductance regulator) that normally regulates pas-
sage of Cl
–
ions into and out of the body’s cells. CFTR
does not function properly in cystic fibrosis patients (see
figure 4.8).
The defective cf gene was isolated in 1987, and its posi-
tion on a particular human chromosome (chromosome 7)
was pinpointed in 1989. In 1990 a working cf gene was suc-
cessfully transferred via adenovirus into human lung cells
growing in tissue culture. The defective cells were “cured,”
becoming able to transport chloride ions across their
plasma membranes. Then in 1991, a team of researchers
successfully transferred a normal human cf gene into the
lung cells of a living animal—a rat. The cf gene was first in-
serted into a cold virus that easily infects lung cells, and the
virus was inhaled by the rat. Carried piggyback, the cf gene
entered the rat lung cells and began producing the normal
human CFTR protein within these cells! Tests of gene
transfer into CF patients were begun in 1993, and while a
great deal of work remains to be done (the initial experi-
ments were not successful), the future for cystic fibrosis pa-
tients for the first time seems bright.
Cystic fibrosis, and other genetic disorders, are
potentially curable if ways can be found to successfully
introduce normal alleles of the genes into affected
individuals.
Chapter 13 Patterns of Inheritance 261
Table 13.2 Some Important Genetic Disorders
Dominant/ Frequency among
Disorder Symptom Defect Recessive Human Births
Cystic fibrosis
Sickle cell anemia
Tay-Sachs disease
Phenylketonuria
Hemophilia
Huntington’s disease
Muscular dystrophy
(Duchenne)
Hypercholesterolemia
Mucus clogs lungs, liver,
and pancreas
Poor blood circulation
Deterioration of central
nervous system in infancy
Brain fails to develop in
infancy
Blood fails to clot
Brain tissue gradually
deteriorates in middle age
Muscles waste away
Excessive cholesterol levels
in blood, leading to heart
disease
Failure of chloride ion
transport mechanism
Abnormal hemoglobin
molecules
Defective enzyme
(hexosaminidase A)
Defective enzyme
(phenylalanine hydroxylase)
Defective blood clotting factor
VIII
Production of an inhibitor of
brain cell metabolism
Degradation of myelin coating
of nerves stimulating muscles
Abnormal form of cholesterol
cell surface receptor
Recessive
Recessive
Recessive
Recessive
Sex-linked
recessive
Dominant
Sex-linked
recessive
Dominant
1/2500
(Caucasians)
1/625
(African Americans)
1/3500
(Ashkenazi Jews)
1/12,000
1/10,000
(Caucasian males)
1/24,000
1/3700
(males)
1/500
Chromosomes: The Vehicles
of Mendelian Inheritance
Chromosomes are not the only kinds of structures that seg-
regate regularly when eukaryotic cells divide. Centrioles
also divide and segregate in a regular fashion, as do the mi-
tochondria and chloroplasts (when present) in the cyto-
plasm. Therefore, in the early twentieth century it was by
no means obvious that chromosomes were the vehicles of
hereditary information.
The Chromosomal Theory of Inheritance
A central role for chromosomes in heredity was first sug-
gested in 1900 by the German geneticist Karl Correns, in
one of the papers announcing the rediscovery of Mendel’s
work. Soon after, observations that similar chromosomes
paired with one another during meiosis led directly to the
chromosomal theory of inheritance, first formulated by
the American Walter Sutton in 1902.
Several pieces of evidence supported Sutton’s theory. One
was that reproduction involves the initial union of only two
cells, egg and sperm. If Mendel’s model were correct, then
these two gametes must make equal hereditary contribu-
tions. Sperm, however, contain little cytoplasm, suggesting
that the hereditary material must reside within the nuclei of
the gametes. Furthermore, while diploid individuals have
two copies of each pair of homologous chromosomes, ga-
metes have only one. This observation was consistent with
Mendel’s model, in which diploid individuals have two
copies of each heritable gene and gametes have one. Finally,
chromosomes segregate during meiosis, and each pair of ho-
mologues orients on the metaphase plate independently of
every other pair. Segregation and independent assortment
were two characteristics of the genes in Mendel’s model.
A Problem with the Chromosomal Theory
However, investigators soon pointed out one problem with
this theory. If Mendelian characters are determined by
genes located on the chromosomes, and if the independent
assortment of Mendelian traits reflects the independent as-
sortment of chromosomes in meiosis, why does the number
of characters that assort independently in a given kind of
organism often greatly exceed the number of chromosome
pairs the organism possesses? This seemed a fatal objec-
tion, and it led many early researchers to have serious
reservations about Sutton’s theory.
Morgan’s White-Eyed Fly
The essential correctness of the chromosomal theory of
heredity was demonstrated long before this paradox was re-
solved. A single small fly provided the proof. In 1910
Thomas Hunt Morgan, studying the fruit fly Drosophila
melanogaster, detected a mutant male fly, one that differed
strikingly from normal flies of the same species: its eyes
were white instead of red (figure 13.29).
Morgan immediately set out to determine if this new
trait would be inherited in a Mendelian fashion. He first
crossed the mutant male to a normal female to see if red or
white eyes were dominant. All of the F
1
progeny had red
eyes, so Morgan concluded that red eye color was domi-
nant over white. Following the experimental procedure
that Mendel had established long ago, Morgan then
crossed the red-eyed flies from the F
1
generation with each
other. Of the 4252 F
2
progeny Morgan examined, 782
(18%) had white eyes. Although the ratio of red eyes to
white eyes in the F
2
progeny was greater than 3:1, the re-
sults of the cross nevertheless provided clear evidence that
eye color segregates. However, there was something about
the outcome that was strange and totally unpredicted by
Mendel’s theory—all of the white-eyed F
2
flies were males!
How could this result be explained? Perhaps it was im-
possible for a white-eyed female fly to exist; such individu-
als might not be viable for some unknown reason. To test
this idea, Morgan testcrossed the female F
1
progeny with
the original white-eyed male. He obtained both white-eyed
and red-eyed males and females in a 1:1:1:1 ratio, just as
Mendelian theory predicted. Hence, a female could have
white eyes. Why, then, were there no white-eyed females
among the progeny of the original cross?
262 Part IV Reproduction and Heredity
13.3 Genes are on chromosomes.
FIGURE 13.29
Red-eyed (normal) and white-eyed (mutant) Drosophila.The
white-eyed defect is hereditary, the result of a mutation in a gene
located on the X chromosome. By studying this mutation,
Morgan first demonstrated that genes are on chromosomes.
Sex Linkage
The solution to this puzzle involved sex. In Drosophila, the
sex of an individual is determined by the number of copies
of a particular chromosome, the X chromosome, that an
individual possesses. A fly with two X chromosomes is a fe-
male, and a fly with only one X chromosome is a male. In
males, the single X chromosome pairs in meiosis with a dis-
similar partner called the Y chromosome.The female thus
produces only X gametes, while the male produces both X
and Y gametes. When fertilization involves an X sperm, the
result is an XX zygote, which develops into a female; when
fertilization involves a Y sperm, the result is an XY zygote,
which develops into a male.
The solution to Morgan’s puzzle is that the gene caus-
ing the white-eye trait in Drosophila resides only on the X
chromosome—it is absent from the Y chromosome. (We
now know that the Y chromosome in flies carries almost
no functional genes.) A trait determined by a gene on the
X chromosome is said to be sex-linked. Knowing the
white-eye trait is recessive to the red-eye trait, we can
now see that Morgan’s result was a natural consequence
of the Mendelian assortment of chromosomes (fig-
ure13.30).
Morgan’s experiment was one of the most important in
the history of genetics because it presented the first clear
evidence that the genes determining Mendelian traits do
indeed reside on the chromosomes, as Sutton had pro-
posed. The segregation of the white-eye trait has a one-to-
one correspondence with the segregation of the X chromo-
some. In other words, Mendelian traits such as eye color in
Drosophila assort independently because chromosomes do.
When Mendel observed the segregation of alternative traits
in pea plants, he was observing a reflection of the meiotic
segregation of chromosomes.
Mendelian traits assort independently because they are
determined by genes located on chromosomes that
assort independently in meiosis.
Chapter 13 Patterns of Inheritance 263
H11003
H11003
Y chromosome X chromosome with
white-eye gene
X chromosome with
red-eye gene
FemaleMale
FemaleMale
FemalesMales
Parents
F
1
generation
F
2
generation
FIGURE 13.30
Morgan’s experiment demonstrating
the chromosomal basis of sex linkage
in Drosophila.The white-eyed mutant
male fly was crossed with a normal
female. The F
1
generation flies all
exhibited red eyes, as expected for flies
heterozygous for a recessive white-eye
allele. In the F
2
generation, all of the
white-eyed flies
were male.
Genetic Recombination
Morgan’s experiments led to the gen-
eral acceptance of Sutton’s chromoso-
mal theory of inheritance. Scientists
then attempted to resolve the paradox
that there are many more indepen-
dently assorting Mendelian genes than
chromosomes. In 1903 the Dutch ge-
neticist Hugo de Vries suggested that
this paradox could be resolved only by
assuming that homologous chromo-
somes exchange elements during
meiosis. In 1909, French cytologist
F.A. Janssens provided evidence to
support this suggestion. Investigating
chiasmata produced during amphibian
meiosis, Janssens noticed that of the
four chromatids involved in each chi-
asma, two crossed each other and two
did not. He suggested that this cross-
ing of chromatids reflected a switch in
chromosomal arms between the pater-
nal and maternal homologues, involv-
ing one chromatid in each homologue.
His suggestion was not accepted
widely, primarily because it was diffi-
cult to see how two chromatids could
break and rejoin at exactly the same
position.
Crossing Over
Later experiments clearly established
that Janssens was indeed correct. One
of these experiments, performed in
1931 by American geneticist Curt
Stern, is described in figure 13.31.
Stern studied two sex-linked eye char-
acters in Drosophila strains whose X
chromosomes were visibly abnormal
at both ends. He first examined many
flies and identified those in which an
exchange had occurred with respect to
the two eye characters. He then stud-
ied the chromosomes of those flies to see if their X chro-
mosomes had exchanged arms. Stern found that all of the
individuals that had exchanged eye traits also possessed
chromosomes that had exchanged abnormal ends. The
conclusion was inescapable: genetic exchanges of charac-
ters such as eye color involve the physical exchange of
chromosome arms, a phenomenon called crossing over.
Crossing over creates new combinations of genes, and is
thus a form of genetic recombination.
The chromosomal exchanges Stern demonstrated pro-
vide the solution to the paradox, because crossing over
can occur between homologues anywhere along the
length of the chromosome, in locations that seem to be
randomly determined. Thus, if two different genes are
located relatively far apart on a chromosome, crossing
over is more likely to occur somewhere between them
than if they are located close together. Two genes can be
on the same chromosome and still show independent as-
sortment if they are located so far apart on the chromo-
some that crossing over occurs regularly between them
(figure 13.32).
264 Part IV Reproduction and Heredity
car
B
car
+
B
+
car
+
B
+
car
+
B
+
B
+
B
+
B
+
B
+
B
+
B
+
B
+
B
+
car
+
car
+
car
+
car
+
B
+
B
+
F
1
female
Abnormality at
another locus of
X chromosome
Abnormality at
one locus of
X chromosome
car
B
car
B
car
B
car car car carcarcar
B B
car car
car
No
crossing
over
Crossing over
during meiosis
in F
1
female
Fertilization
by sperm
from carnation
F
1
male
Fertilization
by sperm
from carnation
F
1
male
carnation,
bar
Parental combinations of
both genetic traits and
chromosome abnormalities
carnationnormal bar
Recombinant combinations
of both genetic traits and
chromosome abnormalities
B
FIGURE 13.31
Stern’s experiment demonstrating the physical exchange of chromosomal arms
during crossing over.Stern monitored crossing over between two genes, the recessive
carnation eye color (car) and the dominant bar-shaped eye (B), on chromosomes with
physical peculiarities visible under a microscope. Whenever these genes recombined
through crossing over, the chromosomes recombined as well. Therefore, the
recombination of genes reflects a physical exchange of chromosome arms. The “+”
notation on the alleles refers to the wild-type allele, the most common allele at a
particular gene.
Using Recombination to Make Genetic Maps
Because crossing over is more frequent between two genes
that are relatively far apart than between two that are close
together, the frequency of crossing over can be used to map
the relative positions of genes on chromosomes. In a cross,
the proportion of progeny exhibiting an exchange between
two genes is a measure of the frequency of crossover events
between them, and thus indicates the relative distance sepa-
rating them. The results of such crosses can be used to con-
struct a genetic map that measures distance between genes
in terms of the frequency of recombination. One “map
unit” is defined as the distance within which a crossover
event is expected to occur in an average of 1% of gametes.
A map unit is now called a centimorgan, after Thomas
Hunt Morgan.
In recent times new technologies have allowed geneti-
cists to create gene maps based on the relative positions of
specific gene sequences called restriction sites because they
are recognized by DNA-cleaving enzymes called restriction
endonucleases. Restriction maps, discussed in chapter 19,
have largely supplanted genetic recombination maps for
detailed gene analysis because they are far easier to pro-
duce. Recombination maps remain the method of choice
for genes widely separated on a chromosome.
The Three-Point Cross. In constructing a genetic map,
one simultaneously monitors recombination among three
or more genes located on the same chromosome, referred
to as syntenic genes. When genes are close enough to-
gether on a chromosome that they do not assort indepen-
dently, they are said to be linked to one another. A cross
involving three linked genes is called a three-point cross.
Data obtained by Morgan on traits encoded by genes on
the X chromosome of Drosophila were used by his student
A. H. Sturtevant, to draw the first genetic map (figure
13.33). By convention, the most common allele of a gene is
often denoted with the symbol “+” and is designated as
wild type. All other alleles are denoted with just the spe-
cific letters.
Chapter 13 Patterns of Inheritance 265
Chromosome
number
Flower color
Location of genes
1
Seed color
2
3
Flower position
4
Pod shape Plant
height
Pod color
5
6
7
Seed shape
FIGURE 13.32
The chromosomal locations of the seven genes studied by
Mendel in the garden pea.The genes for plant height and pod
shape are very close to each other and rarely recombine. Plant
height and pod shape were not among the characters Mendel
examined in dihybrid crosses. One wonders what he would have
made of the linkage he surely would have detected had he tested
these characters.
Five
traits
y Yellow body color
w White eye color
v Vermilion eye color
m Miniature wing
r Rudimentary wing
Recombination
frequencies
y and w 0.010
v and m 0.030
v and r 0.269
v and w 0.300
v and y 0.322
w and m 0.327
y and m 0.355
w and r 0.450
Genetic
map
.58
.34
.31
.01
0
r
m
v
w
y
FIGURE 13.33
The first genetic map.This map of
the X chromosome of Drosophilawas
prepared in 1913 by A. H. Sturtevant, a
student of Morgan. On it he located
the relative positions of five recessive
traits that exhibited sex linkage by
estimating their relative recombination
frequencies in genetic crosses.
Sturtevant arbitrarily chose the
position of the yellowgene
as zero on his map to provide a frame
of reference. The higher the
recombination frequency, the farther
apart the two genes.
Analyzing a Three-Point Cross. The first genetic map
was constructed by A. H. Sturtevant, a student of Morgan’s
in 1913. He studied several traits of Drosophila, all of which
exhibited sex linkage and thus were encoded by genes re-
siding on the same chromosome (the X chromosome).
Here we will describe his study of three traits: y, yellow
body color (the normal body color is gray), w, white eye
color (the normal eye color is red), and m, miniature wing
(the normal wing is 50% longer).
Sturtevant carried out the mapping cross by crossing a
female fly homozygous for the three recessive alleles with a
normal male fly that carried none of them. All of the prog-
eny were heterozygotes. Such a cross is conventionally rep-
resented by a diagram like the one that follows, in which
the lines represent gene locations and + indicates the nor-
mal, or “wild-type” allele. Each female fly participating in a
cross possesses two homologous copies of the chromosome
being mapped, and both chromosomes are represented in
the diagram. Crossing over occurs between these two
copies in meiosis.
y w m
×
y
+
w
+
m
+
P generation _______ _______
y w m (Y chromosome)
↓
y w m
F
1
generation _______
females y
+
w
+
m
+
These heterozygous females, the F
1
generation, are the
key to the mapping procedure. Because they are heterozy-
gous, any crossing over that occurs during meiosis will, if it
occurs between where these genes are located, produce ga-
metes with different combinations of alleles for these
genes—in other words, recombinant chromosomes. Thus,
a crossover between the homologous X chromosomes of
such a female in the interval between the y and w genes will
yield recombinant [ yw
+
] and [ y
+
w] chromosomes, which
are different combinations than we started with. In the dia-
gram below, the crossed lines between the chromosomes
indicate where the crossover occurs. (In the parental chro-
mosomes of this cross, w is always linked with y and y
+
linked with w
+
.)
y w m y w
+
m
+
→
_______
y
+
w
+
m
+
y
+
w m
In order to see all the recombinant types that might be
present among the gametes of these heterozygous flies,
Sturtevant conducted a testcross. He crossed female het-
erozygous flies to males recessive for all three traits and
examined the progeny. Because males contribute either a
Y chromosome with no genes on it or an X chromosome
with recessive alleles at all three loci, the male contribu-
tion does not disguise the potentially recombinant female
chromosomes.
Table 13.3 summarizes the results Sturtevant obtained.
The parentals are represented by the highest number of
progeny and the double crossovers (progeny in which two
crossovers occurred) by the lowest number. To analyze his
data, Sturtevant considered the traits in pairs and deter-
mined which involved a crossover event.
1. For the body trait ( y) and the eye trait (w), the first
two classes, [y
+
w
+
] and [y w], involve no crossovers
(they are parental combinations). In table 13.3, no
progeny numbers are tabulated for these two classes
on the “body-eye” column (a dash appears instead).
2. The next two classes have the same body-eye combi-
nation as the parents, [y
+
w
+
] and [y w], so again no
numbers are entered as recombinants under body-eye
crossover type.
3. The next two classes, [y
+
w] and [yw
+
], do not have
the same body-eye combinations as the parent chro-
mosomes, so the observed numbers of progeny are
recorded, 16 and 12, respectively.
4. The last two classes also differ from parental chromo-
somes in body-eye combination, so again the ob-
served numbers of each class are recorded, 1 and 0.
5. The sum of the numbers of observed progeny that
are recombinant for body ( y) and eye (w) is 16 +12 +
1, or 29. Because the total number of progeny is
2205, this represents 29/2205, or 0.01315. The per-
centage of recombination between y and w is thus
1.315%, or 1.3 centimorgans.
To estimate the percentage of recombination between
eye (w) and wing (m), one proceeds in the same manner,
obtaining a value of 32.608%, or 32.6 centimorgans. Simi-
larly, body (y) and wing (m) are separated by a recombina-
tion distance of 33.832%, or 33.8 centimorgans.
From this, then, we can construct our genetic map. The
biggest distance, 33.8 centimorgans, separates the two out-
side genes, which are evidently y and m. The gene w is be-
tween them, near y.
y w m
1.3 32.6
33.8
The two distances 1.3 and 32.6 do not add up to 33.8
but rather to 33.9. The difference, 0.1, represents chromo-
somes in which two crossovers occurred, one between y and
w and another between w and m. These chromosomes do
not exhibit recombination between yand m.
Genetic maps such as this are key tools in genetic analy-
sis, permitting an investigator reliably to predict how a
newly discovered trait, once it has been located on the
chromosome map, will recombine with many others.
266 Part IV Reproduction and Heredity
The Human Genetic Map
Genetic maps of human chromosomes (figure 13.34) are of
great importance. Knowing where particular genes are lo-
cated on human chromosomes can often be used to tell
whether a fetus at risk of inheriting a genetic disorder actu-
ally has the disorder. The genetic-engineering techniques
described in chapter 19 have begun to permit investigators
to isolate specific genes and determine their nucleotide se-
quences. It is hoped that knowledge of differences at the
gene level may suggest successful therapies for particular
genetic disorders and that knowledge of a gene’s location
on a chromosome will soon permit the substitution of nor-
mal alleles for dysfunctional ones. Because of the great po-
tential of this approach, investigators are working hard to
assemble a detailed map of the entire human genome, the
Human Genome Project, described in chapter 19. Ini-
tially, this map will consist of a “library” of thousands of
small fragments of DNA whose relative positions are
known. Investigators wishing to study a particular gene will
first use techniques described in chapter 19 to screen this
library and determine which fragment carries the gene of
interest. They will then be able to analyze that fragment in
detail. In parallel with this mammoth undertaking, the
other, smaller genomes have already been sequenced, in-
cluding those of yeasts and several bacteria. Progress on the
human genome is rapid, and the full map is expected within
the next 10 years.
Gene maps locate the relative positions of different
genes on the chromosomes of an organism.
Traditionally produced by analyzing the relative
amounts of recombination in genetic crosses, gene
maps are increasingly being made by analyzing the sizes
of fragments made by restriction enzymes.
Chapter 13 Patterns of Inheritance 267
Table 13.3 Sturtevant’s Results
Phenotypes Crossover Types
Number of
Body Eye Wing Progeny Body-Eye Eye-Wing Body-Wing
Parental y
+
w
+
m
+
758 — — —
ywm 700 — — —
Single crossover y
+
w
+
m 401 — 401 401
ywm
+
317 — 317 317
y
+
wm 16 16 — 16
yw
+
m
+
12 12 — 12
Double crossover y
+
wm
+
111—
yw
+
m 000
TOTAL 2205 29 719 746
Recombination frequency (%) 1.315 32.608 33.832
Duchenne muscular dystrophy
Becker muscular dystrophy
Ichthyosis, X-linked
Placental steroid sulfatase deficiency
Kallmann syndrome
Chondrodysplasia punctata,
X-linked recessive
Hypophosphatemia
Aicardi syndrome
Hypomagnesemia, X-linked
Ocular albinism
Retinoschisis
Adrenal hypoplasia
Glycerol kinase deficiency
Incontinentia pigmenti
Wiskott-Aldrich syndrome
Menkes syndrome
Charcot-Marie-Tooth neuropathy
Choroideremia
Cleft palate, X-linked
Spastic paraplegia, X-linked,
uncomplicated
Deafness with stapes fixation
PRPS-related gout
Lowe syndrome
Lesch-Nyhan syndrome
HPRT-related gout
Hunter syndrome
Hemophilia B
Hemophilia A
G6PD deficiency: favism
Drug-sensitive anemia
Chronic hemolytic anemia
Manic-depressive illness, X-linked
Colorblindness, (several forms)
Dyskeratosis congenita
TKCR syndrome
Adrenoleukodystrophy
Adrenomyeloneuropathy
Emery-Dreifuss muscular dystrophy
Diabetes insipidus, renal
Myotubular myopathy, X-linked
Androgen insensitivity
Chronic granulomatous disease
Retinitis pigmentosa-3
Norrie disease
Retinitis pigmentosa-2
Sideroblastic anemia
Aarskog-Scott syndrome
PGK deficiency hemolytic anemia
Anhidrotic ectodermal dysplasia
Agammaglobulinemia
Kennedy disease
Pelizaeus-Merzbacher disease
Alport syndrome
Fabry disease
Lymphoproliferative syndrome
Albinism-deafness syndrome
Fragile-X syndrome
Immunodeficiency, X-linked,
with hyper IgM
Ornithine transcarbamylase
deficiency
FIGURE 13.34
The human X chromosome gene map.Over 59 diseases have
been traced to specific segments of the X chromosome. Many of
these disorders are also influenced by genes on other
chromosomes.
Human Chromosomes
Each human somatic cell normally has 46 chromosomes,
which in meiosis form 23 pairs. By convention, the chro-
mosomes are divided into seven groups (designated A
through G), each characterized by a different size, shape,
and appearance. The differences among the chromosomes
are most clearly visible when the chromosomes are
arranged in order in a karyotype (figure 13.35). Tech-
niques that stain individual segments of chromosomes with
different-colored dyes make the identification of chromo-
somes unambiguous. Like a fingerprint, each chromosome
always exhibits the same pattern of colored bands.
Human Sex Chromosomes
Of the 23 pairs of human chromosomes, 22 are perfectly
matched in both males and females and are called auto-
somes. The remaining pair, the sex chromosomes, con-
sist of two similar chromosomes in females and two dissim-
ilar chromosomes in males. In humans, females are
designated XX and males XY. One of the sex chromosomes
in the male (the Y chromosome) is highly condensed and
bears few functional genes. Because few genes on the Y
chromosome are expressed, recessive alleles on a male’s
single X chromosome have no active counterpart on the Y
chromosome. Some of the active genes the Y chromosome
does possess are responsible for the features associated with
“maleness” in humans. Consequently, any individual with
at leastone Y chromosome is a male.
Sex Chromosomes in Other Organisms
The structure and number of sex chromosomes vary in dif-
ferent organisms (table 13.4). In the fruit fly Drosophila, fe-
males are XX and males XY, as in humans and most other
vertebrates. However, in birds, the male has two Z chro-
mosomes, and the female has a Z and a W chromosome. In
some insects, such as grasshoppers, there is no Y chromo-
some—females are XX and males are characterized as XO
(the O indicates the absence of a chromosome).
Sex Determination
In humans a specific gene located on the Y chromosome
known as SRY plays a key role in development of male sex-
ual characteristics. This gene is expressed early in develop-
ment, and acts to masculinize genitalia and secondary sex-
ual organs that would otherwise be female. Lacking a Y
chromosome, females fail to undergo these changes.
Among fishes and in some species of reptiles, environ-
mental changes can cause changes in the expression of
this sex-determining gene, and thus of the sex of the
adult individual.
268 Part IV Reproduction and Heredity
FIGURE 13.35
A human karyotype.This karyotype shows the colored banding
patterns, arranged by class A–G.
Table 13.4 Sex Determination in Some Organisms
Female Male
Humans, Drosophila XX XY
Birds ZW ZZ
Grasshoppers XX XO
Honeybees Diploid Haploid
Barr Bodies
Although males have only one copy
of the X chromosome and females
have two, female cells do not produce
twice as much of the proteins en-
coded by genes on the X chromo-
some. Instead, one of the X chromo-
somes in females is inactivated early
in embryonic development, shortly
after the embryo’s sex is determined.
Which X chromosome is inactivated
varies randomly from cell to cell. If a
woman is heterozygous for a sex-
linked trait, some of her cells will ex-
press one allele and some the other.
The inactivated and highly con-
densed X chromosome is visible as a
darkly staining Barr body attached to
the nuclear membrane (figure 13.36).
X-inactivation is not restricted to humans. The
patches of color on tortoiseshell and calico cats are a fa-
miliar result of this process. The gene for orange coat
color is located on the X chromosome. The O allele spec-
ifies orange fur, and the o allele specifies black fur. Early
in development, one X chromosome is inactivated in the
cells that will become skin cells. If the remaining active X
carries the O allele, then the patch of skin that results
from that cell will have orange fur. If it carries the o al-
lele, then the fur will be black. Because X-inactivation is
a random process, the orange and black patches appear
randomly in the cat’s coat. Because only females have two
copies of the X chromosome, only they can be heterozy-
gous at the O gene, so almost all calico cats are females
(figure 13.37). The exception is male cats that have the
genotype XXY; the XXY genotype is discussed in the
next section. The white on a calico cat is due to the ac-
tion of an allele at another gene, the white spotting gene.
One of the 23 pairs of human chromosomes carries
the genes that determine sex. The gene determining
maleness is located on a version of the sex
chromosome called Y, which has few other
transcribed genes.
Chapter 13 Patterns of Inheritance 269
FIGURE 13.36
Barr bodies.In the developing female embryo, one of the
X chromosomes (determined randomly) condenses and becomes
inactivated. These condensed X chromosomes, called Barr bodies,
then attach to the nuclear membrane.
FIGURE 13.37
A calico cat. The coat coloration of this cat is due to the random
inactivation of her X chromosome during early development. The
female is heterozygous for orange coat color, but because only
one coat color allele is expressed, she exhibits patches of orange
and black fur.
Zygote
MitosisRandom
inactivation
Barr body
Some cells
Other cells
Embryo
XX
Human Abnormalities
Due to Alterations in
Chromosome Number
Occasionally, homologues or sister
chromatids fail to separate properly in
meiosis, leading to the acquisition or
loss of a chromosome in a gamete. This
condition, called primary nondisjunc-
tion, can result in individuals with se-
vere abnormalities if the affected gamete
forms a zygote.
Nondisjunction Involving
Autosomes
Almost all humans of the same sex have
the same karyotype, for the same reason
that all automobiles have engines, trans-
missions, and wheels: other arrange-
ments don’t work well. Humans who have lost even one
copy of an autosome (called monosomics) do not survive
development. In all but a few cases, humans who have
gained an extra autosome (called trisomics) also do not
survive. However, five of the smallest autosomes—those
numbered 13, 15, 18, 21, and 22—can be present in hu-
mans as three copies and still allow the individual to survive
for a time. The presence of an extra chromosome 13, 15, or
18 causes severe developmental defects, and infants with
such a genetic makeup die within a few months. In con-
trast, individuals who have an extra copy of chromosome 21
or, more rarely, chromosome 22, usually survive to adult-
hood. In such individuals, the maturation of the skeletal
system is delayed, so they generally are short and have poor
muscle tone. Their mental development is also affected,
and children with trisomy 21 or trisomy 22 are always men-
tally retarded.
Down Syndrome. The developmental defect produced
by trisomy 21 (figure 13.38) was first described in 1866 by
J. Langdon Down; for this reason, it is called Down syn-
drome (formerly “Down’s syndrome”). About 1 in every
750 children exhibits Down syndrome, and the frequency is
similar in all racial groups. Similar conditions also occur in
chimpanzees and other related primates. In humans, the
defect is associated with a particular small portion of chro-
mosome 21. When this chromosomal segment is present in
three copies instead of two, Down syndrome results. In
97% of the human cases examined, all of chromosome 21 is
present in three copies. In the other 3%, a small portion of
chromosome 21 containing the critical segment has been
added to another chromosome by a process called transloca-
tion (see chapter 18); it exists along with the normal two
copies of chromosome 21. This condition is known as
translocation Down syndrome.
Not much is known about the developmental role of the
genes whose extra copies produces Down syndrome, al-
though clues are beginning to emerge from current re-
search. Some researchers suspect that the gene or genes
that produce Down syndrome are similar or identical to
some of the genes associated with cancer and with
Alzheimer’s disease. The reason for this suspicion is that
one of the human cancer-causing genes (to be described in
chapter 18) and the gene causing Alzheimer’s disease are
located on the segment of chromosome 21 associated with
Down syndrome. Moreover, cancer is more common in
children with Down syndrome. The incidence of leukemia,
for example, is 11 times higher in children with Down syn-
drome than in unaffected children of the same age.
How does Down syndrome arise? In humans, it comes
about almost exclusively as a result of primary nondisjunc-
tion of chromosome 21 during egg formation. The cause of
these primary nondisjunctions is not known, but their inci-
dence, like that of cancer, increases with age (figure 13.39).
In mothers younger than 20 years of age, the risk of giving
birth to a child with Down syndrome is about 1 in 1700; in
mothers 20 to 30 years old, the risk is only about 1 in 1400.
In mothers 30 to 35 years old, however, the risk rises to 1
in 750, and by age 45, the risk is as high as 1 in 16!
Primary nondisjunctions are far more common in
women than in men because all of the eggs a woman will
ever produce have developed to the point of prophase in
meiosis I by the time she is born. By the time she has chil-
dren, her eggs are as old as she is. In contrast, men produce
new sperm daily. Therefore, there is a much greater chance
for problems of various kinds, including those that cause
primary nondisjunction, to accumulate over time in the ga-
metes of women than in those of men. For this reason, the
age of the mother is more critical than that of the father in
couples contemplating childbearing.
270 Part IV Reproduction and Heredity
23 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18
19 20 21 22 X Y
1
FIGURE 13.38
Down syndrome.As shown in this male karyotype, Down syndrome is associated with
trisomy of chromosome 21. A child with Down syndrome sitting on his father’s knee.
Nondisjunction Involving the Sex Chromosomes
Individuals that gain or lose a sex chromosome do not gen-
erally experience the severe developmental abnormalities
caused by similar changes in autosomes. Such individuals
may reach maturity, but they have somewhat abnormal
features.
The X Chromosome. When X chromosomes fail to
separate during meiosis, some of the gametes that are
produced possess both X chromosomes and so are XX ga-
metes; the other gametes that result from such an event
have no sex chromosome and are designated “O”
(figure13.40).
If an XX gamete combines with an X gamete, the re-
sulting XXX zygote develops into a female with one func-
tional X chromosome and two Barr bodies. She is sterile
but usually normal in other respects. If an XX gamete in-
stead combines with a Y gamete, the effects are more seri-
ous. The resulting XXY zygote develops into a sterile
male who has many female body characteristics and, in
some cases, diminished mental capacity. This condition,
called Klinefelter syndrome, occurs in about 1 out of every
500 male births.
If an O gamete fuses with a Y gamete, the resulting OY
zygote is nonviable and fails to develop further because hu-
mans cannot survive when they lack the genes on the X
chromosome. If, on the other hand, an O gamete fuses with
an X gamete, the XO zygote develops into a sterile female
of short stature, with a webbed neck and immature sex or-
gans that do not undergo changes during puberty. The
mental abilities of an XO individual are in the low-normal
range. This condition, called Turner syndrome, occurs
roughly once in every 5000 female births.
The Y Chromosome. The Y chromosome can also fail
to separate in meiosis, leading to the formation of YY ga-
metes. When these gametes combine with X gametes, the
XYY zygotes develop into fertile males of normal appear-
ance. The frequency of the XYY genotype (Jacob’s syn-
drome) is about 1 per 1000 newborn males, but it is ap-
proximately 20 times higher among males in penal and
mental institutions. This observation has led to the highly
controversial suggestion that XYY males are inherently an-
tisocial, a suggestion supported by some studies but not by
others. In any case, most XYY males do not develop pat-
terns of antisocial behavior.
Gene dosage plays a crucial role in development, so
humans do not tolerate the loss or addition of
chromosomes well. Autosome loss is always lethal, and
an extra autosome is with few exceptions lethal too.
Additional sex chromosomes have less serious
consequences, although they can lead to sterility.
Chapter 13 Patterns of Inheritance 271
100.0
30.0
20.0
10.0
Incidence of Down syndrome
per 1000 live births
3.0
2.0
1.0
0.3
15 20 25 30 35
Age of mother
40 45 50
FIGURE 13.39
Correlation between maternal age and the incidence of Down
syndrome.As women age, the chances they will bear a child with
Down syndrome increase. After a woman reaches 35, the
frequency of Down syndrome increases rapidly.
Female
(Triple X
syndrome)
Female
(Turner
syndrome)
Male
(Klinefelter
syndrome)
Nonviable
X
Y
Nondisjunction
Eggs
Male
Female
XX
XY
XX
O
Sperm
XXX XO
XXY OY
FIGURE 13.40
How nondisjunction can produce abnormalities in the
number of sex chromosomes.When nondisjunction occurs
in the production of female gametes, the gamete with two
X chromosomes (XX) produces Klinefelter males (XXY) and
XXX females. The gamete with no X chromosome (O) produces
Turner females (XO) and nonviable OY males lacking any
X chromosome.
Genetic Counseling
Although most genetic disorders cannot yet be cured, we
are learning a great deal about them, and progress toward
successful therapy is being made in many cases. In the ab-
sence of a cure, however, the only recourse is to try to
avoid producing children with these conditions. The
process of identifying parents at risk of producing children
with genetic defects and of assessing the genetic state of
early embryos is called genetic counseling.
If a genetic defect is caused by a recessive allele, how
can potential parents determine the likelihood that they
carry the allele? One way is through pedigree analysis,
often employed as an aid in genetic counseling. By ana-
lyzing a person’s pedigree, it is sometimes possible to es-
timate the likelihood that the person is a carrier for cer-
tain disorders. For example, if one of your relatives has
been afflicted with a recessive genetic disorder such as
cystic fibrosis, it is possible that you are a heterozygous
carrier of the recessive allele for that disorder. When a
couple is expecting a child, and pedigree analysis indi-
cates that both of them have a significant probability of
being heterozygous carriers of a recessive allele responsi-
ble for a serious genetic disorder, the pregnancy is said to
be a high-risk pregnancy. In such cases, there is a sig-
nificant probability that the child will exhibit the clinical
disorder.
Another class of high-risk pregnancies is that in which
the mothers are more than 35 years old. As we have seen,
the frequency of birth of infants with Down syndrome in-
creases dramatically in the pregnancies of older women (see
figure 13.39).
When a pregnancy is diagnosed as being high-risk, many
women elect to undergo amniocentesis, a procedure that per-
mits the prenatal diagnosis of many genetic disorders. In the
fourth month of pregnancy, a sterile hypodermic needle is
inserted into the expanded uterus of the mother, removing a
small sample of the amniotic fluid bathing the fetus (figure
13.41). Within the fluid are free-floating cells derived from
the fetus; once removed, these cells can be grown in cul-
tures in the laboratory. During amniocentesis, the position
of the needle and that of the fetus are usually observed by
means of ultrasound. The sound waves used in ultrasound
are not harmful to mother or fetus, and they permit the per-
son withdrawing the amniotic fluid to do so without damag-
ing the fetus. In addition, ultrasound can be used to examine
the fetus for signs of major abnormalities.
In recent years, physicians have increasingly turned to a
new, less invasive procedure for genetic screening called
chorionic villi sampling. In this procedure, the physician
removes cells from the chorion, a membranous part of the
placenta that nourishes the fetus. This procedure can be
used earlier in pregnancy (by the eighth week) and yields
results much more rapidly than does amniocentesis.
To test for certain genetic disorders, genetic counselors
can look for three things in the cultures of cells obtained
from amniocentesis or chorionic villi sampling. First,
analysis of the karyotype can reveal aneuploidy (extra or
missing chromosomes) and gross chromosomal alterations.
Second, in many cases it is possible to test directly for the
proper functioning of enzymes involved in genetic disorders.
The lack of normal enzymatic activity signals the presence
of the disorder. Thus, the lack of the enzyme responsible
for breaking down phenylalanine signals PKU (phenylke-
272 Part IV Reproduction and Heredity
Amniotic fluid
Fetal cells
Hypodermic
syringe
Uterus
FIGURE 13.41
Amniocentesis.A needle is inserted into
the amniotic cavity, and a sample of
amniotic fluid, containing some free cells
derived from the fetus, is withdrawn into a
syringe. The fetal cells are then grown in
culture and their karyotype and many of
their metabolic functions are examined.
tonuria), the absence of the enzyme responsible for the
breakdown of gangliosides indicates Tay-Sachs disease,
and so forth.
Third, genetic counselors can look for an association
with known genetic markers. For sickle cell anemia, Hunt-
ington’s disease, and one form of muscular dystrophy (a
genetic disorder characterized by weakened muscles), in-
vestigators have found other mutations on the same chro-
mosomes that, by chance, occur at about the same place as
the mutations that cause those disorders. By testing for
the presence of these other mutations, a genetic counselor
can identify individuals with a high probability of possess-
ing the disorder-causing mutations. Finding such muta-
tions in the first place is a little like searching for a needle
in a haystack, but persistent efforts have proved successful
in these three disorders. The associated mutations are de-
tectable because they alter the length of the DNA seg-
ments that restriction enzymes produce when they cut
strands of DNA at particular places (see chapter 18).
Therefore, these mutations produce what are called re-
striction fragment length polymorphisms, or RFLPs
(figure 13.42).
Many gene defects can be detected early in pregnancy,
allowing for appropriate planning by the prospective
parents.
Chapter 13 Patterns of Inheritance 273
Short fragment Medium-length fragment
Cut
Short fragment
Medium-length fragment
Cut Cut
AATTC
CTTAA G
G AATTC
CTTAA G
G AATTC
CTTAA G
G
Gel electrophoresis
Long Short
Cut Cut
Gel electrophoresis
Long Short
Long-length fragment
Long-length fragment
AATTC
CTTAA G
G AATTC
CTTAA G
GAAATTC
TTTAAG
(a) No mutation
(b) Mutation
FIGURE 13.42
RFLPs.Restriction fragment
length polymorphisms (RFLPs)
are playing an increasingly
important role in genetic
identification. In (a), the
restriction endonuclease cuts the
DNA molecule in three places,
producing two fragments. In (b),
the mutation of a single
nucleotide from G to A (see top
fragment) alters a restriction
endonuclease cutting site. Now
the enzyme no longer cuts the
DNA molecule at that site. As a
result, a single long fragment is
obtained, rather than two
shorter ones. Such a change is
easy to detect when the
fragments are subjected to a
technique called gel
electrophoresis.
274 Part IV Reproduction and Heredity
Chapter 13
Summary Questions Media Resources
13.1 Mendel solved the mystery of heredity.
? Koelreuter noted the basic facts of heredity a century
before Mendel. He found that alternative traits
segregate in crosses and may mask each other’s
appearance. Mendel, however, was the first to
quantify his data, counting the numbers of each
alternative type among the progeny of crosses.
? By counting progeny types, Mendel learned that the
alternatives that were masked in hybrids (the F
1
generation) appeared only 25% of the time in the F
2
generation. This finding, which led directly to
Mendel’s model of heredity, is usually referred to as
the Mendelian ratio of 3:1 dominant-to-recessive
traits.
? When two genes are located on different
chromosomes, the alleles assort independently.
? Because phenotypes are often influenced by more
than one gene, the ratios of alternative phenotypes
observed in crosses sometimes deviate from the
simple ratios predicted by Mendel.
1.Why weren’t the implications
of Koelreuter’s results
recognized for a century?
2.What characteristics of the
garden pea made this organism a
good choice for Mendel’s
experiments on heredity?
3.To determine whether a
purple-flowered pea plant of
unknown genotype is
homozygous or heterozygous,
what type of plant should it be
crossed with?
4.In a dihybrid cross between
two heterozygotes, what fraction
of the offspring should be
homozygous recessive for both
traits?
? Some genetic disorders are relatively common in
human populations; others are rare. Many of the
most important genetic disorders are associated with
recessive alleles, which are not eliminated from the
human population, even though their effects in
homozygotes may be lethal.
5.Why is Huntington’s disease
maintained at its current
frequency in human
populations?
13.2 Human genetics follows Mendelian principles.
? The first clear evidence that genes reside on
chromosomes was provided by Thomas Hunt
Morgan, who demonstrated that the segregation of
the white-eye trait in Drosophilais associated with the
segregation of the X chromosome, which is involved
in sex determination.
? The first genetic evidence that crossing over occurs
between chromosomes was provided by Curt Stern,
who showed that when two Mendelian traits
exchange during a cross, so do visible abnormalities
on the ends of the chromosomes bearing those traits.
? The frequency of crossing over between genes can be
used to construct genetic maps.
? Primary nondisjunction results when chromosomes
do not separate during meiosis, leading to gametes
with missing or extra chromosomes. In humans, the
loss of an autosome is invariably fatal.
6.When Morgan crossed a
white-eyed male fly with a
normal red-eyed female, and
then crossed two of the red-eyed
progeny, about
1
?4of the
offspring were white-eyed—but
they were ALL male! Why?
7.What is primary
nondisjunction? How is it
related to Down syndrome?
8.Is an individual with
Klinefelter syndrome genetically
male or female? Why?
13.3 Genes are on chromosomes.
http://www.mhhe.com/raven6e http://www.biocourse.com
? Exploration: Heredity
in families
? Introduction to
Classic Genetics
? Monohybrid Cross
? Dihybrid Cross
? Experiments:
Probability and
Hypothesis Testing in
Biology
? Beyond Mendel
? On Science Article:
Advances in Gene
Therapy
? Experiment: Muller-
Lethal Mutations in
Populations
? Exploration: Down
Syndrome
? Exploration:
Constructing a
Genetic Map
? Exploration: Gene
Segregation within
families
? Exploration: Making
a Restriction Map
? Exploration: Cystic
Fibrosis
? Recombination
? Introduction to
Chromosomes Sex
Chromosomes
? Abnormal
Chromosomes
Mendelian Genetics Problems
cow in the herd has horns. Some of the calves born
that year, however, grow horns. You remove them
from the herd and make certain that no horned adult
has gotten into your pasture. Despite your efforts,
more horned calves are born the next year. What is
the reason for the appearance of the horned calves? If
your goal is to maintain a herd consisting entirely of
polled cattle, what should you do?
4. An inherited trait among humans in Norway causes
affected individuals to have very wavy hair, not unlike
that of a sheep. The trait, called woolly, is very evident
when it occurs in families; no child possesses woolly
hair unless at least one parent does. Imagine you are a
Norwegian judge, and you have before you a woolly-
haired man suing his normal-haired wife for divorce
because their first child has woolly hair but their sec-
ond child has normal hair. The husband claims this
constitutes evidence of his wife’s infidelity. Do you
accept his claim? Justify your decision.
5. In human beings, Down syndrome, a serious develop-
mental abnormality, results from the presence of
three copies of chromosome 21 rather than the usual
two copies. If a female exhibiting Down syndrome
mates with a normal male, what proportion of her
offspring would you expect to be affected?
6. Many animals and plants bear recessive alleles for al-
binism, a condition in which homozygous individuals
lack certain pigments. An albino plant, for example,
lacks chlorophyll and is white, and an albino human
lacks melanin. If two normally pigmented persons het-
erozygous for the same albinism allele marry, what pro-
portion of their children would you expect to be albino?
7. You inherit a racehorse and decide to put him out to
stud. In looking over the stud book, however, you
discover that the horse’s grandfather exhibited a rare
disorder that causes brittle bones. The disorder is
hereditary and results from homozygosity for a reces-
sive allele. If your horse is heterozygous for the allele,
it will not be possible to use him for stud because the
genetic defect may be passed on. How would you de-
termine whether your horse carries this allele?
8. In the fly Drosophila, the allele for dumpy wings (d) is
recessive to the normal long-wing allele (d
+
), and the
allele for white eye (w) is recessive to the normal red-
eye allele (w
+
). In a cross of d
+
d
+
w
+
w × d
+
dww, what
proportion of the offspring are expected to be “nor-
mal” (long wings, red eyes)? What proportion are ex-
pected to have dumpy wings and white eyes?
9. Your instructor presents you with a Drosophila with
red eyes, as well as a stock of white-eyed flies and an-
other stock of flies homozygous for the red-eye allele.
You know that the presence of white eyes in Drosophila
is caused by homozygosity for a recessive allele. How
would you determine whether the single red-eyed fly
was heterozygous for the white-eye allele?
Chapter 13 Patterns of Inheritance 275
P generation
Round
seeds
Wrinkled
seeds
F
1
generation
(all round seeds)
F
2
generation
Round seeds (3) Wrinkled seeds (1)
2. The annual plant Haplopappus gracilis has two pairs of
chromosomes (1 and 2). In this species, the probabil-
ity that two characters a and b selected at random will
be on the same chromosome is equal to the probabil-
ity that they will both be on chromosome 1 (
1
?2 ×
1
?2 =
1
?4, or 0.25), plus the probability that they will both be
on chromosome 2 (also
1
?2 ×
1
?2 =
1
?4, or 0.25), for an
overall probability of
1
?2, or 0.5. In general, the proba-
bility that two randomly selected characters will be
on the same chromosome is equal to
1
?n where n is the
number of chromosome pairs. Humans have 23 pairs
of chromosomes. What is the probability that any
two human characters selected at random will be on
the same chromosome?
3. Among Hereford cattle there is a dominant allele
called polled; the individuals that have this allele lack
horns. Suppose you acquire a herd consisting entirely
of polled cattle, and you carefully determine that no
1. The illustration below describes Mendel’s cross of
wrinkled and round seed characters. (Hint: Do you ex-
pect all the seeds in a pod to be the same?) What is
wrong with this diagram?
10. Some children are born with recessive traits (and,
therefore, must be homozygous for the recessive al-
lele specifying the trait), even though neither of the
parents exhibits the trait. What can account for
this?
11. You collect two individuals of Drosophila, one a
young male and the other a young, unmated female.
Both are normal in appearance, with the red eyes
typical of Drosophila. You keep the two flies in the
same bottle, where they mate. Two weeks later, the
offspring they have produced all have red eyes.
From among the offspring, you select 100 individu-
als, some male and some female. You cross each in-
dividually with a fly you know to be homozygous
for the recessive allele sepia, which produces black
eyes when homozygous. Examining the results of
your 100 crosses, you observe that in about half of
the crosses, only red-eyed flies were produced. In
the other half, however, the progeny of each cross
consists of about 50% red-eyed flies and 50%
black-eyed flies. What were the genotypes of your
original two flies?
12. Hemophilia is a recessive sex-linked human blood
disease that leads to failure of blood to clot nor-
mally. One form of hemophilia has been traced to
the royal family of England, from which it spread
throughout the royal families of Europe. For the
purposes of this problem, assume that it originated
as a mutation either in Prince Albert or in his wife,
Queen Victoria.
a. Prince Albert did not have hemophilia. If the dis-
ease is a sex-linked recessive abnormality, how
could it have originated in Prince Albert, a male,
who would have been expected to exhibit sex-
linked recessive traits?
b. Alexis, the son of Czar Nicholas II of Russia and
Empress Alexandra (a granddaughter of Victoria),
had hemophilia, but their daughter Anastasia did
not. Anastasia died, a victim of the Russian revo-
lution, before she had any children. Can we as-
sume that Anastasia would have been a carrier of
the disease? Would your answer be different if
the disease had been present in Nicholas II or in
Alexandra?
13. In 1986, National Geographic magazine conducted a
survey of its readers’ abilities to detect odors. About
7% of Caucasians in the United States could not
smell the odor of musk. If neither parent could smell
musk, none of their children were able to smell it. On
the other hand, if the two parents could smell musk,
their children generally could smell it, too, but a few
of the children in those families were unable to smell
it. Assuming that a single pair of alleles governs this
trait, is the ability to smell musk best explained as an
example of dominant or recessive inheritance?
14. A couple with a newborn baby is troubled that the
child does not resemble either of them. Suspecting
that a mix-up occurred at the hospital, they check the
blood type of the infant. It is type O. As the father is
type A and the mother type B, they conclude a mix-
up must have occurred. Are they correct?
15. Mabel’s sister died of cystic fibrosis as a child. Mabel
does not have the disease, and neither do her parents.
Mabel is pregnant with her first child. If you were a
genetic counselor, what would you tell her about the
probability that her child will have cystic fibrosis?
16. How many chromosomes would you expect to find in
the karyotype of a person with Turner syndrome?
17. A woman is married for the second time. Her first
husband has blood type A and her child by that
marriage has type O. Her new husband has type B
blood, and when they have a child its blood type is
AB. What is the woman’s blood genotype and blood
type?
18. Two intensely freckled parents have five children.
Three eventually become intensely freckled and two
do not. Assuming this trait is governed by a single
pair of alleles, is the expression of intense freckles
best explained as an example of dominant or recessive
inheritance?
19. Total color blindness is a rare hereditary disorder
among humans. Affected individuals can see no col-
ors, only shades of gray. It occurs in individuals ho-
mozygous for a recessive allele, and it is not sex-
linked. A man whose father is totally color blind
intends to marry a woman whose mother is totally
color blind. What are the chances they will produce
offspring who are totally color blind?
20. A normally pigmented man marries an albino woman.
They have three children, one of whom is an albino.
What is the genotype of the father?
21. Four babies are born in a hospital, and each has a dif-
ferent blood type: A, B, AB, and O. The parents of
these babies have the following pairs of blood groups:
A and B, O and O, AB and O, and B and B. Which
baby belongs to which parents?
22. A couple both work in an atomic energy plant, and
both are exposed daily to low-level background radia-
tion. After several years, they have a child who has
Duchenne muscular dystrophy, a recessive genetic
defect caused by a mutation on the X chromosome.
Neither the parents nor the grandparents have the
disease. The couple sue the plant, claiming that
the abnormality in their child is the direct result of
radiation-induced mutation of their gametes, and that
the company should have protected them from this
radiation. Before reaching a decision, the judge hear-
ing the case insists on knowing the sex of the child.
Which sex would be more likely to result in an award
of damages, and why?
276 Part IV Reproduction and Heredity
277
Can Cancer Tumors Be
Starved to Death?
One of the most exciting recent developments in the war
against cancer is the report that it might be possible to
starve cancer tumors to death. Many laboratories have
begun to look into this possibility, although it’s not yet
clear that the approach will actually work to cure cancer.
One of the most exciting and frustrating things about
watching a developing science story like this one is that you
can't flip ahead and read the ending—in the real world of
research, you never know how things are going to turn out.
This story starts when a Harvard University researcher,
Dr. Judah Folkman, followed up on a familiar observation
made by many oncologists (cancer specialists), that removal
of a primary tumor often leads to more rapid growth of
secondary tumors. "Perhaps," Folkman reasoned, "the pri-
mary tumor is producing some substance that inhibits the
growth of the other tumors." Such a substance could be a
powerful weapon against cancer.
Folkman set out to see if he could isolate a chemical
from primary tumors that inhibited the growth of sec-
ondary ones. Three years ago he announced he had found
two. He called them angiostatin and endostatin.
To understand how these two proteins work, put your-
self in the place of a tumor. To grow, a tumor must obtain
from the body's blood supply all the food and nutrients it
needs to make more cancer cells. To facilitate this neces-
sary grocery shopping, tumors leak out substances into the
surrounding tissues that encourage angiogenesis, the for-
mation of small blood vessels. This call for more blood
vessels insures an ever-greater flow of blood to the tumor
as it grows larger.
When examined, Folkman's two cancer inhibitors
turned out to be angiogenesis inhibitors. Angiostatin and
endostatin kill a tumor by cutting off its blood supply.
This may sound like an unlikely approach to curing cancer,
but think about it—the cells of a growing tumor require a
plentiful supply of food and nutrients to fuel their produc-
tion of new cancer cells. Cut this off, and the tumor cells
die, literally starving to death.
By producing factors like angiostatin and endostatin, the
primary tumor holds back the growth of any competing
tumors, allowing the primary tumor to hog the available
resources for its own use (see above).
In laboratory tests the angiogenesis inhibitors caused
tumors in mice to regress to microscopic size, a result that
electrified researchers all over the world. Other scientists
were soon trying to replicate this exciting result. Some
have succeeded, others not. Five major laboratories have
isolated their own angiogenesis inhibitors and published
findings of antitumor activity. The National Cancer
Institute is proceeding with tests of angiostatin and other
angiogenesis inhibitors in humans. Preliminary results
are encouraging. While not a cure-all for all cancers,
angiogenesis inhibitors seem very effective against some,
particularly solid-tumor cancers.
Gaining a better understanding of how tumors induce
angiogenesis has become a high priority of cancer research.
One promising line of research concerns hypoxia. As a solid
tumor grows and outstrips its blood supply, its interior be-
comes hypoxic (oxygen depleted). In response to hypoxia, it
appears that genes are turned on that promote survival
under low oxygen pressure, including ones that increase
blood flow to the tumor by promoting angiogenesis. Un-
derstanding this process may give important clues as to
how angiogenesis inhibitors work to inhibit tumor growth.
So how does a lowering of oxygen pressure within a
tumor promote blood vessel formation? Dr. Randall Johnson
of the University of California, San Diego, is studying one
important response by a tumor to hypoxia—the induction
of a gene-specific transcription factor (that is, a protein that
activates the transcription of a particular gene) that pro-
motes angiogenesis. Called HIF-1, for hypoxia inducible
factor-1, this transcription factor appears to induce the tran-
scription of genes necessary for blood vessel formation.
Part
1. Primary tumor
produces the
angiogenesis
inhibitor
endostatin.
2. Endostatin
inhibits formation
of new blood
vessels.
3. Lacking a blood
supply,
secondary tumor
cannot grow.
Primary tumor
Secondary
tumor
Muscle
tissue
Blood
vessel
2
3
1
V
Molecular Genetics
How primary tumors kill off the competition.Tumors require
an ample blood supply to fuel their growth. The growth of new
blood vessels is called angiogenesis. Inhibiting angiogenesis offers
a possible way to block tumor growth.
Real People Doing Real Science
The Experiment
In order to examine the involvement of the hypoxia-
inducible transcriptional factor (HIF-1) in angiogenesis,
Johnson and his co-workers were faced with the problem
that HIF-1 has many other effects on cell growth. To get a
clear look at its role in angiogenesis, the researchers turned
to embryonic stem cells. Embryonic stem cells are cells
harvested from early embryos, before they have differenti-
ated, while they are still capable of unlimited division. Be-
cause such stem cells have the capacity to form tumors (ter-
atocarcinomas) when injected into certain kinds of mice,
they offer a good natural laboratory in which to study how
HIF-1 might influence cancer growth. The research team
first prepared a mutant HIF-1 embryonic stem cell line in
which the function of the transcription factor encoded by
HIF-1 was completely destroyed or null.
The researchers then grew these HIF-1 null stem cells
under hypoxic conditions. If HIF-1 genes indeed foster
tumor growth in normal cells by promoting angiogenesis,
then it would be expected that these nullcells would be un-
able to promote tumor growth in this way.
The researchers tested the ability of null cells to
promote tumor growth by injecting HIF-1α null cells into
laboratory mice, and in control experiments injecting wild-
type stem cells. The injected cells were allowed to grow
and form tumors in both null and control host animals.
The tumors that formed were then examined and measured
for differences.
To get a closer look at what was really going on, the null
and wild-type cells were compared in their ability to actually
form new blood vessels. This was done by examining levels
of mRNA of a growth factor that plays a key role in the for-
mation and growth of blood vessels. This factor is a protein
called vascular endothelial growth factor (VEGF). The lev-
els of VEGF mRNA in the cells were determined by
hybridizing cDNA VEGF probes to mRNA isolated from
tumors, and measuring in each instance how much tumor
mRNA bound to the cDNA probe. In parallel studies, anti-
bodies were used to determine levels of VEGF protein.
The Results
The researchers found that the nullcells were greatly compro-
mised in their ability to form tumors compared to the wild-
type cells with the effects becoming more significant over time
(see graph a above). Tumors were five times larger in wild-
type cells than in the HIF-1 null cells after 21 days. Clearly
knocking out HIF-1 retards tumor growth significantly.
This decrease in the size of tumors produced by null
cells is further supported by the results of the VEGF pro-
tein analysis (see graph b above). Levels of the protein
VEGF rise in wild-type cells under conditions of hypoxia,
increasing the immediate availability of oxygen to the
tumor by promoting capillary formation. The researchers
found levels of VEGF protein were lower in null cell tu-
mors, and responded to hypoxia at a lower rate.
Both the decrease in tumor size and the lower level of
VEGF in the HIF-1 null cells supports the hypothesis that
HIF-1 plays an essential role in promoting angiogenesis in
a tumor, responding to a hypoxic condition by increasing
the levels of VEGF.
Do the angiogenesis inhibitors like angiostatin, being
tested as cancer cures, in fact act by inhibiting VEGF? The
sorts of experiments being carried out in Johnson’s labora-
tory, and in many other cancer centers, should soon cast
light on this still-murky question.
9 days 21 days
Days in culture
3
4
5
T
umor weight (g)
6
0
2
1
48
Hours of hypoxic treatment
72
75
150
225
VEGF (pg/ml)
300
0
Wild-type cells
HIF-1α null cells
Wild-type cells
HIF-1α null cells
(b)(a)
Tumor growth in HIF-1α null cells and wild-type cells. (a) The size of tumors formed by the HIF-1α null cells were significantly
smaller compared to those formed by wild-type cells. (b) HIF-1α nullcells had significantly lower levels of VEGF protein production
under hypoxic conditions compared to wild-type cells. VEGF promotes the formation of capillaries.
To explore this experiment further,
go to the Virtual Lab at
www.mhhe.com/raven6/vlab5.mhtml
279
14
DNA: The Genetic
Material
Concept Outline
14.1 What is the genetic material?
The Hammerling Experiment: Cells Store Hereditary
Information in the Nucleus
Transplantation Experiments: Each Cell Contains a
Full Set of Genetic Instructions
The Griffith Experiment: Hereditary Information Can
Pass between Organisms
The Avery and Hershey-Chase Experiments: The
Active Principle Is DNA
14.2 What is the structure of DNA?
The Chemical Nature of Nucleic Acids. Nucleic acids
are polymers containing four nucleotides.
The Three-Dimensional Structure of DNA. The
DNA molecule is a double helix, with two strands
held together by base-pairing.
14.3 How does DNA replicate?
The Meselson–Stahl Experiment: DNA Replication Is
Semiconservative
The Replication Process. DNA is replicated by the
enzyme DNA polymerase III, working in concert
with many other proteins. DNA replicates by
assembling a complementary copy of each strand
semidiscontinuously.
Eukaryotic DNA Replication. Eukaryotic
chromosomes consist of many zones of replication.
14.4 What is a gene?
The One-Gene/One-Polypeptide Hypothesis. A gene
encodes all the information needed to express a
functional protein or RNA molecule.
How DNA Encodes Protein Structure. The
nucleotide sequence of a gene dictates the amino acid
sequence of the protein it encodes.
T
he realization that patterns of heredity can be ex-
plained by the segregation of chromosomes in meio-
sis raised a question that occupied biologists for over 50
years: What is the exact nature of the connection between
hereditary traits and chromosomes? This chapter de-
scribes the chain of experiments that have led to our cur-
rent understanding of the molecular mechanisms of
heredity (figure 14.1). The experiments are among the
most elegant in science. Just as in a good detective story,
each conclusion has led to new questions. The intellectual
path taken has not always been a straight one, the best
questions not always obvious. But however erratic and
lurching the course of the experimental journey, our pic-
ture of heredity has become progressively clearer, the
image more sharply defined.
FIGURE 14.1
DNA.The hereditary blueprint in each cell of all living
organisms is a very long, slender molecule called deoxyribonucleic
acid (DNA).
In this experiment, the initial flower-shaped cap was
somewhat intermediate in shape, unlike the disk-shaped
caps of subsequent generations. Hammerling speculated
that this initial cap, which resembled that of A. crenulata,
was formed from instructions already present in the trans-
planted stalk when it was excised from the original A.
crenulata cell. In contrast, all of the caps that regenerated
subsequently used new information derived from the foot
of the A. mediterraneacell the stalk had been grafted onto.
In some unknown way, the original instructions that had
been present in the stalk were eventually “used up.” We
now understand that genetic instructions (in the form of
messenger RNA, discussed in chapter 15) pass from the nu-
cleus in the foot upward through the stalkto the developing
cap.
Hereditary information in Acetabularia is stored in the
foot of the cell, where the nucleus resides.
280 Part V Molecular Genetics
The Hammerling Experiment: Cells
Store Hereditary Information in the
Nucleus
Perhaps the most basic question one can ask about heredi-
tary information is where it is stored in the cell. To answer
this question, Danish biologist Joachim Hammerling,
working at the Max Plank Institute for Marine Biology in
Berlin in the 1930s, cut cells into pieces and observed the
pieces to see which were able to express hereditary infor-
mation. For this experiment, Hammerling needed cells
large enough to operate on conveniently and differentiated
enough to distinguish the pieces. He chose the unicellular
green alga Acetabularia, which grows up to 5 cm, as a
model organism for his investigations. Just as Mendel
used pea plants and Sturtevant used fruit flies as model or-
ganisms, Hammerling picked an organism that was suited
to the specific experimental question he wanted to answer,
assuming that what he learned could then be applied to
other organisms.
Individuals of the genus Acetabulariahave distinct foot,
stalk, and cap regions; all are differentiated parts of a sin-
gle cell. The nucleus is located in the foot. As a prelimi-
nary experiment, Hammerling amputated the caps of
some cells and the feet of others. He found that when he
amputated the cap, a new cap regenerated from the re-
maining portions of the cell (foot and stalk). When he
amputated the foot, however, no new foot regenerated
from the cap and stalk. Hammerling, therefore, hypothe-
sized that the hereditary information resided within the
foot of Acetabularia.
Surgery on Single Cells
To test his hypothesis, Hammerling selected individuals
from two species of the genus Acetabularia in which the
caps look very different from one another: A. mediterranea
has a disk-shaped cap, and A. crenulata has a branched,
flower-like cap. Hammerling grafted a stalk from A. crenu-
lata to a foot from A. mediterranea (figure 14.2). The cap
that regenerated looked somewhat like the cap of A. crenu-
lata,though not exactly the same.
Hammerling then cut off this regenerated cap and
found that a disk-shaped cap exactly like that of A.
mediterranea formed in the second regeneration and in
every regeneration thereafter. This experiment supported
Hammerling’s hypothesis that the instructions specifying
the kind of cap are stored in the foot of the cell, and that
these instructions must pass from the foot through the
stalk to the cap.
14.1 What is the genetic material?
Nucleus in base determines
type of cap regenerated
A. crenulata A. mediterranea
FIGURE 14.2
Hammerling’s Acetabularia reciprocal graft experiment.
Hammerling grafted a stalk of each species of Acetabulariaonto
the foot of the other species. In each case, the cap that eventually
developed was dictated by the nucleus-containing foot rather than
by the stalk.
Transplantation Experiments: Each
Cell Contains a Full Set of Genetic
Instructions
Because the nucleus is contained in the foot of Acetabu-
laria, Hammerling’s experiments suggested that the nu-
cleus is the repository of hereditary information in a cell.
A direct test of this hypothesis was carried out in 1952 by
American embryologists Robert Briggs and Thomas
King. Using a glass pipette drawn to a fine tip and work-
ing with a microscope, Briggs and King removed the nu-
cleus from a frog egg. Without the nucleus, the egg did
not develop. However, when they replaced the nucleus
with one removed from a more advanced frog embryo
cell, the egg developed into an adult frog. Clearly, the
nucleus was directing the egg’s development (fig-
ure14.3).
Successfully Transplanting Nuclei
Can every nucleus in an organism direct the development
of an entire adult individual? The experiment of Briggs and
King did not answer this question definitively, because the
nuclei they transplanted from frog embryos into eggs often
caused the eggs to develop abnormally. Two experiments
performed soon afterward gave a clearer answer to the
question. In the first, John Gurdon, working with another
species of frog at Oxford and Yale, transplanted nuclei
from tadpole cells into eggs from which the nuclei had
been removed. The experiments were difficult—it was nec-
essary to synchronize the division cycles of donor and host.
However, in many experiments, the eggs went on to de-
velop normally, indicating that the nuclei of cells in later
stages of development retain the genetic information nec-
essary to direct the development of all other cells in an in-
dividual.
Totipotency in Plants
In the second experiment, F. C. Steward at Cornell Uni-
versity in 1958 placed small fragments of fully developed
carrot tissue (isolated from a part of the vascular system
called the phloem) in a flask containing liquid growth
medium. Steward observed that when individual cells broke
away from the fragments, they often divided and developed
into multicellular roots. When he immobilized the roots by
placing them in a solid growth medium, they went on to
develop normally into entire, mature plants. Steward’s ex-
periment makes it clear that, even in adult tissues, the nu-
clei of individual plant cells are “totipotent”—each contains
a full set of hereditary instructions and can generate an en-
tire adult individual. As you will learn in chapter 19, animal
cells, like plant cells, can be totipotent, and a single adult
animal cell can generate an entire adult animal.
Hereditary information is stored in the nucleus of
eukaryotic cells. Each nucleus in any eukaryotic cell
contains a full set of genetic instructions.
Chapter 14 DNA: The Genetic Material 281
Egg
(two nucleoli)
Tadpole
(one nucleolus)
UV light destroys
nucleus, or it is removed
with micropipette.
Epithelial cells are
isolated from
tadpole intestine.
Nucleus is
removed
in micropipette.
Epithelial cell nucleus
is inserted into
enucleate egg.
No growth
Embryo
Embryo
Tadpole
Abnormal
embryo
Occasionally, an adult
frog develops. Its cells
possess one nucleolus.
1
2
3
FIGURE 14.3
Briggs and King’s nuclear transplant experiment.Two strains of frogs were used that differed from each other in the number of
nucleoli their cells possessed. The nucleus was removed from an egg of one strain, either by sucking the egg nucleus into a micropipette
or, more simply, by destroying it with ultraviolet light. A nucleus obtained from a differentiated cell of the other strain was then injected
into this enucleate egg. The hybrid egg was allowed to develop. One of three results was obtained in individual experiments: (1) no growth
occurred, perhaps reflecting damage to the egg cell during the nuclear transplant operation; (2) normal growth and development occurred
up to an early embryo stage, but subsequent development was not normal and the embryo did not survive; and (3) normal growth and
development occurred, eventually leading to the development of an adult frog. That frog was of the strain that contributed the nucleus and
not of the strain that contributed the egg. Only a few experiments gave this third result, but they serve to clearly establish that the nucleus
directs frog development.
The Griffith Experiment:
Hereditary Information Can Pass
between Organisms
The identification of the nucleus as the repository of
hereditary information focused attention on the chromo-
somes, which were already suspected to be the vehicles of
Mendelian inheritance. Specifically, biologists wondered
how the genes, the units of hereditary information studied
by Mendel, were actually arranged in the chromosomes.
They knew that chromosomes contained both protein and
deoxyribonucleic acid (DNA). Which of these held the
genes? Starting in the late 1920s and continuing for about
30 years, a series of investigations addressed this question.
In 1928, British microbiologist Frederick Griffith made
a series of unexpected observations while experimenting
with pathogenic (disease-causing) bacteria. When he in-
fected mice with a virulent strain of Streptococcus pneumoniae
bacteria (then known as Pneumococcus), the mice died of
blood poisoning. However, when he infected similar mice
with a mutant strain of S. pneumoniae that lacked the viru-
lent strain’s polysaccharide coat, the mice showed no ill ef-
fects. The coat was apparently necessary for virulence. The
normal pathogenic form of this bacterium is referred to as
the S form because it forms smooth colonies on a culture
dish. The mutant form, which lacks an enzyme needed to
manufacture the polysaccharide capsule, is called the R
form because it forms rough colonies.
To determine whether the polysaccharide coat itself had
a toxic effect, Griffith injected dead bacteria of the virulent
S strain into mice; the mice remained perfectly healthy. As
a control, he injected mice with a mixture containing dead
S bacteria of the virulent strain and live coatless R bacteria,
each of which by itself did not harm the mice (figure 14.4).
Unexpectedly, the mice developed disease symptoms and
many of them died. The blood of the dead mice was found
to contain high levels of live, virulent Streptococcus type S
bacteria, which had surface proteins characteristic of the
live (previously R) strain. Somehow, the information speci-
fying the polysaccharide coat had passed from the dead,
virulent S bacteria to the live, coatless R bacteria in the
mixture, permanently transforming the coatless R bacteria
into the virulent S variety. Transformation is the transfer
of genetic material from one cell to another and can alter
the genetic makeup of the recipient cell.
Hereditary information can pass from dead cells to
living ones, transforming them.
282 Part V Molecular Genetics
Mice die; their blood
contains live pathogenic
strain of S. pneumoniae
Mixture of heat-killed pathogenic
and live nonpathogenic strains
of S. pneumoniae
+
Heat-killed pathogenic
strain of S. pneumoniae
Live pathogenic
strain of S. pneumoniae
Live nonpathogenic
strain of S. pneumoniae
Polysaccharide
coat
Mice liveMice die Mice live(2)(1) (3) (4)
FIGURE 14.4
Griffith’s discovery of transformation.(1) The pathogenic of the bacterium Streptococcus pneumoniaekills many of the mice it is injected
into. The bacterial cells are covered with a polysaccharide coat, which the bacteria themselves synthesize. (2) Interestingly, an injection of
live, coatless bacteria produced no ill effects. However, the coat itself is not the agent of disease. (3) When Griffith injected mice with dead
bacteria that possessed polysaccharide coats, the mice were unharmed. (4) But when Griffith injected a mixture of dead bacteria with
polysaccharide coats and live bacteria without such coats, many of the mice died, and virulent bacteria with coats were recovered. Griffith
concluded that the live cells had been “transformed” by the dead ones; that is, genetic information specifying the polysaccharide coat had
passed from the dead cells to the living ones.
The Avery and Hershey-Chase
Experiments: The Active Principle
Is DNA
The Avery Experiments
The agent responsible for transforming Streptococcus went
undiscovered until 1944. In a classic series of experiments,
Oswald Avery and his coworkers Colin MacLeod and
Maclyn McCarty characterized what they referred to as the
“transforming principle.” They first prepared the mixture
of dead S Streptococcus and live R Streptococcus that Griffith
had used. Then Avery and his colleagues removed as much
of the protein as they could from their preparation, eventu-
ally achieving 99.98% purity. Despite the removal of nearly
all protein, the transforming activity was not reduced.
Moreover, the properties of the transforming principle re-
sembled those of DNA in several ways:
1. When the purified principle was analyzed chemically,
the array of elements agreed closely with DNA.
2. When spun at high speeds in an ultracentrifuge, the
transforming principle migrated to the same level
(density) as DNA.
3. Extracting the lipid and protein from the purified
transforming principle did not reduce its activity.
4. Protein-digesting enzymes did not affect the princi-
ple’s activity; nor did RNA-digesting enzymes.
5. The DNA-digesting enzyme DNase destroyed all
transforming activity.
The evidence was overwhelming. They concluded that
“a nucleic acid of the deoxyribose type is the fundamental
unit of the transforming principle of Pneumococcus Type
III”—in essence, that DNA is the hereditary material.
The Hershey–Chase Experiment
Avery’s results were not widely accepted at first, as many
biologists preferred to believe that proteins were the repos-
itory of hereditary information. Additional evidence sup-
porting Avery’s conclusion was provided in 1952 by Alfred
Hershey and Martha Chase, who experimented with bacte-
riophages, viruses that attack bacteria. Viruses, described
in more detail in chapter 33, consist of either DNA or
RNA (ribonucleic acid) surrounded by a protein coat.
When a lytic (potentially cell-rupturing) bacteriophage in-
fects a bacterial cell, it first binds to the cell’s outer surface
and then injects its hereditary information into the cell.
There, the hereditary information directs the production of
thousands of new viruses within the bacterium. The bacter-
ial cell eventually ruptures, or lyses, releasing the newly
made viruses.
To identify the hereditary material injected into bacter-
ial cells at the start of an infection, Hershey and Chase used
the bacteriophage T2, which contains DNA rather than
RNA. They labeled the two parts of the viruses, the DNA
and the protein coat, with different radioactive isotopes
that would serve as tracers. In some experiments, the
viruses were grown on a medium containing an isotope of
phosphorus,
32
P, and the isotope was incorporated into the
phosphate groups of newly synthesized DNA molecules.
In other experiments, the viruses were grown on a medium
containing
35
S, an isotope of sulfur, which is incorporated
into the amino acids of newly synthesized protein coats.
The
32
P and
35
S isotopes are easily distinguished from each
other because they emit particles with different energies
when they decay.
After the labeled viruses were permitted to infect bacte-
ria, the bacterial cells were agitated violently to remove the
protein coats of the infecting viruses from the surfaces of
the bacteria. This procedure removed nearly all of the
35
S
label (and thus nearly all of the viral protein) from the bac-
teria. However, the
32
P label (and thus the viral DNA) had
transferred to the interior of the bacteria (figure 14.5) and
was found in viruses subsequently released from the in-
fected bacteria. Hence, the hereditary information injected
into the bacteria that specified the new generation of
viruses was DNA and not protein.
Avery’s experiments demonstrate conclusively that
DNA is Griffith’s transforming material. The hereditary
material of bacteriophages is DNA and not protein.
Chapter 14 DNA: The Genetic Material 283
Protein coat
labeled with
35
S
DNA labeled
with
32
P
Bacteriophages infect
bacterial cells.
T2 bacteriophages
are labeled with
radioactive isotopes.
Bacterial cells are
agitated to remove
protein coats.
35
S radioactivity
found in the medium
32
P radioactivity found
in the bacterial cells
FIGURE 14.5
The Hershey and Chase experiment.Hershey and Chase found
that
35
S radioactivity did not enter infected bacterial cellsand
32
P
radioactivity did. They concluded that viral DNA, not protein,was
responsible for directing the production of new viruses.
The Chemical Nature of
Nucleic Acids
A German chemist, Friedrich Miescher, discovered DNA
in 1869, only four years after Mendel’s work was published.
Miescher extracted a white substance from the nuclei of
human cells and fish sperm. The proportion of nitrogen
and phosphorus in the substance was different from that in
any other known constituent of cells, which convinced Mi-
escher that he had discovered a new biological substance.
He called this substance “nuclein,” because it seemed to be
specifically associated with the nucleus.
Levene’s Analysis: DNA Is a Polymer
Because Miescher’s nuclein was slightly acidic, it came to
be called nucleic acid. For 50 years biologists did little
research on the substance, because nothing was known of
its function in cells. In the 1920s, the basic structure of
nucleic acids was determined by the biochemist P. A.
Levene, who found that DNA contains three main com-
ponents (figure 14.6): (1)phosphate (PO
4
) groups;
(2)five-carbon sugars; and (3)nitrogen-containing bases
called purines (adenine, A, and guanine, G) and pyrim-
idines (thymine, T, and cytosine, C; RNA contains
uracil, U, instead of T). From the roughly equal propor-
tions of these components, Levene concluded correctly
that DNA and RNA molecules are made of repeating
units of the three components. Each unit, consisting of a
sugar attached to a phosphate group and a base, is called
a nucleotide. The identity of the base distinguishes one
nucleotide from another.
To identify the various chemical groups in DNA and
RNA, it is customary to number the carbon atoms of the
base and the sugar and then refer to any chemical group
attached to a carbon atom by that number. In the sugar,
four of the carbon atoms together with an oxygen atom
form a five-membered ring. As illustrated in figure 14.7,
the carbon atoms are numbered 1′ to 5′, proceeding
clockwise from the oxygen atom; the prime symbol (′) in-
dicates that the number refers to a carbon in a sugar
rather than a base. Under this numbering scheme, the
phosphate group is attached to the 5′ carbon atom of the
sugar, and the base is attached to the 1′ carbon atom. In
addition, a free hydroxyl (—OH) group is attached to the
3′carbon atom.
The 5′ phosphate and 3′ hydroxyl groups allow DNA
and RNA to form long chains of nucleotides, because
these two groups can react chemically with each other.
The reaction between the phosphate group of one nu-
cleotide and the hydroxyl group of another is a dehydra-
tion synthesis, eliminating a water molecule and forming
a covalent bond that links the two groups (figure 14.8).
The linkage is called a phosphodiester bond because
284 Part V Molecular Genetics
N
N
C
N
C
C
N
C
C
O
–
P
O
HO
O
–
H
HC
H
H
Adenine
H
H
HO
OH
Deoxyribose
(DNA only)
Phosphate
H
O
C
CC
CHH
H
H
OH
NH
2
C
Cytosine
C
N
CH
CH
O
NH
2
N
N
C
N
C
C
C
Guanine
Purines
O
Pyrimidines
N
H
C
Uracil
(RNA only)
CC
H
H
C
O
O
N
HH
N
H
C
Thymine
(DNA only)
C
N
C
H
CH
3
H
C
O
H
H
2
N
O
N
HC
H
HO
OH OH
Ribose
(RNA only)
O
C
CC
CHH
H
H
OH
C
HN
14.2 What is the structure of DNA?
FIGURE 14.6
Nucleotide subunits of DNA and RNA.The nucleotide
subunits of DNA and RNA are composed of three elements: a
five-carbon sugar (deoxyribose in DNA and ribose in RNA), a
phosphate group, and a nitrogenous base (either a purine or a
pyrimidine).
OH
CH
2
O
4H11032
5H11032
3H11032
2H11032
1H11032
PO
4
Base
FIGURE 14.7
Numbering the carbon
atoms in a nucleotide.The
carbon atoms in the sugar of
the nucleotide are numbered
1′to 5′, proceeding clockwise
from the oxygen atom. The
“prime” symbol (′) indicates
that the carbon belongs to the
sugar rather than the base.
the phosphate group is now linked to the
two sugars by means of a pair of ester (P—
O—C) bonds. The two-unit polymer re-
sulting from this reaction still has a free 5′
phosphate group at one end and a free 3′
hydroxyl group at the other, so it can link
to other nucleotides. In this way, many
thousands of nucleotides can join together
in long chains.
Linear strands of DNA or RNA, no mat-
ter how long, will almost always have a free
5′ phosphate group at one end and a free 3′
hydroxyl group at the other. Therefore,
every DNA and RNA molecule has an in-
trinsic directionality, and we can refer un-
ambiguously to each end of the molecule.
By convention, the sequence of bases is usu-
ally expressed in the 5′-to-3′ direction.
Thus, the base sequence “GTCCAT” refers
to the sequence,
5′pGpTpCpCpApT—OH 3′
where the phosphates are indicated by “p.”
Note that this is not the same molecule as
that represented by the reverse sequence:
5′pTpApCpCpTpG—OH 3′
Levene’s early studies indicated that all
four types of DNA nucleotides were present
in roughly equal amounts. This result,
which later proved to be erroneous, led to
the mistaken idea that DNA was a simple polymer in
which the four nucleotides merely repeated (for instance,
GCAT . . . GCAT . . . GCAT . . . GCAT . . .). If the
sequence never varied, it was difficult to see how DNA
might contain the hereditary information; this was why
Avery’s conclusion that DNA is the transforming princi-
ple was not readily accepted at first. It seemed more plau-
sible that DNA was simply a structural element of the
chromosomes, with proteins playing the central genetic
role.
Chargaff’s Analysis: DNA Is Not a
Simple Repeating Polymer
When Levene’s chemical analysis of DNA
was repeated using more sensitive tech-
niques that became available after World
War II, quite a different result was ob-
tained. The four nucleotides were not pre-
sent in equal proportions in DNA mole-
cules after all. A careful study carried out
by Erwin Chargaff showed that the nu-
cleotide composition of DNA molecules
varied in complex ways, depending on the
source of the DNA (table 14.1). This
strongly suggested that DNA was not a
simple repeating polymer and might have
the information-encoding properties ge-
netic material must have. Despite DNA’s
complexity, however, Chargaff observed an
important underlying regularity in double-
stranded DNA: the amount of adenine present
in DNA always equals the amount of thymine,
and the amount of guanine always equals the
amount of cytosine. These findings are com-
monly referred to as Chargaff’s rules:
1. The proportion of A always equals
that of T, and the proportion of G
always equals that of C:
A = T, and G = C.
2. It follows that there is always an
equal proportion of purines (A and
G) and pyrimidines (C and T).
A single strand of DNA or RNA consists of a series of
nucleotides joined together in a long chain. In all
natural double-stranded DNA molecules, the
proportion of A equals that of T, and the proportion of
G equals that of C.
Chapter 14 DNA: The Genetic Material 285
Table 14.1 Chargaff’s Analysis of DNA Nucleotide Base Compositions
Base Composition (Mole Percent)
Organism A T G C
Escherichia coli (K12) 26.0 23.9 24.9 25.2
Mycobacterium tuberculosis 15.1 14.6 34.9 35.4
Yeast 31.3 32.9 18.7 17.1
Herring 27.8 27.5 22.2 22.6
Rat 28.6 28.4 21.4 21.5
Human 30.9 29.4 19.9 19.8
Source: Data from E. Chargaff and J. Davidson (editors), The Nucleic Acides, 1955, Academic Press, New York, NY.
OH
O
3H11032
5H11032
PO
4
Base
CH
2
O
Base
CH
2
O
P
O
C
O
-
O
FIGURE 14.8
A phosphodiester bond.
The Three-
Dimensional Structure
of DNA
As it became clear that DNA was the
molecule that stored the hereditary
information, investigators began to
puzzle over how such a seemingly
simple molecule could carry out such
a complex function.
Franklin: X-ray Diffraction
Patterns of DNA
The significance of the regularities
pointed out by Chargaff were not im-
mediately obvious, but they became
clear when a British chemist, Ros-
alind Franklin (figure 14.9a), carried
out an X-ray diffraction analysis of
DNA. In X-ray diffraction, a mole-
cule is bombarded with a beam of X
rays. When individual rays encounter
atoms, their path is bent or dif-
fracted, and the diffraction pattern is
recorded on photographic film. The
patterns resemble the ripples created
by tossing a rock into a smooth lake
(figure 14.9b). When carefully ana-
lyzed, they yield information about
the three-dimensional structure of a
molecule.
X-ray diffraction works best on
substances that can be prepared as
perfectly regular crystalline arrays.
However, it was impossible to obtain
true crystals of natural DNA at the
time Franklin conducted her analysis,
so she had to use DNA in the form of
fibers. Franklin worked in the labora-
tory of British biochemist Maurice
Wilkins, who was able to prepare
more uniformly oriented DNA fibers
than anyone had previously. Using
these fibers, Franklin succeeded in
obtaining crude diffraction informa-
tion on natural DNA. The diffrac-
tion patterns she obtained suggested
that the DNA molecule had the
shape of a helix, or corkscrew, with a
diameter of about 2 nanometers and
a complete helical turn every 3.4
nanometers (figure 14.9c).
286 Part V Molecular Genetics
G???C
G???C
Minor
groove
Minor
groove
Major
groove
Major
groove
3.4 nm
0.34 nm
3H110325H11032
3H11032 5H11032
2 nm
C???G
G???C
G???C
G???C
C???G
TA
TA
TA
TA
TA
TA
TA
(a)
(b)
FIGURE 14.9
Rosalind Franklin’s X-ray diffraction
patterns suggested the shape of DNA.
(a) Rosalind Franklin developed techniques
for taking X-ray diffraction pictures of
fibers of DNA. (b) This is the telltale X-ray
diffraction photograph of DNA fibers
made in 1953 by Rosalind Franklin in the
laboratory of Maurice Wilkins. (c) The X-
ray diffraction studies of Rosalind Franklin
suggested the dimensions of the double
helix.
(c)
Watson and Crick: A Model of
the Double Helix
Learning informally of Franklin’s re-
sults before they were published in
1953, James Watson and Francis
Crick, two young investigators at
Cambridge University, quickly
worked out a likely structure for the
DNA molecule (figure 14.10), which
we now know was substantially cor-
rect. They analyzed the problem de-
ductively, first building models of
the nucleotides, and then trying to
assemble the nucleotides into a mol-
ecule that matched what was known
about the structure of DNA. They
tried various possibilities before they
finally hit on the idea that the mole-
cule might be a simple double helix,
with the bases of two strands pointed
inward toward each other, forming
base-pairs. In their model, base-
pairs always consist of purines, which
are large, pointing toward pyrim-
idines, which are small, keeping the
diameter of the molecule a constant
2 nanometers. Because hydrogen
bonds can form between the bases in
a base-pair, the double helix is stabi-
lized as a duplex DNA molecule
composed of two antiparallel
strands, one chain running 3′ to 5′
and the other 5′to 3′. The base-pairs
are planar (flat) and stack 0.34 nm
apart as a result of hydrophobic in-
teractions, contributing to the over-
all stability of the molecule.
The Watson–Crick model ex-
plained why Chargaff had obtained
the results he had: in a double helix,
adenine forms two hydrogen bonds
with thymine, but it will not form hy-
drogen bonds properly with cytosine.
Similarly, guanine forms three hydro-
gen bonds with cytosine, but it will
not form hydrogen bonds properly
with thymine. Consequently, adenine
and thymine will always occur in the
same proportions in any DNA mole-
cule, as will guanine and cytosine, be-
cause of this base-pairing.
The DNA molecule is a double
helix, the strands held together by
base-pairing.
Chapter 14 DNA: The Genetic Material 287
OH
H11032 end
H11032 end
Phosphodiester
bond
Hydrogen bonds between
nitrogenous bases
Sugar-phosphate "backbone"
P
P
P
P
P
O
O
O
O
O
O
A
T
G
C
T
A
C
G
G
O
O
O
O
P
P
P
P
C
P
O
3
5
FIGURE 14.10
DNA is a double helix.(a) In a DNA
duplex molecule, only two base-pairs are
possible: adenine (A) can pair with thymine
(T), and guanine (G) can pair with cytosine
(C). An A-T base-pair has two hydrogen
bonds, while a G-C base-pair has three.
(b) James Watson (far left), and Francis
Crick (left) deduced the structure of DNA in
1953 from Chargaff’s rules and Franklin’s
diffraction studies.
(a)
(b)
The Meselson–Stahl Experiment:
DNA Replication Is Semiconservative
The Watson–Crick model immediately suggested that
the basis for copying the genetic information is comple-
mentarity. One chain of the DNA molecule may have
any conceivable base sequence, but this sequence com-
pletely determines the sequence of its partner in the du-
plex. For example, if the sequence of one chain is 5′-
ATTGCAT-3′, the sequence of its partner must be
3′-TAACGTA-5′. Thus, each chain in the duplex is a
complement of the other.
The complementarity of the DNA duplex provides a
ready means of accurately duplicating the molecule. If one
were to “unzip” the molecule, one would need only to as-
semble the appropriate complementary nucleotides on the
exposed single strands to form two daughter duplexes with
the same sequence. This form of DNA replication is called
semiconservative,because while the sequence of the origi-
nal duplex is conserved after one round of replication, the
duplex itself is not. Instead, each strand of the duplex be-
comes part of another duplex.
Two other hypotheses of gene replication were also
proposed. The conservative model stated that the parental
double helix would remain intact and generate DNA
copies consisting of entirely new molecules. The disper-
sive model predicted that parental DNA would become
dispersed throughout the new copy so that each strand of
all the daughter molecules would be a mixture of old and
new DNA.
The three hypotheses of DNA replication were evalu-
ated in 1958 by Matthew Meselson and Franklin Stahl of
the California Institute of Technology. These two scien-
tists grew bacteria in a medium containing the heavy iso-
tope of nitrogen,
15
N, which became incorporated into the
bases of the bacterial DNA. After several generations, the
DNA of these bacteria was denser than that of bacteria
grown in a medium containing the lighter isotope of nitro-
gen,
14
N. Meselson and Stahl then transferred the bacteria
from the
15
N medium to the
14
N medium and collected the
DNA at various intervals.
By dissolving the DNA they had collected in a heavy
salt called cesium chloride and then spinning the solution
at very high speeds in an ultracentrifuge, Meselson and
Stahl were able to separate DNA strands of different den-
sities. The enormous centrifugal forces generated by the
ultracentrifuge caused the cesium ions to migrate toward
the bottom of the centrifuge tube, creating a gradient of
cesium concentration, and thus of density. Each DNA
strand floats or sinks in the gradient until it reaches the
position where its density exactly matches the density of
the cesium there. Because
15
N strands are denser than
14
N
strands, they migrate farther down the tube to a denser
region of the cesium gradient.
The DNA collected immediately after the transfer was
all dense. However, after the bacteria completed their first
round of DNA replication in the
14
N medium, the density
of their DNA had decreased to a value intermediate be-
tween
14
N-DNA and
15
N-DNA. After the second round of
replication, two density classes of DNA were observed, one
intermediate and one equal to that of
14
N-DNA (figure
14.11).
Meselson and Stahl interpreted their results as follows:
after the first round of replication, each daughter DNA du-
plex was a hybrid possessing one of the heavy strands of the
parent molecule and one light strand; when this hybrid du-
plex replicated, it contributed one heavy strand to form an-
other hybrid duplex and one light strand to form a light du-
plex (figure 14.12). Thus, this experiment clearly confirmed
the prediction of the Watson-Crick model that DNA repli-
cates in a semiconservative manner.
The basis for the great accuracy of DNA replication is
complementarity. A DNA molecule is a duplex,
containing two strands that are complementary mirror
images of each other, so either one can be used as a
template to reconstruct the other.
288 Part V Molecular Genetics
14.3 How does DNA replicate?
FIGURE 14.11
The key result of the Meselson and Stahl experiment.These
bands of DNA, photographed on the left and scanned on the
right, are from the density-gradient centrifugation experiment of
Meselson and Stahl. At 0 generation, all DNA is heavy; after one
replication all DNA has a hybrid density; after two replications,
all DNA is hybrid or light.
Chapter 14 DNA: The Genetic Material 289
2. Bacteria were then
allowed to grow in a
medium containing a
light isotope of
nitrogen.
1. Bacteria were grown in
a medium containing a
heavy isotope of nitrogen.
3. At various times, the
DNA from bacterial cells
was extracted.
4. The DNA was suspended
in a cesium chloride solution.
DNA
Bacterial
cell
1
23
Sample at
0 minutes
Sample at
20 minutes
4
Sample at
40 minutes
Centrifugation
1234
Control group
(unlabeled DNA)
Labeled parent
DNA (both strands
heavy)
F
1
generation
DNA (one heavy/
light hybrid
molecule)
F
2
generation DNA
(one unlabeled molecule,
one heavy/light hybrid
molecule)
15
N medium
14 14
N medium
14
N mediumN medium
FIGURE 14.12
The Meselson and Stahl experiment: evidence demonstrating semiconservative replication.Bacterial cells were grown for several
generations in a medium containing a heavy isotope of nitrogen (
15
N) and then were transferred to a new medium containing the normal
lighter isotope (
14
N). At various times thereafter, samples of the bacteria were collected, and their DNA was dissolved in a solution of
cesium chloride, which was spun rapidly in a centrifuge. Because the cesium ion is so massive, it tends to settle toward the bottom of the
spinning tube, establishing a gradient of cesium density. DNA molecules sink in the gradient until they reach a place where their density
equals that of the cesium; they then “float” at that position. DNA containing
15
N is denser than that containing
14
N, so it sinks to a lower
position in the cesium gradient. After one generation in
14
N medium, the bacteria yielded a single band of DNA with a density between
that of
14
N-DNA and
15
N-DNA, indicating that only one strand of each duplex contained
15
N. After two generations in
14
N medium, two
bands were obtained; one of intermediate density (in which one of the strands contained
15
N) and one of low density (in which neither
strand contained
15
N). Meselson and Stahl concluded that replication of the DNA duplex involves building new molecules by separating
strands and assembling new partners on each of these templates.
The Replication Process
To be effective, DNA replication must be fast and accurate.
The machinery responsible has been the subject of inten-
sive study for 40 years, and we now know a great deal about
it. The replication of DNA begins at one or more sites on
the DNA molecule where there is a specific sequence of
nucleotides called a replication origin (figure 14.13).
There the DNA replicating enzyme DNA polymerase III
and other enzymes begin a complex process that catalyzes
the addition of nucleotides to the growing complementary
strands of DNA (figure 14.14). Table 14.2 lists the proteins
involved in DNA replication in bacteria. Before consider-
ing the replication process in detail, let’s take a closer look
at DNA polymerase III.
DNA Polymerase III
The first DNA polymerase enzyme to be characterized,
DNA polymerase I of the bacterium Escherichia coli, is a rel-
atively small enzyme that plays a key supporting role in
290 Part V Molecular Genetics
Parental DNA
duplex
Replication
origin
Template
strands
New
strands
Two daughter
DNA duplexes
FIGURE 14.13
Origins of replication. At a site called the replication origin, the
DNA duplex opens to create two separate strands, each of which
can be used as a template for a new strand. Eukaryotic DNA has
multiple origins of replication.
O
O
O
O
O
O
O
O
O
O
O
OHOH
O
O
O
O
O
O
O
O
O
O
O
P
P
PPP
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
Pyrophosphate
3H11032
3H11032
3H11032
3H11032
5H11032
5H11032
5H110325H11032
Sugar-
phosphate
backbone
New strandTemplate strand New strandTemplate strand
P
P
P
P
P
P
OH
OH
OH
T
T
G
C
A
A
A
A
T
G
C
T
T
G
C
A
A
A
A
T
G
C
DNA polymerase III
FIGURE 14.14
How nucleotides are added in DNA replication. DNA polymerase III, along with other enzymes, catalyzes the addition of nucleotides
to the growing complementary strand of DNA. When a nucleotide is added, two of its phosphates are lost as pyrophosphate.
DNA replication. The true E. coli replicating enzyme,
dubbed DNA polymerase III, is some 10 times larger and
far more complex in structure. We know more about DNA
polymerase III than any other organism’s DNA poly-
merase, and so will describe it in detail here. Other DNA
polymerases are thought to be broadly similar.
DNA polymerase III contains 10 different kinds of
polypeptide chains, as illustrated in figure 14.15. The en-
zyme is a dimer, with two similar multisubunit complexes.
Each complex catalyzes the replication of one DNA strand.
A variety of different proteins play key roles within each
complex. The subunits include a single large catalytic α
subunit that catalyzes 5′ to 3′ addition of nucleotides to a
growing chain, a smaller ε subunit that proofreads 3′ to 5′
for mistakes, and a ring-shaped β
2
dimer subunit that
clamps the polymerase III complex around the DNA dou-
ble helix. Polymerase III progressively threads the DNA
through the enzyme complex, moving it at a rapid rate,
some 1000 nucleotides per second (100 full turns of the
helix, 0.34 micrometers).
Chapter 14 DNA: The Genetic Material 291
Table 14.2 DNA Replication Proteins of E. coli
Size Molecules
Protein Role (kd) per Cell
Helicase
Primase
Single-strand
binding protein
DNA gyrase
DNA
polymerase III
DNA
polymerase I
DNA ligase
Unwinds the double
helix
Synthesizes
RNA primers
Stabilizes single-
stranded regions
Relieves
torque
Synthesizes
DNA
Erases primer
and fills gaps
Joins the ends
of DNA segments
300
60
74
400
~
~
900
103
74
20
50
300
250
20
300
300
FIGURE 14.15
The DNA polymerase III complex.(a) The complex contains
10 kinds of protein chains. The protein is a dimer because both
strands of the DNA duplex must be replicated simultaneously.
The catalytic (α) subunits, the proofreading (ε) subunits, and the
“sliding clamp” (β
2
) subunits (yellowand blue) are labeled. (b) The
“sliding clamp” units encircle the DNA template and (c) move it
through the catalytic subunit like a rope drawn through a ring.
(a)
H9252
2
H9252
2
H9251
H9280H9280
H9251
(c)(b)
The Need for a Primer
One of the features of DNA polymerase III is that it can
add nucleotides only to a chain of nucleotides that is al-
ready paired with the parent strands. Hence, DNA poly-
merase cannot link the first nucleotides in a newly synthe-
sized strand. Instead, another enzyme, an RNA polymerase
called primase, constructs an RNA primer, a sequence of
about 10 RNA nucleotides complementary to the parent
DNA template. DNA polymerase III recognizes the primer
and adds DNA nucleotides to it to construct the new DNA
strands. The RNA nucleotides in the primers are then re-
placed by DNA nucleotides.
The Two Strands of DNA Are Assembled in
Different Ways
Another feature of DNA polymerase III is that it can add
nucleotides only to the 3′ end of a DNA strand (the end
with an —OH group attached to a 3′ carbon atom). This
means that replication always proceeds in the 5′→3′direc-
tion on a growing DNA strand. Because the two parent
strands of a DNA molecule are antiparallel, the new strands
are oriented in opposite directions along the parent templates
at each replication fork (figure 14.16). Therefore, the new
strands must be elongated by different mechanisms! The
leading strand, which elongates toward the replication
fork, is built up simply by adding nucleotides continuously
to its growing 3′ end. In contrast, the lagging strand,
which elongates away from the replication fork, is synthe-
sized discontinuously as a series of short segments that are
later connected. These segments, called Okazaki frag-
ments, are about 100 to 200 nucleotides long in eukaryotes
and 1000 to 2000 nucleotides long in prokaryotes. Each
Okazaki fragment is synthesized by DNA polymerase III in
the 5′→3′ direction, beginning at the replication fork and
moving away from it. When the polymerase reaches the 5′
end of the lagging strand, another enzyme, DNA ligase,
attaches the fragment to the lagging strand. The DNA is
further unwound, new RNA primers are constructed, and
DNA polymerase III then jumps ahead 1000 to 2000 nu-
cleotides (toward the replication fork) to begin construct-
ing another Okazaki fragment. If one looks carefully at
electron micrographs showing DNA replication in
progress, one can sometimes see that one of the parent
strands near the replication fork appears single-stranded
over a distance of about 1000 nucleotides. Because the syn-
thesis of the leading strand is continuous, while that of the
lagging strand is discontinuous, the overall replication of
DNA is said to be semidiscontinuous.
The Replication Process
The replication of the DNA double helix is a complex
process that has taken decades of research to understand. It
takes place in five interlocking steps:
292 Part V Molecular Genetics
5H11032
5H11032
3H11032
3H11032
Leading
strand
Lagging
strand
DNA ligase
DNA polymerase I
Okazaki
fragment
RNA
primer
First subunit of
DNA polymerase III
Single-strand
binding proteins
Second subunit of
DNA polymerase III
Primase
Helicase
3H11032
5H11032
Parental
DNA helix
3H11032
5H11032
FIGURE 14.16
A DNA replication fork.Helicase enzymes separate the strands of the double helix, and single-strand binding proteins stabilize the
single-stranded regions. Replication occurs by two mechanisms. (1) Continuous synthesis:After primase adds a short RNA primer, DNA
polymerase III adds nucleotides to the 3′end of the leading strand. DNA polymerase I then replaces the RNA primer with DNA
nucleotides. (2) Discontinuous synthesis:Primase adds a short RNA primer (green) ahead of the 5′end of the lagging strand. DNA polymerase
III then adds nucleotides to the primer until the gap is filled in. DNA polymerase I replaces the primer with DNA nucleotides, and DNA
ligase attaches the short segment of nucleotides to the lagging strand.
1. Opening up the DNA double helix. The very sta-
ble DNA double helix must be opened up and its
strands separated from each other for semiconserva-
tive replication to occur.
Stage one: Initiating replication. The binding of ini-
tiator proteins to the replication origin starts an in-
tricate series of interactions that opens the helix.
Stage two: Unwinding the duplex. After initiation,
“unwinding” enzymes called helicases bind to and
move along one strand, shouldering aside the other
strand as they go.
Stage three: Stabilizing the single strands. The un-
wound portion of the DNA double helix is stabilized
by single-strand binding protein, which binds to
the exposed single strands, protecting them from
cleavage and preventing them from rewinding.
Stage four: Relieving the torque generated by unwinding.
For replication to proceed at 1000 nucleotides per
second, the parental helix ahead of the replication
fork must rotate 100 revolutions per second! To re-
lieve the resulting twisting, called torque, enzymes
known as topisomerases—or, more informally, gy-
rases—cleave a strand of the helix, allow it to swivel
around the intact strand, and then reseal the broken
strand.
2. Building a primer. New DNA cannot be synthe-
sized on the exposed templates until a primer is con-
structed, as DNA polymerases require 3′ primers to
initiate replication. The necessary primer is a short
stretch of RNA, added by a specialized RNA poly-
merase called primase in a multisubunit complex in-
formally called a primosome. Why an RNA primer,
rather than DNA? Starting chains on exposed tem-
plates introduces many errors; RNA marks this initial
stretch as “temporary,” making this error-prone
stretch easy to excise later.
3. Assembling complementary strands. Next, the
dimeric DNA polymerase III then binds to the repli-
cation fork. While the leading strand complexes with
one half of the polymerase dimer, the lagging strand
is thought to loop around and complex with the other
half of the polymerase dimer (figure 14.17). Moving
in concert down the parental double helix, DNA
polymerase III catalyzes the formation of comple-
mentary sequences on each of the two single strands
at the same time.
4. Removing the primer. The enzyme DNA poly-
merase I now removes the RNA primer and fills in
the gap, as well as any gaps between Okazaki frag-
ments.
5. Joining the Okazaki fragments. After any gaps
between Okazaki fragments are filled in, the enzyme
DNA ligase joins the fragments to the lagging
strand.
DNA replication involves many different proteins that
open and unwind the DNA double helix, stabilize the
single strands, synthesize RNA primers, assemble new
complementary strands on each exposed parental
strand—one of them discontinuously—remove the RNA
primer, and join new discontinuous segments on the
lagging strand.
Chapter 14 DNA: The Genetic Material 293
Leading
strand
Lagging strand
DNA polymerase III
3H11032
3H11032
3H11032
5H11032
5H11032
5H11032
RNA
primer
FIGURE 14.17
How DNA polymerase III works.This diagram presents a current view of how DNA polymerase III works. Note that the DNA on the
lagging strand is folded to allow the dimeric DNA polymerase III molecule to replicate both strands of the parental DNA duplex
simultaneously. This brings the 3′end of each completed Okazaki fragment close to the start site for the next fragment.
Eukaryotic DNA Replication
In eukaryotic cells, the DNA is packaged in nucleosomes
within chromosomes (figure 14.18). Each individual zone
of a chromosome replicates as a discrete section called a
replication unit, or replicon, which can vary in length
from 10,000 to 1 million base-pairs; most are about
100,000 base-pairs long. Each replication unit has its own
origin of replication, and multiple units may be undergo-
ing replication at any given time, as can be seen in elec-
tron micrographs of replicating chromosomes (figure
14.19). Each unit replicates in a way fundamentally simi-
lar to prokaryotic DNA replication, using similar en-
zymes. The advantage of having multiple origins of repli-
cation in eukaryotes is speed: replication takes
approximately eight hours in humans cells, but if there
were only one origin, it would take 100 times longer.
Regulation of the replication process ensures that only
one copy of the DNA is ultimately produced. How a cell
achieves this regulation is not yet completely clear. It
may involve periodic inhibitor or initiator proteins on the
DNA molecule itself.
Eukaryotic chromosomes have multiple origins of
replication.
294 Part V Molecular Genetics
FIGURE 14.18
DNA of a single human chromosome.This chromosome has
been “exploded,” or relieved, of most of its packaging proteins.
The residual protein scaffolding appears as the dark material in
the lower part of the micrograph.
1
2
3
4
Parent strand
Daughter
strand
Point of
separation
FIGURE 14.19
Eukaryotic chromosomes possess numerous replication forks
spaced along their length.Four replication units (each with two
replication forks) are producing daughter strands (a) in this
electron micrograph, as indicated in redin the (b) corresponding
drawing.
(a) (b)
The One-Gene/One-Polypeptide
Hypothesis
As the structure of DNA was being solved, other biologists
continued to puzzle over how the genes of Mendel were re-
lated to DNA.
Garrod: Inherited Disorders Can Involve Specific
Enzymes
In 1902, a British physician, Archibald Garrod, was work-
ing with one of the early Mendelian geneticists, his coun-
tryman William Bateson, when he noted that certain dis-
eases he encountered among his patients seemed to be
more prevalent in particular families. By examining sev-
eral generations of these families, he found that some of
the diseases behaved as if they were the product of simple
recessive alleles. Garrod concluded that these disorders
were Mendelian traits and that they had resulted from
changes in the hereditary information in an ancestor of
the affected families.
Garrod investigated several of these dis-
orders in detail. In alkaptonuria the pa-
tients produced urine that contained ho-
mogentisic acid (alkapton). This substance
oxidized rapidly when exposed to air, turning the urine
black. In normal individuals, homogentisic acid is broken
down into simpler substances. With considerable insight,
Garrod concluded that patients suffering from alkaptonuria
lacked the enzyme necessary to catalyze this breakdown.
He speculated that many other inherited diseases might
also reflect enzyme deficiencies.
Beadle and Tatum: Genes Specify Enzymes
From Garrod’s finding, it took but a short leap of intu-
ition to surmise that the information encoded within the
DNA of chromosomes acts to specify particular enzymes.
This point was not actually established, however, until
1941, when a series of experiments by Stanford University
geneticists George Beadle and Edward Tatum provided
definitive evidence on this point. Beadle and Tatum delib-
erately set out to create Mendelian mutations in chromo-
somes and then studied the effects of these mutations on
the organism (figure 14.20).
Chapter 14 DNA: The Genetic Material 295
14.4 What is a gene?
Wild-type
Neurospora
Minimal
medium
Products of
one meiosis
Select one of
the spores
Grow on
complete medium
Minimal
control
Nucleic
acid
CholinePyridoxine RiboflavinArginine
Minimal media supplemented with:
ThiamineFolic
acid
NiacinInositolp-Amino
benzoic acid
Test on minimal
medium to confirm
presence of mutation
Growth on
complete
medium
X rays or ultraviolet light
Asexual
spores
Meiosis
FIGURE 14.20
Beadle and Tatum’s procedure for
isolating nutritional mutants in
Neurospora.This fungus grows easily on an
artificial medium in test tubes. In this
experiment, spores were irradiated to
increase the frequency of mutation; they
were then placed on a “complete” medium
that contained all of the nutrients necessary
for growth. Once the fungal colonies were
established on the complete medium,
individual spores were transferred to a
“minimal” medium that lacked various
substances the fungus could normally
manufacture. Any spore that would not grow
on the minimal medium but would grow on
the complete medium contained one or more
mutations in genes needed to produce the
missing nutrients. To determine which gene
had mutated, the minimal medium was
supplemented with particular substances.
The mutation illustrated here produced an
arginine mutant, a collection of cells that lost
the ability to manufacture arginine. These
cells will not grow on minimal medium but
will grow on minimal medium with only
arginine added.
A Defined System. One of the reasons Beadle and
Tatum’s experiments produced clear-cut results is that the
researchers made an excellent choice of experimental organ-
ism. They chose the bread mold Neurospora, a fungus that
can be grown readily in the laboratory on a defined medium
(a medium that contains only known substances such as glu-
cose and sodium chloride, rather than some uncharacterized
mixture of substances such as ground-up yeasts). Beadle and
Tatum exposed Neurospora spores to X rays, expecting that
the DNA in some of the spores would experience damage in
regions encoding the ability to make compounds needed for
normal growth (see figure 14.20). DNA changes of this kind
are called mutations, and organisms that have undergone
such changes (in this case losing the ability to synthesize one
or more compounds) are called mutants. Initially, they al-
lowed the progeny of the irradiated spores to grow on a de-
fined medium containing all of the nutrients necessary for
growth, so that any growth-deficient mutants resulting from
the irradiation would be kept alive.
Isolating Growth-Deficient Mutants. To determine
whether any of the progeny of the irradiated spores had
mutations causing metabolic deficiencies, Beadle and
Tatum placed subcultures of individual fungal cells on a
“minimal” medium that contained only sugar, ammonia,
salts, a few vitamins, and water. Cells that had lost the abil-
ity to make other compounds necessary for growth would
not survive on such a medium. Using this approach, Beadle
and Tatum succeeded in identifying and isolating many
growth-deficient mutants.
Identifying the Deficiencies. Next the researchers
added various chemicals to the minimal medium in an at-
tempt to find one that would enable a given mutant strain
to grow. This procedure allowed them to pinpoint the na-
ture of the biochemical deficiency that strain had. The ad-
dition of arginine, for example, permitted several mutant
strains, dubbed argmutants, to grow. When their chromo-
somal positions were located, the argmutations were found
to cluster in three areas (figure 14.21).
One-Gene/One-Polypeptide
For each enzyme in the arginine biosynthetic pathway,
Beadle and Tatum were able to isolate a mutant strain with
a defective form of that enzyme, and the mutation was al-
ways located at one of a few specific chromosomal sites.
Most importantly, they found there was a different site for
each enzyme. Thus, each of the mutants they examined had
a defect in a single enzyme, caused by a mutation at a single
site on one chromosome. Beadle and Tatum concluded
that genes produce their effects by specifying the structure
of enzymes and that each gene encodes the structure of one
enzyme. They called this relationship the one-gene/one-
enzyme hypothesis. Because many enzymes contain mul-
tiple protein or polypeptide subunits, each encoded by a
separate gene, the relationship is today more commonly re-
ferred to as “one-gene/one-polypeptide.”
Enzymes are responsible for catalyzing the synthesis of
all the parts of an organism. They mediate the assembly of
nucleic acids, proteins, carbohydrates, and lipids. There-
fore, by encoding the structure of enzymes and other pro-
teins, DNA specifies the structure of the organism itself.
Genetic traits are expressed largely as a result of the
activities of enzymes. Organisms store hereditary
information by encoding the structures of enzymes and
other proteins in their DNA.
296 Part V Molecular Genetics
Chromosome
Gene
cluster 1
Enzyme E
Glutamate Ornithine Citruline Arginosuccinate Arginine
Enzyme F Enzyme G Enzyme H
Encoded enzyme
Substrate in
biochemical
pathway
Gene
cluster 2
Gene
cluster 3
arg-Harg-G
arg-F
arg-E
FIGURE 14.21
Evidence for the “one-gene/one-polypeptide” hypothesis.The chromosomal locations of the many arginine mutants isolated by
Beadle and Tatum cluster around three locations. These locations correspond to the locations of the genes encoding the enzymes that
carry out arginine biosynthesis.
How DNA Encodes Protein
Structure
What kind of information must a gene encode to specify a
protein? For some time, the answer to that question was
not clear, as protein structure seemed impossibly complex.
Sanger: Proteins Consist of Defined Sequences of
Amino Acids
The picture changed in 1953, the same year in which Wat-
son and Crick unraveled the structure of DNA. That year,
the English biochemist Frederick Sanger, after many years
of work, announced the complete sequence of amino acids
in the protein insulin. Insulin, a small protein hormone,
was the first protein for which the amino acid sequence was
determined. Sanger’s achievement was extremely signifi-
cant because it demonstrated for the first time that proteins
consisted of definable sequences of amino acids—for any
given form of insulin, every molecule has the same amino
acid sequence. Sanger’s work soon led to the sequencing of
many other proteins, and it became clear that all enzymes
and other proteins are strings of amino acids arranged in a
certain definite order. The information needed to specify a
protein such as an enzyme, therefore, is an ordered list of
amino acids.
Ingram: Single Amino Acid Changes in a Protein
Can Have Profound Effects
Following Sanger’s pioneering work, Vernon Ingram in
1956 discovered the molecular basis of sickle cell anemia, a
protein defect inherited as a Mendelian disorder. By ana-
lyzing the structures of normal and sickle cell hemoglobin,
Ingram, working at Cambridge University, showed that
sickle cell anemia is caused by a change from glutamic acid
to valine at a single position in the protein (figure 14.22).
The alleles of the gene encoding hemoglobin differed only
in their specification of this one amino acid in the hemo-
globin amino acid chain.
These experiments and other related ones have finally
brought us to a clear understanding of the unit of heredity.
The characteristics of sickle cell anemia and most other
hereditary traits are defined by changes in protein structure
brought about by an alteration in the sequence of amino
acids that make up the protein. This sequence in turn is
dictated by the order of nucleotides in a particular region
of the chromosome. For example, the critical change lead-
ing to sickle cell disease is a mutation that replaces a single
thymine with an adenine at the position that codes for glu-
tamic acid, converting the position to valine. The sequence
of nucleotides that determines the amino acid sequence of a
protein is called a gene. Although most genes encode pro-
teins or subunits of proteins, some genes are devoted to the
production of special forms of RNA, many of which play
important roles in protein synthesis themselves.
A half-century of experimentation has made clear that
DNA is the molecule responsible for the inheritance of
traits, and that this molecule is divided into functional
units called genes.
Chapter 14 DNA: The Genetic Material 297
Normal hemoglobin H9252 chain
Valine Histidine Leucine Threonine Proline
Glutamic
acid
Sickle cell anemia hemoglobin H9252 chain
Valine Histidine Leucine Threonine Proline
Glutamic
acid
Glutamic
acid
Valine
FIGURE 14.22
The molecular basis of a hereditary disease.Sickle cell anemia is
produced by a recessive allele of the gene that encodes the hemoglobin
βchains. It represents a change in a single amino acid, from glutamic
acid to valine at the sixth position in the chains, which consequently
alters the tertiary structure of the hemoglobin molecule, reducing its
ability to carry oxygen.
298 Part V Molecular Genetics
Chapter 14
Summary Questions Media Resources
14.1 What is the genetic material?
? Eukaryotic cells store hereditary information within
the nucleus.
? In viruses, bacteria, and eukaryotes, the hereditary
information resides in nucleic acids. The transfer of
nucleic acids can lead to the transfer of hereditary
traits.
? When radioactively labeled DNA viruses infect
bacteria, the DNA but not the protein coat of the
viruses enters the bacterial cells, indicating that the
hereditary material is DNA rather than protein.
1.In Hammerling’s experiments
on Acetabularia,what happened
when a stalk from A. crenulata
was grafted to a foot from A.
mediterranea?
2.How did Hershey and Chase
determine which component of
bacterial viruses contains the
viruses’ hereditary information?
? Chargaff showed that the proportion of adenine in
DNA always equals that of thymine, and the
proportion of guanine always equals that of cytosine.
? DNA has the structure of a double helix, consisting of
two chains of nucleotides held together by hydrogen
bonds between adenines and thymines, and between
guanines and cytosines.
3.What is the three-
dimensional shape of DNA, and
how does this shape fit with
Chargaff’s observations on the
proportions of purines and
pyrimidines in DNA?
4.How did Meselson and Stahl
show that DNA replication is
semiconservative?
14.2 What is the structure of DNA?
? During the S phase of the cell cycle, the hereditary
message in DNA is replicated with great accuracy.
? During replication, the DNA duplex is unwound, and
two new strands are assembled in opposite directions
along the original strands. One strand elongates by
the continuous addition of nucleotides to its growing
end; the other is constructed by the addition of
segments containing 100 to 2000 nucleotides, which
are then joined to the end of that strand.
5.How is the leading strand of a
DNA duplex replicated? How is
the lagging strand replicated?
What is the basis for the
requirement that the leading and
lagging strands be replicated by
different mechanisms?
14.3 How does DNA replicate?
? Most hereditary traits reflect the actions of enzymes.
? The traits are hereditary because the information
necessary to specify the structure of the enzymes is
stored within the DNA.
? Each enzyme is encoded by a specific region of the
DNA called a gene.
6.What hypothesis did Beadle
and Tatum test in their
experiments on Neurospora?
What did they do to change the
DNA in individuals of this
organism? How did they
determine whether any of these
changes affected enzymes in
biosynthetic pathways?
14.4 What is a gene?
http://www.mhhe.com/raven6e http://www.biocourse.com
? Experiment:
Griffith/Hershey/
Chase-DNA is the
Genetic Material
? DNA Structure
? DNA Packaging
? Nucleic Acid
? DNA Structure
? Experiment:
Kornbert-Isolating
DNA Poly merase
? DNA Replication
? DNA Replication
? Student Research:
Microsatellites in
Rabbits
Experiment
? Meselson-Stahl—
DNA Replication is
Semiconservative
? Okazaki: DNA
Synthesis is
Discontinous
? Scientists on Science:
The Future of
Molecular Biology
? Experiment:
Ephrussi/Beadle/
Tatum—Genes
Encode Enzymes
299
15
Genes and How They Work
Concept Outline
15.1 The Central Dogma traces the flow of gene-
encoded information.
Cells Use RNA to Make Protein. The information in
genes is expressed in two steps, first being transcribed into
RNA, and the RNA then being translated into protein.
15.2 Genes encode information in three-nucleotide
code words.
The Genetic Code. The sequence of amino acids in a
protein is encoded in the sequence of nucleotides in DNA,
three nucleotides encoding an amino acid.
15.3 Genes are first transcribed, then translated.
Transcription. The enzyme RNA polymerase unwinds
the DNA helix and synthesizes an RNA copy of one strand.
Translation. mRNA is translated by activating enzymes
that select tRNAs to match amino acids. Proteins are
synthesized on ribosomes, which provide a framework for
the interaction of tRNA and mRNA.
15.4 Eukaryotic gene transcripts are spliced.
The Discovery of Introns. Eukaryotic genes contain
extensive material that is not translated.
Differences between Bacterial and Eukaryotic Gene
Expression. Gene expression is broadly similar in
bacteria and eukaryotes, although it differs in some
respects.
E
very cell in your body contains the hereditary instruc-
tions specifying that you will have arms rather than
fins, hair rather than feathers, and two eyes rather than one.
The color of your eyes, the texture of your fingernails, and
all of the other traits you receive from your parents are
recorded in the cells of your body. As we have seen, this in-
formation is contained in long molecules of DNA (figure
15.1). The essence of heredity is the ability of cells to use
the information in their DNA to produce particular pro-
teins, thereby affecting what the cells will be like. In that
sense, proteins are the tools of heredity. In this chapter, we
will examine how proteins are synthesized from the infor-
mation in DNA, using both prokaryotes and eukaryotes as
models.
FIGURE 15.1
The unraveled chromosome of an E. coli bacterium. This com-
plex tangle of DNA represents the full set of assembly instructions
for the living organism E. coli.
These RNA molecules, together with ribosomal proteins
and certain enzymes, constitute a system that reads the ge-
netic messages encoded by nucleotide sequences in the
DNA and produces the polypeptides that those sequences
specify. As we will see, biologists have also learned to read
these messages. In so doing, they have learned a great deal
about what genes are and how they are able to dictate what a
protein will be like and when it will be made.
The Central Dogma
All organisms, from the simplest bacteria to ourselves, use
the same basic mechanism of reading and expressing genes,
so fundamental to life as we know it that it is often referred
to as the “Central Dogma”: Information passes from the
genes (DNA) to an RNA copy of the gene, and the RNA
copy directs the sequential assembly of a chain of amino
acids (figure 15.5). Said briefly,
DNA → RNA → protein
300 Part V Molecular Genetics
Cells Use RNA to Make Protein
To find out how a eukaryotic cell uses its DNA to direct the
production of particular proteins, you must first ask where
in the cell the proteins are made. We can answer this ques-
tion by placing cells in a medium containing radioactively
labeled amino acids for a short time. The cells will take up
the labeled amino acids and incorporate them into proteins.
If we then look to see where in the cells radioactive proteins
first appear, we will find that it is not in the nucleus, where
the DNA is, but rather in the cytoplasm, on large RNA-
protein aggregates called ribosomes (figure 15.2). These
polypeptide-making factories are very complex, composed
of several RNA molecules and over 50 different proteins
(figure 15.3). Protein synthesis involves three different sites
on the ribosome surface, called the P, A, and E sites, dis-
cussed later in this chapter.
Kinds of RNA
The class of RNA found in ribosomes is called ribosomal
RNA (rRNA). During polypeptide synthesis, rRNA pro-
vides the site where polypeptides are assembled. In addition
to rRNA, there are two other major classes of RNA in cells.
Transfer RNA (tRNA) molecules both transport the
amino acids to the ribosome for use in building the polypep-
tides and position each amino acid at the correct place on
the elongating polypeptide chain (figure 15.4). Human cells
contain about 45 different kinds of tRNA molecules. Mes-
senger RNA (mRNA) molecules are long strands of RNA
that are transcribed from DNA and that travel to the ribo-
somes to direct precisely which amino acids are assembled
into polypeptides.
15.1 The Central Dogma traces the flow of gene-encoded information.
Small
subunit
Large
subunit
Large ribosomal
subunit
E site
P site
A site
mRNA
binding
site
Small ribosomal
subunit
EPA
FIGURE 15.2
A ribosome is composed of two subunits. The smaller subunit
fits into a depression on the surface of the larger one. The A, P,
and E sites on the ribosome, discussed later in this chapter, play
key roles in protein synthesis.
FIGURE 15.3
Ribosomes are very complex machines. The complete atomic
structure of a bacterial large ribosomal subunit has been
determined at 2.4 ? resolution. The RNA of the subunit is shown
in gray and the proteins in gold. The subunit’s RNA is twisted
into irregular shapes that fit together like a three-dimensional
jigsaw puzzle. Proteins are abundant everywhere on its surface
except where peptide bonds form and where it contacts the small
subunit. The proteins stabilize the structure by interacting with
adjacent RNA strands, often with folded extensions that reach
into the subunit’s interior.
Transcription: An Overview
The first step of the Central Dogma is the transfer of infor-
mation from DNA to RNA, which occurs when an mRNA
copy of the gene is produced. Like all classes of RNA,
mRNA is formed on a DNA template. Because the DNA
sequence in the gene is transcribed into an RNA sequence,
this stage is called transcription. Transcription is initiated
when the enzyme RNA polymerase binds to a particular
binding site called a promoter located at the beginning of a
gene. Starting there, the RNA polymerase moves along the
strand into the gene. As it encounters each DNA nucleotide,
it adds the corresponding complementary RNA nucleotide
to a growing mRNA strand. Thus, guanine (G), cytosine
(C), thymine (T), and adenine (A) in the DNA would signal
the addition of C, G, A, and uracil (U), respectively, to the
mRNA.
When the RNA polymerase arrives at a transcriptional
“stop” signal at the opposite end of the gene, it disengages
from the DNA and releases the newly assembled RNA
chain. This chain is a complementary transcript of the gene
from which it was copied.
Translation: An Overview
The second step of the Central Dogma is the transfer of
information from RNA to protein, which occurs when
the information contained in the mRNA transcript is
used to direct the sequence of amino acids during the
synthesis of polypeptides by ribosomes. This process is
called translation because the nucleotide sequence of the
mRNA transcript is translated into an amino acid se-
quence in the polypeptide. Translation begins when an
rRNA molecule within the ribosome recognizes and
binds to a “start” sequence on the mRNA. The ribosome
then moves along the mRNA molecule, three nucleotides
at a time. Each group of three nucleotides is a codeword
that specifies which amino acid will be added to the
growing polypeptide chain. The ribosome continues in
this fashion until it encounters a translational “stop” sig-
nal; then it disengages from the mRNA and releases the
completed polypeptide.
The two steps of the Central Dogma, taken together,
are a concise summary of the events involved in the expres-
sion of an active gene. Biologists refer to this process as
gene expression.
The information encoded in genes is expressed in two
phases: transcription, in which an RNA polymerase
enzyme assembles an mRNA molecule whose
nucleotide sequence is complementary to the DNA
nucleotide sequence of the gene; and translation, in
which a ribosome assembles a polypeptide, whose
amino acid sequence is specified by the nucleotide
sequence in the mRNA.
Chapter 15 Genes and How They Work 301
OH
Amino acid
attaches here
Anticodon
Anticodon
(a)
(b)
5H11541
5H11541
3H11541
3H11541
FIGURE 15.4
The structure of tRNA. (a) In the two-dimensional schematic,
the three loops of tRNA are unfolded. Two of the loops bind to
the ribosome during polypeptide synthesis, and the third loop
contains the anticodon sequence, which is complementary to a
three-base sequence on messenger RNA. Amino acids attach to
the free, single-stranded —OH end. (b) In the three-dimensional
structure, the loops of tRNA are folded.
DNA
Transcription
Translation
Protein
mRNA
FIGURE 15.5
The Central Dogma of gene expression. DNA is transcribed
to make mRNA, which is translated to make a protein.
The Genetic Code
The essential question of gene expression is, “How does
the order of nucleotides in a DNA molecule encode the in-
formation that specifies the order of amino acids in a
polypeptide?” The answer came in 1961, through an exper-
iment led by Francis Crick. That experiment was so elegant
and the result so critical to understanding the genetic code
that we will describe it in detail.
Proving Code Words Have Only Three Letters
Crick and his colleagues reasoned that the genetic code
most likely consisted of a series of blocks of information
called codons, each corresponding to an amino acid in the
encoded protein. They further hypothesized that the infor-
mation within one codon was probably a sequence of three
nucleotides specifying a particular amino acid. They ar-
rived at the number three, because a two-nucleotide codon
would not yield enough combinations to code for the 20
different amino acids that commonly occur in proteins.
With four DNA nucleotides (G, C, T, and A), only 4
2
, or
16, different pairs of nucleotides could be formed. How-
ever, these same nucleotides can be arranged in 4
3
, or 64,
different combinations of three, more than enough to code
for the 20 amino acids.
In theory, the codons in a gene could lie immediately
adjacent to each other, forming a continuous sequence of
transcribed nucleotides. Alternatively, the sequence could
be punctuated with untranscribed nucleotides between the
codons, like the spaces that separate the words in this sen-
tence. It was important to determine which method cells
employ because these two ways of transcribing DNA imply
different translating processes.
To choose between these alternative mechanisms, Crick
and his colleagues used a chemical to delete one, two, or
three nucleotides from a viral DNA molecule and then
asked whether a gene downstream of the deletions was
transcribed correctly. When they made a single deletion or
two deletions near each other, the reading frame of the
genetic message shifted, and the downstream gene was
transcribed as nonsense. However, when they made three
deletions, the correct reading frame was restored, and the
sequences downstream were transcribed correctly. They
obtained the same results when they made additions to the
DNA consisting of one, two, or three nucleotides. As
shown in figure 15.6, these results could not have been ob-
tained if the codons were punctuated by untranscribed nu-
cleotides. Thus, Crick and his colleagues concluded that
the genetic code is read in increments consisting of three
nucleotides (in other words, it is a triplet code) and that
reading occurs continuously without punctuation between
the three-nucleotide units.
Breaking the Genetic Code
Within a year of Crick’s experiment, other researchers suc-
ceeded in determining the amino acids specified by particular
three-nucleotide units. Marshall Nirenberg discovered in
1961 that adding the synthetic mRNA molecule polyU (an
RNA molecule consisting of a string of uracil nucleotides) to
cell-free systems resulted in the production of the polypep-
tide polyphenylalanine (a string of phenylalanine amino
acids). Therefore, one of the three-nucleotide sequences
specifying phenylalanine is UUU. In 1964, Nirenberg and
Philip Leder developed a powerful triplet binding assay in
which a specific triplet was tested to see which radioactive
amino acid (complexed to tRNA) it would bind. Some 47 of
the 64 possible triplets gave unambiguous results. Har Gob-
ind Khorana decoded the remaining 17 triplets by construct-
ing artificial mRNA molecules of defined sequence and ex-
amining what polypeptides they directed. In these ways, all
64 possible three-nucleotide sequences were tested, and the
full genetic code was determined (table 15.1).
302 Part V Molecular Genetics
15.2 Genes encode information in three-nucleotide code words.
(Nonsense)
(Nonsense)
Hypothesis A :
unpunctuated
Delete 1 base
Delete T
WHYDIDTHEREDBATEATTHEFATRAT?
WHYODIDOTHEOREDOBATOEATOTHEOFATORAT?
WHY DID HER EDB ATE ATT HEF ATR AT?
(Sense)
Hypothesis A :
unpunctuated
Delete 3 bases
Delete T,R,and A
WHYDIDTHEREDBATEATTHEFATRAT?
WHY DID HEE DBT EAT THE FAT RAT?
(Nonsense)
Hypothesis B :
punctuated
Delete T
WHY DID HEO EDO ATO ATO HEO ATO AT?
O O R B E T F R
WHYODIDOTHEOREDOBATOEATOTHEOFATORAT?
(Nonsense)
Hypothesis B :
punctuated
Delete T,R,and A
WHY DID HEO DOB OEA OTH OFA ORA?
O O E T T E T T
FIGURE 15.6
Using frame-shift alterations of DNA to determine if the
genetic code is punctuated. The hypothetical genetic message
presented here is “Why did the red bat eat the fat rat?” Under
hypothesis B, which proposes that the message is punctuated, the
three-letter words are separated by nucleotides that are not read
(indicated by the letter “O”).
The Code Is Practically Universal
The genetic code is the same in almost all organisms. For
example, the codon AGA specifies the amino acid arginine
in bacteria, in humans, and in all other organisms whose
genetic code has been studied. The universality of the ge-
netic code is among the strongest evidence that all living
things share a common evolutionary heritage. Because the
code is universal, genes transcribed from one organism can
be translated in another; the mRNA is fully able to dictate a
functionally active protein. Similarly, genes can be trans-
ferred from one organism to another and be successfully
transcribed and translated in their new host. This univer-
sality of gene expression is central to many of the advances
of genetic engineering. Many commercial products such as
the insulin used to treat diabetes are now manufactured by
placing human genes into bacteria, which then serve as tiny
factories to turn out prodigious quantities of insulin.
But Not Quite
In 1979, investigators began to determine the complete
nucleotide sequences of the mitochondrial genomes in
humans, cattle, and mice. It came as something of a shock
when these investigators learned that the genetic code
used by these mammalian mitochondria was not quite the
same as the “universal code” that has become so familiar
to biologists. In the mitochondrial genomes, what should
have been a “stop” codon, UGA, was instead read as the
amino acid tryptophan; AUA was read as methionine
rather than isoleucine; and AGA and AGG were read as
“stop” rather than arginine. Furthermore, minor differ-
ences from the universal code have also been found in the
genomes of chloroplasts and ciliates (certain types of
protists).
Thus, it appears that the genetic code is not quite uni-
versal. Some time ago, presumably after they began their
endosymbiotic existence, mitochondria and chloroplasts
began to read the code differently, particularly the portion
of the code associated with “stop” signals.
Within genes that encode proteins, the nucleotide
sequence of DNA is read in blocks of three consecutive
nucleotides, without punctuation between the blocks.
Each block, or codon, codes for one amino acid.
Chapter 15 Genes and How They Work 303
Table 15.1 The Genetic Code
Second Letter
First Third
Letter U C A G Letter
U
C
A
G
Phenylalanine
Leucine
Leucine
Isoleucine
Methionine;
Start
Valine
Serine
Proline
Threonine
Alanine
Tyrosine
Stop
Stop
Histidine
Glutamine
Asparagine
Lysine
Aspartate
Glutamate
Cysteine
Stop
Tryptophan
Arginine
Serine
Arginine
Glycine
U
C
A
G
U
C
A
G
U
C
A
G
U
C
A
G
A codon consists of three nucleotides read in the sequence shown. For example, ACU codes for threonine. The first letter, A, is in the First Letter column;
the second letter, C, is in the Second Letter column; and the third letter, U, is in the Third Letter column. Each of the mRNA codons is recognized by a
corresponding anticodon sequence on a tRNA molecule. Some tRNA molecules recognize more than one codon in mRNA, but they always code for the
same amino acid. In fact, most amino acids are specified by more than one codon. For example, threonine is specified by four codons, which differ only in
the third nucleotide (ACU, ACC, ACA, and ACG).
UUU
UUC
UUA
UUG
CUU
CUC
CUA
CUG
AUU
AUC
AUA
AUG
GUU
GUC
GUA
GUG
UCU
UCC
UCA
UCG
CCU
CCC
CCA
CCG
ACU
ACC
ACA
ACG
GCU
GCC
GCA
GCG
UAU
UAC
UAA
UAG
CAU
CAC
CAA
CAG
AAU
AAC
AAA
AAG
GAU
GAC
GAA
GAG
UGU
UGC
UGA
UGG
CGU
CGC
CGA
CGG
AGU
AGC
AGA
AGG
GGU
GGC
GGA
GGG
Transcription
The first step in gene expression is the production of an
RNA copy of the DNA sequence encoding the gene, a
process called transcription. To understand the mecha-
nism behind the transcription process, it is useful to focus
first on RNA polymerase, the remarkable enzyme responsi-
ble for carrying it out (figure 15.7).
RNA Polymerase
RNA polymerase is best understood in bacteria. Bacterial
RNA polymerase is very large and complex, consisting of
five subunits: two α subunits bind regulatory proteins, a
β′ subunit binds the DNA template, a β subunit binds
RNA nucleoside subunits, and a σ subunit recognizes the
promoter and initiates synthesis. Only one of the two
strands of DNA, called the template strand, is tran-
scribed. The RNA transcript’s sequence is complemen-
tary to the template strand. The strand of DNA that is
not transcribed is called the coding strand. It has the
same sequence as the RNA transcript, except T takes the
place of U. The coding strand is also known as the sense
(+) strand, and the template strand as the antisense (–)
strand.
In both bacteria and eukaryotes, the polymerase adds ri-
bonucleotides to the growing 3′ end of an RNA chain. No
primer is needed, and synthesis proceeds in the 5′→3′ di-
rection. Bacteria contain only one RNA polymerase en-
zyme, while eukaryotes have three different RNA poly-
merases: RNA polymerase I synthesizes rRNA in the
nucleolus; RNA polymerase II synthesizes mRNA; and
RNA polymerase III synthesizes tRNA.
Promoter
Transcription starts at RNA polymerase binding sites
called promoters on the DNA template strand. A pro-
moter is a short sequence that is not itself transcribed by
the polymerase that binds to it. Striking similarities are evi-
dent in the sequences of different promoters. For example,
two six-base sequences are common to many bacterial pro-
moters, a TTGACA sequence called the –35 sequence, lo-
cated 35 nucleotides upstream of the position where tran-
scription actually starts, and a TATAAT sequence called
the –10 sequence, located 10 nucleotides upstream of the
start site. In eukaryotic DNA, the sequence TATAAA,
called the TATA box, is located at –25 and is very similar
to the prokaryotic –10 sequence but is farther from the
start site.
Promoters differ widely in efficiency. Strong promoters
cause frequent initiations of transcription, as often as every
2 seconds in some bacteria. Weak promoters may tran-
scribe only once every 10 minutes. Most strong promoters
have unaltered –35 and –10 sequences, while weak promot-
ers often have substitutions within these sites.
Initiation
The binding of RNA polymerase to the promoter is the
first step in gene transcription. In bacteria, a subunit of
RNA polymerase called σ (sigma) recognizes the –10 se-
quence in the promoter and binds RNA polymerase there.
Importantly, this subunit can detect the –10 sequence with-
out unwinding the DNA double helix. In eukaryotes, the
–25 sequence plays a similar role in initiating transcription,
as it is the binding site for a key protein factor. Other eu-
karyotic factors then bind one after another, assembling a
large and complicated transcription complex. The eu-
karyotic transcription complex is described in detail in the
following chapter.
Once bound to the promoter, the RNA polymerase be-
gins to unwind the DNA helix. Measurements indicate that
bacterial RNA polymerase unwinds a segment approxi-
mately 17 base-pairs long, nearly two turns of the DNA
double helix. This sets the stage for the assembly of the
RNA chain.
Elongation
The transcription of the RNA chain usually starts with
ATP or GTP. One of these forms the 5′ end of the chain,
which grows in the 5′→3′ direction as ribonucleotides are
added. Unlike DNA synthesis, a primer is not required.
The region containing the RNA polymerase, DNA, and
growing RNA transcript is called the transcription bubble
because it contains a locally unwound “bubble” of DNA
(figure 15.8). Within the bubble, the first 12 bases of the
304 Part V Molecular Genetics
15.3 Genes are first transcribed, then translated.
FIGURE 15.7
RNA polymerase. In this electron micrograph, the dark circles
are RNA polymerase molecules bound to several promoter sites
on bacterial virus DNA.
newly synthesized RNA strand temporarily form a helix
with the template DNA strand. Corresponding to not quite
one turn of the helix, this stabilizes the positioning of the 3′
end of the RNA so it can interact with an incoming ribonu-
cleotide. The RNA-DNA hybrid helix rotates each time a
nucleotide is added so that the 3′ end of the RNA stays at
the catalytic site.
The transcription bubble moves down the DNA at a
constant rate, about 50 nucleotides per second, leaving the
growing RNA strand protruding from the bubble. After the
transcription bubble passes, the now transcribed DNA is
rewound as it leaves the bubble.
Unlike DNA polymerase, RNA polymerase has no
proofreading capability. Transcription thus produces many
more copying errors than replication. These mistakes,
however, are not transmitted to progeny. Most genes are
transcribed many times, so a few faulty copies are not
harmful.
Termination
At the end of a gene are “stop” sequences that cause the
formation of phosphodiester bonds to cease, the RNA-
DNA hybrid within the transcription bubble to dissociate,
the RNA polymerase to release the DNA, and the DNA
within the transcription bubble to rewind. The simplest
stop signal is a series of GC base-pairs followed by a series
of AT base-pairs. The RNA transcript of this stop region
forms a GC hairpin (figure 15.9), followed by four or more
U ribonucleotides. How does this structure terminate tran-
scription? The hairpin causes the RNA polymerase to
pause immediately after the polymerase has synthesized it,
placing the polymerase directly over the run of four uracils.
The pairing of U with DNA’s A is the weakest of the four
hybrid base-pairs and is not strong enough to hold the hy-
brid strands together during the long pause. Instead, the
RNA strand dissociates from the DNA within the tran-
scription bubble, and transcription stops. A variety of pro-
tein factors aid hairpin loops in terminating transcription of
particular genes.
Posttranscriptional Modifications
In eukaryotes, every mRNA transcript must travel a long
journey out from the nucleus into the cytoplasm before it
can be translated. Eukaryotic mRNA transcripts are modi-
fied in several ways to aid this journey:
5′ caps. Transcripts usually begin with A or G, and, in
eukaryotes, the terminal phosphate of the 5′ A or G is
removed, and then a very unusual 5′-5′ linkage forms
with GTP. Called a 5′ cap, this structure protects the 5′
end of the RNA template from nucleases and phos-
phatases during its long journey through the cytoplasm.
Without these caps, RNA transcripts are rapidly de-
graded.
3′ poly-A tails. The 3′ end of eukaryotic transcript is
cleaved off at a specific site, often containing the se-
quence AAUAAA. A special poly-A polymerase enzyme
then adds about 250 A ribonucleotides to the 3′ end of
the transcript. Called a 3′ poly-A tail, this long string of
As protects the transcript from degradation by nucleases.
It also appears to make the transcript a better template
for protein synthesis.
Transcription is carried out by the enzyme RNA
polymerase, aided in eukaryotes by many other
proteins.
Chapter 15 Genes and How They Work 305
FIGURE 15.8
Model of a transcription bubble. The
DNA duplex unwinds as it enters the RNA
polymerase complex and rewinds as it
leaves. One of the strands of DNA
functions as a template, and nucleotide
building blocks are assembled into RNA
from this template.
Template
strand
Rewinding
mRNA
RNA-DNA hybrid helix
RNA polymerase
Unwinding
Coding
strand
DNA
5H11541
5H11541
3H11541
3H11541
5H11541
3H11541
C
C
C
C
C
C
C
C
C C
C
C
G
G
G
G
G
G
G
G
G
G
G
G
A
A
A
A
A
A
A
A
A
A
A
A
A
A
A
T
T
T
T
T
T
T
T
T
T
T
T
U U
U
C
C
A
U
G
C
C
G
C
G
G
C
C
G
U
U
U
OH3H11032
5H11032
G
U
G
U
C
G
C
FIGURE 15.9
A GC hairpin. This structure stops gene transcription.
Translation
In prokaryotes, translation begins when the initial portion
of an mRNA molecule binds to an rRNA molecule in a ri-
bosome. The mRNA lies on the ribosome in such a way
that only one of its codons is exposed at the polypeptide-
making site at any time. A tRNA molecule possessing the
complementary three-nucleotide sequence, or anticodon,
binds to the exposed codon on the mRNA.
Because this tRNA molecule carries a particular amino
acid, that amino acid and no other is added to the polypep-
tide in that position. As the mRNA molecule moves
through the ribosome, successive codons on the mRNA are
exposed, and a series of tRNA molecules bind one after an-
other to the exposed codons. Each of these tRNA mole-
cules carries an attached amino acid, which it adds to the
end of the growing polypeptide chain (figure 15.10).
There are about 45 different kinds of tRNA molecules.
Why are there 45 and not 64 tRNAs (one for each codon)?
Because the third base-pair of a tRNA anticodon allows
some “wobble,” some tRNAs recognize more than one
codon.
How do particular amino acids become associated with
particular tRNA molecules? The key translation step,
which pairs the three-nucleotide sequences with appropri-
ate amino acids, is carried out by a remarkable set of en-
zymes called activating enzymes.
Activating Enzymes
Particular tRNA molecules become attached to specific
amino acids through the action of activating enzymes
called aminoacyl-tRNA synthetases, one of which exists
for each of the 20 common amino acids (figure 15.11).
Therefore, these enzymes must correspond to specific an-
ticodon sequences on a tRNA molecule as well as particu-
lar amino acids. Some activating enzymes correspond to
only one anticodon and thus only one tRNA molecule.
Others recognize two, three, four, or six different tRNA
molecules, each with a different anticodon but coding for
the same amino acid (see table 15.1). If one considers the
nucleotide sequence of mRNA a coded message, then the
20 activating enzymes are responsible for decoding that
message.
“Start” and “Stop” Signals
There is no tRNA with an anticodon complementary to
three of the 64 codons: UAA, UAG, and UGA. These
codons, called nonsense codons, serve as “stop” signals in
the mRNA message, marking the end of a polypeptide.
The “start” signal that marks the beginning of a polypep-
tide within an mRNA message is the codon AUG, which
also encodes the amino acid methionine. The ribosome will
usually use the first AUG that it encounters in the mRNA
to signal the start of translation.
Initiation
In prokaryotes, polypeptide synthesis begins with the for-
mation of an initiation complex. First, a tRNA molecule
carrying a chemically modified methionine called N-
formylmethionine (tRNA
fMet
) binds to the small ribosomal
subunit. Proteins called initiation factors position the
tRNA
fMet
on the ribosomal surface at the P site (for pep-
tidyl), where peptide bonds will form. Nearby, two other
sites will form: the A site (for aminoacyl), where successive
amino acid-bearing tRNAs will bind, and the E site (for
exit), where empty tRNAs will exit the ribosome (figure
15.12). This initiation complex, guided by another initia-
tion factor, then binds to the anticodon AUG on the
mRNA. Proper positioning of the mRNA is critical because
it determines the reading frame—that is, which groups of
three nucleotides will be read as codons. Moreover, the
complex must bind to the beginning of the mRNA mole-
cule, so that all of the transcribed gene will be translated.
In bacteria, the beginning of each mRNA molecule is
marked by a leader sequence complementary to one of the
rRNA molecules on the ribosome. This complementarity
ensures that the mRNA is read from the beginning. Bacte-
ria often include several genes within a single mRNA tran-
script (polycistronic mRNA), while each eukaryotic gene is
transcribed on a separate mRNA (monocistronic mRNA).
306 Part V Molecular Genetics
Ribosomes
RNA polymerase
DNA
Polyribosome
mRNA
FIGURE 15.10
Translation in action. Bacteria have no nucleus and hence no
membrane barrier between the DNA and the cytoplasm. In this
electron micrograph of genes being transcribed in the bacterium
Escherichia coli, you can see every stage of the process. The arrows
point to RNA polymerase enzymes. From each mRNA molecule
dangling from the DNA, a series of ribosomes is assembling
polypeptides. These clumps of ribosomes are sometimes called
“polyribosomes.”
Initiation in eukaryotes is similar, although it differs in
two important ways. First, in eukaryotes, the initiating
amino acid is methionine rather than N-formylmethionine.
Second, the initiation complex is far more complicated
than in bacteria, containing nine or more protein factors,
many consisting of several subunits. Eukaryotic initiation
complexes are discussed in detail in the following chapter.
Elongation
After the initiation complex has formed, the large ribosome
subunit binds, exposing the mRNA codon adjacent to the
initiating AUG codon, and so positioning it for interaction
with another amino acid-bearing tRNA molecule. When a
tRNA molecule with the appropriate anticodon appears,
proteins called elongation factors assist in binding it to the
exposed mRNA codon at the A site. When the second
tRNA binds to the ribosome, it places its amino acid di-
rectly adjacent to the initial methionine, which is still at-
tached to its tRNA molecule, which in turn is still bound to
the ribosome. The two amino acids undergo a chemical re-
action, catalyzed by peptidyl transferase, which releases the
initial methionine from its tRNA and attaches it instead by
a peptide bond to the second amino acid.
Chapter 15 Genes and How They Work 307
Activating
enzyme
Anticodon
tRNA
Trp
Tryptophan
attached to
tRNA
Trp
tRNA
Trp
binds to UGG
codon of mRNA
Trp
Trp
Trp
mRNA
ACC
A
C
C
UGG
CO
=
OH
OH
CO
=
H
2
O
O
CO
=
O
FIGURE 15.11
Activating enzymes “read” the genetic code. Each kind of activating enzyme recognizes and binds to a specific amino acid, such as
tryptophan; it also recognizes and binds to the tRNA molecules with anticodons specifying that amino acid, such as ACC for tryptophan.
In this way, activating enzymes link the tRNA molecules to specific amino acids.
fMet
fMet
fMet
fMet
tRNA
fMet
Leader
sequence
mRNA
Small ribosomal subunit
(containing ribosomal RNA)
Initiation
factor
Initiation
factor
Initiation complex
mRNA
Large
ribosomal
subunit
E site
P site
A site
5H11541
3H11541
U
U
A C
A
G
U
U
A C
U A C
U
A
C
A G
U
A
G
U
A
G
FIGURE 15.12
Formation of the initiation complex. In prokaryotes, proteins called initiation factors play key roles in positioning the small ribosomal
subunit and the N-formylmethionine, or tRNA
fMet
, molecule at the beginning of the mRNA. When the tRNA
fMet
is positioned over the
first AUG codon of the mRNA, the large ribosomal subunit binds, forming the P, A, and E sites where successive tRNA molecules bind to
the ribosomes, and polypeptide synthesis begins.
Translocation
In a process called translocation (figure 15.13), the ribo-
some now moves (translocates) three more nucleotides
along the mRNA molecule in the 5′ → 3′ direction, guided
by other elongation factors. This movement relocates the
initial tRNA to the E site and ejects it from the ribosome,
repositions the growing polypeptide chain (at this point
containing two amino acids) to the P site, and exposes the
next codon on the mRNA at the A site. When a tRNA
molecule recognizing that codon appears, it binds to the
codon at the A site, placing its amino acid adjacent to the
growing chain. The chain then transfers to the new amino
acid, and the entire process is repeated.
Termination
Elongation continues in this fashion until a chain-terminating
nonsense codon is exposed (for example, UAA in figure
15.14). Nonsense codons do not bind to tRNA, but they are
recognized by release factors, proteins that release the
newly made polypeptide from the ribosome.
The first step in protein synthesis is the formation of an
initiation complex. Each step of the ribosome’s progress
exposes a codon, to which a tRNA molecule with the
complementary anticodon binds. The amino acid
carried by each tRNA molecule is added to the end of
the growing polypeptide chain.
308 Part V Molecular Genetics
Elongation
factor
Leu
Leu
Leu
Leu
tRNA
fMet fMet
fMet
fMet
P site
E site
A site
mRNA
5H11541 5H11541
5H11541 5H115413H11541
3H11541
3H11541 3H11541
U UA
A A
A
C
C
C
A U
U
G
G
G
U
U
A
A A
A
C
C
C
A U
U
G
G
G
U
U
A
A A
A
C
C
C
A U
UG G
G
U
U
A
A A
A
C
C
C
A U
U
G
G
G
FIGURE 15.13
Translocation. The initiating tRNA
fMet
in prokaryotes (tRNA
fMet
in eukaryotes) occupies the P site, and a tRNA molecule with an
anticodon complementary to the exposed mRNA codon binds at the A site. fMet is transferred to the incoming amino acid (Leu), as the
ribosome moves three nucleotides to the right along the mRNA. The empty tRNA
fMet
moves to the E site to exit the ribosome, the
growing polypeptide chain moves to the P site, and the A site is again exposed and ready to bind the next amino acid–laden tRNA.
Val
Val
Ser
Ser
Ala
Ala
Trp
Trp
Release
factor
P site
E
site
A
site
mRNA
Polypeptide chain
released
tRNA
Large
ribosomal
subunit
Small
ribosomal
subunit
A
C
C
A
AA
CC
U UGG
A
AA
CC
U UGG
5H11541 5H11541
3H11541
3H11541
tRNA
FIGURE 15.14
Termination of protein synthesis. There is no tRNA with an anticodon complementary to any of the three termination signal codons,
such as the UAA nonsense codon illustrated here. When a ribosome encounters a termination codon, it therefore stops translocating.
A specific release factor facilitates the release of the polypeptide chain by breaking the covalent bond that links the polypeptide to the
P-site tRNA.
The Discovery of Introns
While the mechanisms of protein synthesis are similar in
bacteria and eukaryotes, they are not identical. One differ-
ence is of particular importance. Unlike bacterial genes,
most eukaryotic genes are larger than they need to be to
produce the polypeptides they code for. Such genes contain
long sequences of nucleotides, known as introns, that do
not code for any portion of the polypeptide specified by the
gene. Introns are inserted between exons, much shorter se-
quences in the gene that do code for portions of the
polypeptide.
In bacteria, virtually every nucleotide within a bacterial
gene transcript is part of an amino acid–specifying codon.
Scientists assumed for many years that this was true of all
organisms. In the late 1970s, however, biologists were
amazed to discover that many of the characteristics of
prokaryotic gene expression did not apply to eukaryotes. In
particular, they found that eukaryotic proteins are encoded
by RNA segments that are excised from several locations
along what is called the primary RNA transcript (or pri-
mary transcript) and then spliced together to form the
mRNA that is eventually translated in the cytoplasm. The
experiment that revealed this unexpected mode of gene ex-
pression consisted of several steps:
1. The mRNA transcribed from a particular gene was
isolated and purified. For example, ovalbumin mRNA
could be obtained fairly easily from unfertilized eggs.
2. Molecules of DNA complementary to the isolated
mRNA were synthesized with the enzyme reverse
transcriptase. These DNA molecules, which are
called “copy” DNA (cDNA), had the same nucleotide
sequence as the template strand of the gene that pro-
duced the mRNA.
3. With genetic engineering techniques (chapter 19),
the portion of the nuclear DNA containing the gene
that produced the mRNA was isolated. This proce-
dure is referred to as cloning the gene in question.
4. Single-stranded forms of the cDNA and the nuclear
DNA were mixed and allowed to pair with each other
(to hybridize).
When the researchers examined the resulting hybrid
DNA molecules with an electron microscope, they found
that the DNA did not appear as a single duplex. Instead,
they observed unpaired loops. In the case of the ovalbu-
min gene, they discovered seven loops, corresponding to
sites where the nuclear DNA contained long nucleotide
sequences not present in the cDNA. The conclusion was
inescapable: nucleotide sequences must have been re-
moved from the gene transcript before it appeared as cy-
toplasmic mRNA. These removed sequences are introns,
and the remaining sequences are exons (figure 15.15).
Because introns are excised from the RNA transcript be-
fore it is translated into protein, they do not affect the
structure of the protein encoded by the gene in which
they occur.
Chapter 15 Genes and How They Work 309
15.4 Eukaryotic gene transcripts are spliced.
(c)
(a)
DNA
Primary
RNA
transcript
Mature mRNA transcript
5H11032 cap
Intron
Exon
mRNA
DNA
1
2
3
4
5
6
7
Exon
(coding region)
Intron
(noncoding region)
123 4 567
Transcription
Introns are cut out and
coding regions are
spliced together
3H11032 poly-A tail
(b)
FIGURE 15.15
The eukaryotic gene that codes for ovalbumin in eggs contains introns. (a) The ovalbumin gene and its primary RNA transcript
contain seven segments not present in the mRNA the ribosomes use to direct protein synthesis. Enzymes cut these segments (introns) out
and splice together the remaining segments (exons). (b) The seven loops are the seven introns represented in the schematic drawing (c) of
the mature mRNA transcript hybridized to DNA.
RNA Splicing
When a gene is transcribed, the primary RNA transcript
(that is, the gene copy as it is made by RNA polymerase, be-
fore any modification occurs) contains sequences comple-
mentary to the entire gene, including introns as well as
exons. However, in a process called RNA processing, or
splicing, the intron sequences are cut out of the primary
transcript before it is used in polypeptide synthesis; there-
fore, those sequences are not translated. The remaining se-
quences, which correspond to the exons, are spliced to-
gether to form the final, “processed” mRNA molecule that
is translated. In a typical human gene, the introns can be 10
to 30 times larger than the exons. For example, even though
only 432 nucleotides are required to encode the 144 amino
acids of hemoglobin, there are actually 1356 nucleotides in
the primary mRNA transcript of the hemoglobin gene. Fig-
ure 15.16 summarizes eukaryotic protein synthesis.
Much of a eukaryotic gene is not translated. Noncoding
segments scattered throughout the gene are removed
from the primary transcript before the mRNA is
translated.
310 Part V Molecular Genetics
DNA
Nucleus
Primary RNA
transcript
RNA polymerase
5H11541
5H11541
5H11541
5H11541
5H11541
3H11541
3H11541
3H11541
3H11541
3H11541
Nuclear
membrane
Small
ribosomal
subunit
Large
ribosomal subunit
Cap
Cytoplasm
mRNA
Nuclear
pore
Poly-A
tail
Ribosome
Codon
Anticodon
tRNA
Amino
acids
Cytoplasm
tRNA
A site
P site
E site
Completed
polypeptide
chain
mRNA
Growing peptide
chain
In the cell nucleus, RNA polymerase transcribes RNA from DNA.
mRNA is transported out of the nucleus. In the cytoplasm,
ribosomal subunits bind to the mRNA.
tRNA molecules become attached to specific amino acids with
the help of activating enzymes. Amino acids are brought to the
ribosome in the order directed by the mRNA.
tRNAs bring their amino acids in at the A site on the ribosome.
Peptide bonds form between amino acids at the P site, and
tRNAs exit the ribosome from the E site.
The polypeptide chain grows until the protein is completed.
5H11541
3H11541
Primary RNA
transcript
Introns
Exons
mRNA
Introns are excised from the RNA transcript, and the remaining
exons are spliced together, producing mRNA.
12
3
5
4
6
Poly-A
tail
Cap
FIGURE 15.16
An overview of gene expression in eukaryotes.
Differences between Bacterial and
Eukaryotic Gene Expression
1. Most eukaryotic genes possess introns. With the ex-
ception of a few genes in the Archaebacteria, prokary-
otic genes lack introns (figure 15.17).
2. Individual bacterial mRNA molecules often contain
transcripts of several genes. By placing genes with re-
lated functions on the same mRNA, bacteria coordi-
nate the regulation of those functions. Eukaryotic
mRNA molecules rarely contain transcripts of more
than one gene. Regulation of eukaryotic gene expres-
sion is achieved in other ways.
3. Because eukaryotes possess a nucleus, their mRNA
molecules must be completely formed and must pass
across the nuclear membrane before they are trans-
lated. Bacteria, which lack nuclei, often begin transla-
tion of an mRNA molecule before its transcription is
completed.
4. In bacteria, translation begins at an AUG codon pre-
ceded by a special nucleotide sequence. In eukaryotic
cells, mRNA molecules are modified at the 5′ leading
end after transcription, adding a 5′ cap, a methylated
guanosine triphosphate. The cap initiates translation
by binding the mRNA, usually at the first AUG, to
the small ribosomal subunit.
5. Eukaryotic mRNA molecules are modified before
they are translated: introns are cut out, and the re-
maining exons are spliced together; a 5′ cap is
added; and a 3′ poly-A tail consisting of some 200
adenine (A) nucleotides is added. These modifica-
tions can delay the destruction of the mRNA by cel-
lular enzymes.
6. The ribosomes of eukaryotes are a little larger than
those of bacteria.
Gene expression is broadly similar in bacteria and
eukaryotes, although it differs in some details.
Chapter 15 Genes and How They Work 311
Bacterial
chromosome
mRNA
Protein
Cell wall
Cell membrane
Translation
Transcription
Chromosome
Nuclear
pore
Nuclear
envelope
mRNA
Intron
DNA
Primary
RNA transcript
Protein
Plasma
membrane
Translation
Transcription
Processing
5H11032 3H11032
Cap
Poly-A tail
FIGURE 15.17
Gene information is processed differently in prokaryotes and eukaryotes. (a) Bacterial genes are transcribed into mRNA, which is
translated immediately. Hence, the sequence of DNA nucleotides corresponds exactly to the sequence of amino acids in the encoded
polypeptide. (b) Eukaryotic genes are typically different, containing long stretches of nucleotides called introns that do not correspond to
amino acids within the encoded polypeptide. Introns are removed from the primary RNA transcript of the gene and a 5′ cap and 3′ poly-A
tail are added before the mRNA directs the synthesis of the polypeptide.
(a) (b)
312 Part V Molecular Genetics
Chapter 15
Summary Questions Media Resources
15.1 The Central Dogma traces the flow of gene-encoded information.
? There are three principal kinds of RNA: messenger
RNA (mRNA), transcripts of genes used to direct the
assembly of amino acids into proteins; ribosomal
RNA (rRNA), which combines with proteins to make
up the ribosomes that carry out the assembly process;
and transfer RNA (tRNA), molecules that transport
the amino acids to the ribosome for assembly into
proteins.
1. What are the three major
classes of RNA? What is the
function of each type?
2. What is the function of RNA
polymerase in transcription?
What determines where RNA
polymerase begins and ends its
function?
? The sequence of nucleotides in DNA encodes the
sequence of amino acids in proteins. The mRNA
transcribed from the DNA is read by ribosomes in
increments of three nucleotides called codons.
3. How did Crick and his
colleagues determine how many
nucleotides are used to specify
each amino acid? What is an
anticodon?
15.2 Genes encode information in three-nucleotide code words.
? During transcription, the enzyme RNA polymerase
manufactures mRNA molecules with nucleotide
sequences complementary to particular segments of
the DNA.
? During translation, the mRNA sequences direct the
assembly of amino acids into proteins on cytoplasmic
ribosomes.
? The information in a gene and in an mRNA molecule
is read in three-nucleotide blocks called codons.
? On the ribosome, the mRNA molecule is positioned
so that only one of its codons is exposed at any time.
? This exposure permits a tRNA molecule with the
complementary base sequence (anticodon) to bind to
it.
? Attached to the other end of the tRNA is an amino
acid, which is added to the end of the growing
polypeptide chain.
4. During protein synthesis,
what mechanism ensures that
only one amino acid is added to
the growing polypeptide at a
time? What mechanism ensures
the correct amino acid is added
at each position in the
polypeptide?
5. How does an mRNA
molecule specify where the
polypeptide it encodes should
begin? How does it specify
where the polypeptide should
end?
6. What roles do elongation
factors play in translation?
15.3 Genes are first transcribed, then translated.
? Most eukaryotic genes contain noncoding sequences
(introns) interspersed randomly between coding
sequences (exons).
? The portions of an mRNA molecule corresponding
to the introns are removed from the primary RNA
transcript before the remainder is translated.
7. What is an intron? What is an
exon? How is each involved in
the mRNA molecule that is
ultimately translated?
15.4 Eukaryotic gene transcripts are spliced.
? Experiment:
Jacob/Meselson/
Brenner-Discovery of
Messenger RNA
(mRNA)
? Gene Activity
? Transcription
? Translation
? Polyribosomes
? Transcription
? Translation
? Experiment:
Chapeville-Proving
the tRNA Hypothesis
? Experiment:
Nirenberg/Khorana-
Breaking the Genetic
Code
? Experiment: The
Genetic Code is Read
in Three Bases at a
Time
? Experiment:
Chambon-Discovery
of Introns
http://www.mhhe.com/raven6e http://www.biocourse.com
313
16
Control of Gene
Expression
Concept Outline
16.1 Gene expression is controlled by regulating
transcription.
An Overview of Transcriptional Control. In bacteria
transcription is regulated by controlling access of RNA
polymerase to the promoter in a flexible and reversible way;
eukaryotes by contrast regulate many of their genes by
turning them on and off in a more permanent fashion.
16.2 Regulatory proteins read DNA without
unwinding it.
How to Read a Helix without Unwinding It.
Regulatory proteins slide special segments called DNA-
binding motifs along the major groove of the DNA helix,
reading the sides of the bases.
Four Important DNA-Binding Motifs. DNA-binding
proteins contain structural motifs such as the helix-turn-
helix which fit into the major groove of the DNA helix.
16.3 Bacteria limit transcription by blocking RNA
polymerase.
Controlling Transcription Initiation. Repressor
proteins inhibit RNA polymerase’s access to the promoter,
while activators facilitate its binding.
16.4 Transcriptional control in eukaryotes operates at
a distance.
Designing a Complex Gene Control System.
Eukaryotic genes use a complex collection of transcription
factors and enhancers to aid the polymerase in
transcription.
The Effect of Chromosome Structure on Gene
Regulation. The tight packaging of eukaryotic DNA into
nucleosomes does not interfere with gene expression.
Posttranscriptional Control in Eukaryotes. Gene
expression can be controlled at a variety of levels after
transcription.
I
n an orchestra, all of the instruments do not play all the
time; if they did, all they would produce is noise. In-
stead, a musical score determines which instruments in the
orchestra play when. Similarly, all of the genes in an organ-
ism are not expressed at the same time, each gene produc-
ing the protein it encodes full tilt. Instead, different genes
are expressed at different times, with a genetic score writ-
ten in regulatory regions of the DNA determining which
genes are active when (figure 16.1).
FIGURE 16.1
Chromosome puffs. In this chromosome of the fly Drosophila
melanogaster, individual active genes can be visualized as “puffs”
on the chromosomes. The RNA being transcribed from the DNA
template has been radioactively labeled, and the dark specks
indicate its position on the chromosome.
the maintenance of a constant internal environment—is
considered by many to be the hallmark of multicellular or-
ganisms. Although cells in such organisms still respond to
signals in their immediate environment (such as growth
factors and hormones) by altering gene expression, in
doing so they participate in regulating the body as a
whole. In multicellular organisms with relatively constant
internal environments, the primary function of gene con-
trol in a cell is not to respond to that cell’s immediate en-
vironment, but rather to participate in regulating the body
as a whole.
Some of these changes in gene expression compensate
for changes in the physiological condition of the body.
Others mediate the decisions that produce the body, en-
suring that the right genes are expressed in the right cells
at the right time during development. The growth and
development of multicellular organisms entail a long se-
ries of biochemical reactions, each catalyzed by a specific
enzyme. Once a particular developmental change has oc-
curred, these enzymes cease to be active, lest they disrupt
the events that must follow. To produce these enzymes,
genes are transcribed in a carefully prescribed order, each
for a specified period of time. In fact, many genes are ac-
tivated only once, producing irreversible effects. In many
animals, for example, stem cells develop into differenti-
ated tissues like skin cells or red blood cells, following a
fixed genetic program that often leads to programmed
cell death. The one-time expression of the genes that
guide this program is fundamentally different from the
reversible metabolic adjustments bacterial cells make to
the environment. In all multicellular organisms, changes
in gene expression within particular cells serve the needs
of the whole organism, rather than the survival of indi-
vidual cells.
Posttranscriptional Control
Gene expression can be regulated at many levels. By far
the most common form of regulation in both bacteria and
eukaryotes is transcriptional control, that is, control of
the transcription of particular genes by RNA polymerase.
Other less common forms of control occur after transcrip-
tion, influencing the mRNA that is produced from the
genes or the activity of the proteins encoded by the
mRNA. These controls, collectively referred to as post-
transcriptional controls, will be discussed briefly later in
this chapter.
Gene expression is controlled at the transcriptional and
posttranscriptional levels. Transcriptional control,
more common, is effected by the binding of proteins to
regulatory sequences within the DNA.
314 Part V Molecular Genetics
An Overview of
Transcriptional Control
Control of gene expression is essential to all organisms.
In bacteria, it allows the cell to take advantage of chang-
ing environmental conditions. In multicellular organisms,
it is critical for directing development and maintaining
homeostasis.
Regulating Promoter Access
One way to control transcription is to regulate the initia-
tion of transcription. In order for a gene to be tran-
scribed, RNA polymerase must have access to the DNA
helix and must be capable of binding to the gene’s pro-
moter, a specific sequence of nucleotides at one end of
the gene that tells the polymerase where to begin tran-
scribing. How is the initiation of transcription regulated?
Protein-binding nucleotide sequences on the DNA regu-
late the initiation of transcription by modulating the abil-
ity of RNA polymerase to bind to the promoter. These
protein-binding sites are usually only 10 to 15 nucleotides
in length (even a large regulatory protein has a “foot-
print,” or binding area, of only about 20 nucleotides).
Hundreds of these regulatory sequences have been char-
acterized, and each provides a binding site for a specific
protein able to recognize the sequence. Binding the pro-
tein to the regulatory sequence either blocks transcription
by getting in the way of RNA polymerase, or stimulates
transcription by facilitating the binding of RNA poly-
merase to the promoter.
Transcriptional Control in Prokaryotes
Control of gene expression is accomplished very differently
in bacteria than in the cells of complex multicellular organ-
isms. Bacterial cells have been shaped by evolution to grow
and divide as rapidly as possible, enabling them to exploit
transient resources. In bacteria, the primary function of
gene control is to adjust the cell’s activities to its immediate
environment. Changes in gene expression alter which en-
zymes are present in the cell in response to the quantity
and type of available nutrients and the amount of oxygen
present. Almost all of these changes are fully reversible, al-
lowing the cell to adjust its enzyme levels up or down as the
environment changes.
Transcriptional Control in Eukaryotes
The cells of multicellular organisms, on the other hand, have
been shaped by evolution to be protected from transient
changes in their immediate environment. Most of them ex-
perience fairly constant conditions. Indeed, homeostasis—
16.1 Gene expression is controlled by regulating transcription.
How to Read a Helix without
Unwinding It
It is the ability of certain proteins to bind to specific DNA
regulatory sequences that provides the basic tool of gene
regulation, the key ability that makes transcriptional con-
trol possible. To understand how cells control gene expres-
sion, it is first necessary to gain a clear picture of this mole-
cular recognition process.
Looking into the Major Groove
Molecular biologists used to think that the DNA helix had
to unwind before proteins could distinguish one DNA se-
quence from another; only in this way, they reasoned,
could regulatory proteins gain access to the hydrogen
bonds between base-pairs. We now know it is unnecessary
for the helix to unwind because proteins can bind to its
outside surface, where the edges of the base-pairs are ex-
posed. Careful inspection of a DNA molecule reveals two
helical grooves winding round the molecule, one deeper
than the other. Within the deeper groove, called the major
groove, the nucleotides’ hydrophobic methyl groups, hy-
drogen atoms, and hydrogen bond donors and acceptors
protrude. The pattern created by these chemical groups is
unique for each of the four possible base-pair arrange-
ments, providing a ready way for a protein nestled in the
groove to read the sequence of bases (figure 16.2).
DNA-Binding Motifs
Protein-DNA recognition is an area of active research; so
far, the structures of over 30 regulatory proteins have been
analyzed. Although each protein is unique in its fine details,
the part of the protein that actually binds to the DNA is
much less variable. Almost all of these proteins employ one
of a small set of structural, or DNA-binding, motifs, par-
ticular bends of the protein chain that permit it to interlock
with the major groove of the DNA helix.
Regulatory proteins identify specific sequences on the
DNA double helix, without unwinding it, by inserting
DNA-binding motifs into the major groove of the
double helix where the edges of the bases protrude.
Chapter 16 Control of Gene Expression 315
16.2 Regulatory proteins read DNA without unwinding it.
N
G
H
H
H
N
N
NH
O H
H
HN
N
N
C
OH
N
M
in
or groov
e
M
ajo
r groo
ve
N
A
H
H
N
N
NH
Sugar
Phosphate
O
H
CH
3
H
H
N
N
T
O
N
M
in
or groov
e
M
ajo
r groo
ve
Key:
= Hydrogen bond donors
= Hydrogen bond acceptors
= Hydrophobic methyl group
= Hydrogen atoms unable to form hydrogen bonds
FIGURE 16.2
Reading the major groove of DNA. Looking down into the major groove of a DNA helix, we can see the edges of the bases protruding
into the groove. Each of the four possible base-pair arrangements (two are shown here) extends a unique set of chemical groups into the
groove, indicated in this diagram by differently colored balls. A regulatory protein can identify the base-pair arrangement by this
characteristic signature.
Four Important DNA-Binding
Motifs
The Helix-Turn-Helix Motif
The most common DNA-binding motif is the helix-turn-
helix, constructed from two α-helical segments of the pro-
tein linked by a short nonhelical segment, the “turn” (fig-
ure 16.3). The first DNA-binding motif recognized, the
helix-turn-helix motif has since been identified in hundreds
of DNA-binding proteins.
A close look at the structure of a helix-turn-helix motif
reveals how proteins containing such motifs are able to in-
teract with the major groove of DNA. Interactions between
the helical segments of the motif hold them at roughly right
angles to each other. When this motif is pressed against
DNA, one of the helical segments (called the recognition
helix) fits snugly in the major groove of the DNA molecule,
while the other butts up against the outside of the DNA
molecule, helping to ensure the proper positioning of the
recognition helix. Most DNA regulatory sequences recog-
nized by helix-turn-helix motifs occur in symmetrical pairs.
Such sequences are bound by proteins containing two helix-
turn-helix motifs separated by 3.4 nm, the distance required
for one turn of the DNA helix (figure 16.4). Having two
protein/DNA-binding sites doubles the zone of contact be-
tween protein and DNA and so greatly strengthens the
bond that forms between them.
316 Part V Molecular Genetics
Recognition helix
FIGURE 16.3
The helix-turn-helix motif. One helical region, called the
recognition helix, actually fits into the major groove of DNA.
There it contacts the edges of base-pairs, enabling it to recognize
specific sequences of DNA bases.
CAP fragment
3.4 nm
Tryptophan repressor Lambda (H9261) repressor
fragment
3.4 nm 3.4 nm
FIGURE 16.4
How the helix-turn-helix binding motif works. The three regulatory proteins illustrated here all bind to DNA using a pair of helix-
turn-helix binding motifs. In each case, the two copies of the motif (red) are separated by 3.4 nm, precisely the spacing of one turn of the
DNA helix. This allows the regulatory proteins to slip into two adjacent portions of the major groove in DNA, providing a strong
attachment.
The Homeodomain Motif
A special class of helix-turn-helix motifs plays a critical role
in development in a wide variety of eukaryotic organisms,
including humans. These motifs were discovered when re-
searchers began to characterize a set of homeotic mutations
in Drosophila (mutations that alter how the parts of the
body are assembled). They found that the mutant genes en-
coded regulatory proteins whose normal function was to
initiate key stages of development by binding to develop-
mental switch-point genes. More than 50 of these regula-
tory proteins have been analyzed, and they all contain a
nearly identical sequence of 60 amino acids, the homeo-
domain (figure 16.5b). The center of the homeodomain is
occupied by a helix-turn-helix motif that binds to the
DNA. Surrounding this motif within the homeodomain is a
region that always presents the motif to the DNA in the
same way.
The Zinc Finger Motif
A different kind of DNA-binding motif uses one or more
zinc atoms to coordinate its binding to DNA. Called zinc
fingers (figure 16.5c), these motifs exist in several forms. In
one form, a zinc atom links an α-helical segment to a
β sheet segment so that the helical segment fits into the
major groove of DNA. This sort of motif often occurs in
clusters, the β sheets spacing the helical segments so that
each helix contacts the major groove. The more zinc fin-
gers in the cluster, the stronger the protein binds to the
DNA. In other forms of the zinc finger motif, the β sheet’s
place is taken by another helical segment.
The Leucine Zipper Motif
In yet another DNA-binding motif, two different protein
subunits cooperate to create a single DNA-binding site.
This motif is created where a region on one of the subunits
containing several hydrophobic amino acids (usually
leucines) interacts with a similar region on the other sub-
unit. This interaction holds the two subunits together at
those regions, while the rest of the subunits are separated.
Called a leucine zipper, this structure has the shape of a
“Y,” with the two arms of the Y being helical regions that
fit into the major groove of DNA (figure 16.5d). Because
the two subunits can contribute quite different helical re-
gions to the motif, leucine zippers allow for great flexibility
in controlling gene expression.
Regulatory proteins bind to the edges of base-pairs
exposed in the major groove of DNA. Most contain
structural motifs such as the helix-turn-helix,
homeodomain, zinc finger, or leucine zipper.
Chapter 16 Control of Gene Expression 317
(a) Helix-turn-helix motif
(b) Homeodomain
(c) Zinc finger
Zn
Zn
(d) Leucine zipper
FIGURE 16.5
Major DNA-binding motifs.
Controlling Transcription Initiation
How do organisms use regulatory DNA sequences and the
proteins that bind them to control when genes are tran-
scribed? The same basic controls are used in bacteria and
eukaryotes, but eukaryotes employ several additional ele-
ments that reflect their more elaborate chromosomal struc-
ture. We will begin by discussing the relatively simple con-
trols found in bacteria.
Repressors Are OFF Switches
A typical bacterium possesses genes encoding several thou-
sand proteins, but only some are transcribed at any one
time; the others are held in reserve until needed. When the
cell encounters a potential food source, for example, it be-
gins to manufacture the enzymes necessary to metabolize
that food. Perhaps the best-understood example of this
type of transcriptional control is the regulation of
tryptophan-producing genes (trp genes), which was investi-
gated in the pioneering work of Charles Yanofsky and his
students at Stanford University.
Operons. The bacterium Escherichia coli uses proteins en-
coded by a cluster of five genes to manufacture the amino
acid tryptophan. All five genes are transcribed together as a
unit called an operon, producing a single, long piece of
mRNA. RNA polymerase binds to a promoter located at
the beginning of the first gene, and then proceeds down
the DNA, transcribing the genes one after another. Regu-
latory proteins shut off transcription by binding to an oper-
ator site immediately in front of the promoter and often
overlapping it.
When tryptophan is present in the medium surround-
ing the bacterium, the cell shuts off transcription of the
trp genes by means of a tryptophan repressor, a helix-
turn-helix regulatory protein that binds to the operator
site located within the trp promoter (figure 16.6). Binding
of the repressor to the operator prevents RNA polymerase
from binding to the promoter. The key to the functioning
of this control mechanism is that the tryptophan repressor
cannot bind to DNA unless it has first bound to two mol-
ecules of tryptophan. The binding of tryptophan to the
repressor alters the orientation of a pair of helix-turn-
helix motifs in the repressor, causing their recognition
helices to fit into adjacent major grooves of the DNA
(figure 16.7).
Thus, the bacterial cell’s synthesis of tryptophan de-
pends upon the absence of tryptophan in the environment.
When the environment lacks tryptophan, there is nothing
to activate the repressor, so the repressor cannot prevent
318 Part V Molecular Genetics
16.3 Bacteria limit transcription by blocking RNA polymerase.
Tryptophan
Promoter
Start of
transcription
Operator
Tryptophan
present
Tryptophan
absent
mRNA synthesis
RNA polymerase
RNA polymerase cannot bind
Inactive
repressor
Active
repressor
Genes are ON
Genes are OFF
Tryptophan is
synthesized
Tryptophan is
not synthesized
FIGURE 16.6
How the trp operon is controlled. The tryptophan repressor cannot bind the operator (which is located within the promoter) unless
tryptophan first binds to the repressor. Therefore, in the absence of tryptophan, the promoter is free to function and RNA polymerase
transcribes the operon. In the presence of tryptophan, the tryptophan-repressor complex binds tightly to the operator, preventing RNA
polymerase from initiating transcription.
RNA polymerase from binding to the trp promoter. The
trp genes are transcribed, and the cell proceeds to manufac-
ture tryptophan from other molecules. On the other hand,
when tryptophan is present in the environment, it binds to
the repressor, which is then able to bind to the trp pro-
moter. This blocks transcription of the trp genes, and the
cell’s synthesis of tryptophan halts.
Activators Are ON Switches
Not all regulatory switches shut genes off—some turn
them on. In these instances, bacterial promoters are delib-
erately constructed to be poor binding sites for RNA poly-
merase, and the genes these promoters govern are thus
rarely transcribed—unless something happens to improve
the promoter’s ability to bind RNA polymerase. This can
happen if a regulatory protein called a transcriptional ac-
tivator binds to the DNA nearby. By contacting the poly-
merase protein itself, the activator protein helps hold the
polymerase against the DNA promoter site so that tran-
scription can begin.
A well-understood transcriptional activator is the
catabolite activator protein (CAP) of E. coli, which initiates
the transcription of genes that allow E. coli to use other
molecules as food when glucose is not present. Falling lev-
els of glucose lead to higher intracellular levels of the sig-
naling molecule, cyclic AMP (cAMP), which binds to the
CAP protein. When cAMP binds to it, the CAP protein
changes shape, enabling its helix-turn-helix motif to bind
to the DNA near any of several promoters. Consequently,
those promoters are activated and their genes can be tran-
scribed (figure 16.8).
Chapter 16 Control of Gene Expression 319
Tryptophan
3.4 nm
FIGURE 16.7
How the tryptophan repressor works. The binding of tryptophan to the repressor increases the distance between the two recognition
helices in the repressor, allowing the repressor to fit snugly into two adjacent portions of the major groove in DNA.
CAP
cAMP
FIGURE 16.8
How CAP works. Binding of the catabolite activator protein
(CAP) to DNA causes the DNA to bend around it. This increases
the activity of RNA polymerase.
Combinations of Switches
By combining ON and OFF switches,
bacteria can create sophisticated transcrip-
tional control systems. A particularly well-
studied example is the lac operon of E.
coli (figure 16.9). This operon is responsi-
ble for producing three proteins that im-
port the disaccharide lactose into the cell
and break it down into two monosaccha-
rides: glucose and galactose.
The Activator Switch. The lac operon
possesses two regulatory sites. One is a
CAP site located adjacent to the lac pro-
moter. It ensures that the lac genes are not
transcribed effectively when ample
amounts of glucose are already present. In
the absence of glucose, a high level of
cAMP builds up in the cell. Consequently,
cAMP is available to bind to CAP and
allow it to change shape, bind to the
DNA, and activate the lac promoter (figure 16.10). In the
presence of glucose, cAMP levels are low, CAP is unable to
bind to the DNA, and the lac promoter is not activated.
The Repressor Switch. Whether the lac genes are actu-
ally transcribed in the absence of glucose is determined by
the second regulatory site, the operator, which is located
adjacent to the promoter. A protein called the lac repressor
is capable of binding to the operator, but only when lactose
is absent. Because the operator and the promoter are close
together, the repressor covers part of the promoter when it
binds to the operator, preventing RNA polymerase from
proceeding and so blocking transcription of the lac genes.
These genes are then said to be “repressed” (figure 16.11).
As a result, the cell does not transcribe genes whose prod-
ucts it has no use for. However, when lactose is present, a
lactose isomer binds to the repressor, twisting its binding
motif away from the major groove of the DNA. This pre-
vents the repressor from binding to the operator and so al-
lows RNA polymerase to bind to the promoter and tran-
scribe the lac genes. Transcription of the lac operon is said
to have been “induced” by lactose.
This two-switch control mechanism thus causes the cell
to produce lactose-utilizing proteins whenever lactose is
present but glucose is not, enabling it to make a metabolic
decision to produce only what the cell needs, conserving its
resources (figure 16.12).
Bacteria regulate gene expression transcriptionally
through the use of repressor and activator “switches,”
such as the trp repressor and the CAP activator. The
transcription of some clusters of genes, such as the lac
operon, is regulated by both repressors and activators.
320 Part V Molecular Genetics
Promoter
for I gene
Gene for
repressor protein
Regulatory region Coding region
CAP binding
site
Gene for
permease
Operator
Promoter for
lac operon
Gene for
H9252-galactosidase
Gene for
transacetylase
P
I
CAP
O
Z
Y
A
P
lac
I
lac control system
FIGURE 16.9
The lac region of the Escherichia coli chromosome. The lac operon consists of a
promoter, an operator, and three genes that code for proteins required for the
metabolism of lactose. In addition, there is a binding site for the catabolite activator
protein (CAP), which affects whether or not RNA polymerase will bind to the
promoter. Gene I codes for a repressor protein, which will bind to the operator and
block transcription of the lac genes. The genes Z, Y, and A encode the two enzymes and
the permease involved in the metabolism of lactose.
RNA polymerase
RNA polymerase
cAMP CAP
CAP
CAP
CAP
Promoter for lac operon
P
lac
P
lac
(a) Glucose low, promoter activated
(b) Glucose high, promoter not activated
Promoter for lac operon
O
O
CAP binding
site
FIGURE 16.10
How the CAP site works. The CAP molecule can attach to the
CAP binding site only when the molecule is bound to cAMP.
(a) When glucose levels are low, cAMP is abundant and binds to
CAP. The cAMP-CAP complex binds to the CAP site, bends in
the DNA, and gives RNA polymerase access to the promoter.
(b) When glucose levels are high, cAMP is scarce, and CAP is
unable to activate the promoter.
Chapter 16 Control of Gene Expression 321
RNA
polymerase
Repressor
Promoter for
lac operon
P
lac
O
DNA
helix
(a)
RNA polymerase cannot transcribe lac genes
Repressor
CAP
CAP
CAP
CAP
Promoter
Promoter
Operator
Operator
Lactose (inducer)
cAMP
cAMP
P
lac
P
lac
RNA
polymerase
RNA
polymerase
O
O
Y
Y
A
A
I
I
Z
Z
(b) lac operon is "repressed"
(c) lac operon is "induced"
FIGURE 16.11
How the lac repressor works. (a) The lac repressor. Because the repressor fills the major groove of the DNA helix, RNA polymerase
cannot fully attach to the promoter, and transcription is blocked. (b) The lac operon is shut down (“repressed”) when the repressor protein
is bound to the operator site. Because promoter and operator sites overlap, RNA polymerase and the repressor cannot functionally bind at
the same time, any more than two people can sit in the same chair at once. (c) The lac operon is transcribed (“induced”) when CAP is
bound and when lactose binding to the repressor changes its shape so that it can no longer sit on the operator site and block RNA
polymerase activity.
mRNA synthesis
CAP
binding
site
RNA-polymerase
binding site
(promoter)
Operator
lacZ gene
Operon OFF
because CAP
is not bound
Operon OFF
both because lac
repressor is
bound and CAP
is not
Operon OFF
because lac
repressor is
bound
Operon ON
because CAP
is bound and
lac repressor
is not
RNA polymerase
Repressor
RNA polymerase
CAP
CAP
Gluc
ose
Lac
t
ose
+
+
+
+
FIGURE 16.12
Two regulatory proteins control the lac
operon. Together, the lac repressor and CAP
provide a very sensitive response to the cell’s need
to utilize lactose-metabolizing enzymes.
322 Part V Molecular Genetics
Designing a Complex Gene
Control System
As we have seen, combinations of ON and OFF control
switches allow bacteria to regulate the transcription of par-
ticular genes in response to the immediate metabolic de-
mands of their environment. All of these switches work by
interacting directly with RNA polymerase, either blocking
or enhancing its binding to specific promoters. There is a
limit to the complexity of this sort of regulation, however,
because only a small number of switches can be squeezed
into and around one promoter. In a eukaryotic organism
that undergoes a complex development, many genes must
interact with one another, requiring many more interacting
elements than can fit around a single promoter (table 16.1).
In eukaryotes, this physical limitation is overcome by
having distant sites on the chromosome exert control over
the transcription of a gene (figure 16.13). In this way, many
regulatory sequences scattered around the chromosomes
can influence a particular gene’s transcription. This
“control-at-a-distance” mechanism includes two features: a
set of proteins that help bind RNA polymerase to the pro-
moter, and modular regulatory proteins that bind to distant
sites. These two features produce a truly flexible control
system.
16.4 Transcriptional control in eukaryotes operates at a distance.
Base pairs
GCCAATGC TATA
-60 bp -25 bp-80 bp-100 bp
Thymidine kinase
promoter
Thymidine
kinase
gene
FIGURE 16.13
A eukaryotic promoter. This promoter for the gene encoding
the enzyme thymidine kinase contains the TATA box that the
initiation factor binds to, as well as three other DNA sequences
that direct the binding of other elements of the transcription
complex.
Table 16.1 Some Gene Regulatory Proteins and the DNA Sequences They Recognize
Regulatory Regulatory
Proteins Proteins
of Species DNA Sequence Recognized* of Species DNA Sequence Recognized*
ESCHERICHIA COLI
lac repressor
CAP
H9261 repressor
YEAST
GAL4
MAT H92512
GCN4
AATTGTGAGCGGATAACAATT
TTAACACTCGCCTATTGTTAA
TGTGAGTTAGCTCACT
ACACTCAATCGAGTGA
TATCACCGCCAGAGGTA
ATAGTGGCGGTCTCCAT
CGGAGGACTGTCCTCCG
GCCTCCTGACAGGAGGC
CATGTAATT
GTACATTAA
ATGACTCAT
TACTGAGTA
AACGGGTTAA
TTGCCCAATT
GGGATTAGA
CCCTAATCT
GGGCGG
CCCGCC
ATGCAAAT
TACGTTTA
TGATAG
ACTATC
*Each regulatory protein is able to recognize a family of closely related DNA sequences; only one member of each family is listed here.
DROSOPHILA
MELANOGASTER
Krüppel
bicoid
HUMAN
Spl
Oct-1
GATA-1
Eukaryotic Transcription Factors
For RNA polymerase to successfully bind to a eukaryotic
promoter and initiate transcription, a set of proteins
called transcription factors must first assemble on the
promoter, forming a complex that guides and stabilizes
the binding of the polymerase (figure 16.14). The assem-
bly process begins some 25 nucleotides upstream from the
transcription start site, where a transcription factor com-
posed of many subunits binds to a short TATA sequence
(discussed in chapter 15). Other transcription factors then
bind, eventually forming a full transcription factor com-
plex able to capture RNA polymerase. In many instances,
the transcription factor complex then phosphorylates the
bound polymerase, disengaging it from the complex so
that it is free to begin transcription.
The binding of several different transcription factors
provides numerous points where control over transcription
may be exerted. Anything that reduces the availability of a
particular factor (for example, by regulating the promoter
that governs the expression and synthesis of that factor) or
limits its ease of assembly into the transcription factor
complex will inhibit transcription.
Chapter 16 Control of Gene Expression 323
Repressor
Silencer
Enhancer
Enhancer
Enhancer
Activator
Activator
Activator
DNA
RNA polymerase
TATA-
binding
protein
Core promoter
A
B
F
E
H
250
110
40
30
30
150
60
80
Activators
These regulatory proteins bind to DNA at distant sites
known as enhancers. When DNA folds so that the
enhancer is brought into proximity with the transcription
complex, the activator proteins interact with the complex
to increase the rate of transcription.
Repressors
These regulatory proteins bind to "silencer" sites
on the DNA, preventing the binding of activators
to nearby enhancers and so slowing transcription.
Basal factors
These transcription factors, in response to
coactivators, position RNA polymerase at
the start of a protein-coding sequence, and
then release the polymerase to transcribe
the mRNA.
Coactivators
These transcription factors transmit signals
from activator proteins to the basal factors.
TAT
A
bo
x
Codi
ng re
gion
FIGURE 16.14
The structure of a human transcription complex. The transcription complex that positions RNA polymerase at the beginning of a
human gene consists of four kinds of proteins. Basal factors (the green shapes at bottom of complex with letter names) are transcription
factors that are essential for transcription but cannot by themselves increase or decrease its rate. They include the TATA-binding protein,
the first of the basal factors to bind to the core promoter sequence. Coactivators (the tan shapes that form the bulk of the transcription
complex, named according to their molecular weights) are transcription factors that link the basal factors with regulatory proteins called
activators (the red shapes). The activators bind to enhancer sequences at other locations on the DNA. The interaction of individual basal
factors with particular activator proteins is necessary for proper positioning of the polymerase, and the rate of transcription is regulated by
the availability of these activators. When a second kind of regulatory protein called a repressor (the purple shape) binds to a so-called
“silencer” sequence located adjacent to or overlapping an enhancer sequence, the corresponding activator that would normally have bound
that enhancer is no longer able to do so. The activator is thus unavailable to interact with the transcription complex and initiate
transcription.
Enhancers
A key advance in the evolution of eukaryotic gene tran-
scription was the advent of regulatory proteins composed
of two distinct modules, or domains. The DNA-binding
domain physically attaches the protein to the DNA at a
specific site, using one of the structural motifs discussed
earlier, while the regulatory domain interacts with other
regulatory proteins.
The great advantage of this modular design is that it un-
couples regulation from DNA binding, allowing a regula-
tory protein to bind to a specific DNA sequence at one site
on a chromosome and exert its regulation over a promoter
at another site, which may be thousands of nucleotides
away. The distant sites where these regulatory proteins
bind are called enhancers. Although enhancers also occur
in exceptional instances in bacteria (figure 16.15), they are
the rule rather than the exception in eukaryotes.
How can regulatory proteins affect a promoter when
they bind to the DNA at enhancer sites located far from
the promoter? Apparently the DNA loops around so that
the enhancer is positioned near the promoter. This brings
the regulatory domain of the protein attached to the en-
hancer into direct contact with the transcription factor
complex attached to the promoter (figure 16.16).
The enhancer mode of transcriptional control that has
evolved in eukaryotes adds a great deal of flexibility to the
control process. The positioning of regulatory sites at a
distance permits a large number of different regulatory
sequences scattered about the DNA to influence a partic-
ular gene.
Transcription factors and enhancers confer great
flexibility on the control of gene expression in
eukaryotes.
324 Part V Molecular Genetics
NtrC (Activator) RNA polymerase
Promoter
Bacterial RNA polymerase is loosely
bound to the promoter. The activator
(NtrC) binds at the enhancer.
ADP
DNA loops around so
that the activator comes
into contact with the
RNA polymerase.
The activator triggers RNA polymerase
activation, and transcription begins.
DNA unloops.
mRNA synthesis
ATP
20 nm
Enhancer
FIGURE 16.15
An enhancer in action. When the bacterial activator NtrC binds to an enhancer, it causes the DNA to loop over to a distant site where
RNA polymerase is bound, activating transcription. While such enhancers are rare in bacteria, they are common in eukaryotes.
Activator
Enhancer
sequence
Transcription
factor
RNA polymerase
Promoter Coding
region
of gene
mRNA synthesis
FIGURE 16.16
How enhancers work. The enhancer site is located far away
from the gene being regulated. Binding of an activator (red) to the
enhancer allows the activator to interact with the transcription
factors (green) associated with RNA polymerase, activating
transcription.
The Effect of Chromosome
Structure on Gene Regulation
The way DNA is packaged into chromosomes can have a
profound effect on gene expression. As we saw in chapter 11,
the DNA of eukaryotes is packaged in a highly compact
form that enables it to fit into the cell nucleus. DNA is
wrapped tightly around histone proteins to form nucleo-
somes (figure 16.17) and then the strand of nucleosomes is
twisted into 30-nm filaments.
Promoter Blocking by Nucleosomes
Intensive study of eukaryotic chromosomes has shown
that histones positioned over promoters block the assem-
bly of transcription factor complexes. Therefore, tran-
scription factors appear unable to bind to a promoter
packaged in a nucleosome. In this way, nucleosomes may
prevent continuous transcription initiation. On the other
hand, nucleosomes do not inhibit activators and RNA
polymerase. The regulatory domains of activators at-
tached to enhancers apparently are able to displace the
histones that block a promoter. In fact, this displacement
of histones and the binding of activator to promoter are
required for the assembly of the transcription factor com-
plex. Once transcription has begun, RNA polymerase
seems to push the histones aside as it traverses the nucle-
osome.
DNA Methylation
Chemical methylation of the DNA was once thought to
play a major role in gene regulation in vertebrate cells.
The addition of a methyl group to cytosine creates
5-methylcytosine but has no effect on base-pairing with
guanine (figure 16.18), just as the addition of a methyl
group to uracil produces thymine without affecting base-
pairing with adenine. Many inactive mammalian genes
are methylated, and it was tempting to conclude that
methylation caused the inactivation. However, methyla-
tion is now viewed as having a less direct role, blocking
accidental transcription of “turned-off” genes. Verte-
brate cells apparently possess a protein that binds to clus-
ters of 5-methylcytosine, preventing transcriptional acti-
vators from gaining access to the DNA. DNA
methylation in vertebrates thus ensures that once a gene
is turned off, it stays off.
Transcriptional control of gene expression occurs in
eukaryotes despite the tight packaging of DNA into
nucleosomes.
Chapter 16 Control of Gene Expression 325
(a)
Core complex
of histones
DNA
Exterior
histone
(b)
FIGURE 16.17
Nucleosomes. (a) In the electron micrograph, the individual
nucleosomes have diameters of about 10 nm. (b) In the diagram of
a nucleosome, the DNA double helix is wound around a core
complex of eight histones; one additional histone binds to the
outside of the nucleosome, exterior to the DNA.
H
C
Cytosine 5-methylcytosine
MethylationC
N
CH H
CH
1
6
5
2
4
O
NH
2
NH
2
N
H
C
C
N
C
CH
3
C
O N
3
FIGURE 16.18
DNA methylation. Cytosine is methylated, creating
5-methylcytosine. Because the methyl group is positioned to the
side, it does not interfere with the hydrogen bonds of a GC base-
pair.
Posttranscriptional Control in
Eukaryotes
Thus far we have discussed gene regulation entirely in
terms of transcription initiation, that is, when and how
often RNA polymerase starts “reading” a particular gene.
Most gene regulation appears to occur at this point. How-
ever, there are many other points after transcription where
gene expression could be regulated in principle, and all of
them serve as control points for at least some eukaryotic
genes. In general, these posttranscriptional control
processes involve the recognition of specific sequences on
the primary RNA transcript by regulatory proteins or other
RNA molecules.
Processing of the Primary Transcript
As we learned in chapter 15, most eukaryotic genes have a
patchwork structure, being composed of numerous short
coding sequences (exons) embedded within long stretches
of noncoding sequences (introns). The initial mRNA mole-
cule copied from a gene by RNA polymerase, the primary
transcript, is a faithful copy of the entire gene, including
introns as well as exons. Before the primary transcript is
translated, the introns, which comprise on average 90% of
the transcript, are removed in a process called RNA pro-
cessing, or RNA splicing. Particles called small nuclear ri-
bonucleoproteins, or snRNPs (more informally, snurps), are
thought to play a role in RNA splicing. These particles re-
side in the nucleus of a cell and are composed of proteins
and a special type of RNA called small nuclear RNA, or
snRNA. One kind of snRNP contains snRNA that can bind
to the 5′ end of an intron by forming base-pairs with com-
plementary sequences on the intron. When multiple
snRNPs combine to form a larger complex called
a spliceosome, the intron loops out and is excised
(figure 16.19).
RNA splicing provides a potential point where the ex-
pression of a gene can be controlled, because exons can be
326 Part V Molecular Genetics
snRNPs
ExonExon
Intron
snRNA
Spliceosome
Exon Exon
Excised
intron
snRNA forms
base-pairs with
5H11032 end of intron.
Spliceosome and
looped intron form.
Exons are spliced;
spliceosome disassembles.
Mature mRNA
5H11032 end of intron is cut and
attached near 3H11032 end of intron,
forming a lariat. The 3H11032
end of the intron is then cut.
5H11032
5H11032
5H11032
5H11032
3H11032
3H11032
3H11032
3H11032
FIGURE 16.19
How spliceosomes process RNA. Particles called snRNPs contain snRNA that interacts with the 5′ end of an intron. Several
snRNPs come together and form a spliceosome. As the intron forms a loop, the 5′ end is cut and linked to a site near the 3′ end of the
intron. The intron forms a lariat that is excised, and the exons are spliced together. The spliceosome then disassembles and releases
the mature mRNA.
spliced together in different ways, allowing a variety of dif-
ferent polypeptides to be assembled from the same gene!
Alternative splicing is common in insects and vertebrates,
with two or three different proteins produced from one
gene. In many cases, gene expression is regulated by chang-
ing which splicing event occurs during different stages of
development or in different tissues.
An excellent example of alternative splicing in action is
found in two different human organs, the thyroid and the
hypothalamus. The thyroid gland (see chapter 56) is re-
sponsible for producing hormones that control processes
such as metabolic rate. The hypothalamus, located in the
brain, collects information from the body (for example, salt
balance) and releases hormones that in turn regulate the re-
lease of hormones from other glands, such as the pituitary
gland (see chapter 56). The two organs produce two dis-
tinct hormones, calcitonin and CGRP (calcitonin gene-
related peptide) as part of their function. Calcitonin is re-
sponsible for controlling the amount of calcium we take up
from our food and the balance of calcium in tissues like
bone and teeth. CGRP is involved in a number of neural
and endocrine functions. Although these two hormones are
used for very different physiological purposes, the hor-
mones are made using the same transcript (figure 16.20).
The appearance of one product versus another is deter-
mined by tissue-specific factors that regulate the processing
of the primary transcript. This ability offers another pow-
erful way to control the expression of gene products, rang-
ing from proteins with subtle differences to totally unre-
lated proteins.
Transport of the Processed Transcript Out
of the Nucleus
Processed mRNA transcripts exit the nucleus through the
nuclear pores described in chapter 5. The passage of a tran-
script across the nuclear membrane is an active process that
requires that the transcript be recognized by receptors lin-
ing the interior of the pores. Specific portions of the tran-
script, such as the poly-A tail, appear to play a role in this
recognition. The transcript cannot move through a pore as
long as any of the splicing enzymes remain associated with
the transcript, ensuring that partially processed transcripts
are not exported into the cytoplasm.
There is little hard evidence that gene expression is reg-
ulated at this point, although it could be. On average, about
10% of transcribed genes are exon sequences, but only
about 5% of the total mRNA produced as primary tran-
script ever reaches the cytoplasm. This suggests that about
half of the exon primary transcripts never leave the nucleus,
but it is not clear whether the disappearance of this mRNA
is selective.
Selecting Which mRNAs Are Translated
The translation of a processed mRNA transcript by the ri-
bosomes in the cytoplasm involves a complex of proteins
called translation factors. In at least some cases, gene ex-
pression is regulated by modification of one or more of
these factors. In other instances, translation repressor
proteins shut down translation by binding to the begin-
ning of the transcript, so that it cannot attach to the ribo-
some. In humans, the production of ferritin (an iron-
storing protein) is normally shut off by a translation
repressor protein called aconitase. Aconitase binds to a 30-
nucleotide sequence at the beginning of the ferritin
mRNA, forming a stable loop to which ribosomes cannot
bind. When the cell encounters iron, the binding of iron to
aconitase causes the aconitase to dissociate from the ferritin
mRNA, freeing the mRNA to be translated and increasing
ferritin production 100-fold.
Chapter 16 Control of Gene Expression 327
Mature
mRNA
Splicing
pathway 2
(thyroid)
Splicing
pathway 1
(hypothalamus)
CGRP
peptide
CGRP
CGRP
D
C
B
A
B
C
D
Calcitonin
Calcitonin
B
C
D
Primary
RNA
transcript
Mature
mRNA
Calcitonin
peptide
FIGURE 16.20
Alternative splicing products. The same transcript made from
one gene can be spliced differently to give rise to two very distinct
protein products, calcitonin and CGRP.
Selectively Degrading mRNA Transcripts
Another aspect that affects gene expression is the stability
of mRNA transcripts in the cell cytoplasm (figure 16.21).
Unlike bacterial mRNA transcripts, which typically have a
half-life of about 3 minutes, eukaryotic mRNA transcripts
are very stable. For example, β-globin gene transcripts have
a half-life of over 10 hours, an eternity in the fast-moving
metabolic life of a cell. The transcripts encoding regulatory
proteins and growth factors, however, are usually much less
stable, with half-lives of less than 1 hour. What makes
these particular transcripts so unstable? In many cases, they
contain specific sequences near their 3′ ends that make
them attractive targets for enzymes that degrade mRNA. A
sequence of A and U nucleotides near the 3′ poly-A tail of a
transcript promotes removal of the tail, which destabilizes
the mRNA. Histone transcripts, for example, have a half-
life of about 1 hour in cells that are actively synthesizing
DNA; at other times during the cell cycle, the poly-A tail is
lost and the transcripts are degraded within minutes. Other
mRNA transcripts contain sequences near their 3′ ends that
are recognition sites for endonucleases, which causes these
transcripts to be digested quickly. The short half-lives of
the mRNA transcripts of many regulatory genes are critical
to the function of those genes, as they enable the levels of
regulatory proteins in the cell to be altered rapidly.
An Example of a Complex Gene Control System
Sunlight is an important gene-controlling signal for plants,
from germination to seed formation. Plants must regulate
their genes according to the presence of sunlight, the qual-
ity of the light source, the time of day, and many other en-
vironmental signals. The combination of these responses
culminate in the way the genes are regulated, such as the
genes cab (a chlorophyll-binding photosynthetic protein)
and rbcS (a subunit of a carbon-fixing enzyme). For in-
stance, photosynthesis-related genes tend to express early
in the day, to carry out photosynthesis, and begin to shut
down later in the day. Expression levels may also be regu-
lated according to lighting conditions, such as cloudy days
versus sunny days. When darkness arrives, the transcripts
must be degraded in preparation for the next day. This is
an example of how complex a gene control system can be,
and scientists are just beginning to understand parts of such
a complicated system.
Although less common than transcriptional control,
posttranscriptional control of gene expression occurs in
eukaryotes via RNA splicing, translation repression, and
selective degradation of mRNA transcripts.
328 Part V Molecular Genetics
operon A cluster of functionally related
genes transcribed into a single mRNA mol-
ecule. A common mode of gene regulation
in prokaryotes, it is rare in eukaryotes other
than fungi.
promoter A site upstream from a gene to
which RNA polymerase attaches to initiate
transcription.
repressor A protein that regulates tran-
scription by binding to the operator and so
preventing RNA polymerase from initiating
transcription from the promoter.
RNA polymerase The enzyme that tran-
scribes DNA into RNA.
transcription The RNA polymerase-
catalyzed assembly of an RNA molecule
complementary to a strand of DNA.
translation The assembly of a polypep-
tide on the ribosomes, using mRNA to di-
rect the sequence of amino acids.
exon A segment of eukaryotic DNA that
is both transcribed into mRNA and trans-
lated into protein. Exons are typically scat-
tered within much longer stretches of non-
translated intron sequences.
intron A segment of eukaryotic DNA that
is transcribed into mRNA but removed be-
fore translation.
nonsense codon A codon (UAA, UAG, or
UGA) for which there is no tRNA with
a complementary andicodon; a chain-
terminating codon often called a “stop” codon.
operator A site of negative gene regula-
tion; a sequence of nucleotides near or
within the promoter that is recognized by a
repressor. Binding of the repressor to the
operator prevents the functional binding of
RNA polymerase to the promoter and so
blocks transcription.
activator A regulatory protein that pro-
motes gene transcription by binding to
DNA sequences upstream of a promoter.
Activator binding stimulates RNA poly-
merase activity.
anticodon The three-nucleotide sequence
on one end of a tRNA molecule that is
complementary to and base-pairs with an
amino acid–specifying codon in mRNA.
codon The basic unit of the genetic code;
a sequence of three adjacent nucleotides in
DNA or mRNA that codes for one amino
acid or for polypeptide termination.
A Vocabulary of
Gene Expression
Chapter 16 Control of Gene Expression 329
Amino
acid
Completed
polypeptide
Cytoplasm
tRNA
Ribosome moves
toward 3H11541 end
Ribosome
Nuclear
membrane
Nuclear
pore
Small
ribosomal
subunit
Cap
Large
ribosomal
subunit
mRNA
mRNA
5H11541
5H11541
5H11541
5H11541
5H11541
3H11541
3H11541
3H11541
3H11541
3H11541
3H11541
Poly-A
tail
Exons
Introns
RNA
polymerase
DNA
Cap
Poly-A
tail
Exon splicing. Gene expression
can be controlled by altering the
rate of splicing in eukaryotes.
Post-translational
modification.
Phosphorylation or other
chemical modifications
can alter the activity of a
protein after it is produced.
6.
Protein synthesis. Many
proteins take part in the
translation process, and
regulation of the availability of
any of them alters the rate of
gene expression by speeding
or slowing protein synthesis.
5.
Initiation of
transcription.
Most control of gene
expression is achieved by
regulating the frequency of
transcription initiation.
1.
2.
Destruction of
the transcript.
Many enzymes
degrade mRNA, and
gene expression can
be regulated by
modulating the degree
to which the transcript
is protected.
4.
Passage through the
nuclear membrane.
Gene expression can be regulated
by controlling access to or efficiency
of transport channels.
3.
Primary
RNA transcript
PO
4
PO
4
FIGURE 16.21
Six levels where gene expression can be controlled in eukaryotes.
330 Part V Molecular Genetics
Chapter 16
Summary Questions Media Resources
16.1 Gene expression is controlled by regulating transcription.
? Regulatory sequences are short stretches of DNA that
function in transcriptional control but are not
transcribed themselves.
? Regulatory proteins recognize and bind to specific
regulatory sequences on the DNA.
1. How do regulatory proteins
identify specific nucleotide
sequences without unwinding
the DNA?
? Regulatory proteins possess structural motifs that
allow them to fit snugly into the major groove of
DNA, where the sides of the base-pairs are exposed.
? Common structural motifs include the helix-turn-
helix, homeodomain, zinc finger, and leucine zipper.
2. What is a helix-turn-helix
motif? What sort of
developmental events are
homeodomain motifs involved
in?
16.2 Regulatory proteins read DNA without unwinding it.
? Many genes are transcriptionally regulated through
repressors, proteins that bind to the DNA at or near
the promoter and thereby inhibit transcription of the
gene.
? Genes may also be transcriptionally regulated
through activators, proteins that bind to the DNA
and thereby stimulate the binding of RNA
polymerase to the promoter.
? Transcription is often controlled by a combination of
repressors and activators.
3. Describe the mechanism by
which the transcription of trp
genes is regulated in Escherichia
coli when tryptophan is present
in the environment.
4. Describe the mechanism by
which the transcription of lac
genes is regulated in E. coli when
glucose is absent but lactose is
present in the environment.
16.3 Bacteria limit transcription by blocking RNA polymerase.
? In eukaryotes, RNA polymerase cannot bind to the
promoter unless aided by a family of transcription
factors.
? Anything that interferes with the activity of the
transcription factors can block or alter gene
expression.
? Eukaryotic DNA is packaged tightly in nucleosomes
within chromosomes. This packaging appears to
provide some inhibition of transcription, although
regulatory proteins and RNA polymerase can still
activate specific genes even when they are so
packaged.
? Gene expression can also be regulated at the
posttranscriptional level, through RNA splicing,
translation repressor proteins, and the selective
degradation of mRNA transcripts.
5. How do transcription factors
promote transcription in
eukaryotic cells? How do the
enhancers of eukaryotic cells
differ from most regulatory sites
on bacterial DNA?
6. What role does the
methylation of DNA likely play
in transcriptional control?
7. How does the primary RNA
transcript of a eukaryotic gene
differ from the mRNA transcript
of that gene as it is translated in
the cytoplasm?
8. How can a eukaryotic cell
control the translation of mRNA
transcripts after they have been
transported from the nucleus to
the cytoplasm?
16.4 Transcriptional control in eukaryotes operates at a distance.
http://www.mhhe.com/raven6e http://www.biocourse.com
? Exploration: Gene
regulation
? Student Research:
Heat Shock Proteins
? Art Activity: The lac
operon
? Regulation of E.coli lac
operon
? Regulation of E.coli
trp operon
? Gene Regulation
? Exploration: Reading
DNA
331
17
Cellular Mechanisms
of Development
Concept Outline
17.1 Development is a regulated process.
Overview of Development. Studies of cellular
mechanisms have focused on mice, fruit flies, nematodes,
and flowering plants.
Vertebrate Development. Vertebrates develop in a
highly orchestrated fashion.
Insect Development. Insect development is highly
specialized, many key events occurring in a fused mass of
cells.
Plant Development. Unlike animal development, which
is buffered from the environment, plant development is
sensitive to environmental influences.
17.2 Multicellular organisms employ the same basic
mechanisms of development.
Cell Movement and Induction. Animal cells move by
extending protein cables that they use to pull themselves
past surrounding cells. Transcription within cells is
influenced by signal molecules from other cells.
Determination. Cells become reversibly committed to
particular developmental paths.
Pattern Formation. Diffusion of chemical inducers
governs pattern formation in fly embryos.
Expression of Homeotic Genes. Master genes
determine the form body segments will take.
Programmed Cell Death. Some genes, when activated,
kill their cells.
17.3 Four model developmental systems have been
extensively researched.
The Mouse. Mus musculus.
The Fruit Fly. Drosophila melanogaster.
The Nematode. Caenorhabditis elegans.
The Flowering Plant. Arabidopsis thaliana.
17.4 Aging can be considered a developmental
process.
Theories of Aging. While there are many ideas
about why cells age, no one theory of aging is widely
accepted.
I
n the previous chapter, we explored gene expression
from the perspective of an individual cell, examining the
diverse mechanisms that may be employed by a cell to
control the transcription of particular genes. Now we will
broaden our perspective and look at the unique challenge
posed by the development of a cell into a multicellular or-
ganism (figure 17.1). In the course of this developmental
journey, a pattern of decisions about transcription are
made that cause particular lines of cells to proceed along
different paths, spinning an incredibly complex web of
cause and effect. Yet, for all its complexity, this develop-
mental program works with impressive precision. In this
chapter, we will explore the mechanisms used by multicel-
lular organisms to control their development and achieve
this precision.
FIGURE 17.1
A collection of future fish undergo embryonic development.
Inside a transparent fish egg, a single cell becomes millions of
cells that form eyes, fins, gills, and other body parts.
332 Part V Molecular Genetics
Overview of Development
Organisms in all three multicellular kingdoms—fungi,
plants, and animals—realize cell specialization by orches-
trating gene expression. That is, different cells express dif-
ferent genes at different times. To understand develop-
ment, we need to focus on how cells determine which
genes to activate, and when.
Among the fungi, the specialized cells are largely lim-
ited to reproductive cells. In basidiomycetes and as-
comycetes (the so-called higher fungi), certain cells pro-
duce hormones that influence other cells, but the basic
design of all fungi is quite simple. For most of its life, a
fungus has a two-dimensional body, consisting of long fila-
ments of cells that are only imperfectly separated from
each other. Fungal maturation is primarily a process of
growth rather than specialization.
Development is far more complex in plants, where the
adult individuals contain a variety of specialized cells or-
ganized into tissues and organs. A hallmark of plant de-
velopment is flexibility; as a plant develops, the precise
array of tissues it achieves is greatly influenced by its
environment.
In animals, development is complex and rigidly con-
trolled, producing a bewildering array of specialized cell
types through mechanisms that are much less sensitive to
the environment. The subject of intensive study, animal de-
velopment has in the last decades become relatively well
understood.
Here we will focus our attention on four developmental
systems which researchers have studied intensively: (1) an
animal with a very complexly arranged body, a mammal;
(2) a less complex animal with an intricate developmental
cycle, an insect; (3) a very simple animal, a nematode; and
(4) a flowering plant (figure 17.2).
To begin our investigation of development, we will
first examine the overall process of development in three
quite different organisms, so we can sort through differ-
ences in the gross process to uncover basic similarities in
underlying mechanisms. We will start by describing the
overall process in vertebrates, because it is the best un-
derstood among the animals. Then we will examine the
very different developmental process carried out by in-
sects, in which genetics has allowed us to gain detailed
knowledge of many aspects of the process. Finally we will
look at development in a third very different organism, a
flowering plant.
Almost all multicellular organisms undergo
development. The process has been well studied in
animals, especially in mammals, insects, nematodes, and
flowering plants.
17.1 Development is a regulated process.
Mammal
Insect
Nematode
Flowering plant
FIGURE 17.2
Four developmental systems. Researchers studying the cellular
mechanisms of development have focused on these four
organisms.
Vertebrate Development
Vertebrate development is a dynamic process in which cells
divide rapidly and move over each other as they first estab-
lish the basic geometry of the body (figure 17.3). At differ-
ent sites, particular cells then proceed to form the body’s
organs, and then the body grows to a size and shape that
will allow it to survive after birth. The entire process, de-
scribed more fully in chapter 60, is traditionally divided
into phases. As in mitosis, however, the boundaries be-
tween phases are somewhat artificial, and the phases, in
fact, grade into one another.
Cleavage
Vertebrates begin development as a single fertilized egg,
the zygote. Within an hour after fertilization, the zygote
begins to divide rapidly into a larger and larger number of
smaller and smaller cells called blastomeres, until a solid
ball of cells is produced (figure 17.4). This initial period of
cell division, termed cleavage, is not accompanied by any
increase in the overall size of the embryo; rather, the con-
tents of the zygote are simply partitioned into the daughter
cells. The two ends of the zygote are traditionally referred
to as the animal and vegetal poles. In general, the blas-
tomeres of the animal pole will go on to form the external
tissues of the body, while those of the vegetal pole will
form the internal tissues. The initial top-bottom (dorsal-
ventral) orientation of the embryo is determined at fertil-
ization by the location where
the sperm nucleus enters the
egg, a point that corresponds
roughly to the future belly.
After about 12 divisions, the
burst of cleavage divisions
slows, and transcription of
key genes begins within the
embryo cells.
Chapter 17 Cellular Mechanisms of Development 333
FIGURE 17.3
The miracle of development. This nine-week-old human fetus
started out as a single cell: a fertilized egg, or zygote. The
zygote’s daughter cells have been repeatedly dividing and
specializing to produce the distinguishable features of a fetus.
(a) (b)
(c) (d)
FIGURE 17.4
Cleavage divisions producing
a frog embryo. (a) The initial
divisions are, in this case, on the
side of the embryo facing you,
producing (b) a cluster of cells on
this side of the embryo, which
soon expands to become a
(c) compact mass of cells.
(d) This mass eventually
invaginates into the interior of
the embryo, forming a gastrula,
then a neurula.
334 Part V Molecular Genetics
Blastomeres
(a) Cleavage
(b) Blastula formation
(c) Gastrulation
(d) Neurulation
(e) Cell migration
(f) Organogenesis
Mesoderm
Endoderm
Neural
plate
Neural
groove
Notochord
Ectoderm
Neural crest
Neural
tube
Notochord
Midgut
Spinal cord
Spinal cord
Mesoderm
Endoderm
Endoderm
Ectoderm
Ectoderm
Mesoderm
Brain
Stomach
Heart
Liver
Intestine
Muscle somites
Mammalian blastocyst
FIGURE 17.5
The path of vertebrate development. An illustration of the major events in the development of Mus musculus, the house mouse.
(a) Cleavage. (b) Formation of blastula. (c) Gastrulation. (d) Neurulation. (e) Cell migration. ( f ) Organogenesis. (g) Growth.
liver, and most of the other internal organs. The cells that
remain on the exterior are ectoderm, and their derivatives
include the skin on the outside of the body and the ner-
vous system. The cells that break away from the invagi-
nating cells and invade the space between the gut and the
exterior wall are mesoderm; they eventually form the no-
tochord, bones, blood vessels, connective tissues, and
muscles.
Neurulation
Soon after gastrulation is complete, a broad zone of ecto-
derm begins to thicken on the dorsal surface of the embryo,
an event triggered by the presence of the notochord be-
neath it. The thickening is produced by the elongation of
certain ectodermal cells. Those cells then assume a wedge
shape by contracting bundles of actin filaments at one end.
This change in shape causes the neural tissue to roll up into
a tube, which eventually pinches off from the rest of the ec-
toderm and gives rise to the brain and spinal cord. This
tube is called the neural tube, and the process by which it
forms is termed neurulation (figure 17.5d).
Cell Migration
During the next stage of vertebrate development, a variety
of cells migrate to form distant tissues, following specific
paths through the embryo to particular locations (figure
17.5e). These migrating cells include those of the neural
crest, which pinch off from the neural tube and form a
number of structures, including some of the body’s sense
organs; cells that migrate from central blocks of muscle
tissue called somites and form the skeletal muscles of the
body; and the precursors of blood cells and gametes.
When a migrating cell reaches its destination, receptor
proteins on its surface interact with proteins on the sur-
faces of cells in the destination tissue, triggering changes
in the cytoskeleton of the migrating cell that cause it to
cease moving.
Organogenesis and Growth
At the end of this wave of cell migration and colonization,
the basic vertebrate body plan has been established, al-
though the embryo is only a few millimeters long and has
only about 10
5
cells. Over the course of subsequent devel-
opment, tissues will develop into organs (figure 17.5f ), and
the embryo will grow to be a hundred times larger, with a
million times as many cells (figure 17.5g).
Vertebrates develop in a highly orchestrated fashion.
The zygote divides rapidly, forming a hollow ball of
cells that then pushes inward, forming the main axis of
an embryo that goes on to develop tissues, and after a
process of cell migration, organs.
Chapter 17 Cellular Mechanisms of Development 335
(g) Growth
Formation of the Blastula
The outermost blastomeres (figure 17.5a) in the ball of
cells produced during cleavage are joined to one another by
tight junctions, which, as you may recall from chapter 7,
are belts of protein that encircle a cell and weld it firmly to
its neighbors. These tight junctions create a seal that iso-
lates the interior of the cell mass from the surrounding
medium. At about the 16-cell stage, the cells in the interior
of the mass begin to pump Na
+
from their cytoplasm into
the spaces between cells. The resulting osmotic gradient
causes water to be drawn into the center of the cell mass,
enlarging the intercellular spaces. Eventually, the spaces
coalesce to form a single large cavity within the cell mass.
The resulting hollow ball of cells is called a blastula, or
blastocyst in mammals (figure 17.5b).
Gastrulation
Some cells of the blastula then push inward, forming a
gastrula that is invaginated. Cells move by using exten-
sions called lamellipodia to crawl over neighboring cells,
which respond by forming lamellipodia of their own.
Soon a sheet of cells contracts on itself and shoves inward,
starting the invagination. Called gastrulation (figure
17.5c), this process creates the main axis of the vertebrate
body, converting the blastula into a bilaterally symmetri-
cal embryo with a central gut. From this point on, the
embryo has three germ layers whose organization fore-
shadows the future organization of the adult body. The
cells that invaginate and form the tube of the primitive
gut are endoderm; they give rise to the stomach, lungs,
Insect Development
Like all animals, insects develop through
an orchestrated series of cell changes, but
the path of development is quite differ-
ent from that of a vertebrate. Many in-
sects produce two different kinds of bod-
ies during their development, the first a
tubular eating machine called a larva,
and the second a flying machine with
legs and wings. The passage from one
body form to the other is called meta-
morphosis and involves a radical shift in
development. Here we will describe de-
velopment in the fruit fly Drosophila (fig-
ure 17.6), which is the subject of much
genetic research.
Maternal Genes
The development of an insect like
Drosophila begins before fertilization,
with the construction of the egg. Spe-
cialized nurse cells that help the egg to
grow move some of their own mRNA into the end of the
egg nearest them (figure 17.7a). As a result, mRNAs pro-
duced by maternal genes are positioned in particular loca-
tions in the egg, so that after repeated divisions subdivide
the fertilized egg, different daughter cells will contain dif-
ferent maternal products. Thus, the action of maternal
(rather than zygotic) genes determines the initial course
of development.
Syncytial Blastoderm
After fertilization, 12 rounds of nuclear division without
cytokinesis produce about 6000 nuclei, all within a single
cytoplasm. All of the nuclei within this syncytial blasto-
derm (figure 17.7b) can freely communicate with one an-
other, but nuclei located in different sectors of the egg ex-
perience different maternal products. The nuclei then
space themselves evenly along the surface of the blasto-
derm, and membranes grow between them. Folding of the
embryo and primary tissue development soon follow, in a
process fundamentally similar to that seen in vertebrate de-
velopment. The tubular body that results within a day of
fertilization is a larva.
Larval Instars
The larva begins to feed immediately, and as it does so, it
grows. Its chitinous exoskeleton cannot stretch much, how-
ever, and within a day it sheds the exoskeleton. Before the
new exoskeleton has had a chance to harden, the larva ex-
pands in size. A total of three larval stages, or instars, are
produced over a period of four days (figure 17.7c).
Imaginal Discs
During embryonic growth, about a dozen groups of cells
called imaginal discs are set aside in the body of the larva
(figure 17.7d). Imaginal discs play no role in the life of the
larva, but are committed to form key parts of the adult fly’s
body.
Metamorphosis
After the last larval stage, a hard outer shell forms, and
the larva is transformed into a pupa (figure 17.7e).
Within the pupa, the larval cells break down and release
their nutrients, which are used in the growth and devel-
opment of the various imaginal discs (eye discs, wing
discs, leg discs, and so on). The imaginal discs then asso-
ciate with one another, assembling themselves into the
body of the adult fly (figure 17.7f ). The metamorphosis
of a Drosophila larva into a pupa and then into adult fly
takes about four days, after which the pupal shell splits
and the fly emerges.
Drosophila development proceeds through two discrete
phases, the first a larval phase that gathers food, then
an adult phase that is capable of flight and
reproduction.
336 Part V Molecular Genetics
FIGURE 17.6
The fruit fly, Drosophila melanogaster. A dorsal view of Drosophila, one of the most
intensively studied animals in development.
Chapter 17 Cellular Mechanisms of Development 337
Movement of
maternal mRNA
(a) Egg
(b) Syncytial blastoderm
Syncytial blastoderm
(c) Larval instars
(d) Imaginal discs
(e) Metamorphosis
(f) Adult
Nurse
cells
Imaginal
discs
Oocyte
Instars
Larva Pupa
Nuclei line up
along surface
and membranes
grow between
them
Chitinous
exoskeleton
FIGURE 17.7
The path of insect development. An illustration of the major events in the development of Drosophila melanogaster.
(a) Egg. (b) Syncytial blastoderm. (c) Larval instars. (d) Imaginal discs. (e) Metamorphosis. ( f ) Adult.
Plant Development
At the most basic level, the developmental paths of plants
and animals share many key elements. However, the mech-
anisms used to achieve body form are quite different.
While animal cells follow an orchestrated series of move-
ments during development, plant cells are encased within
stiff cellulose walls, and, therefore, cannot move. Each cell
in a plant is fixed into position when it is created. Instead of
using cell migration, plants develop by building their bod-
ies outward, creating new parts from special groups of self-
renewing cells called meristems. As meristem cells contin-
ually divide, they produce cells that can differentiate into
the tissues of the plant.
Another major difference between animals and plants
is that most animals are mobile and can move away from
unfavorable circumstances, while plants are anchored in
position and must simply endure whatever environment
they experience. Plants compensate for this restriction by
relaxing the rules of development to accommodate local
circumstances. Instead of creating a body in which every
part is specified to have a fixed size and location, a plant
assembles its body from a few types of modules, such as
leaves, roots, branch nodes, and flowers. Each module
has a rigidly controlled structure and organization, but
how the modules are utilized is quite flexible. As a plant
develops, it simply adds more modules, with the environ-
ment having a major influence on the type, number, size,
and location of what is added. In this way the plant is
able to adjust the path of its development to local
circumstances.
Early Cell Division
The first division of the fertilized egg in a flowering plant
is off-center, so that one of the daughter cells is small, with
dense cytoplasm (figure 17.8a). That cell, the future em-
bryo, begins to divide repeatedly, forming a ball of cells.
The other daughter cell also divides repeatedly, forming an
elongated structure called a suspensor, which links the
embryo to the nutrient tissue of the seed. The suspensor
also provides a route for nutrients to reach the developing
embryo. Just as the animal embryo acquires its initial axis as
a cell mass formed during cleavage divisions, so the plant
embryo forms its root-shoot axis at this time. Cells near the
suspensor are destined to form a root, while those at the
other end of the axis ultimately become a shoot.
Tissue Formation
Three basic tissues differentiate while the plant embryo is
still a ball of cells (figure 17.8b), analogous to the formation
of the three germ layers in animal embryos, although in
plants, no cell movements are involved. The outermost
cells in a plant embryo become epidermal cells. The bulk
of the embryonic interior consists of ground tissue cells
that eventually function in food and water storage. Lastly,
cells at the core of the embryo are destined to form the fu-
ture vascular tissue.
Seed Formation
Soon after the three basic tissues form, a flowering plant
embryo develops one or two seed leaves called cotyle-
dons. At this point, development is arrested, and the em-
bryo is now either surrounded by nutritive tissue or has
amassed stored food in its cotyledons (figure 17.8c). The
resulting package, known as a seed, is resistant to drought
and other unfavorable conditions; in its dormant state, it is
a vehicle for dispersing the embryo to distant sites and al-
lows a plant embryo to survive in environments that might
kill a mature plant.
Germination
A seed germinates in response to changes in its environ-
ment brought about by water, temperature, or other fac-
tors. The embryo within the seed resumes development
and grows rapidly, its roots extending downward and its
leaf-bearing shoots extending upward (figure 17.8d).
Meristematic Development
Plants development exhibits its great flexibility during the
assembly of the modules that make up a plant body. Apical
meristems at the root and shoot tips generate the large
numbers of cells needed to form leaves, flowers, and all
other components of the mature plant (figure 17.8e). At
the same time, meristems ensheathing the stems and roots
produce the wood and other tissues that allow growth in
circumference. A variety of hormones produced by plant
tissues influence meristem activity and, thus, the develop-
ment of the plant body. Plant hormones (see chapter 41)
are the tools that allow plant development to adjust to the
environment.
Morphogenesis
The form of a plant body is largely determined by con-
trolled changes in cell shape as they expand osmotically
after they form (see figure 17.8e). Plant growth-regulating
hormones and other factors influence the orientation of
bundles of microtubules on the interior of the plasma
membrane. These microtubules seem to guide cellulose de-
position as the cell wall forms around the outside of a new
cell. The orientation of the cellulose fibers, in turn, deter-
mines how the cell will elongate as it increases in volume,
and so determines the cell’s final shape.
In a developing plant, leaves, flowers, and branches are
added to the growing body in ways that are strongly
influenced by the environment.
338 Part V Molecular Genetics
Chapter 17 Cellular Mechanisms of Development 339
(a) Early cell division
(b) Tissue formation
(c) Seed formation
(d) Germination
(e) Meristematic development
and morphogenesis
Embryo
Embryo
Epidermal cells
Ground tissue cells
Vascular tissue cells
Apical meristem
Cotyledons
Suspensor
Apical meristem
Cotyledons
Seed wall
FIGURE 17.8
The path of plant development. An illustration of the developmental stages of Arabidopsis thaliana. (a) Early cell division.
(b) Tissue formation. (c) Seed formation. (d) Germination. (e) Meristematic development and morphogenesis.
Despite the many differences in the three developmental
paths we have just discussed, it is becoming increasingly
clear that most multicellular organisms develop according
to molecular mechanisms that are fundamentally very simi-
lar. This observation suggests that these mechanisms
evolved very early in the history of multicellular life. Here,
we will focus on six mechanisms that seem to be of particu-
lar importance in the development of a wide variety of or-
ganisms. We will consider them in roughly the order in
which they first become important during development.
Cell Movement and Induction
Cell Movement
Cells migrate during many stages in animal development,
sometimes traveling great distances before reaching the site
where they are destined to develop. By the time vertebrate
development is complete, most tissues contain cells that
originated from quite different parts of the early embryo.
One way cells move is by pulling themselves along using
cell adhesion molecules, such as the cadherin proteins you
read about in chapter 7. Cadherins span the plasma mem-
brane, protruding into the cytoplasm and extending out
from the cell surface. The cytoplasmic portion of the mole-
cule is attached to actin or intermediate filaments of the cy-
toskeleton, while the extracellular portion has five 100-
amino acid segments linked end-to-end; three or more of
these segments have Ca
++
binding sites that play a critical
role in the attachment of the cadherin to other cells. Over a
dozen different cadherins have been discovered to date.
Each type of cadherin attaches to others of its own type at
its terminal segments, forming a two-cadherin link between
the cytoskeletons of adjacent cells. As a cell migrates to a
different tissue, the nature of the cadherin it expresses
changes, and if cells expressing two different cadherins are
mixed, they quickly sort themselves out, aggregating into
two separate masses. This is how the different imaginal discs
of a Drosophila larva assemble into an adult. Other calcium-
independent cell adhesion molecules, such as the neural
cell adhesion molecules (N-CAMs) expressed by migrating
nerve cells, reinforce the associations made by cadherins,
but cadherins play the major role in holding aggregating
cells together.
In some tissues, such as connective tissue, much of the
volume of the tissue is taken up by the spaces between cells.
These spaces are not vacant, however. Rather, they are
filled with a network of molecules secreted by surrounding
cells, principally, a matrix of long polysaccharide chains co-
valently linked to proteins (proteoglycans), within which
are embedded strands of fibrous protein (collagen, elastin,
and fibronectin). Migrating cells traverse this matrix by
binding to it with cell surface proteins called integrins,
which was also described in chapter 7. Integrins are at-
tached to actin filaments of the cytoskeleton and protrude
out from the cell surface in pairs, like two hands. The
“hands” grasp a specific component of the matrix such as
collagen or fibronectin, thus linking the cytoskeleton to the
fibers of the matrix. In addition to providing an anchor,
this binding can initiate changes within the cell, alter the
growth of the cytoskeleton, and change the way in which
the cell secretes materials into the matrix.
Thus, cell migration is largely a matter of changing pat-
terns of cell adhesion. As a migrating cell travels, it contin-
ually extends projections that probe the nature of its envi-
ronment. Tugged this way and that by different tentative
attachments, the cell literally feels its way toward its ulti-
mate target site.
340 Part V Molecular Genetics
17.2 Multicellular organisms employ the same basic mechanisms of
development.
Ectoderm
Neural
cavity
Wall of forebrain Optic cup
Optic stalk
Optic nerve
Retina
Lens
Cornea
Lens invagination
FIGURE 17.9
Development of the vertebrate eye
proceeds by induction. The eye develops
as an extension of the forebrain called the
optic stalk that grows out until it contacts
the ectoderm. This contact induces the
formation of a lens from the ectoderm.
Induction
In Drosophila the initial cells created by cleavage divisions
contain different developmental signals (called determi-
nants) from the egg, setting individual cells off on different
developmental paths. This pattern of development is called
mosaic development. In mammals, by contrast, all of the
blastomeres receive equivalent sets of determinants; body
form is determined by cell-cell interactions, a pattern called
regulative development.
We can demonstrate the importance of cell-cell inter-
actions in development by separating the cells of an early
blastula and allowing them to develop independently.
Under these conditions, animal pole blastomeres develop
features of ectoderm and vegetal pole blastomeres de-
velop features of endoderm, but none of the cells ever de-
velop features characteristic of mesoderm. However, if
animal pole and vegetal pole cells are placed next to each
other, some of the animal pole cells will develop as meso-
derm. The interaction between the two cell types triggers
a switch in the developmental path of the cells! When a
cell switches from one path to another as a result of in-
teraction with an adjacent cell, induction has taken place
(figure 17.9).
How do cells induce developmental changes in neigh-
boring cells? Apparently, the inducing cells secrete proteins
that act as intercellular signals. Signal molecules, which we
discussed in detail in chapter 7, are capable of producing
abrupt changes in the patterns of gene transcription.
In some cases, particular groups of cells called organiz-
ers produce diffusible signal molecules that convey posi-
tional information to other cells. Organizers can have a
profound influence on the development of surrounding tis-
sues (see chapter 60). Working as signal beacons, they in-
form surrounding cells of their distance from the organizer.
The closer a particular cell is to an organizer, the higher
the concentration of the signal molecule, or morphogen, it
experiences (figure 17.10). Although only a few mor-
phogens have been isolated, they are thought to be part of a
widespread mechanism for determining relative position
during development.
A single morphogen can have different effects, depend-
ing upon how far away from the organizer the affected
cell is located. Thus, low levels of the morphogen activin
will cause cells of the animal pole of an early Xenopus em-
bryo to develop into epidermis, while slightly higher lev-
els will induce the cells to develop into muscles, and levels
a little higher than that will induce them to form noto-
chord (figure 17.11).
Cells migrate by extending probes to neighboring cells
which they use to pull themselves along. Interactions
between cells strongly influence the developmental
paths they take. Signal molecules from an inducing cell
alter patterns of transcription in cells which come in
contact with it.
Chapter 17 Cellular Mechanisms of Development 341
Organizer cells
secreting morphogen
Decreasing
morphogen
concentration
gradient
Distance from secretion site
Concentration of morphogen
Organ A Organ B Organ C
Embryo
FIGURE 17.10
An organizer creates a morphogen gradient. As a morphogen
diffuses from the organizer site, it becomes less concentrated.
Different concentrations of the morphogen stimulate the
development of different organs.
Develops into
notochord
Animal pole
Vegetal pole
Develops into
muscle
Secretion
of morphogen
Develops into
epidermis
FIGURE 17.11
Fate of cells in an early Xenopus embryo. The fates of the
individual cells are determined by the concentration of
morphogen washing over them.
Determination
The mammalian egg is symmetrical in its contents as well
as its shape, so that all of the cells of an early blastoderm
are equivalent up to the eight-cell stage. The cells are said
to be totipotent, meaning that they are potentially capable
of expressing all of the genes of their genome. If they are
separated from one another, any one of them can produce a
completely normal individual. Indeed, just this sort of pro-
cedure has been used to produce sets of four or eight iden-
tical offspring in the commercial breeding of particularly
valuable lines of cattle. The reverse process works, too; if
cells from two different eight-cell-stage embryos are com-
bined, a single normal individual results. Such an individual
is called a chimera, because it contains cells from different
genetic lines (figure 17.12).
Mammalian cells start to become different after the
eight-cell stage as a result of cell-cell interactions like those
we just discussed. At this point, the pathway that will influ-
ence the future developmental fate of the cells is deter-
mined. The commitment of a particular cell to a specialized
developmental path is called determination. A cell in the
prospective brain region of an amphibian embryo at the
early gastrula stage has not yet been determined; if trans-
planted elsewhere in the embryo, it will develop like its
new neighbors (see chapter 60). By the late gastrula stage,
however, determination has taken place, and the cell will
develop as neural tissue no matter where it is transplanted.
Determination must be carefully distinguished from differ-
entiation, which is the cell specialization that occurs at the
end of the developmental path. Cells may become deter-
mined to give rise to particular tissues long before they ac-
tually differentiate into those tissues. The cells of a
Drosophila eye imaginal disc, for example, are fully deter-
mined to produce an eye, but they remain totally undiffer-
entiated during most of the course of larval development.
The Mechanism of Determination
What is the molecular mechanism of determination? The
gene regulatory proteins discussed in detail in chapter 16
are the tools used by cells to initiate developmental
changes. When genes encoding these proteins are acti-
vated, one of their effects is to reinforce their own activa-
tion. This makes the developmental switch deterministic,
initiating a chain of events that leads down a particular de-
velopmental pathway. Cells in which a set of regulatory
genes have been activated may not actually undergo differ-
entiation until some time later, when other factors interact
with the regulatory protein and cause it to activate still
other genes. Nevertheless, once the initial “switch” is
thrown, the cell is fully committed to its future develop-
mental path.
Often, before a cell becomes fully committed to a partic-
ular developmental path, it first becomes partially commit-
ted, acquiring positional labels that reflect its location in
the embryo. These labels can have a great influence on how
the pattern of the body subsequently develops. In a chicken
embryo, if tissue at the base of
the leg bud (which would nor-
mally give rise to the thigh) is
transplanted to the tip of the
identical-looking wing bud
(which would normally give rise
to the wing tip), that tissue will
develop into a toe rather than a
thigh! The tissue has already
been determined as leg but is not
yet committed to being a particu-
lar part of the leg. Therefore, it
can be influenced by the posi-
tional signaling at the tip of the
wing bud to form a tip (in this
case a tip of leg).
342 Part V Molecular Genetics
Homozygous white mouse
embryo is removed from mother
at eight-cell stage.
Homozygous black mouse
embryo is removed from mother
at eight-cell stage.
Protease enzymes are used
to remove zona pellucida
from each embryo.
Incubated together at
body temperature, the
two embryos fuse.
The 16-cell embryo
continues development in
vitro as a single embryo
to blastocyst stage.
The fusion blastocyst
is transfered to a
pseudopregnant foster
mother.
The chimeric baby mouse
that develops in the foster
mother has four parents
(none of them is the foster
mother).
FIGURE 17.12
Constructing a chimeric mouse.
Cells from two eight-cell individuals
fuse to form a single individual.
Is Determination Irreversible?
Until very recently, biologists thought
determination was irreversible. Exper-
iments carried out in the 1950s and
1960s by John Gurdon and others
made what seemed a convincing case:
using very fine pipettes (hollow glass
tubes) to suck the nucleus out of a frog
or toad egg, these researchers replaced
the egg nucleus with a nucleus sucked
out of a body cell taken from another
individual (see figure 14.3). If the
transplanted nucleus was obtained
from an advanced embryo, the egg
went on to develop into a tadpole, but
died before becoming an adult.
Nuclear transplant experiments
were attempted without success by
many investigators, until finally, in
1984, Steen Willadsen, a Danish em-
bryologist working in Texas, suc-
ceeded in cloning a sheep using the
nucleus from a cell of an early embryo.
The key to his success was in picking a
cell very early in development. This
exciting result was soon replicated by
others in a host of other organisms,
including pigs and monkeys.
Only early embryo cells seemed to
work, however. Researchers became
convinced, after many attempts to
transfer older nuclei, that animal cells
become irreversibly committed after
the first few cell divisions of the devel-
oping embryo.
We now know this conclusion to
have been unwarranted. The key ad-
vance unraveling this puzzle was made
in Scotland by geneticists Keith
Campbell and Ian Wilmut, who rea-
soned that perhaps the egg and the donated nucleus needed
to be at the same stage in the cell cycle. They removed
mammary cells from the udder of a six-year-old sheep. The
origin of these cells gave the clone its name, “Dolly,” after
the country singer Dolly Parton. The cells were grown in
tissue culture; then, in preparation for cloning, the re-
searchers substantially reduced for five days the concentra-
tion of serum nutrients on which the sheep mammary cells
were subsisting. Starving the cells caused them to pause at
the beginning of the cell cycle. In parallel preparation, eggs
obtained from a ewe were enucleated (figure 17.13).
Mammary cells and egg cells were then surgically com-
bined in January of 1996, inserting the mammary cells in-
side the covering around the egg cell. The researchers then
applied a brief electrical shock. This caused the plasma
membranes surrounding the two cells to become leaky, so
that the nucleus of the mammary cell passed into the egg
cell—a neat trick. The shock also kick-started the cell
cycle, causing the cell to begin to divide.
After six days, in 30 of 277 tries, the dividing embryo
reached the hollow-ball “blastula” stage, and 29 of these
were transplanted into surrogate mother sheep. A little
over five months later, on July 5, 1996, one sheep gave
birth to a lamb, Dolly, the first clone generated from a
fully differentiated animal cell. Dolly established beyond
all dispute that determination is reversible, that with the
right techniques the fate of a fully differentiated cell can
be altered.
The commitment of particular cells to certain
developmental fates is fully reversible.
Chapter 17 Cellular Mechanisms of Development 343
Mammary cell is extracted and
grown in nutrient-deficient media
that arrests cell cycle
Nucleus containing
source DNA
Mammary cell
is inserted inside
covering of
egg cell
Egg cell is extracted and
nucleus removed from egg
cell with a micropipette
Electric shock opens
cell membranes and
triggers cell division
Embryo begins to
develop in vitro
Blastula stage
embryo
Embryo is
implanted into
surrogate mother
After a five-month pregnancy,
a lamb genetically identical
to the sheep the mammary
cell was extracted from
is born
FIGURE 17.13
Proof that determination is reversible. This experiment by Campbell and Wilmut was
the first successful cloning of an adult animal.
Pattern Formation
All animals seem to use positional information to deter-
mine the basic pattern of body compartments and, thus, the
overall architecture of the adult body. How is positional in-
formation encoded in labels and read by cells? To answer
this question, let us consider how positional labels are used
in pattern formation in Drosophila. The Nobel Prize in
Physiology or Medicine was awarded in 1995 for the un-
raveling of this puzzle.
As we noted previously, a Drosophila egg acquires an ini-
tial asymmetry long before fertilization as a result of mater-
nal mRNA molecules that are deposited in one end of the
egg by nurse cells. Part of this maternal mRNA, from a
gene called bicoid, remains near its point of entry, marking
what will become the embryo’s front end. Fertilization
causes this mRNA to be translated into bicoid protein,
which diffuses throughout the syncytial blastoderm, form-
ing a morphogen gradient. Mothers unable to make bicoid
protein produce embryos without a head or thorax (in ef-
fect, these embryos are two-tailed, or bicaudal—hence the
name “bicoid”). Bicoid protein establishes the anterior
(front) end of the embryo. If bicoid protein is injected into
the anterior end of mutant embryos unable to make it, the
344 Part V Molecular Genetics
H
T
A
Establishing polarity of the
embryo: Fertilization of the
egg triggers the production of
bicoid protein from maternal
RNA in the egg. The bicoid
protein diffuses through the
egg, forming a gradient. This
gradient determines the
polarity of the embryo, with the
head and thorax developing in
the zone of high
concentration (yellow through
red).
Setting the stage for
segmentation: About 2
1
/2 hours
after fertilization, bicoid protein
turns on a series of brief signals
from so-called gap genes. The
gap proteins act to divide the
embryo into large blocks. In this
photo, fluorescent dyes in
antibodies that bind to the gap
proteins Krüppel (red) and
hunchback (green) make the
blocks visible; the region of
overlap is yellow.
Laying down the
fundamental regions: About
1
/2 hour later, the gap genes
switch on a so-called “pair-
rule” gene called hairy. Hairy
produces a series of
boundaries within each block,
dividing the embryo into
seven fundamental regions.
Forming the segments: The
final stage of segmentation
occurs when a “segment-
polarity” gene called engrailed
divides each of the seven
regions into halves, producing
14 narrow compartments.
Each compartment corresponds
to one segment of the future
body. There are three head
segments (H, top left), three
thoracic segments (T, lower
left), and eight abdominal
segments (A, from bottom left
to upper right).
FIGURE 17.14
Body organization in an early Drosophila embryo. In these images by 1995 Nobel laureate, Christiane Nüsslein-Volhard, and Sean
Carroll, we watch a Drosophila egg pass through the early stages of development, in which the basic segmentation pattern of the embryo is
established.
embryos will develop normally. If it is injected into the op-
posite (posterior) end of normal embryos, a head and tho-
rax will develop at that end.
Bicoid protein exerts this profound effect on the organi-
zation of the embryo by activating genes that encode the
first mRNAs to be transcribed after fertilization. Within
the first two hours, before cellularization of the syncytial
blastoderm, a group of six genes called the gap genes be-
gins to be transcribed. These genes map out the coarsest
subdivision of the embryo (figure 17.14). One of them is a
gene called hunchback (because an embryo without hunch-
back lacks a thorax and so, takes on a hunched shape). Al-
though hunchback mRNA is distributed throughout the em-
bryo, its translation is controlled by the protein product of
another maternal mRNA called nanos (named after the
Greek word for “dwarf,” as mutants without nanos genes
lack abdominal segments and hence, are small). The nanos
protein binds to hunchback mRNA, preventing it from
being translated. The only place in the embryo where there
is too little nanos protein to block translation of hunchback
mRNA is the far anterior end. Consequently, hunchback
protein is made primarily at the anterior end of the em-
bryo. As it diffuses back toward the posterior end, it sets up
a second morphogen gradient responsible for establishing
the thoracic and abdominal segments.
Other gap genes act in more posterior regions of the
embryo. They, in turn, activate 11 or more pair-rule
genes. (When mutated, each of these genes alters every
other body segment.) One of the pair-rule genes, named
hairy, produces seven bands of protein, which look like
stripes when visualized with fluorescent markers. These
bands establish boundaries that divide the embryo into
seven zones. Finally, a group of 16 or more segment po-
larity genes subdivide these zones. The engrailed gene, for
example, divides each of the seven zones established by
hairy into anterior and posterior compartments. The 14
compartments that result correspond to the three head seg-
ments, three thoracic segments, and eight abdominal seg-
ments of the embryo.
Thus, within three hours after fertilization, a highly or-
chestrated cascade of segmentation gene activity produces
the fly embryo’s basic body plan. The activation of these
and other developmentally important genes (figure 17.15)
depends upon the free diffusion of morphogens that is pos-
sible within a syncytial blastoderm. In mammalian embryos
with cell partitions, other mechanisms must operate.
In Drosophila diffusion of chemical inducers produces
the embryo’s basic body plan, a cascade of genes
dividing it into 14 compartments.
Chapter 17 Cellular Mechanisms of Development 345
(a) (d)
(e)(b)
(c) (f)
FIGURE 17.15
A gene controlling organ
formation in Drosophila.
Called tinman, this gene is
responsible for the formation
of gut musculature and the
heart. The dye shows
expression of the tinman in
five-hour (a) and seventeen-
hour (b) Drosophila embryos.
The gut musculature then
appears along the edges of
normal embryos (c) but is not
present in embryos in which
the gene has been mutated (d).
The heart tissue develops
along the center of normal
embryos (e) but is missing in
tinman mutant embryos (f ).
Expression of Homeotic Genes
After pattern formation has successfully established the
number of body segments in Drosophila, a series of
homeotic genes act as master switches to determine the
forms these segments will assume. Homeotic genes code
for proteins that function as transcription factors. Each
homeotic gene activates a particular module of the genetic
program, initiating the production of specific body parts
within each of the 14 compartments.
Homeotic Mutations
Mutations in homeotic genes lead to the appearance of per-
fectly normal body parts in unusual places. Mutations in
bithorax (figure 17.16), for example, cause a fly to grow an
extra pair of wings, as if it had a double thoracic segment,
and mutations in Antennapedia cause legs to grow out of the
head in place of antennae! In the early 1950s, geneticist
Edward Lewis discovered that several homeotic genes, in-
cluding bithorax, map together on the third chromosome of
Drosophila, in a tight cluster called the bithorax complex.
346 Part V Molecular Genetics
FIGURE 17.16
Mutations in homeotic genes. Three separate mutations in the bithorax gene caused this fruit fly to develop an extra thoracic segment,
with accompanying wings. Compare this photograph with that of the normal fruit fly in figure 17.6.
Mutations in these genes all affect body parts of the tho-
racic and abdominal segments, and Lewis concluded that
the genes of the bithorax complex control the development
of body parts in the rear half of the thorax and all of the ab-
domen. Most interestingly, the order of the genes in the
bithorax complex mirrors the order of the body parts they
control, as if the genes are activated serially! Genes at the
beginning of the cluster switch on development of the tho-
rax, those in the middle control the anterior part of the ab-
domen, and those at the end affect the tip of the abdomen.
A second cluster of homeotic genes, the Antennapedia
complex, was discovered in 1980 by Thomas Kaufmann.
The Antennapedia complex governs the anterior end of the
fly, and the order of genes in it also corresponds to the
order of segments they control (figure 17.17).
The Homeobox
Drosophila homeotic genes typically contain the home-
obox, a sequence of 180 nucleotides that codes for a 60-
amino acid DNA-binding peptide domain called the home-
odomain (figure 17.18). As we saw in chapter 16, proteins
that contain the homeodomain function as transcription
factors, ensuring that developmentally related genes are
transcribed at the appropriate time. Segmentation genes
such as bicoid and engrailed also contain the homeobox se-
quence. Clearly, the homeobox distinguishes those portions
of the genome devoted to pattern formation.
Chapter 17 Cellular Mechanisms of Development 347
FIGURE 17.17
Drosophila homeotic genes. Called the
homeotic gene complex, or HOM complex, the
genes are grouped into two clusters, the
Antennapedia complex (anterior) and the
bithorax complex (posterior).
Dfd
abd-Babd-A
pb
lab
Scr
Antp
Ubx
Drosophila HOM genes
Drosophila embryo
ThoraxHead Abdomen
Variable region
Hinge region
Homeodomain
COOH
H
2
N
Helices
1
2
4
3
FIGURE 17.18
Homeodomain protein. This protein plays an important
regulatory role when it binds to DNA and regulates expression of
specific genes. The variable region of the protein determines the
specific activity of the protein. Also included in this protein is a
small hinge region and the homeodomain, a 60-amino-acid
sequence common to all proteins of this type. The homeodomain
region of the protein is coded for by the homeobox region of
genes and is composed of four α helices. One of the helices
recognizes and binds to a specific DNA sequence in target genes.
Evolution of Homeobox Genes
Since their initial discovery in Drosophila,
homeotic genes have also been found in
mice and humans, which are separated
from insects by over 600 million years of
evolution. Their presence in mammals
and insects indicates that homeotic genes
governing the positioning of body parts
must have arisen very early in the evolu-
tionary history of animals. Similar genes
also appear to operate in flowering plants.
Gene probes made using the homeobox
sequence of Drosophila have been used to
identify very similar sequences in a wide
variety of other organisms, including
frogs, mice, humans, cows, chickens, bee-
tles, and even earthworms. Mice and hu-
mans have four clusters of homeobox-
containing genes, called Hox genes in
mice. Just as in flies, the homeotic genes
of mammals appear to be lined up in the
same order as the segments they control
(figure 17.19). Thus, the ordered nature
of homeotic gene clusters is highly con-
served in evolution (figure 17.20). There
is a total of 38 Hox genes in the four
homeotic clusters of a mouse, and we are
only beginning to understand how they
interact.
Homeotic genes encode transcription
factors that activate blocks of genes
specifying particular body parts.
348 Part V Molecular Genetics
Fruit fly
Fruit fly embryo
Mouse
embryo
Mouse
HOM fly
chromosome
Mouse
chromosomes
Hox 1
Hox 2
Hox 3
Hox 4
pblab
Dfd Scr Antp
abd-Babd-A
Ubx
FIGURE 17.19
A comparison of homeotic gene clusters in the fruit fly Drosophila melanogaster
and the mouse Mus musculus. Similar genes, the Drosophila HOM genes and the
mouse Hox genes, control the development of front and back parts of the body. These
genes are located on a single chromosome in the fly, and on four separate chromosomes
in mammals. The genes are color-coded to match the parts of the body in which they
are expressed.
FIGURE 17.20
The remarkably conserved homeobox
series. By inserting a mouse homeobox-
containing gene into a fruit fly, a mutant
fly (right) can be manufactured with a leg
(arrow) growing from where its antenna
would be in a normal fly (left).
Programmed Cell Death
Not every cell that is produced during development is des-
tined to survive. For example, the cells between your fin-
gers and toes die; if they did not, you would have paddles
rather than digits. Vertebrate embryos produce a very large
number of neurons, ensuring that there are enough neu-
rons to make all of the necessary synaptic connections, but
over half of these neurons never make connections and die
in an orderly way as the nervous system develops. Unlike
accidental cell deaths due to injury, these cell deaths are
planned for and indeed required for proper development.
Cells that die due to injury typically swell and burst, releas-
ing their contents into the extracellular fluid. This form of
cell death is called necrosis. In contrast, cells programmed
to die shrivel and shrink in a process called apoptosis
(from the Greek word meaning shedding of leaves in au-
tumn), and their remains are taken up by surrounding cells.
Gene Control of Apoptosis
This sort of developmentally regulated cell suicide occurs
when a “death program” is activated. All animal cells ap-
pear to possess such programs. In the nematode worm, for
example, the same 131 cells always die during development
in a predictable and reproducible pattern of apoptosis.
Three genes govern this process. Two (ced-3 and ced-4)
constitute the death program itself; if either is mutant,
those 131 cells do not die, and go on instead to form ner-
vous and other tissue. The third gene (ced-9) represses the
death program encoded by the other two (figure 17.21a).
The same sorts of apoptosis programs occur in human
cells: the bax gene encodes the cell death program, and an-
other, an oncogene called bcl-2, represses it (figure 17.21b).
The mechanism of apoptosis appears to have been highly
conserved during the course of animal evolution. The
protein made by bcl-2 is 25% identical in amino acid se-
quence to that made by ced-9. If a copy of the human bcl-2
gene is transferred into a nematode with a defective ced-9
gene, bcl-2 suppresses the cell death program of ced-3 and
ced-4!
How does bax kill a cell? The bax protein seems to in-
duce apoptosis by binding to the permeability pore of the
cell’s mitochondria, increasing its permeability and in
doing so triggering cell death. How does bcl-2 prevent cell
death? One suggestion is that it prevents damage from free
radicals, highly reactive fragments of atoms that can dam-
age cells severely. Proteins or other molecules that destroy
free radicals are called antioxidants. Antioxidants are al-
most as effective as bcl-2 in blocking apoptosis.
Animal development involves programmed cell death
(apoptosis), in which particular genes, when activated,
kill their cells.
Chapter 17 Cellular Mechanisms of Development 349
ced-3
protein
ced-4
protein
ced-3
protein
ced-4
protein
Nematode Human
+
+
ced-3
ced-4 ced-9
ced-3
ced-4 ced-9
Death
program
No death
program
Death
program
No death
program
bax
bax protein
bax protein
bcl-2
bax
bcl-2
FIGURE 17.21
Programmed cell death. Apoptosis, or programmed cell death, is necessary for normal development of all animals. (a) In the
developing nematode, for example, two genes, ced-3 and ced-4, code for proteins that cause the programmed cell death of 131 specific
cells. In the other cells of the developing nematode, the product of a third gene, ced-9, represses the death program encoded by ced-3
and ced-4. (b) In developing humans, the product of a gene called bax causes a cell death program in some cells and is blocked by the
bcl-2 gene in other cells.
(a) (b)
The Mouse
Some of the most elegant investiga-
tions of the cellular mechanisms of
development are being done with
mammals, particularly the mouse
Mus musculus. Mice have a battery of
homeotic genes, the Hox genes (fig-
ure 17.22), which seem to be closely
related to the homeotic genes of
Drosophila. Very interestingly, not
only do the same genes occur, but
they also seem to operate in the
same order! Clearly, the homeotic
gene system has been highly con-
served during the course of animal
evolution.
What lends great power to this
developmental model system is the
ability to create chimeric mice con-
taining cells from two different ge-
netic lines. Mammalian embryos are
unusual among vertebrates in that
they arise from symmetrical eggs;
there are no chemical gradients, and
during the initial cleavage divisions,
all of the daughter cells are identical.
Up to the eight-cell stage, any one
of the cells, if isolated, will form a
normal adult. Moreover, two differ-
ent eight-cell-stage embryos can be
fused to form a single embryo that
will go on to form a normal adult.
The resulting adult is a chimera,
containing cells from both embryos.
In a very real sense, these chimeric
mice each have four parents!
The Hox genes control body
part development in mice.
350 Part V Molecular Genetics
17.3 Four model developmental systems have been extensively researched.
Mouse chromosomes
Hox 4
Hox 3
Hox 2
Hox 1
FIGURE 17.22
Studying development in the mouse.
Chapter 17 Cellular Mechanisms of Development 351
Mouse embryo
Adult mouse
Drosophila egg
bicoid
Krüppel knirps
hunchback
even-skipped
fushi-tarazu
engrailed
The Fruit Fly
The tiny fruit fly Drosophila melanogaster has been a favorite
of geneticists for over 90 years and is now playing a key
role in our growing understanding of the cellular mecha-
nisms of development. Over the last 10 years, researchers
have pieced together a fairly complete picture of how genes
expressed early in fruit fly development determine the pat-
tern of the adult body (figure 17.23). The major parts of
the adult body are determined as patches of tissue called
imaginal discs that float within the body of the larva; dur-
ing the pupal stage, these discs grow, develop, and associate
to form the adult body.
The adult Drosophila body is divided into 17 segments,
some bearing jointed appendages such as wings or legs.
These segments are established during very early develop-
ment, before the many nuclei of the blastoderm are fully
separated from one another. Chemical gradients, estab-
lished within the egg by material from the mother, create a
polarity that directs embryonic development. Reacting to
this gradient, a series of segmentation genes progressively
subdivide the embryo, first into four broad stripes, and
then into 7, 14, and finally 17 segments.
Within each segment, the development of key body
parts is under the control of homeotic genes that determine
where the body part will form. As we have seen, there are
two clusters of homeotic genes, one called Antennapedia
that governs the front (anterior) end of the body, and an-
other called bithorax that governs the rear (posterior) end.
The organization of genes within each cluster corresponds
nicely with the order of the segments they affect. A very
similar set of homeotic genes governs body architecture in
mice and humans.
A series of segmentation genes divides a Drosophila
embryo into parts; Antennapedia genes control anterior
development, and bithorax genes control the
development of the posterior.
FIGURE 17.23
Studying development in the fruit fly.
Drosophila embryo
Adult fly
Lip
Lip
Larva with imaginal discs
Mouthparts
Mouthparts
Prothorax Antenna Eye Leg (3) Wing Rudimentary
wing
Genital
Antp
ftz
Tuba 84B
Scr
Dfd
tRNA:lys5:84AB
ama
bcd
lab
Zen
Zen2
Bithorax complex
(Posterior)
Antennapedia complex
(Anterior)
3R
chromosome
abd-Babd-AUbx
AntpScrDfdpblab
354 Part V Molecular Genetics
Cuticle
Gonad
Nervous system Pharynx
Cuticle-making cells
The Nematode
One of the most powerful models of animal development is
the tiny nematode Caenorhabditis elegans. Only about 1 mm
long, it consists of 959 somatic cells and has about the same
amount of DNA as Drosophila. The entire genome has been
mapped as a series of overlapping fragments, and a serious
effort is underway to determine the complete DNA se-
quence of the genome.
Because C. elegans is transparent, individual cells can be
followed as they divide. By observing them, researchers
have learned how each of the cells that make up the adult
worm is derived from the fertilized egg. As shown on this
lineage map (figure 17.24), the egg divides into two, and
then its daughter cells continue to divide. Each horizontal
line on the map represents one round of cell division. The
length of each vertical line represents the time between cell
divisions, and the end of each vertical line represents one
fully differentiated cell. In figure 17.24, the major organs of
the worm are color-coded to match the colors of the corre-
sponding groups of cells on the lineage map.
Some of these differentiated cells, such as some of the
cells that generate the worm’s external cuticle, are “born”
after only 8 rounds of cell division; other cuticle cells require
as many as 14 rounds. The cells that make up the worm’s
pharynx, or feeding organ, are born after 9 to 11 rounds of
division, while cells in the gonads require up to 17 divisions.
Exactly 302 nerve cells are destined for the worm’s ner-
vous system. Exactly 131 cells are programmed to die,
mostly within minutes of their birth. The fate of each cell is
the same in every C. elegans individual, except for the cells
that will become eggs and sperm.
The nematode develops 959 somatic cells from a single
fertilized egg in a carefully orchestrated series of cell
divisions which have been carefully mapped by
researchers.
FIGURE 17.24
Studying development in the nematode.
Chapter 17 Cellular Mechanisms of Development 355
Vulva
Intestine
Sperm
Nervous system
Pharynx
Vulva
Egg
Intestine
Gonad
Egg and
sperm line
The Flowering Plant
Scientists are only beginning to unravel the molecular biol-
ogy of plant development, largely through intensive recent
study of a small weedy relative of the mustard plant, the
wall cress Arabidopsis thaliana. Easy to grow and cross, and
with a short generation time, Arabidopsis makes an ideal
model for investigating plant development. It is able to
self-fertilize, like Mendel’s pea plants, making genetic
analysis convenient. Arabidopsis can be grown indoors in
test tubes, a single plant producing thousands of offspring
after only two months. Its genome is approximately the
same size as those of the nematode Caenorhabditis elegans
and the fruit fly Drosophila melanogaster. An ordered library
of Arabidopsis gene clones was made available to researchers
in 1997, and the full genome sequence was completed in
1999.
Pattern Formation
Much of the current work investigating Arabidopsis devel-
opment has centered on obtaining and studying muta-
tions that alter the plant’s development. Many different
sorts of mutations have been identified. Some of the most
interesting of them alter the basic architecture of the em-
bryo, the pattern of tissues laid down as the embryo first
forms. Mutations in over 50 different genes that alter
pattern formation in Arabidopsis embryos are now known,
affecting every stage of development. While work in this
area is still very preliminary, it appears that the mecha-
nisms that establish patterns in the early Arabidopsis em-
bryo are broadly similar to those known to function in
animal development.
Organ Formation
Importantly, the subsequent development of organs in
Arabidopsis also seems to parallel organ development in
animals, and a similar set of regulatory genes control de-
velopment in Arabidopsis, Drosophila, and mice. Arabidopsis
flowers, for example, are modified leaves formed as four
whorls in a specific order, and homeotic mutations have
been identified that convert one part of the pattern to
another, just as they do in the body segments of a fly
(figure 17.25).
Scientists are only beginning to understand the
molecular biology of plant development. In broad
outline, it appears quite similar to the development in
animals. The genes that determine pattern formation
and organ development, for example, operate in the
same way in plants and animals.
356 Part V Molecular Genetics
Mutation: class B genes
not functioning
Floral meristem
Homeotic mutant
flower
Whorl 1
sepal (A)
Whorl 2
petal (A and B)
Class A genes
expressed in
meristem
Class B genes
expressed in
meristem
Class C genes
expressed in
meristem
Whorl 3
stamen (B and C)
Whorl 4
carpel (C)
FIGURE 17.25
Studying development in a flowering plant.
Chapter 17 Cellular Mechanisms of Development 357
Normal flower
Shoot apical
meristem
Stamen
Carpel
Petal
Sepal
Root apical
meristem
Cotyledon (seed leaf)
Theories of Aging
All humans die. The oldest documented person, Jeanne
Louise Calment of Arles, France, reached the age of 122
years before her death in 1997. The “safest” age is around
puberty. As you can see in figure 17.26, 10- to 15-year-olds
have the lowest risk of dying. The death rate begins to in-
crease rapidly after puberty; the rate of mortality then be-
gins to increase as an exponential function of increasing
age. Plotted on a log scale as in figure 17.26 (in a so-called
Gompertz plot), the mortality rate increases as a straight
line from about 15 to 90 years, doubling about every eight
years (the “Gompertz number”). By the time we reach 100,
age has taken such a toll that the risk of dying reaches 50%
per year.
A wide variety of theories have been advanced to explain
why humans and other animals age. No one theory has
gained general acceptance, but the following four are being
intensively investigated:
Accumulated Mutation Hypothesis
The oldest general theory of aging is that cells accumulate
mutations as they age, leading eventually to lethal damage.
Careful studies have shown that somatic mutations do in-
deed accumulate during aging. As cells age, for example,
they tend to accumulate the modified base 8-hydroxygua-
nine, in which an —OH group is added to the base gua-
nine. There is little direct evidence, however, that these
mutations cause aging. No acceleration in aging occurred
among survivors of Hiroshima and Nagasaki despite their
enormous added mutation load, arguing against any gen-
eral relationship between mutation and aging.
Telomere Depletion Hypothesis
In a seminal experiment carried out in 1961, Leonard
Hayflick demonstrated that fibroblast cells growing in tis-
sue culture will divide only a certain number of times (fig-
ure 17.27). After about 50 population doublings, cell divi-
sion stops, the cell cycle blocked just before DNA
replication. If a cell sample is taken after 20 doublings and
frozen, when thawed it resumes growth for 30 more dou-
blings, then stops.
An explanation of the “Hayflick limit” was suggested in
1986 when Howard Cooke first glimpsed an extra length
of DNA at the ends of chromosomes. These telomeric
regions, repeats of the sequence TTAGGG, were found
to be substantially shorter in older somatic tissue, and
Cooke speculated that a 100 base-pair portion of the
telomere cap was lost by a chromosome during each cycle
of DNA replication. Eventually, after some 50 replication
cycles, the protective telomeric cap would be used up, and
the cell line would then enter senescence, no longer able
to proliferate. Cancer cells appear to avoid telomeric
shortening.
Research reported in 1998 has confirmed Cooke’s hy-
pothesis, providing direct evidence for a causal relation be-
tween telomeric shortening and cell senescence. Using ge-
netic engineering, researchers transferred into human
primary cell cultures a gene that leads to expression of
telomerase, an enzyme that builds TTAGGG telomeric
caps. The result was unequivocal. New telomeric caps were
added to the chromosomes of the cells, and the cells with
the artificially elongated telomeres did not senesce at the
Hayflick limit, continuing to divide in a healthy and vigor-
ous manner for more than 20 additional generations.
Wear-and-Tear Hypothesis
Numerous theories of aging focus in one way or another on
the general idea that cells wear out over time, accumulating
damage until they are no longer able to function. Loosely
dubbed the “wear-and-tear” hypothesis, this idea implies
that there is no inherent designed-in limit to aging, just a
statistical one—over time, disruption, wear, and damage
eventually erode a cell’s ability to function properly.
358 Part V Molecular Genetics
17.4 Aging can be considered a developmental process.
Age (years)
Deaths per 1000 men per year
0.5
1.0
2
5
10
20
50
100
200
500
1000
0.3
0 1020304050607080
India, 1900
Sweden, 1949
United States, 1900
United States, 1940
United States, 1950
Mexico, 1940
FIGURE 17.26
Gompertz curves. While human populations may differ 25-fold
in their mortality rates before puberty, the slopes of their
Gompertz curves are about the same in later years.
There is considerable evidence that aging cells do accu-
mulate damage. Some of the most interesting evidence
concerns free radicals, fragments of molecules or atoms
that contain an unpaired electron. Free radicals are very re-
active chemically and can be quite destructive in a cell. Free
radicals are produced as natural by-products of oxidative
metabolism, but most are mopped up by special enzymes
that function to sweep the cell interior free of their de-
structive effects.
One of the most damaging free radical reactions that oc-
curs in cells causes glucose to become linked to proteins, a
nonenzymatic process called glycation. Two of the most
commonly glycated proteins are collagen and elastin, key
components of the connective tissues in our joints. Gly-
cated collagen and elastin are not replaced, and individual
molecules may be as old as the individual.
Glycation of collagen, elastin, and a diverse collection of
other proteins within the cell produces a complex mixture
of glucose-linked proteins called advanced glycosylation
end products (AGEs). AGEs can cross-link to one another,
reducing the flexibility of connective tissues in the joints
and producing many of the other characteristic symptoms
of aging.
Gene Clock Hypothesis
There is very little doubt that at least some aspects of aging
are under the direct control of genes. Just as genes regulate
the body’s development, so they appear to regulate its rate
of aging. Mutations in these genes can produce premature
aging in the young. In the very rare recessive Hutchinson-
Gilford syndrome, growth, sexual maturation, and skeletal
development are retarded; atherosclerosis and strokes usu-
ally lead to death by age 12 years. Only some 20 cases have
ever been described.
The similar Werner’s syndrome is not as rare, affect-
ing some 10 people per million worldwide. The syn-
drome is named after Otto Werner, who in Germany in
1904 reported a family affected by premature aging and
said a genetic component was at work. Werner’s syn-
drome makes its appearance in adolescence, usually pro-
ducing death before age 50 of heart attack or one of a va-
riety of rare connective tissue cancers. The gene
responsible for Werner’s syndrome was identified in
1996. Located on the short arm of chromosome 8, it
seems to affect a helicase enzyme involved in the repair
of DNA. The gene, which codes for a 1432-amino-acid
protein, has been fully sequenced, and four mutant alle-
les identified. Helicase enzymes are needed to unwind
the DNA double helix whenever DNA has to be repli-
cated, repaired, or transcribed. The high incidence of
certain cancers among Werner’s syndrome patients leads
investigators to speculate that the mutant helicase may
fail to activate critical tumor suppressor genes. The po-
tential role of helicases in aging is the subject of heated
research.
Research on aging in other animals strongly supports
the hypothesis that genes regulate the rate of aging. Partic-
ularly impressive results have been obtained in the nema-
tode Caenorhabditis elegans, where genes discovered in 1996
seem to affect an intrinsic genetic clock. A combination of
mutations can increase the worm’s lifespan fivefold, the
largest increase in lifespan seen in any organism! Mutations
in the clock gene clk-1 cause individual cells to divide more
slowly, and the animal spends more time in each phase of
its life cycle. Mutations in two other clock genes, clk-2 and
clk-3, have similar effects. Nematodes with mutations in
two of the clock genes lived three to four times longer than
normal. It seems that slowing life down in nematodes ex-
tends it. Perhaps, as the “wear-and-tear” theory suggests,
aging results from damage to cells and their DNA by
highly reactive oxidative by-products of metabolism. Living
more slowly, destructive by-products may be produced less
frequently, accumulate more slowly, and their damage be
repaired more efficiently. Similar genes have been reported
in yeasts, and attempts are now underway to isolate and
clone these genes.
Among the many theories advanced to explain aging,
many involve the progressive accumulation of damage
to DNA. When genes affecting aging have been
isolated, they affect DNA repair processes.
Chapter 17 Cellular Mechanisms of Development 359
Relative growth rate
Diploid
fibroblasts
Cancer cells
III
II
I
12345
Months
6 7 8 9 10 11 12
Transfers to new plates
10 20 30 40 50
FIGURE 17.27
Hayflick’s experiment. Fibroblast cells stop growing after about
50 doublings. Growth is rapid in phases I and II, but slows in
phase III, as the culture becomes senescent, until the final
doubling. Cancer cells, by contrast, do not “age.”
360 Part V Molecular Genetics
Chapter 17 Summary
Summary Questions Media Resources
17.1 Development is a regulated process.
? Vertebrate development is initiated by a rapid
cleavage of the fertilized egg into a hollow ball of
cells, the blastula. Cell movements then form primary
germ layers and organize the structure of the embryo.
? Cells determined in the insect embryo are carried
within the body of larvae as imaginal discs, which are
assembled into the adult body during pupation.
? Plant meristems continuously produce new tissues,
which then differentiate into body parts. This
differentiation is significantly influenced by the
environment.
1. What is cleavage? How does
the type of cleavage influence
subsequent embryonic
development?
2. What is a blastula? How
does it form and what does it
turn into?
3. What is a gastrula? Where
are the germ layers in a gastrula?
4. What is neurulation? How
and when does it occur?
? Cell movement in animal development is carried out
by altering a cell’s complement of surface adhesion
molecules, which it uses to pull itself over other cells.
? A key to animal development is the ability of cells to
alter the developmental paths of adjacent cells, a
process called induction. Induction is achieved by
diffusible chemicals called morphogens.
? Determination of a cell’s ultimate developmental fate
often involves the addition to it of positional labels
that reflect its location in the embryo.
? The location of structures within body segments is
dictated by a spatially organized assembly of
homeotic genes, first discovered in Drosophila but
now known to occur in all animals.
? Many cells are genetically programmed to die, usually
soon after they are formed during development, in a
process called apoptosis.
5. What role do cadherins and
integrins play in cell movement?
6. What is the difference
between mosaic development
and regulative development?
7. How do organizers and
morphogens participate in
induction?
8. How is determination
distinguished from
differentiation?
9. What role does maternal
mRNA play in the development
of a Drosophila embryo?
10. What are homeotic genes
and what do they do?
17.2 Multicellular organisms employ the same basic mechanisms of development.
? The four most intensively studied model systems of
development are the mouse Mus musculus, the fruit fly
Drosophila melanogaster, the nematode Caenorhabditis
elegans, and the flowering plant Arabidopsis thaliana.
11. What are the major
differences between vertebrate,
insect, and plant developmental
pathways? What are the
similarities?
17.3 Four model developmental systems have been extensively researched.
? Aging is not well understood, although not for want
of theories, most of which involve progressive
damage to DNA.
12. Cancer cell cultures never
seem to grow old, dividing
ceaselessly. What can you
deduce about the state of their
telomerase gene?
17.4 Aging can be considered a developmental process.
www.mhhe.com www.biocourse.com
? Introduction to
Development
? Vertebrate Limb
Formation
? Induction
? Pattern Formation
361
18
Altering the Genetic
Message
Concept Outline
18.1 Mutations are changes in the genetic message.
Mutations Are Rare But Important. Changes in genes
provide the raw material for evolution.
Kinds of Mutation. Some mutations alter genes
themselves, others alter the positions of genes.
Point Mutations. Radiation damage or chemical
modification can change one or a few nucleotides.
Changes in Gene Position. Chromosomal
rearrangement and insertional inactivation reflect changes
in gene position.
18.2 Cancer results from mutation of growth-
regulating genes.
What Is Cancer? Cancer is a growth disorder of cells.
Kinds of Cancer. Cancer occurs in almost all tissues, but
more in some than others.
Some Tumors Are Caused by Chemicals. Chemicals
that mutate DNA cause cancer.
Other Tumors Result from Viral Infection. Viruses
carrying growth-regulating genes can cause cancer.
Cancer and the Cell Cycle. Cancer results from
mutation of genes regulating cell proliferation
Smoking and Cancer. Smoking causes lung cancer.
Curing Cancer. New approaches offer promise of a cure.
18.3 Recombination alters gene location.
An Overview of Recombination. Recombination is
produced by gene transfer and by reciprocal recombination.
Gene Transfer. Many genes move within small circles of
DNA called plasmids. Plasmids can move between bacterial
cells and carry bacterial genes. Some gene sequences move
from one location to another on a chromosome.
Reciprocal Recombination. Reciprocal recombination
can alter genes in several ways.
Trinucleotide Repeats. Increases in the number of
repeated triplets can produce gene disorders.
18.4 Genomes are continually evolving.
Classes of Eukaryotic DNA. Unequal crossing over
expands eukaryotic genomes.
I
n general, the genetic message can be altered in two
broad ways: mutation and recombination. A change in
the content of the genetic message—the base sequence of
one or more genes—is referred to as a mutation. Some mu-
tations alter the identity of a particular nucleotide, while
others remove or add nucleotides to a gene. A change in
the position of a portion of the genetic message is referred
to as recombination. Some recombination events move a
gene to a different chromosome; others alter the location
of only part of a gene. In this chapter, we will first consider
gene mutation, using cancer as a focus for our inquiry (fig-
ure 18.1). Then we will turn to recombination, focusing on
how it has affected the organization of the eukaryotic
genome.
FIGURE 18.1
Cancer. A scanning electron micrograph of deadly cancer cells
(8000×).
Evolution can be viewed as the selection of particular
combinations of alleles from a pool of alternatives. The
rate of evolution is ultimately limited by the rate at which
these alternatives are generated. Genetic change through
mutation and recombination provides the raw material for
evolution.
Genetic changes in somatic cells do not pass on to off-
spring, and so have less evolutionary consequence than
germ-line change. However, changes in the genes of so-
matic cells can have an important immediate impact, par-
ticularly if the gene affects development or is involved with
regulation of cell proliferation.
Rare changes in genes, called mutations, can have
significant effects on the individual when they occur in
somatic tissue, but are only inherited if they occur in
germ-line tissue. Inherited changes provide the raw
material for evolution.
362 Part V Molecular Genetics
Mutations Are Rare
But Important
The cells of eukaryotes contain an enor-
mous amount of DNA. If the DNA in all of
the cells of an adult human were lined up
end-to-end, it would stretch nearly 100 bil-
lion kilometers—60 times the distance from
Earth to Jupiter! The DNA in any multicel-
lular organism is the final result of a long
series of replications, starting with the
DNA of a single cell, the fertilized egg. Or-
ganisms have evolved many different mech-
anisms to avoid errors during DNA replica-
tion and to preserve the DNA from
damage. Some of these mechanisms “proof-
read” the replicated DNA strands for accu-
racy and correct any mistakes. The proof-
reading is not perfect, however. If it were,
no variation in the nucleotide sequences of
genes would be generated.
Mistakes Happen
In fact, cells do make mistakes during repli-
cation, and damage to the genetic message
also occurs, causing mutation (figure 18.2).
However, change is rare. Typically, a par-
ticular gene is altered in only one of a mil-
lion gametes. If changes were common, the
genetic instructions encoded in DNA
would soon degrade into meaningless gib-
berish. Limited as it might seem, the steady
trickle of change that does occur is the very stuff of evo-
lution. Every difference in the genetic messages that
specify different organisms arose as the result of genetic
change.
The Importance of Genetic Change
All evolution begins with alterations in the genetic mes-
sage: mutation creates new alleles, gene transfer and trans-
position alter gene location, reciprocal recombination shuf-
fles and sorts these changes, and chromosomal
rearrangement alters the organization of entire chromo-
somes. Some changes in germ-line tissue produce alter-
ations that enable an organism to leave more offspring, and
those changes tend to be preserved as the genetic endow-
ment of future generations. Other changes reduce the abil-
ity of an organism to leave offspring. Those changes tend
to be lost, as the organisms that carry them contribute
fewer members to future generations.
18.1 Mutations are changes in the genetic message.
FIGURE 18.2
Mutation. Normal fruit flies have one pair of wings extending from the thorax. This
fly is a mutant because of changes in bithorax, a gene regulating a critical stage of
development; it possesses two thoracic segments and thus two sets of wings.
Kinds of Mutation
Because mutations can occur randomly anywhere in a cell’s
DNA, mutations can be detrimental, just as making a ran-
dom change in a computer program or a musical score usu-
ally worsens performance. The consequences of a detri-
mental mutation may be minor or catastrophic, depending
on the function of the altered gene.
Mutations in Germ-Line Tissues
The effect of a mutation depends critically on the identity
of the cell in which the mutation occurs. During the em-
bryonic development of all multicellular organisms, there
comes a point when cells destined to form gametes (germ-
line cells) are segregated from those that will form the
other cells of the body (somatic cells). Only when a muta-
tion occurs within a germ-line cell is it passed to subse-
quent generations as part of the hereditary endowment of
the gametes derived from that cell.
Mutations in Somatic Tissues
Mutations in germ-line tissue are of enormous biological
importance because they provide the raw material from
which natural selection produces evolutionary change.
Change can occur only if there are new, different allele
combinations available to replace the old. Mutation pro-
duces new alleles, and recombination puts the alleles to-
gether in different combinations. In animals, it is the oc-
currence of these two processes in germ-line tissue that is
important to evolution, as mutations in somatic cells (so-
matic mutations) are not passed from one generation to
the next. However, a somatic mutation may have drastic ef-
fects on the individual organism in which it occurs, as it is
passed on to all of the cells that are descended from the
original mutant cell. Thus, if a mutant lung cell divides, all
cells derived from it will carry the mutation. Somatic muta-
tions of lung cells are, as we shall see, the principal cause of
lung cancer in humans.
Point Mutations
One category of mutational changes affects the message it-
self, producing alterations in the sequence of DNA nu-
cleotides (table 18.1 summarizes the sources and types of
mutations). If alterations involve only one or a few base-
pairs in the coding sequence, they are called point muta-
tions. While some point mutations arise due to sponta-
neous pairing errors that occur during DNA replication,
others result from damage to the DNA caused by muta-
gens, usually radiation or chemicals. The latter class of
mutations is of particular practical importance because
modern industrial societies often release many chemical
mutagens into the environment.
Changes in Gene Position
Another category of mutations affects the way the genetic
message is organized. In both bacteria and eukaryotes, indi-
vidual genes may move from one place in the genome to
another by transposition. When a particular gene moves
to a different location, its expression or the expression of
neighboring genes may be altered. In addition, large seg-
ments of chromosomes in eukaryotes may change their rel-
ative locations or undergo duplication. Such chromosomal
rearrangements often have drastic effects on the expres-
sion of the genetic message.
Point mutations are changes in the hereditary message
of an organism. They may result from spontaneous
errors during DNA replication or from damage to the
DNA due to radiation or chemicals.
Chapter 18 Altering the Genetic Message 363
Table 18.1 Types of Mutation
Mutation Example result
NO MUTATION
Normal B protein is
produced by the
B gene.
POINT MUTATION
Base substitution B protein is inactive
because changed
amino acid disrupts
function.
Insertion B protein is inactive
because inserted
material disrupts
proper shape.
Deletion B protein is inactive
because portion of
protein is missing.
CHANGES IN GENE POSITION
Transposition B gene or B protein
may be regulated
differently because of
change in gene
position.
Chromosomal rearrangement B gene may be
inactivated or
regulated differently in
its new location on
chromosome.
Substitution of one
or a few bases
Addition of
one or a
few bases
ABC
AC
A C
ACB
AC
Loss of one or a
few bases
A C
B
B
Point Mutations
Physical Damage to DNA
Ionizing Radiation. High-energy
forms of radiation, such as X rays and
gamma rays, are highly mutagenic.
When such radiation reaches a cell, it is
absorbed by the atoms it encounters,
imparting energy to the electrons in
their outer shells. These energized
electrons are ejected from the atoms,
leaving behind free radicals, ionized
atoms with unpaired electrons. Free
radicals react violently with other mol-
ecules, including DNA.
When a free radical breaks both
phosphodiester bonds of a DNA helix,
causing a double-strand break, the
cell’s usual mutational repair enzymes
cannot fix the damage. The two frag-
ments created by the break must be aligned while the phos-
phodiester bonds between them form again. Bacteria have
no mechanism to achieve this alignment, and double-strand
breaks are lethal to their descendants. In eukaryotes, which
almost all possess multiple copies of their chromosomes,
the synaptonemal complex assembled in meiosis is used to
pair the fragmented chromosome with its homologue. In
fact, it is speculated that meiosis may have evolved initially
as a mechanism to repair double-strand breaks in DNA (see
chapter 12).
Ultraviolet Radiation. Ultraviolet (UV) radiation, the
component of sunlight that tans (and burns), contains much
less energy than ionizing radiation. It does not induce atoms
to eject electrons, and thus it does not produce free radicals.
The only molecules capable of absorbing UV radiation are
certain organic ring compounds, whose outer-shell elec-
trons become reactive when they absorb UV energy.
DNA strongly absorbs UV radiation in the pyrimidine
bases, thymine and cytosine. If one of the nucleotides on
either side of the absorbing pyrimidine is also a pyrimidine,
a double covalent bond forms between them. The resulting
cross-link between adjacent pyrimidines is called a pyrimi-
dine dimer (figure 18.3). In most cases, cellular UV repair
systems either cleave the bonds that link the adjacent
pyrimidines or excise the entire pyrimidine dimer from the
strand and fill in the gap, using the other strand as a tem-
plate (figure 18.4). In those rare instances in which a
pyrimidine dimer goes unrepaired, DNA polymerase may
fail to replicate the portion of the strand that includes the
dimer, skipping ahead and leaving the problem area to be
filled in later. This filling-in process is often error-prone,
however, and it may create mutational changes in the base
sequence of the gap region. Some unrepaired pyrimidine
dimers block DNA replication altogether, which is lethal to
the cell.
Sunlight can wreak havoc on the cells of the skin be-
cause its UV light causes mutations. Indeed, a strong and
direct association exists between exposure to bright sun-
light, UV-induced DNA damage, and skin cancer. A deep
tan is not healthy! A rare hereditary disorder among hu-
mans called xeroderma pigmentosum causes these prob-
lems after a lesser exposure to UV. Individuals with this
disorder develop extensive skin tumors after exposure to
sunlight because they lack a mechanism for repairing the
DNA damage UV radiation causes. Because of the many
different proteins involved in excision and repair of pyrimi-
dine dimers, mutations in as many as eight different genes
cause the disease.
364 Part V Molecular Genetics
T
T
T
T
T
T
A
A
Thymine
dimer
Ultraviolet
light
Kink
FIGURE 18.3
Making a pyrimidine dimer. When two pyrimidines, such as two thymines, are adjacent to
each other in a DNA strand, the absorption of UV radiation can cause covalent bonds to
form between them—creating a pyrimidine dimer. The dimer introduces a “kink” into the
double helix that prevents replication of the duplex by DNA polymerase.
T
T
C A T A A C A G
T
T
C A T A A C A G
G T A G T C
1
G T A
G
T C
2
C A T A A C A G
G T A T T G T C
4
C A T A A C A G
G T A T C
3
T
FIGURE 18.4
Repair of a
pyrimidine dimer.
Some pyrimidine
dimers are repaired
by excising the
dimer, as well as a
short run of
nucleotides on either
side of it, and then
filling in the gap
using the other
strand as a template.
Chemical Modification of DNA
Many mutations result from direct chemical modification
of the DNA. The chemicals that act on DNA fall into
three classes: (1) chemicals that resemble DNA nu-
cleotides but pair incorrectly when they are incorporated
into DNA (figure 18.5). Some of the new AIDS
chemotherapeutic drugs are analogues of nitrogenous
bases that are inserted into the viral or infected cell DNA.
This DNA cannot be properly transcribed, so viral
growth slows; (2) chemicals that remove the amino group
from adenine or cytosine, causing them to mispair; and (3)
chemicals that add hydrocarbon groups to nucleotide
bases, also causing them to mispair. This last group in-
cludes many particularly potent mutagens commonly used
in laboratories, as well as compounds sometimes released
into the environment, such as mustard gas.
Spontaneous Mutations
Many point mutations occur spontaneously, without ex-
posure to radiation or mutagenic chemicals. Sometimes
nucleotide bases spontaneously shift to alternative confor-
mations, or isomers, which form different kinds of hydro-
gen bonds than the normal conformations. During repli-
cation, DNA polymerase pairs a different nucleotide with
the isomer than it would have otherwise selected. Unre-
paired spontaneous errors occur in fewer than one in a
billion nucleotides per generation, but they are still an
important source of mutation.
Sequences sometimes misalign when homologous
chromosomes pair, causing a portion of one strand to
loop out. These misalignments, called slipped mispair-
ing, are usually only transitory, and the chromosomes
quickly revert to the normal arrangement (figure 18.6). If
the error-correcting system of the cell encounters a
slipped mispairing before it reverts, however, the system
will attempt to “correct” it, usually by excising the loop.
This may result in a deletion of several hundred nu-
cleotides from one of the chromosomes. Many of these
deletions start or end in the middle of a codon, thereby
shifting the reading frame by one or two bases. These so-
called frame-shift mutations cause the gene to be read
in the wrong three-base groupings, distorting the genetic
message, just as the deletion of the letter F from the sen-
tence, THE FAT CAT ATE THE RAT shifts the read-
ing frame of the sentence, producing the meaningless
message, THE ATC ATA TET HER AT. Some chemi-
cals specifically promote deletions and frame-shift muta-
tions by stabilizing the loops produced during slipped
mispairing, thus increasing the time the loops are vulner-
able to excision.
Chapter 18 Altering the Genetic Message 365
H
Cytosine
N
H
O
NH
2
N
H
Thymine
N
CH
3
H
O
O
N
H
5-Bromouracil
N
BrH
O
O
N
FIGURE 18.5
Chemicals that resemble DNA bases can cause mutations. For
example, DNA polymerase cannot distinguish between thymine
and 5-bromouracil, which are similar in shape. Once incorporated
into a DNA molecule, however, 5-bromouracil tends to rearrange
to a form that resembles cytosine and pairs with guanine. When
this happens, what was originally an A-T base-pair becomes a G-
C base-pair.
Resumption of
correct pairing
Correct
pairing
Slipped
mispairing
Excision
of loop
ResultResult
FIGURE 18.6
Slipped mispairing. Slipped mispairing occurs when a sequence
is present in more than one copy on a chromosome and the copies
on homologous chromosomes pair out of register, like a shirt
buttoned wrong. The loop this mistake produces is sometimes
excised by the cell’s repair enzymes, producing a short deletion
and often altering the reading frame. Any chemical that stabilizes
the loop increases the chance it will be excised.
The major sources of physical damage to DNA are
ionizing radiation, which breaks the DNA strands;
ultraviolet radiation, which creates nucleotide cross-
links whose removal often leads to errors in base
selection; and chemicals that modify DNA bases and
alter their base-pairing behavior. Unrepaired
spontaneous errors in DNA replication occur rarely.
Changes in Gene Position
Chromosome location is an important factor in determin-
ing whether genes are transcribed. Some genes cannot be
transcribed if they are adjacent to a tightly coiled region of
the chromosome, even though the same gene can be tran-
scribed normally in any other location. Transcription of
many chromosomal regions appears to be regulated in this
manner; the binding of specific proteins regulates the de-
gree of coiling in local regions of the chromosome, deter-
mining the accessibility RNA polymerase has to genes lo-
cated within those regions.
Chromosomal Rearrangements
Chromosomes undergo several different kinds of gross
physical alterations that have significant effects on the loca-
tions of their genes. The two most important are translo-
cations, in which a segment of one chromosome becomes
part of another chromosome, and inversions, in which the
orientation of a portion of a chromosome is reversed.
Translocations often have significant effects on gene ex-
pression. Inversions, on the other hand, usually do not alter
gene expression, but they are nonetheless important. Re-
combination within a region that is inverted on one homo-
logue but not the other (figure 18.7) leads to serious prob-
lems: none of the gametes that contain chromatids
produced following such a crossover event will have a com-
plete set of genes.
Other chromosomal alterations change the number of
gene copies an individual possesses. Particular genes or seg-
ments of chromosomes may be deleted or duplicated,
whole chromosomes may be lost or gained (aneuploidy), and
entire sets of chromosomes may be added (polyploidy). Most
deletions are harmful because they halve the number of
gene copies within a diploid genome and thus seriously af-
fect the level of transcription. Duplications cause gene im-
balance and are also usually harmful.
Insertional Inactivation
Many small segments of DNA are capable of moving
from one location to another in the genome, using an en-
zyme to cut and paste themselves into new genetic neigh-
borhoods. We call these mobile bits of DNA transpos-
able elements, or transposons. Transposons select their
new locations at random, and are as likely to enter one
segment of a chromosome as another. Inevitably, some
transposons end up inserted into genes, and this almost
always inactivates the gene. The encoded protein now
has a large meaningless chunk inserted within it, disrupt-
ing its structure. This form of mutation, called inser-
tional inactivation, is common in nature. Indeed, it
seems to be one of the most significant causes of muta-
tion. The original white-eye mutant of Drosophila discov-
ered by Morgan (see chapter 13) is the result of a trans-
position event, a transposon nested within a gene
encoding a pigment-producing enzyme.
As you might expect, a variety of human gene disorders
are the result of transposition. The human transposon
called Alu, for example, is responsible for an X-linked he-
mophilia, inserting into clotting factor IX and placing a
premature stop codon there. It also causes inherited high
levels of cholesterol (hypercholesterolemia), Alu elements
inserting into the gene encoding the low density lipopro-
tein (LDL) receptor. In one very interesting case, a
Drosophila transposon called Mariner proves responsible for
a rare human neurological disorder called Charcot-Marie-
Tooth disease, in which the muscles and nerves of the legs
and feet gradually wither away. The Mariner transposon is
inserted into a key gene called CMT on chromosome 17,
creating a weak site where the chromosome can break. No
one knows how the Drosophila transposon got into the
human genome.
Many mutations result from changes in gene location or
from insertional inactivation.
366 Part V Molecular Genetics
c
f
g
h
i
b
d
e
a
E
F
G
H
I
B
D
C
A
1
c
f
g
h
i
b
d
e
a E
F
G
H
I
B
D
C
A
Inverted
segment
2
c
f
g
h
i
b
d
e
a
F
G
H
I
B
C
A
E
D
3
c
f
g
h
i
b
e
F
H
I
B
C
A
4
G
c
f
g
h
i
b
d
e
a
F
G
H
I
B
C
A
E
D
5
d
a
D
E
FIGURE 18.7
The consequence of inversion. (1) When a segment of a chromosome is inverted, (2) it can pair in meiosis only by forming an internal
loop. (3) Any crossing over that occurs within the inverted segment during meiosis will result in nonviable gametes; some genes are lost
from each chromosome, while others are duplicated (4 and 5). For clarity, only two strands are shown, although crossing over occurs in the
four-strand stage. The pairing that occurs between inverted segments is sometimes visible under the microscope as a characteristic loop
(inset).
What Is Cancer?
Cancer is a growth disorder of cells. It starts when an ap-
parently normal cell begins to grow in an uncontrolled and
invasive way (figure 18.8). The result is a cluster of cells,
called a tumor, that constantly expands in size. Cells that
leave the tumor and spread throughout the body, forming
new tumors at distant sites, are called metastases (figure
18.9). Cancer is perhaps the most pernicious disease. Of
the children born in 1999, one-third will contract cancer at
some time during their lives; one-fourth of the male chil-
dren and one-third of the female children will someday die
of cancer. Most of us have had family or friends affected by
the disease. In 1997, 560,000 Americans died of cancer.
Not surprisingly, researchers are expending a great deal
of effort to learn the cause of this disease. Scientists have
made a great deal of progress in the last 20 years using
molecular biological techniques, and the rough outlines of
understanding are now emerging. We now know that can-
cer is a gene disorder of somatic tissue, in which damaged
genes fail to properly control cell proliferation. The cell di-
vision cycle is regulated by a sophisticated group of pro-
teins described in chapter 11. Cancer results from the mu-
tation of the genes encoding these proteins.
Cancer can be caused by chemicals that mutate DNA or
in some instances by viruses that circumvent the cell’s nor-
mal proliferation controls. Whatever the immediate cause,
however, all cancers are characterized by unrestrained
growth and division. Cell division never stops in a cancer-
ous line of cells. Cancer cells are virtually immortal—until
the body in which they reside dies.
Cancer is unrestrained cell proliferation caused by
damage to genes regulating the cell division cycle.
Chapter 18 Altering the Genetic Message 367
18.2 Cancer results from mutation of growth-regulating genes.
FIGURE 18.8
Lung cancer cells (530×). These cells are from a tumor located
in the alveolus (air sac) of a lung.
FIGURE 18.9
Portrait of a cancer. This ball of cells is a
carcinoma (cancer tumor) developing from
epithelial cells that line the interior surface
of a human lung. As the mass of cells
grows, it invades surrounding tissues,
eventually penetrating lymphatic and
blood vessels, both plentiful within the
lung. These vessels carry metastatic cancer
cells throughout the body, where they
lodge and grow, forming new masses of
cancerous tissue.
Carcinoma of the lung
Connective tissue
Lymphatic vessel
Smooth muscle
Metastatic cells Blood vessel
Blood vessel
Kinds of Cancer
Cancer can occur in almost any tissue,
so a bewildering number of different
cancers occur. Tumors arising from
cells in connective tissue, bone, or
muscle are known as sarcomas, while
those that originate in epithelial tissue
such as skin are called carcinomas. In
the United States, the three deadliest
human cancers are lung cancer, cancer
of the colon and rectum, and breast
cancer (table 18.2). Lung cancer, re-
sponsible for the most cancer deaths,
is largely preventable; most cases re-
sult from smoking cigarettes. Col-
orectal cancers appear to be fostered
by the high-meat diets so favored in
the United States. The cause of breast
cancer is still a mystery, although in
1994 and 1995 researchers isolated
two genes responsible for hereditary
susceptibility to breast cancer, BRCA1
and BRCA2 (Breast Cancer genes #1
and #2 located on human chromo-
somes 17 and 13); their discovery of-
fers hope that researchers will soon be
able to unravel the fundamental mechanism leading to
hereditary breast cancer, about one-third of all breast
cancers.
The association of particular chemicals with cancer,
particularly chemicals that are potent mutagens, led re-
searchers early on to the suspicion that cancer might be
caused, at least in part, by chemicals, the so-called chem-
ical carcinogenesis theory. Agents thought to cause
cancer are called carcinogens. A simple and effective
way to test if a chemical is mutagenic is the Ames test
(figure 18.10), named for its developer, Bruce Ames. The
test uses a strain of Salmonella bacteria that has a defec-
tive histidine-synthesizing gene. Because these bacteria
cannot make histidine, they cannot grow on media without
it. Only a back-mutation that restores the ability to manu-
facture histidine will permit growth. Thus the number of
colonies of these bacteria that grow on histidine-free
medium is a measure of the frequency of back-mutation. A
majority of chemicals that cause back-mutations in this
test are carcinogenic, and vice versa. To increase the sen-
sitivity of the test, the strains of bacteria are altered to
disable their DNA repair machinery. The search for the
cause of cancer has focused in part on chemical carcino-
gens and other environmental factors, including ionizing
radiation such as X rays (figure 18.11).
Cancers occur in all tissues, but are more common in
some than others.
368 Part V Molecular Genetics
Table 18.2 Incidence of Cancer in the United States in 1999
Type of Cancer New Cases Deaths % of Cancer Deaths
Lung 171,600 158,900 28
Colon and rectum 129,400 56,600 10
Leukemia/lymphoma 94,200 49,100 9
Breast 176,300 43,700 8
Prostate 179,300 37,000 7
Pancreas 28,600 28,600 5
Ovary 25,200 14,500 3
Stomach 21,900 13,500 2
Liver 14,500 13,600 2
Nervous system/eye 19,000 13,300 2
Bladder 54,200 12,100 2
Oral cavity 29,800 8,100 2
Kidney 30,000 11,900 2
Cervix/uterus 50,200 11,200 2
Malignant melanoma 44,200 7,300 1
Sarcoma (connective tissue) 10,400 5,800 1
All other cancers 143,000 77,900 14
In the United States in 1999 there were 1,221,800 reported cases of new cancers and 563,100 cancer
deaths, indicating that roughly half the people who develop cancer die from it.
Source: Data from the American Cancer Society, Inc., 1999.
Suspected
carcinogen
Histidine-
dependent
bacteria
Rat liver extract
Mix
Pour into petri dish
and incubate on
histidine-lacking
medium
Count the
number of
bacterial
colonies
that grow
FIGURE 18.10
The Ames test. This test is uses a strain of Salmonella bacteria
that requires histidine in the growth medium due to a mutated
gene. If a suspected carcinogen is mutagenic, it can reverse this
mutation. Rat liver extract is added because it contains enzymes
that can convert carcinogens into mutagens. The mutagenicity of
the carcinogen can be quantified by counting the number of
bacterial colonies that grow on a medium lacking histidine.
Chapter 18 Altering the Genetic Message 369
Nigeria
Japan
Colombia
Chile Hungary
Poland
Puerto Rico
Finland
Yugoslavia
Jamaica
Norway
Israel
Sweden
Netherlands
UK
Denmark
Canada
USA
New Zealand
West Germany
Iceland
East Germany
Romania
0
10
20
30
40
50
Meat consumption (grams per person per day)
Cancer of large intestine annual incidence (per 100,000 population)
0 40 80 120 160 200 240 280 320
0
20
40
60
80
100
120
Manufactured cigarettes per adult in 1950
Lung cancer at ages 35
–
44 in the early 1970s
(per 100,000 population)
500 1000 1500 2000 2500 3000
Spain
Germany
Australia
France
Sweden
Finland
Switzerland
Denmark
Holland
Greece
New Zealand
Austria
Norway
USA
Ireland
UK
Canada
Italy
Belgium
Japan
Portugal
USA — never smoked
Above U.S. average
Highest cancer rates
(a) POLLUTION
(b) DIET (c) SMOKING
FIGURE 18.11
Potential cancer-causing agents. (a) The incidence of cancer per 1000 people is not uniform throughout the United States. The
incidence is higher in cities and in the Mississippi Delta, suggesting that pollution and pesticide runoff may contribute to the development
of cancer. (b) One of the deadliest cancers in the United States, cancer of the large intestine, is uncommon in many other countries. Its
incidence appears to be related to the amount of meat a person consumes: a high-meat diet slows the passage of food through the intestine,
prolonging exposure of the intestinal wall to digestive waste. (c) The biggest killer among cancers is lung cancer, and the most deadly
environmental agent producing lung cancer is cigarette smoke. The incidence of lung cancer among men 35 to 44 years of age in various
countries strongly correlates with the cigarette consumption in that country 20 years earlier.
Some Tumors Are Caused by
Chemicals
Early Ideas
The chemical carcinogenesis theory was first advanced over
200 years ago in 1761 by Dr. John Hill, an English physi-
cian, who noted unusual tumors of the nose in heavy snuff
users and suggested tobacco had produced these cancers. In
1775, a London surgeon, Sir Percivall Pott, made a similar
observation, noting that men who had been chimney
sweeps exhibited frequent cancer of the scrotum, and sug-
gesting that soot and tars might be responsible. British
sweeps washed themselves infrequently and always seemed
covered with soot. Chimney sweeps on the continent, who
washed daily, had much less of this scrotal cancer. These
and many other observations led to the hypothesis that
cancer results from the action of chemicals on the body.
Demonstrating That Chemicals Can Cause
Cancer
It was over a century before this hypothesis was directly
tested. In 1915, Japanese doctor Katsusaburo Yamagiwa ap-
plied extracts of coal tar to the skin of 137 rabbits every 2 or
3 days for 3 months. Then he waited to see what would
happen. After a year, cancers appeared at the site of applica-
tion in seven of the rabbits. Yamagiwa had induced cancer
with the coal tar, the first direct demonstration of chemical
carcinogenesis. In the decades that followed, this approach
demonstrated that many chemicals were capable of causing
cancer. Importantly, most of them were potent mutagens.
Because these were lab studies, many people did not ac-
cept that the results applied to real people. Do tars in fact in-
duce cancer in humans? In 1949, the American physician
Ernst Winder and the British epidemiologist Richard Doll
independently reported that lung cancer showed a strong
link to the smoking of cigarettes, which introduces tars into
the lungs. Winder interviewed 684 lung cancer patients and
600 normal controls, asking whether each had ever smoked.
Cancer rates were 40 times higher in heavy smokers than in
nonsmokers. Doll’s study was even more convincing. He in-
terviewed a large number of British physicians, noting which
ones smoked, then waited to see which would develop lung
cancer. Many did. Overwhelmingly, those who did were
smokers. From these studies, it seemed likely as long as 50
years ago that tars and other chemicals in cigarette smoke in-
duce cancer in the lungs of persistent smokers. While this
suggestion was (and is) resisted by the tobacco industry, the
evidence that has accumulated since these pioneering studies
makes a clear case, and there is no longer any real doubt.
Chemicals in cigarette smoke cause cancer.
Carcinogens Are Common
In ongoing investigations over the last 50 years, many
hundreds of synthetic chemicals have been shown capable
of causing cancer in laboratory animals. Among them are
trichloroethylene, asbestos, benzene, vinyl chloride,
arsenic, arylamide, and a host of complex petroleum
products with chemical structures resembling chicken
wire. People in the workplace encounter chemicals daily
(table 18.3).
In addition to identifying potentially dangerous sub-
stances, what have the studies of potential carcinogens
told us about the nature of cancer? What do these cancer-
causing chemicals have in common? They are all mutagens,
each capable of inducing changes in DNA.
Chemicals that produce mutations in DNA are often
potent carcinogens. Tars in cigarette smoke, for
example, are the direct cause of most lung cancers.
370 Part V Molecular Genetics
Table 18.3 Chemical Carcinogens in the Workplace
Workers at Risk
Chemical Cancer for Exposure
COMMON EXPOSURE
Benzene Myelogenous Painters; dye users;
leukemia furniture finishers
Diesel exhaust Lung Railroad and
bus-garage workers;
truckers; miners
Mineral oils Skin Metal machinists
Pesticides Lung Sprayers
Cigarette tar Lung Smokers
UNCOMMON EXPOSURE
Asbestos Mesothelioma, Brake-lining,
lung insulation workers
Synthetic mineral Lung Wall and pipe
fibers insulation and duct
wrapping users
Hair dyes Bladder Hairdressers and
barbers
Paint Lung Painters
Polychlorinated Liver, skin Users of hydraulic
biphenyls fluids and
lubricants, inks,
adhesives, insecticides
Soot Skin Chimney sweeps;
bricklayers; firefighters;
heating-unit service
workers
RARE EXPOSURE
Arsenic Lung, skin Insecticide/herbicide
sprayers; tanners;
oil refiners
Formaldehyde Nose Wood product,
paper, textiles, and
metal product workers
Other Tumors Result from Viral
Infection
Chemical mutagens are not the only carcinogens, however.
Some tumors seem almost certainly to result from viral in-
fection. Viruses can be isolated from certain tumors, and
these viruses cause virus-containing tumors to develop in
other individuals. About 15% of human cancers are associ-
ated with viruses.
A Virus That Causes Cancer
In 1911, American medical researcher Peyton Rous re-
ported that a virus, subsequently named Rous avian sar-
coma virus (RSV), was associated with chicken sarcomas.
He found that RSV could infect and initiate cancer in
chicken fibroblast (connective tissue) cells growing in cul-
ture; from those cancerous cells, more viruses could be iso-
lated. Rous was awarded the 1966 Nobel Prize in Physiol-
ogy or Medicine for this discovery. RSV proved to be a
kind of RNA virus called a retrovirus. When retroviruses
infect a cell, they make a DNA copy of their RNA genome
and insert that copy into the host cell’s DNA.
How RSV Causes Cancer
How does RSV initiate cancer? When RSV was compared
to a closely related virus, RAV-O, which is unable to trans-
form normal chicken cells into cancerous cells, the two
viruses proved to be identical except for one gene that was
present in RSV but absent from RAV-O. That gene was
called the src gene, short for sarcoma.
How do viral genes cause cancer? An essential clue came
in 1970, when temperature-sensitive RSV mutants were
isolated. These mutants would transform tissue culture
cells into cancer cells at 35°C, but not at 41°C. Tempera-
ture sensitivity of this kind is almost always associated with
proteins. It seemed likely, therefore, that the src gene was
actively transcribed by the cell, rather than serving as a
recognition site for some sort of regulatory protein. This
was an exciting result, suggesting that the protein specified
by this cancer-causing gene, or oncogene, could be iso-
lated and its properties studied.
The src protein was first isolated in 1977 by J. Michael
Bishop and Harold Varmus, who won the Nobel Prize for
their efforts. It turned out to be an enzyme of moderate
size that phosphorylates (adds a phosphate group to) the ty-
rosine amino acids of proteins. Such enzymes, called tyro-
sine kinases, are quite common in animal cells. One exam-
ple is an enzyme that also serves as a plasma membrane
receptor for epidermal growth factor, a protein that sig-
nals the initiation of cell division. This finding raised the
exciting possibility that RSV may cause cancer by introduc-
ing into cells an active form of a normally quiescent
growth-promoting enzyme. Later experiments showed this
is indeed the case.
Origin of the src Gene
Does the src gene actually integrate into the host cell’s
chromosome along with the rest of the RSV genome? One
way to answer this question is to prepare a radioactive ver-
sion of the gene, allow it to bind to complementary se-
quences on the chicken chromosomes, and examine where
the chromosomes become radioactive. The result of this
experiment is that radioactive src DNA does in fact bind to
the site where RSV DNA is inserted into the chicken
genome—but it also binds to a second site where there is
no part of the RSV genome!
The explanation for the second binding site is that the
src gene is not exclusively a viral gene. It is also a growth-
promoting gene that evolved in and occurs normally in
chickens. This normal chicken gene is the second site
where src binds to chicken DNA. Somehow, an ancestor of
RSV picked up a copy of the normal chicken gene in some
past infection. Now part of the virus, the gene is tran-
scribed under the control of viral promoters rather than
under the regulatory system of the chicken genome (figure
18.12).
Studies of RSV reveal that cancer results from the
inappropriate activity of growth-promoting genes that
are less active or completely inactive in normal cells.
Chapter 18 Altering the Genetic Message 371
Tyrosine kinase gene of chicken
chromosome with 6 introns
Retrovirus genome
without oncogene (RAV-0)
Envelope proteins
Genome of Rous avian sarcoma virus (RSV)
RNA transcript
Reverse transcriptase
DNA copy
123 4 5 6
gag
src
pol env
gag pol env src
FIGURE 18.12
How a chicken gene got into the RSV genome. RSV contains
only a few genes: gag and env, which encode the viral protein coat
and envelope proteins, and pol, which encodes reverse
transcriptase. It also contains the src gene that causes sarcomas,
which the RAV-O virus lacks. RSV originally obtained its src gene
from chickens, where a copy of the gene occurs normally and is
controlled by the chicken’s regulatory genes.
Cancer and the Cell Cycle
An important technique used to study tumors is called
transfection. In this procedure, the nuclear DNA from
tumor cells is isolated and cleaved into random fragments.
Each fragment is then tested individually for its ability to
induce cancer in the cells that assimilate it.
Using transfection, researchers have discovered that
most human tumors appear to result from the mutation of
genes that regulate the cell cycle. Sometimes the mutation
of only one or two gene is all that is needed to transform
normally dividing cells into cancerous cells in tissue culture
(table 18.4).
Point Mutations Can Lead to Cancer
The difference between a normal gene encoding a protein
that regulates the cell cycle and a cancer-inducing version
can be a single point mutation in the DNA. In one case of
ras-induced bladder cancer, for example, a single DNA
base change from guanine to thymine converts a glycine
in the normal ras protein into a valine in the cancer-caus-
ing version. Several other ras-induced human carcinomas
have been shown to also involve single nucleotide substi-
tutions.
Telomerase and Cancer
Telomeres are short sequences of nucleotides repeated
thousands of times on the ends of chromosomes. Because
DNA polymerase is unable to copy chromosomes all the
way to the tip (there is no place for the primer necessary to
copy the last Okazaki fragment), telomeric segments are
lost every time a cell divides.
In healthy cells a tumor suppressor inhibits production
of a special enzyme called telomerase that adds the lost
telomere material back to the tip. Without this enzyme, a
cell’s chromosomes lose material from their telomeres with
each replication. Every time a chromosome is copied as the
cell prepares to divide, more of the tip is lost. After some
30 divisions, so much is lost that copying is no longer pos-
sible. Cells in the tissues of an adult human have typically
undergone 25 or more divisions. Cancer can’t get very far
with only the 5 remaining cell divisions. Were cancer to
start, it would grind to a halt after only a few divisions for
lack of telomere.
Thus, we see that the cell’s inhibition of telomerase in
somatic cells is a very effective natural brake on the cancer
process. Any mutation that destroys the telomerase in-
hibitor releases that brake, making cancer possible. Thus,
when researchers looked for telomerase in human ovarian
tumor cells, they found it. These cells contained muta-
tions that had inactivated the cell control that blocks the
transcription of the telomerase gene. Telomerase pro-
duced in these cells reversed normal telomere shortening,
allowing the cells to proliferate and gain the immortality
of cancer cells.
Mutations in Proto-Oncogenes: Accelerating the
Cell Cycle
Most cancers are the direct result of mutations in growth-
regulating genes. There are two general classes of cancer-
inducing mutations: mutations of proto-oncogenes and
mutations of tumor-suppressor genes.
Genes known as proto-oncogenes encode proteins
that stimulate cell division. Mutations that overactivate
these stimulatory proteins cause the cells that contain
them to proliferate excessively. Mutated proto-oncogenes
become cancer-causing genes called oncogenes (Greek
onco-, “tumor”) (figure 18.13). Often the induction of
these cancers involves changes in the activity of intracel-
lular signalling molecules associated with receptors on
the surface of the plasma membrane. In a normal cell, the
signalling pathways activated by these receptors trigger
passage of the G
1
checkpoint of cell proliferation (see fig-
ure 11.17).
The mutated alleles of these oncogenes are genetically
dominant. Among the most widely studied are myc and ras.
Expression of myc stimulates the production of cyclins and
cyclin-dependent protein kinases (Cdks), key elements in
regulating the checkpoints of cell division.
372 Part V Molecular Genetics
Growth-factor receptors:
PDGF receptor
erbB
Growth-factors:
PDGF
Cytoplasmic steroid-type
growth-factor receptors:
RET
Cytoplasmic
serine/threonine-specific
protein kinases:
raf
Membrane/cytoskeleton-
protein kinases:
src
Nuclear
proteins:
myc
bcl
MDM
Cytoplasmic tyrosine-
specific protein kinases:
N-ras
G proteins:
K-ras
FIGURE 18.13
The main classes of oncogenes. Before they are altered by
mutation to their cancer-causing condition, oncogenes are called
proto-oncogenes (that is, genes able to become oncogenes).
Illustrated here are the principal classes of proto-oncogenes, with
some typical representatives indicated.
The ras gene product is involved in the cellular response
to a variety of growth factors such as EGF, an intercellular
signal that normally initiates cell proliferation. When EGF
binds to a specific receptor protein on the plasma mem-
brane of epithelial cells, the portion of the receptor that
protrudes into the cytoplasm stimulates the ras protein to
bind to GTP. The ras protein/GTP complex in turn re-
cruits and activates a protein called Raf to the inner surface
of the plasma membrane, which in turn activates cytoplas-
mic kinases and so triggers an intracellular signaling system
(see chapter 7). The final step in the pathway is the activa-
tion of transcription factors that trigger cell proliferation.
Cancer-causing mutations in ras greatly reduce the amount
of EGF necessary to initiate cell proliferation.
Chapter 18 Altering the Genetic Message 373
Table 18.4 Some Genes Implicated in Human Cancers
Gene Product Cancer
ONCOGENES
Genes Encoding Growth Factors or Their Receptors
erb-B Receptor for epidermal growth factor Glioblastoma (a brain cancer); breast cancer
erb-B2 A growth factor receptor (gene also called neu) Breast cancer; ovarian cancer; salivary gland cancer
PDGF Platelet-derived growth factor Glioma (a brain cancer)
RET A growth factor receptor Thyroid cancer
Genes Encoding Cytoplasmic Relays in Intracellular Signaling Pathways
K-ras Protein kinase Lung cancer; colon cancer; ovarian cancer;
pancreatic cancer
N-ras Protein kinase Leukemias
Genes Encoding Transcription Factors That Activate Transcription of Growth-Promoting Genes
c-myc Transcription factor Lung cancer; breast cancer; stomach cancer;
leukemias
L-myc Transcription factor Lung cancer
N-myc Transcription factor Neuroblastoma (a nerve cell cancer)
Genes Encoding Other Kinds of Proteins
bcl-2 Protein that blocks cell suicide Follicular B cell lymphoma
bcl-1 Cyclin D1, which stimulates the cell Breast cancer; head and neck cancers
cycle clock (gene also called PRAD1)
MDM2 Protein antagonist of p53 tumor-supressor protein Wide variety of sarcomas (connective tissue
cancers)
TUMOR-SUPRESSOR GENES
Genes Encoding Cytoplasmic Proteins
APC Step in a signaling pathway Colon cancer; stomach cancer
DPC4 A relay in signaling pathway that inhibits cell division Pancreatic cancer
NF-1 Inhibitor of ras, a protein that stimulates cell division Neurofibroma; myeloid leukemia
NF-2 Inhibitor of ras Meningioma (brain cancer); schwannoma (cancer
of cells supporting peripheral nerves)
Genes Encoding Nuclear Proteins
MTS1 p16 protein, which slows the cell cycle clock A wide range of cancers
p53 p53 protein, which halts cell division at the G
1
checkpoint A wide range of cancers
Rb Rb protein, which acts as a master brake of the cell cycle Retinoblastoma; breast cancer; bone cancer;
bladder cancer
Genes Encoding Proteins of Unknown Cellular Locations
BRCA1 ? Breast cancer; ovarian cancer
BRCA2 ? Breast cancer
VHL ? Renal cell cancer
Mutations in Tumor-Suppressor Genes:
Inactivating the Cell’s Inhibitors of Proliferation
If the first class of cancer-inducing mutations “steps on the
accelerator” of cell division, the second class of cancer-
inducing mutations “removes the brakes.” Cell division is
normally turned off in healthy cells by proteins that pre-
vent cyclins from binding to Cdks. The genes that encode
these proteins are called tumor-suppressor genes. Their
mutant alleles are genetically recessive.
Among the most widely studied tumor-suppressor
genes are Rb, p16, p21, and p53. The unphosphorylated
product of the Rb gene ties up transcription factor E2F,
which transcribes several genes required for passage
through the G
1
checkpoint into S phase of the cell cycle
(figure 18.14). The proteins encoded by p16 and p21 re-
inforce the tumor-suppressing role of the Rb protein,
preventing its phosphorylation by binding to the appro-
priate Cdk/cyclin complex and inhibiting its kinase activ-
ity. The p53 protein senses the integrity of the DNA and
is activated if the DNA is damaged (figure 18.15). It ap-
pears to act by inducing the transcription of p21, which
binds to cyclins and Cdk and prevents them from inter-
acting. One of the reasons repeated smoking leads inex-
orably to lung cancer is that it induces p53 mutations. In-
deed, almost half of all cancers involve mutations of the
p53 gene.
374 Part V Molecular Genetics
Rb
Retinoblastoma protein p16 Tumor suppressor
Cell division No cell division
x
Rb
Cyclins
Cdk
Growth
blocked
at G
1
Cell
nucleus
E2F
E2F
E2F
Rb
Rb
ATP
P
Mitosis
initiated
Mitosis
inhibited
Cell
nucleus
p16 binds to Cdk, preventing
phosphorylation of Rb
p16
Cdk
Growth
blocked
at G
1
E2F
E2F
Rb
Rb
p16
Cyclins
FIGURE 18.14
How the tumor-suppressor genes Rb and p16 interact to
block cell division. The retinoblastoma protein (Rb) binds to the
transcription factor (E2F) that activates genes in the nucleus,
preventing this factor from initiating mitosis. The G
1
checkpoint is
passed when Cdk interacts with cyclins to phosphorylate Rb,
releasing E2F. The p16 tumor-suppressor protein reinforces Rb’s
inhibitory action by binding to Cdk so that Cdk is not available to
phosphorylate Rb.
1. Halts cell cycle
at G
1
checkpoint
2. Activates DNA
repair system
Cdk
Damage to
DNA
p53
Initiates
transcription
of repair
enzymes
Initiates
transcription
of p21
DNA
repair
p21
Cyclins
p21
Blocks cell cycle
at G
1
checkpoint
Prevents DNA
replication
FIGURE 18.15
The role of tumor-suppressor p53 in regulating the cell
cycle. The p53 protein works at the G
1
checkpoint to check for
DNA damage. If the DNA is damaged, p53 activates the DNA
repair system and stops the cell cycle at the G
1
checkpoint (before
DNA replication). This allows time for the damage to be repaired.
p53 stops the cell cycle by inducing the transcription of p21. The
p21 protein then binds to cyclins and prevents them from
complexing with Cdk.
Cancer-Causing Mutations Accumulate over
Time
Cells control proliferation at several checkpoints, and all
of these controls must be inactivated for cancer to be ini-
tiated. Therefore, the induction of most cancers involves
the mutation of multiple genes; four is a typical number
(figure 18.16). In many of the tissue culture cell lines used
to study cancer, most of the controls are already inacti-
vated, so that mutations in only one or a few genes trans-
form the line into cancerous growth. The need to inacti-
vate several regulatory genes almost certainly explains
why most cancers occur in people over 40 years old (fig-
ure 18.17); in older persons, there has been more time for
individual cells to accumulate multiple mutations. It is
now clear that mutations, including those in potentially
cancer-causing genes, do accumulate over time. Using the
polymerase chain reaction (PCR), researchers in 1994
searched for a certain cancer-associated gene mutation in
the blood cells of 63 cancer-free people. They found that
the mutation occurred 13 times more often in people over
60 years old than in people under 20.
Cancer is a disease in which the controls that normally
restrict cell proliferation do not operate. In some cases,
cancerous growth is initiated by the inappropriate
activation of proteins that regulate the cell cycle; in
other cases, it is initiated by the inactivation of proteins
that normally suppress cell division.
Chapter 18 Altering the Genetic Message 375
MUTATED
GENE
Tumor
suppressor
Normal
epithelium
Hyperproliferative
epithelium
Early benign
polyp
Intermediate
benign polyp
Late benign
polyp
Carcinoma Metastasis
APC OncogeneK-ras
Tumor
suppressor
DCC
Tumor
suppressor
p53
Other
mutations
Loss of APC Mutation of K-ras and DCC Mutation of p53
FIGURE 18.16
The progression of mutations that commonly lead to colorectal cancer. The fatal metastasis is the last of six serial changes that the
epithelial cells lining the rectum undergo. One of these changes is brought about by mutation of a proto-oncogene, and three of them
involve mutations that inactivate tumor-suppressor genes.
0 10 20 30 40 50 60 70
80
0
25
50
75
100
200
300
400
500
Age at death (years)
Annual death rate
150
250
350
450
FIGURE 18.17
The annual death rate from cancer climbs with age. The rate
of cancer deaths increases steeply after age 40 and even more
steeply after age 60, suggesting that several independent mutations
must accumulate to give rise to cancer.
Smoking and Cancer
How can we prevent cancer? The most obvious strategy is
to minimize mutational insult. Anything that decreases ex-
posure to mutagens can decrease the incidence of cancer
because exposure has the potential to mutate a normal gene
into an oncogene. It is no accident that the most reliable
tests for the carcinogenicity of a substance are tests that
measure the substance’s mutagenicity.
The Association between Smoking and Cancer
About a third of all cases of cancer in the United States are
directly attributable to cigarette smoking. The association
between smoking and cancer is particularly striking for
lung cancer (figure 18.18). Studies of male smokers show a
highly positive correlation between the number of ciga-
rettes smoked per day and the incidence of lung cancer
(figure 18.19). For individuals who smoke two or more
packs a day, the risk of contracting lung cancer is at least 40
times greater than it is for nonsmokers, whose risk level ap-
proaches zero. Clearly, an effective way to avoid lung can-
cer is not to smoke. Other studies have shown a clear rela-
tionship between cigarette smoking and reduced life
expectancy (figure 18.20). Life insurance companies have
calculated that smoking a single cigarette lowers one’s life
expectancy by 10.7 minutes (longer than it takes to smoke
the cigarette)! Every pack of 20 cigarettes bears an unwrit-
ten label:
“The price of smoking this pack of cigarettes is 3
1
?2 hours
of your life.”
Smoking Introduces Mutagens to the Lungs
Over half a million people died of cancer in the United
States in 1999; about 28% of them died of lung cancer.
About 140,000 persons were diagnosed with lung cancer
each year in the 1980s. Around 90% of them died within
three years after diagnosis; 96% of them were cigarette
smokers.
Smoking is a popular pastime. In the United States, 24%
of the population smokes, and U.S. smokers consumed over
450 billion cigarettes in 1999. The smoke emitted from
these cigarettes contains some 3000 chemical components,
including vinyl chloride, benzo[a]pyrenes, and nitroso-nor-
nicotine, all potent mutagens. Smoking places these muta-
gens into direct contact with the tissues of the lungs.
Mutagens in the Lung Cause Cancer
Introducing powerful mutagens to the lungs causes consid-
erable damage to the genes of the epithelial cells that line
the lungs and are directly exposed to the chemicals. Among
the genes that are mutated as a result are some whose nor-
mal function is to regulate cell proliferation. When these
genes are damaged, lung cancer results.
376 Part V Molecular Genetics
FIGURE 18.18
Photo of a cancerous human lung. The bottom half of the lung
is normal, while a cancerous tumor has completely taken over the
top half. The cancer cells will eventually break through into the
lymph and blood vessels and spread through the body.
Cigarettes smoked per day
Incidence of cancer per 100,000 men
10
0
100
200
300
400
500
20 30 40
FIGURE 18.19
Smoking causes cancer. The annual incidence of lung cancer per
100,000 men clearly increases with the number of cigarettes
smoked per day.
This process has been clearly demonstrated for
benzo[a]pyrene (BP), one of the potent mutagens released
into cigarette smoke from tars in the tobacco. The epithe-
lial cells of the lung absorb BP from tobacco smoke and
chemically alter it to a derivative form. This derivative
form, benzo[a]pyrene-diolepoxide (BPDE), binds directly
to the tumor-suppressor gene p53 and mutates it to an in-
active form. The protein encoded by p53 oversees the G
1
cell cycle checkpoint described in chapter 11 and is one of
the body’s key mechanisms for preventing uncontrolled cell
proliferation. The destruction of p53 in lung epithelial cells
greatly hastens the onset of lung cancer—p53 is mutated to
an inactive form in over 70% of lung cancers. When exam-
ined, the p53 mutations in cancer cells almost all occur at
one of three “hot spots.” The key evidence linking smoking
and cancer is that when the mutations of p53 caused by
BPDE from cigarettes are examined, they occur at the
same three specific “hot spots!”
The Incidence of Cancer Reflects Smoking
Cigarette manufacturers argue that the causal connection
between smoking and cancer has not been proved, and
that somehow the relationship is coincidental. Look care-
fully at the data presented in figure 18.21 and see if you
agree. The upper graph, compiled from data on American
men, shows the incidence of smoking from 1900 to 1990
and the incidence of lung cancer over the same period.
Note that as late as 1920, lung cancer was a rare disease.
About 20 years after the incidence of smoking began to
increase among men, lung cancer also started to become
more common.
Now look at the lower graph, which presents data on
American women. Because of social mores, significant
numbers of American women did not smoke until after
World War II, when many social conventions changed. As
late as 1963, when lung cancer among males was near cur-
rent levels, this disease was still rare in women. In the
United States that year, only 6588 women died of lung can-
cer. But as more women smoked, more developed lung
cancer, again with a lag of about 20 years. American
women today have achieved equality with men in the num-
bers of cigarettes they smoke, and their lung cancer death
rates are today approaching those for men. In 1990, more
than 49,000 women died of lung cancer in the United
States. The current annual rate of deaths from lung cancer
in male and female smokers is 180 per 100,000, or about 2
out of every 1000 smokers each year.
The easiest way to avoid cancer is to avoid exposure to
mutagens. The single greatest contribution one can
make to a longer life is not to smoke.
Chapter 18 Altering the Genetic Message 377
40
0
20
40
60
80
100
Age
Percentage alive
Never smoked regularly
1–14 cigarettes a day
15–24 cigarettes a day
25 or more a day
55 70 85
FIGURE 18.20
Tobacco reduces life expectancy. The world’s longest-running
survey of smoking, begun in 1951 in Britain, revealed that by 1994
the death rate for smokers had climbed to three times the rate for
nonsmokers among men 35 to 69 years of age.
Source: Data from New Scientist, October 15, 1994.
0
1000
2000
3000
4000
5000
0
20
40
60
80
100
0
1000
2000
3000
4000
5000
0
20
40
60
80
100
Cigarettes smoked per capita per year
Incidence of lung cancer (per 100,000 per year)
1900 1920 1940 1960 1980 1990
1900 1920 1940 1960 1980 1990
Men
Women
Lung
cancer
Lung
cancer
Smoking
Smoking
FIGURE 18.21
The incidence of lung cancer in men and women. What do
these graphs indicate about the connection between smoking and
lung cancer?
Curing Cancer
Potential cancer therapies are being developed on many
fronts (figure 18.22). Some act to prevent the start of can-
cer within cells. Others act outside cancer cells, preventing
tumors from growing and spreading.
Preventing the Start of Cancer
Many promising cancer therapies act within potential can-
cer cells, focusing on different stages of the cell’s “Shall I
divide?” decision-making process.
1. Receiving the Signal to Divide. The first step in the
decision process is the reception of a “divide” signal, usu-
ally a small protein called a growth factor released from a
neighboring cell. The growth factor is received by a pro-
tein receptor on the cell surface. Mutations that increase
the number of receptors on the cell surface amplify the di-
vision signal and so lead to cancer. Over 20% of breast can-
cer tumors prove to overproduce a protein called HER2 as-
sociated with the receptor for epidermal growth factor.
Therapies directed at this stage of the decision process
utilize the human immune system to attack cancer cells.
Special protein molecules called “monoclonal antibodies,”
created by genetic engineering, are the therapeutic agents.
These monoclonal antibodies are designed to seek out and
stick to HER2. Like waving a red flag, the presence of the
monoclonal antibody calls down attack by the immune sys-
tem on the HER2 cell. Because breast cancer cells overpro-
duce HER2, they are killed preferentially. Genentech’s re-
cently approved monoclonal antibody, called “herceptin,”
has given promising results in clinical tests. In other tests,
the monoclonal antibody C225, directed against epidermal
growth factor receptors, has succeeded in curing advanced
colon cancer. Clinical trials of C225 have begun.
2. The Relay Switch. The second step in the decision
process is the passage of the signal into the cell’s interior,
the cytoplasm. This is carried out in normal cells by a pro-
tein called Ras that acts as a relay switch. When growth
factor binds to a receptor like EGF, the adjacent Ras pro-
tein acts like it has been “goosed,” contorting into a new
shape. This new shape is chemically active, and initiates a
chain of reactions that passes the “divide” signal inward to-
ward the nucleus. Mutated forms of the Ras protein behave
like a relay switch stuck in the “ON” position, continually
instructing the cell to divide when it should not. 30% of all
cancers have a mutant form of Ras.
Therapies directed at this stage of the decision process
take advantage of the fact that normal Ras proteins are in-
active when made. Only after it has been modified by the
special enzyme farnesyl transferase does Ras protein become
able to function as a relay switch. In tests on animals, farne-
syl transferase inhibitors induce the regression of tumors
and prevent the formation of new ones.
3. Amplifying the Signal. The third step in the decision
process is the amplification of the signal within the cyto-
plasm. Just as a TV signal needs to be amplified in order to
be received at a distance, so a “divide” signal must be am-
plified if it is to reach the nucleus at the interior of the cell,
a very long journey at a molecular scale. Cells use an inge-
nious trick to amplify the signal. Ras, when “ON,” activates
an enzyme, a protein kinase. This protein kinase activates
other protein kinases that in their turn activate still others.
The trick is that once a protein kinase enzyme is activated,
it goes to work like a demon, activating hoards of others
every second! And each and every one it activates behaves
the same way too, activating still more, in a cascade of ever-
widening effect. At each stage of the relay, the signal is am-
plified a thousand-fold. Mutations stimulating any of the
protein kinases can dangerously increase the already ampli-
fied signal and lead to cancer. Five percent of all cancers,
for example, have a mutant hyperactive form of the protein
kinase Src.
Therapies directed at this stage of the decision process
employ so-called “anti-sense RNA” directed specifically
against Src or other cancer-inducing kinase mutations. The
idea is that the src gene uses a complementary copy of itself
to manufacture the Src protein (the “sense” RNA or mes-
senger RNA), and a mirror image complementary copy of
the sense RNA (“anti-sense RNA”) will stick to it, gum-
ming it up so it can’t be used to make Src protein. The ap-
proach appears promising. In tissue culture, anti-sense
RNAs inhibit the growth of cancer cells, and some also ap-
pear to block the growth of human tumors implanted in
laboratory animals. Human clinical trials are underway.
4. Releasing the Brake. The fourth step in the decision
process is the removal of the “brake” the cell uses to re-
strain cell division. In healthy cells this brake, a tumor sup-
pressor protein called Rb, blocks the activity of a transcrip-
tion factor protein called E2F. When free, E2F enables the
cell to copy its DNA. Normal cell division is triggered to
begin when Rb is inhibited, unleashing E2F. Mutations
which destroy Rb release E2F from its control completely,
leading to ceaseless cell division. Forty percent of all can-
cers have a defective form of Rb.
Therapies directed at this stage of the decision process
are only now being attempted. They focus on drugs able to
inhibit E2F, which should halt the growth of tumors aris-
ing from inactive Rb. Experiments in mice in which the
E2F genes have been destroyed provide a model system to
study such drugs, which are being actively investigated.
5. Checking That Everything Is Ready. The fifth step in
the decision process is the mechanism used by the cell to en-
sure that its DNA is undamaged and ready to divide. This job
is carried out in healthy cells by the tumor-suppressor protein
p53, which inspects the integrity of the DNA. When it de-
tects damaged or foreign DNA, p53 stops cell division and
activates the cell’s DNA repair systems. If the damage doesn’t
378 Part V Molecular Genetics
get repaired in a reasonable time, p53 pulls the plug, trigger-
ing events that kill the cell. In this way, mutations such as
those that cause cancer are either repaired or the cells con-
taining them eliminated. If p53 is itself destroyed by muta-
tion, future damage accumulates unrepaired. Among this
damage are mutations that lead to cancer. Fifty percent of all
cancers have a disabled p53. Fully 70 to 80% of lung cancers
have a mutant inactive p53—the chemical benzo[a]pyrene in
cigarette smoke is a potent mutagen of p53.
A promising new therapy using adenovirus (responsible
for mild colds) is being targeted at cancers with a mutant
p53. To grow in a host cell, adenovirus must use the prod-
uct of its gene E1B to block the host cell’s p53, thereby en-
abling replication of the adenovirus DNA. This means that
while mutant adenovirus without E1B cannot grow in
healthy cells, the mutants should be able to grow in, and
destroy, cancer cells with defective p53. When human
colon and lung cancer cells are introduced into mice lack-
ing an immune system and allowed to produce substantial
tumors, 60% of the tumors simply disappear when treated
with E1B-deficient adenovirus, and do not reappear later.
Initial clinical trials are less encouraging, as many people
possess antibodies to adenovirus.
6. Stepping on the Gas. Cell division starts with replica-
tion of the DNA. In healthy cells, another tumor suppressor
“keeps the gas tank nearly empty” for the DNA replication
process by inhibiting production of an enzyme called telom-
erase. Without this enzyme, a cell’s chromosomes lose ma-
terial from their tips, called telomeres. Every time a chro-
mosome is copied, more tip material is lost. After some
thirty divisions, so much is lost that copying is no longer
possible. Cells in the tissues of an adult human have typi-
cally undergone twenty five or more divisions. Cancer can’t
get very far with only the five remaining cell divisions, so
inhibiting telomerase is a very effective natural break on the
cancer process. It is thought that almost all cancers involve a
mutation that destroys the telomerase inhibitor, releasing
this break and making cancer possible. It should be possible
to block cancer by reapplying this inhibition. Cancer thera-
pies that inhibit telomerase are just beginning clinical trials.
Preventing the Spread of Cancer
7. Tumor Growth. Once a cell begins cancerous growth,
it forms an expanding tumor. As the tumor grows ever-
larger, it requires an increasing supply of food and nutri-
ents, obtained from the body’s blood supply. To facilitate
this necessary grocery shopping, tumors leak out sub-
stances into the surrounding tissues that encourage angio-
genesis, the formation of small blood vessels. Chemicals
that inhibit this process are called angiogenesis inhibitors.
In mice, two such angiogenesis inhibitors, angiostatin and
endostatin, caused tumors to regress to microscopic size.
This very exciting result has proven controversial, but ini-
tial human trials seem promising.
8. Metastasis. If cancerous tumors simply continued to
grow where they form, many could be surgically removed,
and far fewer would prove fatal. Unfortunately, many can-
cerous tumors eventually metastasize, individual cancer
cells breaking their moorings to the extracellular matrix
and spreading to other locations in the body where they ini-
tiate formation of secondary tumors. This process involves
metal-requiring protease enzymes that cleave the cell-ma-
trix linkage, components of the extracellular matrix such as
fibronectin that also promote the migration of several non-
cancerous cell types, and RhoC, a GTP-hydrolyzing en-
zyme that promotes cell migration by providing needed
GTP. All of these components offer promising targets for
future anti-cancer therapy.
Therapies such as those described here are only part of a
wave of potential treatments under development and clini-
cal trial. The clinical trials will take years to complete, but
in the coming decade we can expect cancer to become a
curable disease.
Understanding of how mutations produce cancer has
progressed to the point where promising potential
therapies can be tested.
Chapter 18 Altering the Genetic Message 379
Cell
surface
protein
Nucleus
Cell
Amplifying
enzyme
Extracellular matrix
Capillary
network
Angiogenesis
Division
occurs
Cell migration
1
2
3
4
65
7
8
FIGURE 18.22
New molecular therapies for cancer target eight different
stages in the cancer process. (1) On the cell surface, a growth
factor signals the cell to divide. (2) Just inside the cell, a protein
relay switch passes on the divide signal. (3) In the cytoplasm,
enzymes amplify the signal. In the nucleus, (4) a “brake”
preventing DNA replication is released, (5) proteins check that
the replicated DNA is not damaged, and (6) other proteins rebuild
chromosome tips so DNA can replicate. (7) The new tumor
promotes angiogenesis, the formation of growth-promoting blood
vessels. (8) Some cancer cells break away from the extracellular
matrix and invade other parts of the body.
An Overview of Recombination
Mutation is a change in the content of an organism’s genetic
message, but it is not the only source of genetic diversity.
Diversity is also generated when existing elements of the
genetic message move around within the genome. As an
analogy, consider the pages of this book. A point mutation
would correspond to a change in one or more of the letters
on the pages. For example, “ . . . in one or more of the let-
ters of the pages” is a mutation of the previous sentence, in
which an “n” is changed to an “f.” A significant alteration is
also achieved, however, when we move the position of
words, as in “ . . . in one or more of the pages on the let-
ters.” The change alters (and destroys) the meaning of the
sentence by exchanging the position of the words “letters”
and “pages.” This second kind of change, which represents
an alteration in the genomic location of a gene or a fragment
of a gene, demonstrates genetic recombination.
Gene Transfer
Viewed broadly, genetic recombination can occur by two
mechanisms (table 18.5). In gene transfer, one chromo-
some or genome donates a segment to another chromo-
some or genome. The transfer of genes from the human
immunodeficiency virus (HIV) to a human chromosome is
an example of gene transfer. Because gene transfer occurs
in both prokaryotes and eukaryotes, it is thought to be the
more primitive of the two mechanisms.
Reciprocal Recombination
Reciprocal recombination is when
two chromosomes trade segments. It is
exemplified by the crossing over that
occurs between homologous chromo-
somes during meiosis. Independent as-
sortment during meiosis is another
form of reciprocal recombination. Dis-
cussed in chapters 12 and 13, it is re-
sponsible for the 9:3:3:1 ratio of pheno-
types in a dihybrid cross and occurs
only in eukaryotes.
Genetic recombination is a change
in the genomic association among
genes. It often involves a change in
the position of a gene or portion of
a gene. Recombination of this sort
may result from one-way gene
transfer or reciprocal gene
exchange.
380 Part V Molecular Genetics
Table 18.5 Classes of Genetic Recombination
Class Occurrence
GENE TRANSFERS
Conjugation Occurs predominantly but not exclusively in bacteria
and is targeted to specific locations in the genome
Transposition Common in both bacteria and eukaryotes; genes move
to new genomic locations, apparently at random
RECIPROCAL RECOMBINATIONS
Crossing over Requires the pairing of homologous chromosomes and
may occur anywhere along their length
Unequal crossing over The result of crossing over between mismatched
segments; leads to gene duplication and deletion
Gene conversion Occurs when homologous chromosomes pair and one is
“corrected” to resemble the other
Independent assortment Haploid cells produced by meiosis contain only one
randomly selected member of each pair of homologous
chromosomes
18.3 Recombination alters gene location.
FIGURE 18.23
A Nobel Prize for discovering gene transfer by transposition.
Barbara McClintock receiving her Nobel Prize in 1983.
Gene Transfer
Genes are not fixed in their locations on
chromosomes or the circular DNA mole-
cules of bacteria; they can move around.
Some genes move because they are part of
small, circular, extrachromosomal DNA
segments called plasmids. Plasmids enter
and leave the main genome at specific places
where a nucleotide sequence matches one
present on the plasmid. Plasmids occur pri-
marily in bacteria, in which the main ge-
nomic DNA can interact readily with other
DNA fragments. About 5% of the DNA
that occurs in a bacterium is plasmid DNA.
Some plasmids are very small, containing
only one or a few genes, while others are
quite complex and contain many genes.
Other genes move within transposons,
which jump from one genomic position to
another at random in both bacteria and eu-
karyotes.
Gene transfer by plasmid movement was
discovered by Joshua Lederberg and Edward
Tatum in 1947. Three years later, trans-
posons were discovered by Barbara McClin-
tock. However, her work implied that the
position of genes in a genome need not be
constant. Researchers accustomed to viewing
genes as fixed entities, like beads on a string,
did not readily accept the idea of trans-
posons. Therefore, while Lederberg and
Tatum were awarded a Nobel Prize for their
discovery in 1958, McClintock did not re-
ceive the same recognition for hers until
1983 (figure 18.23).
Plasmid Creation
To understand how plasmids arise, consider a hypotheti-
cal stretch of bacterial DNA that contains two copies of
the same nucleotide sequence. It is possible for the two
copies to base-pair with each other and create a transient
“loop,” or double duplex. All cells have recombination
enzymes that can cause such double duplexes to undergo
a reciprocal exchange, in which they exchange strands.
As a result of the exchange, the loop is freed from the
rest of the DNA molecule and becomes a plasmid (figure
18.24, steps 1–3). Any genes between the duplicated se-
quences (such as gene A in figure 18.24) are transferred
to the plasmid.
Once a plasmid has been created by reciprocal exchange,
DNA polymerase will replicate it if it contains a replication
origin, often without the controls that restrict the main
genome to one replication per cell division. Consequently,
some plasmids may be present in multiple copies, others in
just a few copies, in a given cell.
Integration
A plasmid created by recombination can reenter the main
genome the same way it left. Sometimes the region of the
plasmid DNA that was involved in the original exchange,
called the recognition site, aligns with a matching se-
quence on the main genome. If a recombination event oc-
curs anywhere in the region of alignment, the plasmid will
integrate into the genome (figure 18.24, steps 4–6). Inte-
gration can occur wherever any shared sequences exist, so
plasmids may be integrated into the main genome at posi-
tions other than the one from which they arose. If a plas-
mid is integrated at a new position, it transfers its genes to
that new position.
Transposons and plasmids transfer genes to new
locations on chromosomes. Plasmids can arise from and
integrate back into a genome wherever DNA sequences
in the genome and in the plasmid match.
Chapter 18 Altering the Genetic Message 381
4
Integration
Plasmid
D BH11032
CH11032
C
DH11032 B
A
BH11032 D
CH11032
CDH11032 B
B
3
1
2
Homologous
pairing
Bacterial
chromosome
DH11032
CH11032 C
BH11032 DA
A
Homologous
pairing
Excision
Excision Integration
6
5
FIGURE 18.24
Integration and excision of a plasmid. Because the ends of the two sequences in
the bacterial genome are the same (D′, C′, B′, and D, C, B), it is possible for the two
ends to pair. Steps 1–3 show the sequence of events if the strands exchange during
the pairing. The result is excision of the loop and a free circle of DNA—a plasmid.
Steps 4–6 show the sequence when a plasmid integrates itself into a bacterial
genome.
Gene Transfer by Conjugation
One of the startling discoveries Lederberg and Tatum
made was that plasmids can pass from one bacterium to an-
other. The plasmid they studied was part of the genome of
Escherichia coli. It was given the name F for fertility factor
because only cells which had that plasmid integrated into
their DNA could act as plasmid donors. These cells are
called Hfr cells (for “high-frequency recombination”). The
F plasmid contains a DNA replication origin and several
genes that promote its transfer to other cells. These genes
encode protein subunits that assemble on the surface of the
bacterial cell, forming a hollow tube called a pilus.
When the pilus of one cell (F
+
) contacts the surface of
another cell that lacks a pilus, and therefore does not con-
tain an F plasmid (F
–
), the pilus draws the two cells close
together so that DNA can be exchanged (figure 18.25).
First, the F plasmid binds to a site on the interior of the F
+
cell just beneath the pilus. Then, by a process called
rolling-circle replication, the F plasmid begins to copy its
DNA at the binding point. As it is replicated, the single-
stranded copy of the plasmid passes into the other cell.
There a complementary strand is added, creating a new,
stable F plasmid (figure 18.26). In this way, genes are
passed from one bacterium to another. This transfer of
genes between bacteria is called conjugation.
In an Hfr cell, with the F plasmid integrated into the
main bacterial genome rather than free in the cytoplasm,
the F plasmid can still organize the transfer of genes. In
this case, the integrated F region binds beneath the pilus
and initiates the replication of the bacterial genome, transfer-
ring the newly replicated portion to the recipient cell.
Transfer proceeds as if the bacterial genome were simply a
part of the F plasmid. By studying this phenomenon, re-
searchers have been able to locate the positions of different
genes in bacterial genomes (figure 18.27).
Gene Transfer by Transposition
Like plasmids, transposons (figure 18.28) move from one
genomic location to another. After spending many genera-
tions in one position, a transposon may abruptly move to a
new position in the genome, carrying various genes along
with it. Transposons encode an enzyme called trans-
posase, that inserts the transposon into the genome (figure
18.29). Because this enzyme usually does not recognize any
particular sequence on the genome, transposons appear to
move to random destinations.
The movement of any given transposon is relatively
rare: it may occur perhaps once in 100,000 cell generations.
Although low, this rate is still about 10 times as frequent as
382 Part V Molecular Genetics
FIGURE 18.25
Contact by a pilus. The pilus of an F
+
cell connects to an F
-
cell
and draws the two cells close together so that DNA transfer can
occur.
F
+
(donor cell)
F
-
(recipient cell)
F Plasmid
Bacterial
chromosome
Conjugation
bridge
FIGURE 18.26
Gene transfer between bacteria. Donor cells (F
+
) contain an F plasmid that recipient cells (F
–
) lack. The F plasmid replicates itself and
transfers the copy across a conjugation bridge. The remaining strand of the plasmid serves as a template to build a replacement. When the
single strand enters the recipient cell, it serves as a template to assemble a double-stranded plasmid. When the process is complete, both
cells contain a complete copy of the plasmid.
the rate at which random mutational changes occur. Fur-
thermore, there are many transposons in most cells. Hence,
over long periods of time, transposition can have an enor-
mous evolutionary impact.
One way this impact can be felt is through mutation.
The insertion of a transposon into a gene often destroys
the gene’s function, resulting in what is termed insertional
inactivation. This phenomenon is thought to be the cause
of a significant number of the spontaneous mutations ob-
served in nature.
Transposition can also facilitate gene mobilization,
the bringing together in one place of genes that are usu-
ally located at different positions in the genome. In bacte-
ria, for example, a number of genes encode enzymes that
make the bacteria resistant to antibiotics such as peni-
cillin, and many of these genes are located on plasmids.
The simultaneous exposure of bacteria to multiple antibi-
otics, a common medical practice some years ago, favors
the persistence of plasmids that have managed to acquire
several resistance genes. Transposition can rapidly gener-
ate such composite plasmids, called resistance transfer
factors (RTFs), by moving antibiotic resistance genes
from several plasmids to one. Bacteria possessing RTFs
are thus able to survive treatment with a wide variety of
antibiotics. RTFs are thought to be responsible for much
of the recent difficulty in treating hospital-engendered
Staphylococcus aureus infections and the new drug-resistant
strains of tuberculosis.
Plasmids transfer copies of bacterial genes (and even
entire genomes) from one bacterium to another.
Transposition is the one-way transfer of genes to a
randomly selected location in the genome. The genes
move because they are associated with mobile genetic
elements called transposons.
Chapter 18 Altering the Genetic Message 383
Plasmid
Transposon
FIGURE 18.28
Transposon. Transposons
form characteristic stem-and-
loop structures called
“lollipops” because their two
ends have the same
nucleotide sequence as
inverted repeats. These ends
pair together to form the
stem of the lollipop.
Transposon
Transposase
FIGURE 18.29
Transposition. Transposase does not recognize any particular
DNA sequence; rather, it selects one at random, moving the
transposon to a random location. Some transposons leave a copy
of themselves behind when they move.
Map of
E. coli
genome
leu
azi
ton
lac
gal
tyr-cys
his
ade
ser-gly
xyl
met-B
12
thi
Direction
of
transfer
azi
0 min 10 min 20 min 25 min
ton
Time elapsed from beginning of
conjugation until interruption
(a)
(b)
lac gal thr
R
arg
FIGURE 18.27
A conjugation map of the E. coli chromosome. Scientists have
been able to break the Escherichia coli conjugation bridges by
agitating the cell suspension rapidly in a blender. By agitating at
different intervals after the start of conjugation, investigators can
locate the positions of various genes along the bacterial genome. (a)
The closer the genes are to the origin of replication, the sooner one
has to turn on the blender to block their transfer.
(b) Map of the E. coli genome developed using this method.
Reciprocal Recombination
In the second major mechanism for producing genetic re-
combination, reciprocal recombination, two homologous
chromosomes exchange all or part of themselves during the
process of meiosis.
Crossing Over
As we saw in chapter 12, crossing over occurs in the first
prophase of meiosis, when two homologous chromosomes
line up side by side within the synaptonemal complex. At
this point, the homologues exchange DNA strands at one
or more locations. This exchange of strands can produce
chromosomes with new combinations of alleles.
Imagine, for example, that a giraffe has genes encoding
neck length and leg length at two different loci on one of
its chromosomes. Imagine further that a recessive mutation
occurs at the neck length locus, leading after several rounds
of independent assortment to some individuals that are ho-
mozygous for a variant “long-neck” allele. Similarly, a re-
cessive mutation at the leg length locus leads to homozy-
gous “long-leg” individuals.
It is very unlikely that these two mutations would arise
at the same time in the same individual because the prob-
ability of two independent events occurring together is
the product of their individual probabilities. If the spon-
taneous occurrence of both mutations in a single individ-
ual were the only way to produce a giraffe with both a
long neck and long legs, it would be extremely unlikely
that such an individual would ever occur. Because of re-
combination, however, a crossover in the interval be-
tween the two genes could in one meiosis produce a
chromosome bearing both variant alleles. This ability to
reshuffle gene combinations rapidly is what makes re-
combination so important to the production of natural
variation.
Unequal Crossing Over
Reciprocal recombination can occur in any region along
two homologous chromosomes with sequences similar
enough to permit close pairing. Mistakes in pairing occa-
sionally happen when several copies of a sequence exist in
different locations on a chromosome. In such cases, one
copy of a sequence may line up with one of the duplicate
copies instead of with its homologous copy. Such misalign-
ment causes slipped mispairing, which, as we discussed ear-
lier, can lead to small deletions and frame-shift mutations.
If a crossover occurs in the pairing region, it will result in
unequal crossing over because the two homologues will ex-
change segments of unequal length.
In unequal crossing over, one chromosome gains extra
copies of the multicopy sequences, while the other chro-
mosome loses them (figure 18.30). This process can gener-
ate a chromosome with hundreds of copies of a particular
gene, lined up side by side in tandem array.
Because the genomes of most eukaryotes possess mul-
tiple copies of transposons scattered throughout the
chromosomes, unequal crossing over between copies of
transposons located in different positions has had a pro-
found influence on gene organization in eukaryotes. As
we shall see later, most of the genes of eukaryotes appear
to have been duplicated one or more times during their
evolution.
Gene Conversion
Because the two homologues that pair within a synaptone-
mal complex are not identical, some nucleotides in one ho-
mologue are not complementary to their counterpart in the
other homologue with which it is paired. These occasional
nonmatching pairs of nucleotides are called mismatch
pairs.
As you might expect, the cell’s error-correcting machin-
ery is able to detect mismatch pairs. If a mismatch is de-
tected during meiosis, the enzymes that “proofread” new
DNA strands during DNA replication correct it. The mis-
matched nucleotide in one of the homologues is excised
and replaced with a nucleotide complementary to the one
in the other homologue. Its base-pairing partner in the first
homologue is then replaced, producing two chromosomes
with the same sequence. This error correction causes one
of the mismatched sequences to convert into the other, a
process called gene conversion.
Unequal crossing over is a crossover between
chromosomal regions that are similar in nucleotide
sequence but are not homologous. Gene conversion is
the alteration of one homologue by the cell’s error-
detection and repair system to make it resemble the
other homologue.
384 Part V Molecular Genetics
16 Gene copies
16 Gene copies
27 Gene copies
5 Gene copies
FIGURE 18.30
Unequal crossing over. When a repeated sequence pairs out of
register, a crossover within the region will produce one
chromosome with fewer gene copies and one with more. Much of
the gene duplication that has occurred in eukaryotic evolution
may well be the result of unequal crossing over.
Trinucleotide Repeats
In 1991, a new kind of change in the genetic material was
reported, one that involved neither changes in the identity
of nucleotides (mutation) nor changes in the position of
nucleotide sequences (recombination), but rather an in-
crease in the number of copies of repeated trinucleotide se-
quences. Called trinucleotide repeats, these changes ap-
pear to be the root cause of a surprisingly large number of
inherited human disorders.
The first examples of disorders resulting from the ex-
pansion of trinucleotide repeat sequences were reported in
individuals with fragile X syndrome (the most common form
of developmental disorder) and spinal muscular atrophy. In
both disorders, genes containing runs of repeated nu-
cleotide triplets (CGG in fragile X syndrome and CAG in
spinal muscular atrophy) exhibit large increases in copy
number. In individuals with fragile X syndrome, for exam-
ple, the CGG sequence is repeated hundreds of times (fig-
ure 18.31), whereas in normal individuals it repeats only
about 30 times.
Ten additional human genes are now known to have al-
leles with expanded trinucleotide repeats (figure 18.32).
Many (but not all) of these alleles are GC-rich. A few of the
alleles appear benign, but most are associated with herita-
ble disorders, including Huntington’s disease, myotonic
dystrophy, and a variety of neurological ataxias. In each
case, the expansion transmits as a dominant trait. Often the
repeats are found within the exons of their genes, but
sometimes, as in the case of fragile X syndrome, they are
located outside the coding segment. Furthermore, although
the repeat number is stably transmitted in normal families,
it shows marked instability once it has abnormally ex-
panded. Siblings often exhibit unique repeat lengths.
As the repeat number increases, disease severity tends to
increase in step. In fragile X syndrome, the CGG triplet
number first increases from the normal stable range of 5 to
55 times (the most common allele has 29 repeats) to an un-
stable number of repeats ranging from 50 to 200, with no
detectable effect. In offspring, the number increases
markedly, with copy numbers ranging from 200 to 1300,
with significant mental retardation (see figure 18.31). Simi-
larly, the normal allele for myotonic dystrophy has 5 GTC
repeats. Mildly affected individuals have about 50, and se-
verely affected individuals have up to 1000.
Trinucleotide repeats appear common in human genes,
but their function is unknown. Nor do we know the mech-
anism behind trinucleotide repeat expansion. It may in-
volve unequal crossing over, which can readily produce
copy-number expansion, or perhaps some sort of stutter in
the DNA polymerase when it encounters a run of triplets.
The fact that di- and tetranucleotide repeat expansions are
not found seems an important clue. Undoubtedly, further
examples of this remarkable class of genetic change will be
reported in the future. Considerable research is currently
focused on this extremely interesting area.
Many human genes contain runs of a trinucleotide
sequence. Their function is unknown, but if the copy
number expands, hereditary disorders often result.
Chapter 18 Altering the Genetic Message 385
Normal
allele
CGG
5–55
CGG repeats
CGGCGG
Pre-fragile X
allele
50–200
CGG repeats
Fragile X
allele
200–1300
CGG repeats
FIGURE 18.31
CGG repeats in fragile X alleles. The CGG triplet is repeated
approximately 30 times in normal alleles. Individuals with pre-
fragile X alleles show no detectable signs of the syndrome but do
have increased numbers of CGG repeats. In fragile X alleles, the
CGG triplet repeats hundreds of times.
CGG CAG CTGGAA
Fragile X syndrome
Fragile site 11B
Fragile XE syndrome
Spinal and bulbar muscular atrophy
Spinocerebellar ataxia type 1
Huntington's disease
Dentatorubral-pallidoluysian atrophy
Machado-Joseph disease
Myotonic dystrophyFriedreich's ataxia
Exon 1 Exon 2 Exon 3Intron 1 Intron 2
Repeated
trinucleotide
Condition
FIGURE 18.32
A hypothetical gene showing the locations and types of trinucleotide repeats associated with various human diseases. The CGG
repeats of fragile X syndrome, fragile XE syndrome, and fragile site 11B occur in the first exon of their respective genes. GAA repeats
characteristic of Friedreich’s ataxia exist in the first intron of its gene. The genes for five different diseases, including Huntington’s disease,
have CAG repeats within their second exons. Lastly, the myotonic dystrophy gene contains CTG repeats within the third exon.
Classes of Eukaryotic DNA
The two main mechanisms of genetic recombination, gene
transfer and reciprocal recombination, are directly respon-
sible for the architecture of the eukaryotic chromosome.
They determine where genes are located and how many
copies of each exist. To understand how recombination
shapes the genome, it is instructive to compare the effects
of recombination in bacteria and eukaryotes.
Comparing Bacterial and Eukaryotic DNA
Sequences
Bacterial genomes are relatively simple, containing genes
that almost always occur as single copies. Unequal crossing
over between repeated transposition elements in their cir-
cular DNA molecules tends to delete material, fostering the
maintenance of a minimum genome size (figure 18.33a).
For this reason, these genomes are very tightly packed,
with few or no noncoding nucleotides. Recall the efficient
use of space in the organization of the lac genes described
in chapter 16.
In eukaryotes, by contrast, the introduction of pairs of
homologous chromosomes (presumably because of their
importance in repairing breaks in double-stranded DNA)
has led to a radically different situation. Unequal crossing
over between homologous chromosomes tends to promote
the duplication of material rather than its reduction (figure
18.33b). Consequently, eukaryotic genomes have been in a
constant state of flux during the course of their evolution.
Multiple copies of genes have evolved, some of them subse-
quently diverging in sequence to become different genes,
which in turn have duplicated and diverged.
Six different classes of eukaryotic DNA sequences are
commonly recognized, based on the number of copies of
each (table 18.6).
Transposons
Transposons exist in multiple copies scattered about the
genome. In Drosophila, for example, more than 30 different
transposons are known, most of them present at 20 to 40
different sites throughout the genome. In all, the known
transposons of Drosophila account for perhaps 5% of its
DNA. Mammalian genomes contain fewer kinds of trans-
posons than the genomes of many other organisms, al-
though the transposons in mammals are repeated more
often. The family of human transposons called ALU ele-
ments, for example, typically occurs about 300,000 times in
each cell. Transposons are transcribed but appear to play
no functional role in the life of the cell. As noted earlier in
this chapter, many transposition events carry transposons
into the exon portions of genes, disrupting the function of
the protein specified by the gene transcript. These inser-
tional inactivations are thought to be responsible for many
naturally occurring mutations.
Tandem Clusters
A second class consists of DNA sequences that are repeated
many times, one copy following another in tandem array.
By transcribing all of the copies in these tandem clusters
simultaneously, a cell can rapidly obtain large amounts of
the product they encode. For example, the genes encoding
rRNA are present in several hundred copies in most eu-
karyotic cells. Because these clusters are active sites of
rRNA synthesis, they are readily visible in cytological
preparations, where they are called nucleolar organizer
regions. When transcription of the rRNA gene clusters
ceases during cell division, the nucleolus disappears from
view under the microscope, but it reappears when tran-
scription begins again.
The genes present in a tandem cluster are very similar in
sequence but not always identical; some may differ by one
386 Part V Molecular Genetics
18.4 Genomes are continually evolving.
Unequal crossing over within
a bacterial genome deletes
material
Lost
(a)
Unequal crossing over between
chromosomes adds material to
one and subtracts it from the other
(b)
X
X
FIGURE 18.33
Unequal crossing over has different consequences in bacteria
and eukaryotes. (a) Bacteria have a circular DNA molecule, and a
crossover between duplicate regions within the molecule deletes
the intervening material. (b) In eukaryotes, with two versions of
each chromosome, crossing over adds material to one
chromosome; thus, gene amplification occurs in that
chromosome.
or a few nucleotides. Each gene in the cluster is separated
from its neighbors by a short “spacer” sequence that is not
transcribed. Unlike the genes, the spacers in a cluster vary
considerably in sequence and in length.
Multigene Families
As we have learned more about the nucleotide sequences of
eukaryotic genomes, it has become apparent that many
genes exist as parts of multigene families, groups of re-
lated but distinctly different genes that often occur to-
gether in a cluster. Multigene families differ from tandem
clusters in that they contain far fewer genes (from three to
several hundred), and those genes differ much more from
one another than the genes in tandem clusters. Despite
their differences, the genes in a multigene family are clearly
related in their sequences, making it likely that they arose
from a single ancestral sequence through a series of un-
equal crossing over events. For example, studies of the evo-
lution of the hemoglobin multigene family indicate that the
ancestral globin gene is at least 800 million years old. By
the time modern fishes evolved, this ancestral gene had al-
ready duplicated, forming the α and β forms. Later, after
the evolutionary divergence of amphibians and reptiles,
these two globin gene forms moved apart on the chromo-
some; the mechanism of this movement is not known, but
it may have involved transposition. In mammals, two more
waves of duplication occurred to produce the array of 11
globin genes found in the human genome. Three of these
genes are silent, encoding nonfunctional proteins. Other
genes are expressed only during embryonic (ζ and ε) or
fetal (γ) development. Only four (δ, β, α
1
, and α
2
) encode
the polypeptides that make up adult human hemoglobin.
Satellite DNA
Some short nucleotide sequences are repeated several mil-
lion times in eukaryotic genomes. These sequences are col-
lectively called satellite DNA and occur outside the main
body of DNA. Almost all satellite DNA is either clustered
around the centromere or located near the ends of the
chromosomes, at the telomeres. These regions of the chro-
mosomes remain highly condensed, tightly coiled, and un-
transcribed throughout the cell cycle; this suggests that
satellite DNA may serve some sort of structural function,
such as initiating the pairing of homologous chromosomes
in meiosis. About 4% of the human genome consists of
satellite DNA.
Dispersed Pseudogenes
Silent copies of a gene, inactivated by mutation, are called
pseudogenes. Such mutations may affect the gene’s pro-
moter (see chapter 16), shift the reading frame of the gene,
or produce a small deletion. While some pseudogenes
occur within a multigene family cluster, others are widely
separated. The latter are called dispersed pseudogenes
because they are believed to have been dispersed from their
original position within a multigene family cluster. No one
suspected the existence of dispersed pseudogenes until a
few years ago, but they are now thought to be of major
evolutionary significance in eukaryotes.
Single-Copy Genes
Ever since eukaryotes appeared, processes such as unequal
crossing over between different copies of transposons have
repeatedly caused segments of chromosomes to duplicate,
and it appears that no portion of the genome has escaped
this phenomenon. The duplication of genes, followed by
the conversion of some of the copies into pseudogenes, has
probably been the major source of “new” genes during the
evolution of eukaryotes. As pseudogenes accumulate muta-
tional changes, a fortuitous combination of changes may
eventually result in an active gene encoding a protein with
different properties. When that new gene first arises, it is a
single-copy gene, but in time it, too, will be duplicated.
Thus, a single-copy gene is but one stage in the cycle of
duplication and divergence that has characterized the evo-
lution of the eukaryotic genome.
Gene sequences in eukaryotes vary greatly in copy
number, some occurring many thousands of times,
others only once. Many protein-encoding eukaryotic
genes occur in several nonidentical copies, some of
them not transcribed.
Chapter 18 Altering the Genetic Message 387
Table 18.6 Classes of DNA Sequences Found in Eukaryotes
Class Description
Transposons Thousands of copies scattered around the genome
Tandem clusters Clusters containing hundreds of nearly identical copies of a gene
Multigene families Clusters of a few to several hundred copies of related but distinctly different genes
Satellite DNA Short sequences present in millions of copies per genome
Dispersed pseudogenes Inactive members of a multigene family separated from other members of the family
Single-copy genes Genes that exist in only one copy in the genome
388 Part V Molecular Genetics
Chapter 18
Summary Questions Media Resources
18.1 Mutations are changes in the genetic message.
? A mutation is any change in the hereditary message.
? Mutations that change one or a few nucleotides are
called point mutations. They may arise as a result of
damage from ionizing or ultraviolet radiation,
chemical mutagens, or errors in pairing during DNA
replication.
1. What are pyrimidine dimers?
How do they form? How are
they repaired? What may
happen if they are not repaired?
2. Explain how slipped
mispairing can cause deletions
and frame-shift mutations.
? Cancer is a disease in which the regulatory controls
that normally restrain cell division are disrupted.
? A variety of environmental factors, including ionizing
radiation, chemical mutagens, and viruses, have been
implicated in causing cancer.
? The best way to avoid getting cancer is to avoid
exposure to mutagens, especially those in cigarette
smoke.
3. What is transfection? What
has it revealed about the genetic
basis of cancer?
4. About how many genes can be
mutated to cause cancer? Why
do most cancers require
mutations in multiple genes?
18.2 Cancer results from mutation of growth-regulating genes.
? Recombination is the creation of new gene
combinations. It includes changes in the position of
genes or fragments of genes as well as the exchange of
entire chromosomes during meiosis.
? Genes may be transferred between bacteria when
they are included within small circles of DNA called
plasmids.
? Transposition is the random movement of genes
within transposons to new locations in the genome. It
is responsible for many naturally occurring
mutations, as the insertion of a transposon into a
gene often inactivates the gene.
? Crossing over involves a physical exchange of genetic
material between homologous chromosomes during
the close pairing that occurs in meiosis. It may
produce chromosomes that have different
combinations of alleles.
5. What is genetic
recombination? What
mechanisms produce it? Which
of these mechanisms occurs in
prokaryotes, and which occurs in
eukaryotes?
6. What is a plasmid? What is a
transposon? How are plasmids
and transposons similar, and
how are they different?
7. What are mismatched pairs?
How are they corrected? What
effect does this correction have
on the genetic message?
18.3 Recombination alters gene location.
? Satellite sequences are short sequences of nucleotides
repeated millions of times.
? Tandem clusters are genes that occur in thousands of
copies grouped together at one or a few sites on a
chromosome. These genes encode products that are
required by the cell in large amounts.
? Multigene families consist of copies of genes
clustered at one site on a chromosome that diverge in
sequence more than the genes in a tandem cluster.
8. What kinds of genes exist in
multigene families? How are
these families thought to have
evolved?
9. What are pseudogenes? How
might they have been involved in
the evolution of single-copy
genes?
18.4 Genomes are continually evolving.
www.mhhe.com www.biocourse.com
? Mutations
? DNA repair
? Experiment:
Luria/Delbrück-
Mutations Occur in
Random
? Polymerase Chain
Reaction
? Student Research: Age
and Breast Cancer
On Science Articles:
? Understanding Cancer
? Evidence Links
Cigarette Smoking to
Lung Cancer
? Deadly Cancer is
Becoming More
Common
? Recombinant
DNA/Technology
? Experiments:
McClintock/Stern
? Student research:
DNA repair in fish
389
19
Gene Technology
Concept Outline
19.1 The ability to manipulate DNA has led to a new
genetics.
Restriction Endonucleases. Enzymes that cleave DNA
at specific sites allow DNA segments from different sources
to be spliced together.
Using Restriction Endonucleases to Manipulate Genes.
Fragments produced by cleaving DNA with restriction
endonucleases can be spliced into plasmids, which can be
used to insert the DNA into host cells.
19.2 Genetic engineering involves easily understood
procedures.
The Four Stages of a Genetic Engineering Experiment.
Gene engineers cut DNA into fragments that they splice
into vectors that carry the fragments into cells.
Working with Gene Clones. Gene technology is used in
a variety of procedures involving DNA manipulation.
19.3 Biotechnology is producing a scientific
revolution.
DNA Sequence Technology. The complete nucleotide
sequence of the genomes of many organisms are now
known. The unique DNA of every individual can be used to
identify sperm, blood, or other tissues.
Biochips. Biochips are squares of glass etched with DNA
strands and can be used for genetic screening.
Medical Applications. Many drugs and vaccines are now
produced with gene technology.
Agricultural Applications. Gene engineers have
developed crops resistant to pesticides and pests, as well as
commercially superior animals.
Cloning. Recent experiments show it is possible to clone
agricultural animals, a result with many implications for
both agriculture and society.
Stem Cells. Both embryonic stem cells and tissue-
specific stem cells can potentially be used to repair or
replace damaged tissue.
Ethics and Regulation. Genetic engineering raises
important questions about danger and privacy.
O
ver the past decades, the development of new and
powerful techniques for studying and manipulating
DNA has revolutionized genetics (figure 19.1). These tech-
niques have allowed biologists to intervene directly in the
genetic fate of organisms for the first time. In this chapter,
we will explore these technologies and consider how they
apply to specific problems of great practical importance.
Few areas of biology will have as great an impact on our fu-
ture lives.
FIGURE 19.1
A famous plasmid. The circular molecule in this electron
micrograph is pSC101, the first plasmid used successfully to clone
a vertebrate gene. Its name comes from the fact that it was the
one-hundred-and-first plasmid isolated by Stanley Cohen.
quences of nucleotides in DNA. These enzymes are the
basic tools of genetic engineering.
Discovery of Restriction Endonucleases
Scientific discoveries often have their origins in seemingly
unimportant observations that receive little attention by re-
searchers before their general significance is appreciated. In
the case of genetic engineering, the original observation
was that bacteria use enzymes to defend themselves against
viruses.
Most organisms eventually evolve means of defending
themselves from predators and parasites, and bacteria are
no exception. Among the natural enemies of bacteria are
bacteriophages, viruses that infect bacteria and multiply
within them. At some point, they cause the bacterial cells to
burst, releasing thousands more viruses. Through natural
selection, some types of bacteria have acquired powerful
weapons against these viruses: they contain enzymes called
restriction endonucleases that fragment the viral DNA as
soon as it enters the bacterial cell. Many restriction en-
donucleases recognize specific nucleotide sequences in a
DNA strand, bind to the DNA at those sequences, and
cleave the DNA at a particular place within the recognition
sequence.
Why don’t restriction endonucleases cleave the bacter-
ial cells’ own DNA as well as that of the viruses? The an-
swer to this question is that bacteria modify their own
DNA, using other enzymes known as methylases to add
methyl (—CH
3
) groups to some of the nucleotides in the
bacterial DNA. When nucleotides within a restriction en-
donuclease’s recognition sequence have been methylated,
the endonuclease cannot bind to that sequence. Conse-
quently, the bacterial DNA is protected from being de-
graded at that site. Viral DNA, on the other hand, has not
been methylated and therefore is not protected from enzy-
matic cleavage.
How Restriction Endonucleases Cut DNA
The sequences recognized by restriction endonucleases are
typically four to six nucleotides long, and they are often
palindromes. This means the nucleotides at one end of the
recognition sequence are complementary to those at the
other end, so that the two strands of the DNA duplex have
the same nucleotide sequence running in opposite direc-
tions for the length of the recognition sequence. Two im-
portant consequences arise from this arrangement of
nucleotides.
390 Part V Molecular Genetics
Restriction Endonucleases
In 1980, geneticists used the relatively new technique of
gene splicing, which we will describe in this chapter, to
introduce the human gene that encodes interferon into
a bacterial cell’s genome. Interferon is a rare blood pro-
tein that increases human resistance to viral infection,
and medical scientists have been interested in its possible
usefulness in cancer therapy. This possibility was diffi-
cult to investigate before 1980, however, because purifi-
cation of the large amounts of interferon required for
clinical testing would have been prohibitively expensive,
given interferon’s scarcity in the blood. An inexpensive
way to produce interferon was needed, and introducing
the gene responsible for its production into a bacterial
cell made that possible. The cell that had acquired the
human interferon gene proceeded to produce interferon
at a rapid rate, and to grow and divide. Soon there were
millions of interferon-producing bacteria in the culture,
all of them descendants of the cell that had originally re-
ceived the human interferon gene.
The Advent of Genetic Engineering
This procedure of producing a line of genetically identical
cells from a single altered cell, called cloning, made every
cell in the culture a miniature factory for producing inter-
feron. The human insulin gene has also been cloned in bac-
teria, and now large amounts of insulin, a hormone essen-
tial for treating some forms of diabetes, can be
manufactured at relatively little expense. Beyond these clin-
ical applications, cloning and related molecular techniques
are used to obtain basic information about how genes are
put together and regulated. The interferon experiment and
others like it marked the beginning of a new genetics, ge-
netic engineering.
The essence of genetic engineering is the ability to cut
DNA into recognizable pieces and rearrange those pieces
in different ways. In the interferon experiment, a piece of
DNA carrying the interferon gene was inserted into a plas-
mid, which then carried the gene into a bacterial cell. Most
other genetic engineering approaches have used the same
general strategy, bringing the gene of interest into the tar-
get cell by first incorporating it into a plasmid or an infec-
tive virus. To make these experiments work, one must be
able to cut the source DNA (human DNA in the interferon
experiment, for example) and the plasmid DNA in such a
way that the desired fragment of source DNA can be
spliced permanently into the plasmid. This cutting is per-
formed by enzymes that recognize and cleave specific se-
19.1 The ability to manipulate DNA has led to a new genetics.
First, because the same recognition
sequence occurs on both strands of the
DNA duplex, the restriction endonucle-
ase can bind to and cleave both strands,
effectively cutting the DNA in half.
This ability to cut across both strands is
almost certainly the reason that restric-
tion endonucleases have evolved to rec-
ognize nucleotide sequences with
twofold rotational symmetry.
Second, because the bond cleaved by
a restriction endonuclease is typically
not positioned in the center of the
recognition sequence to which it binds,
and because the DNA strands are an-
tiparallel, the cut sites for the two
strands of a duplex are offset from each
other (figure 19.2). After cleavage, each
DNA fragment has a single-stranded
end a few nucleotides long. The single-
stranded ends of the two fragments are
complementary to each other.
Why Restriction Endonucleases
Are So Useful
There are hundreds of bacterial restric-
tion endonucleases, and each one has a
specific recognition sequence. By
chance, a particular endonuclease’s
recognition sequence is likely to occur
somewhere in any given sample of
DNA; the shorter the sequence, the
more often it will arise by chance within
a sample. Therefore, a given restriction
endonuclease can probably cut DNA
from any source into fragments. Each
fragment will have complementary
single-stranded ends characteristic of
that endonuclease. Because of their
complementarity, these single-stranded
ends can pair with each other (conse-
quently, they are sometimes called
“sticky ends”). Once their ends have
paired, two fragments can then be
joined together with the aid of the en-
zyme DNA ligase, which re-forms the phosphodiester
bonds of DNA. What makes restriction endonucleases so
valuable for genetic engineering is the fact that any two frag-
ments produced by the same restriction endonuclease can be
joined together. Fragments of elephant and ostrich DNA
cleaved by the same endonuclease can be joined to one an-
other as readily as two bacterial DNA fragments.
Genetic engineering involves manipulating specific genes
by cutting and rearranging DNA. A restriction
endonuclease cleaves DNA at a specific site, generating in
most cases two fragments with short single-stranded ends.
Because these ends are complementary to each other, any
pair of fragments produced by the same endonuclease,
from any DNA source, can be joined together.
Chapter 19 Gene Technology 391
GAATTC
CTTAAG
GAATTC
AATTC
AATTC
AATTC
GAATTC
G
G
G
G
G
AA
TTC
G
CTTAAG
CTT
AA
G CTTAA
CTTAA
CTTAAG
DNA ligase
joins the strands.
DNA from another source
cut with the same restriction
endonuclease is added.
Restriction endonuclease
cleaves the DNA.
DNA
duplex
Sticky ends (complementary
single-stranded DNA tails)
Restriction sites
Recombinant DNA molecule
FIGURE 19.2
Many restriction endonucleases produce DNA fragments with “sticky ends.” The
restriction endonuclease EcoRI always cleaves the sequence GAATTC between G and A.
Because the same sequence occurs on both strands, both are cut. However, the two
sequences run in opposite directions on the two strands. As a result, single-stranded tails
are produced that are complementary to each other, or “sticky.”
Using Restriction
Endonucleases to
Manipulate Genes
A chimera is a mythical creature with the
head of a lion, body of a goat, and tail of
a serpent. Although no such creatures ex-
isted in nature, biologists have made
chimeras of a more modest kind through
genetic engineering.
Constructing pSC101
One of the first chimeras was manufac-
tured from a bacterial plasmid called a
resistance transfer factor by American
geneticists Stanley Cohen and Herbert
Boyer in 1973. Cohen and Boyer used a
restriction endonuclease called EcoRI,
which is obtained from Escherichia coli,
to cut the plasmid into fragments. One
fragment, 9000 nucleotides in length,
contained both the origin of replication
necessary for replicating the plasmid and
a gene that conferred resistance to the
antibiotic tetracycline (tet
r
). Because
both ends of this fragment were cut by
the same restriction endonuclease, they
could be ligated to form a circle, a
smaller plasmid Cohen dubbed pSC101
(figure 19.3).
Using pSC101 to Make Recombinant DNA
Cohen and Boyer also used EcoRI to cleave DNA that
coded for rRNA that they had isolated from an adult am-
phibian, the African clawed frog, Xenopus laevis. They
then mixed the fragments of Xenopus DNA with pSC101
plasmids that had been “reopened” by EcoRI and allowed
bacterial cells to take up DNA from the mixture. Some of
the bacterial cells immediately became resistant to tetra-
cycline, indicating that they had incorporated the pSC101
plasmid with its antibiotic-resistance gene. Furthermore,
some of these pSC101-containing bacteria also began to
produce frog ribosomal RNA! Cohen and Boyer con-
cluded that the frog rRNA gene must have been inserted
into the pSC101 plasmids in those bacteria. In other
words, the two ends of the pSC101 plasmid, produced by
cleavage with EcoRI, had joined to the two ends of a frog
DNA fragment that contained the rRNA gene, also
cleaved with EcoRI.
The pSC101 plasmid containing the frog rRNA gene is
a true chimera, an entirely new genome that never existed
in nature and never would have evolved by natural means.
It is a form of recombinant DNA—that is, DNA created
in the laboratory by joining together pieces of different
genomes to form a novel combination.
Other Vectors
The introduction of foreign DNA fragments into host cells
has become common in molecular genetics. The genome
that carries the foreign DNA into the host cell is called a
vector. Plasmids, with names like pUC18 can be induced
to make hundreds of copies of themselves and thus of the
foreign genes they contain. Much larger pieces of DNA can
be introduced using YAKs (yeast artificial chromosomes) as
a vector instead of a plasmid. Not all vectors have bacterial
targets. Animal viruses such as the human cold virus aden-
ovirus, for example, are serving as vectors to carry genes
into monkey and human cells, and animal genes have even
been introduced into plant cells.
One of the first recombinant genomes produced by
genetic engineering was a bacterial plasmid into which
an amphibian ribosomal RNA gene was inserted.
Viruses can also be used as vectors to insert foreign
DNA into host cells and create recombinant genomes.
392 Part V Molecular Genetics
Amphibian
DNA
Endonuclease EcoRI
rRNA gene
Recombinant
plasmid
Plasmid
pSC101
tet
r
gene
Cleaved plasmid
is combined with
amphibian fragment.
Cleave plasmid
pSC101 with
EcoRI.
Cleave amphibian
DNA with restriction
endonuclease EcoRI.
FIGURE 19.3
One of the first genetic engineering experiments. This diagram illustrates how
Cohen and Boyer inserted an amphibian gene encoding rRNA into pSC101. The
plasmid contains a single site cleaved by the restriction endonuclease EcoRI; it also
contains tet
r
, a gene which confers resistance to the antibiotic tetracycline. The rRNA-
encoding gene was inserted into pSC101 by cleaving the amphibian DNA and the
plasmid with EcoRI and allowing the complementary sequences to pair.
Examples of Gene
Manipulation
SUPER SALMON!
Canadian fisheries scientists have inserted recombinant growth hor-
mone genes into developing salmon embryos, creating the first trans-
genic salmon. Not only do these transgenic fish have shortened pro-
duction cycles, they are, on an average, 11 times heavier than
nontransgenic salmon! The implications for the fisheries industry and
for worldwide food production are obvious.
WILT-PROOF FLOWERS
Ethylene, the plant hormone that causes fruit to ripen, also causes
flowers to wilt. Researchers at Purdue have found the gene that
makes flower petals respond to ethylene by wilting and replaced it
with a gene insensitive to ethylene. The transgenic carnations they
produced lasted for 3 weeks after cutting, while normal carnations
last only 3 days.
HERMAN THE WONDER BULL
GenPharm, a California biotechnology company, engineered Herman,
a bull that possesses the gene for human lactoferrin (HLF). HLF con-
fers antibacterial and iron transport properties to humans. Many of
Herman’s female offspring now produce milk containing HLF, and
GenPharm intends to build a herd of transgenic cows for the large-
scale commercial production of HLF.
Chapter 19 Gene Technology 393
WEEVIL-PROOF
PEAS
Not only has gene tech-
nology afforded agricul-
ture viral and pest con-
trol in the field, it has
also provided a pest
control technique for the
storage bin. A team of
U.S. and Australian sci-
entists have engineered
a gene that is expressed
only in the seed of the
pea plant. The enzyme
inhibitor encoded by this
gene inhibits feeding by
weevils, one of the most
notorious pests affecting
stored crops. The world-
wide ramifications are
significant as up to 40%
of stored grains are lost
to pests.
394 Part V Molecular Genetics
The Four Stages of a Genetic
Engineering Experiment
Like the experiment of Cohen and Boyer, most genetic
engineering experiments consist of four stages: DNA
cleavage, production of recombinant DNA, cloning, and
screening.
Stage 1: DNA Cleavage
A restriction endonuclease is used to cleave the source
DNA into fragments. Because the endonuclease’s recog-
nition sequence is likely to occur many times within the
source DNA, cleavage will produce a large number of
different fragments. A different set of fragments will be
obtained by employing endonucleases that recognize dif-
ferent sequences. The fragments can be separated from
one another according to their size by electrophoresis
(figure 19.4).
Stage 2: Production of Recombinant DNA
The fragments of DNA are inserted into plasmids or viral
vectors, which have been cleaved with the same restriction
endonuclease as the source DNA.
19.2 Genetic engineering involves easily understood procedures.
Longer fragments
Shorter fragments
Mixture of DNA fragments of
different sizes in solution placed
at the top of "lanes" in the gel
Electric current applied, fragments migrate
down the gel by size—smaller ones move
faster (and therefore go farther) than larger
ones
Power
source
Completed gel
Gel
Glass
plates
Anode+
Cathode
DNA and
restriction
endonuclease
–
FIGURE 19.4
Gel electrophoresis. (a) After restriction endonucleases have cleaved the DNA, the fragments are loaded on a gel, and an electric current
is applied. The DNA fragments migrate through the gel, with bigger ones moving more slowly. The fragments can be visualized easily, as
the migrating bands fluoresce in UV light when stained with ethidium bromide. (b) In the photograph, one band of DNA has been excised
from the gel for further analysis and can be seen glowing in the tube the technician holds.
(a)
(b)
Stage 3: Cloning
The plasmids or viruses serve as vectors that can intro-
duce the DNA fragments into cells—usually, but not al-
ways, bacteria (figure 19.5). As each cell reproduces, it
forms a clone of cells that all contain the fragment-bearing
vector. Each clone is maintained separately, and all of
them together constitute a clone library of the original
source DNA.
Chapter 19 Gene Technology 395
+
Animal cell
DNA
Gene of
interest
Restriction
site
lacZH11032
gene
Nonfunctional
lacZH11032gene
amp
r
gene
E. coli
Plasmid
Stage 1: DNA from two sources
is isolated and cleaved with the
same restriction endonuclease.
Stage 2: The two types of
DNA can pair at their sticky
ends when mixed together;
DNA ligase joins the segments.
Stage 3: Plasmids are inserted into
bacterial cells by transformation;
bacterial cells reproduce and form
clones.
To stage 4: Clones are
screened for gene of interest.
Sticky
ends
Recombinant
DNA and plasmids
Restriction
endonuclease
cut sites
Clone 1 Clone 2 Clone 3
Part of a clone library
FIGURE 19.5
Stages in a genetic engineering experiment. In stage 1, DNA containing the gene of interest (in this case, from an animal cell) and
DNA from a plasmid are cleaved with the same restriction endonuclease. The genes amp
r
and lacZ' are contained within the plasmid and
used for screening a clone (stage 4). In stage 2, the two cleaved sources of DNA are mixed together and pair at their sticky ends. In stage 3,
the recombinant DNA is inserted into a bacterial cell, which reproduces and forms clones. In stage 4, the bacterial clones will be screened
for the gene of interest.
Stage 4: Screening
The clones containing a specific DNA fragment of interest,
often a fragment that includes a particular gene, are identi-
fied from the clone library. Let’s examine this stage in
more detail, as it is generally the most challenging in any
genetic engineering experiment.
4–I: The Preliminary Screening of Clones. Investiga-
tors initially try to eliminate from the library any clones
that do not contain vectors, as well as clones whose vectors
do not contain fragments of the source DNA. The first cat-
egory of clones can be eliminated by employing a vector
with a gene that confers resistance to a specific antibiotic,
such as tetracycline, penicillin, or ampicillin. In figure
19.6a, the gene amp
r
is incorporated into the plasmid and
confers resistance to the antibiotic ampicillin. When the
clones are exposed to a medium containing that antibiotic,
only clones that contain the vector will be resistant to the
antibiotic and able to grow.
One way to eliminate clones with vectors that do not
have an inserted DNA fragment is to use a vector that, in
addition to containing antibiotic resistance genes, contains
the lacZ' gene which is required to produce β-galactosidase,
an enzyme that enables the cells to metabolize the sugar,
X-gal. Metabolism of X-gal results in the formation of a
blue reaction product, so any cells whose vectors contain a
functional version of this gene will turn blue in the pres-
ence of X-gal (figure 19.6b). However, if one uses a restric-
tion endonuclease whose recognition sequence lies within
the lacZ' gene, the gene will be interrupted when recombi-
nants are formed, and the cell will be unable to metabolize
X-gal. Therefore, cells with vectors that contain a fragment
of source DNA should remain colorless in the presence of
X-gal.
Any cells that are able to grow in a medium containing
the antibiotic but don’t turn blue in the medium with X-gal
must have incorporated a vector with a fragment of source
DNA. Identifying cells that have a specific fragment of the
source DNA is the next step in screening clones.
396 Part V Molecular Genetics
Eliminate cells
without plasmid
Colonies with
plasmid
Ampicillin in
media
Identify cells
without
recombinant DNA
Colony with
recombinant
DNA
Cells that did not take up the plasmid are
not resistant to ampicillin and do not form
colonies on media containing this antibiotic.
(a) (b)
Bacterial cell that did not take up plasmid
amp
r
gene
Gene of interest
lacZH11032 gene
(nonfunctional)
Bacterial cell without
recombinant DNA
lacZH11032 gene (functional)
Cells that did not take up DNA fragments
have functional lacZH11032 genes, are able to metabolize
X-gal, and turn blue on media that contain X-gal.
X-gal
in media
Fragment of DNA
FIGURE 19.6
Stage 4-I: Using antibiotic resistance and X-gal as preliminary screens of restriction fragment clones. Bacteria are transformed
with recombinant plasmids that contain a gene (amp
r
) that confers resistance to the antibiotic ampicillin and a gene (lacZ') that is required
to produce β-galactosidase, the enzyme which enables the cells to metabolize the sugar X-gal. (a) Only those bacteria that have
incorporated a plasmid will be resistant to ampicillin and will grow on a medium that contains the antibiotic. (b) Ampicillin-resistant
bacteria will be able to metabolize X-gal if their plasmid does not contain a DNA fragment inserted in the lacZ' gene; such bacteria will
turn blue when grown on a medium containing X-gal. Bacteria with a plasmid that has a DNA fragment inserted within the lacZ' gene will
not be able to metabolize X-gal and, therefore, will remain colorless in the presence of X-gal.
4–II: Finding the Gene of Interest. A clone library may
contain anywhere from a few dozen to many thousand indi-
vidual fragments of source DNA. Many of those fragments
will be identical, so to assemble a complete library of the
entire source genome, several hundred thousand clones
could be required. A complete Drosophila (fruit fly) library,
for example, contains more than 40,000 different clones; a
complete human library consisting of fragments 20 kilo-
bases long would require close to a million clones. To
search such an immense library for a clone that contains a
fragment corresponding to a particular gene requires inge-
nuity, but many different approaches have been successful.
The most general procedure for screening clone li-
braries to find a particular gene is hybridization (figure
19.7). In this method, the cloned genes form base-pairs
with complementary sequences on another nucleic acid.
The complementary nucleic acid is called a probe because
it is used to probe for the presence of the gene of interest.
At least part of the nucleotide sequence of the gene of in-
terest must be known to be able to construct the probe.
In this method of screening, bacterial colonies contain-
ing an inserted gene are grown on agar. Some cells are
transferred to a filter pressed onto the colonies, forming a
replica of the plate. The filter is then treated with a solu-
tion that denatures the bacterial DNA and that contains a
radioactively labeled probe. The probe hybridizes with
complementary single-stranded sequences on the bacterial
DNA.
When the filter is laid over photographic film, areas that
contain radioactivity will expose the film (autoradiography).
Only colonies which contain the gene of interest hybridize
with the radioactive probe and emit radioactivity onto the
film. The pattern on the film is then compared to the origi-
nal master plate, and the gene-containing colonies may be
identified.
Genetic engineering generally involves four stages:
cleaving the source DNA; making recombinants;
cloning copies of the recombinants; and screening the
cloned copies for the desired gene. Screening can be
achieved by making the desired clones resistant to
certain antibiotics and giving them other properties that
make them readily identifiable.
Chapter 19 Gene Technology 397
Film
Filter
1. Colonies of plasmid-containing
bacteria, each from a clone from
the clone library, are grown on agar.
5. A comparison with the original
plate identifies the colony
containing the gene.
2. A replica of the plate is made
by pressing a filter against the
colonies. Some cells from each
colony adhere to the filter.
3. The filter is washed with a solution that denatures
the DNA and contains the radioactively labeled
probe. The probe contains nucleotide sequences
complementary to the gene of interest and binds
to cells containing the gene.
4. Only those colonies containing the gene
will retain the probe and emit radioactivity
on film placed over the filter.
FIGURE 19.7
Stage 4-II: Using hybridization to identify the gene of interest. (1) Each of the colonies on these bacterial culture plates represents
millions of clones descended from a single cell. To test whether a certain gene is present in any particular clone, it is necessary to identify
colonies whose cells contain DNA that hybridizes with a probe containing DNA sequences complementary to the gene. (2) Pressing a
filter against the master plate causes some cells from each colony to adhere to the filter. (3) The filter is then washed with a solution that
denatures the DNA and contains the radioactively labeled probe. (4) Only those colonies that contain DNA that hybridizes with the probe,
and thus contain the gene of interest, will expose film in autoradiography. (5) The film is then compared to the master plate to identify the
gene-containing colony.
Working with Gene Clones
Once a gene has been successfully cloned, a variety of pro-
cedures are available to characterize it.
Getting Enough DNA to Work with: The
Polymerase Chain Reaction
Once a particular gene is identified within the library of
DNA fragments, the final requirement is to make multiple
copies of it. One way to do this is to insert the identified
fragment into a bacterium; after repeated cell divisions,
millions of cells will contain copies of the fragment. A far
more direct approach, however, is to use DNA polymerase
to copy the gene sequence of interest through the poly-
merase chain reaction (PCR; figure 19.8). Kary Mullis
developed PCR in 1983 while he was a staff chemist at the
Cetus Corporation; in 1993, it won him the Nobel Prize in
Chemistry. PCR can amplify specific sequences or add se-
quences (such as endonuclease recognition sequences) as
primers to cloned DNA. There are three steps in PCR:
Step 1: Denaturation. First, an excess of primer (typ-
ically a synthetic sequence of 20 to 30 nucleotides) is
mixed with the DNA fragment to be amplified. This
mixture of primer and fragment is heated to about
98° C. At this temperature, the double-stranded DNA
fragment dissociates into single strands.
Step 2: Annealing of Primers. Next, the solution is
allowed to cool to about 60°C. As it cools, the single
strands of DNA reassociate into double strands. How-
ever, because of the large excess of primer, each strand
of the fragment base-pairs with a complementary primer
flanking the region to be amplified, leaving the rest of
the fragment single-stranded.
Step 3: Primer Extension. Now a very heat-stable
type of DNA polymerase, called Taq polymerase (after
the thermophilic bacterium Thermus aquaticus, from
which Taq is extracted) is added, along with a supply of
all four nucleotides. Using the primer, the polymerase
copies the rest of the fragment as if it were replicating
DNA. When it is done, the primer has been lengthened
into a complementary copy of the entire single-stranded
fragment. Because both DNA strands are replicated,
there are now two copies of the original fragment.
Steps 1 to 3 are now repeated, and the two copies be-
come four. It is not necessary to add any more polymerase,
as the heating step does not harm this particular enzyme.
Each heating and cooling cycle, which can be as short as 1
or 2 minutes, doubles the number of DNA molecules. After
20 cycles, a single fragment produces more than one mil-
lion (2
20
) copies! In a few hours, 100 billion copies of the
fragment can be manufactured.
PCR, now fully automated, has revolutionized many as-
pects of science and medicine because it allows the investi-
gation of minute samples of DNA. In criminal investiga-
tions, “DNA fingerprints” are prepared from the cells in a
tiny speck of dried blood or at the base of a single human
hair. Physicians can detect genetic defects in very early em-
bryos by collecting a few sloughed-off cells and amplifying
their DNA. PCR could also be used to examine the DNA
of historical figures such as Abraham Lincoln and of now-
extinct species, as long as even a minuscule amount of their
DNA remains intact.
398 Part V Molecular Genetics
Target sequence
Primers
DNA polymerase
Free nucleotides
2
copies
4 copies
8 copies
Cycle
3
Cycle
2
Cycle
1
P
P
P
P
P
P
P
P
P
P
P
3 Primer
extension
Annealing
of primers
PP
P
PP
P
P
P
PP
P
Heat
Heat
Heat
Cool
Cool
Cool
Denaturation
FIGURE 19.8
The polymerase chain reaction. (1) Denaturation. A solution
containing primers and the DNA fragment to be amplified is
heated so that the DNA dissociates into single strands.
(2) Annealing of primers. The solution is cooled, and the primers
bind to complementary sequences on the DNA flanking the region
to be amplified. (3) Primer extension. DNA polymerase then copies
the remainder of each strand, beginning at the primer. Steps 1–3
are then repeated with the replicated strands. This process is
repeated many times, each time doubling the number of copies,
until enough copies of the DNA fragment exist for analysis.
Identifying DNA: Southern Blotting
Once a gene has been cloned, it may be used as a probe to
identify the same or a similar gene in another sample (fig-
ure 19.9). In this procedure, called a Southern blot, DNA
from the sample is cleaved into restriction fragments with a
restriction endonuclease, and the fragments are spread
apart by gel electrophoresis. The double-stranded helix of
each DNA fragment is then denatured into single strands
by making the pH of the gel basic, and the gel is “blotted”
with a sheet of nitrocellulose, transferring some of the
DNA strands to the sheet. Next, a probe consisting of puri-
fied, single-stranded DNA corresponding to a specific gene
(or mRNA transcribed from that gene) is poured over the
sheet. Any fragment that has a nucleotide sequence com-
plementary to the probe’s sequence will hybridize (base-
pair) with the probe. If the probe has been labeled with
32
P,
it will be radioactive, and the sheet will show a band of ra-
dioactivity where the probe hybridized with the comple-
mentary fragment.
Chapter 19 Gene Technology 399
1. Electrophoresis is performed, using
radioactively labeled markers as a
size guide in the first lane.
3. Pattern on gel is copied faithfully,
or "blotted", onto the nitrocellulose.
4. Blotted nitocellulose is incubated
with radioactively labeled nucleic
acids, and then rinsed.
5. Photographic film is laid over the paper and
is exposed only in areas that contain
radioactivity (autoradiography). Nitrocellulose
is examined for radioactive bands, indicating
hybridization of the original nucleic acids with
the radioactively labeled ones.
2. The gel is covered with a sheet of nitrocellulose and
placed in a tray of buffer on top of a sponge. Alkaline
chemicals in the buffer denature the DNA into single
strands. The buffer wicks its way up through the gel
and nitrocellulose into a stack of paper towels placed
on top of the nitrocellulose.
Test nucleic
acids
Radioactively
labeled markers
with specific
sizes
Electrophoretic
gel
Nitrocellulose paper now
contains nucleic acid "print"
Sealed container
Size
markers
Hybridized
nucleic acids
Film
Radioactively
labeled nucleic
acids
Gel
Buffer
Sponge
Stack of paper towels
Nitrocellulose paper
Gel
Electrophoresis
FIGURE 19.9
The Southern blot procedure. E. M. Southern developed this procedure in 1975 to enable DNA fragments of interest to be visualized in
a complex sample containing many other fragments of similar size. The DNA is separated on a gel, then transferred (“blotted”) onto a
solid support medium such as nitrocellulose paper or a nylon membrane. It is then incubated with a radioactive single-strand copy of the
gene of interest, which hybridizes to the blot at the location(s) where there is a fragment with a complementary sequence. The positions of
radioactive bands on the blot identify the fragments of interest.
Distinguishing Differences in
DNA: RFLP Analysis
Often a researcher wishes not to find
a specific gene, but rather to identify
a particular individual using a specific
gene as a marker. One powerful way
to do this is to analyze restriction
fragment length polymorphisms,
or RFLPs (figure 19.10). Point muta-
tions, sequence repetitions, and
transposons (see chapter 18) that
occur within or between the restric-
tion endonuclease recognition sites
will alter the length of the DNA frag-
ments (restriction fragments) the re-
striction endonucleases produce.
DNA from different individuals
rarely has exactly the same array of
restriction sites and distances be-
tween sites, so the population is said
to be polymorphic (having many
forms) for their restriction fragment
patterns. By cutting a DNA sample
with a particular restriction endonu-
clease, separating the fragments ac-
cording to length on an elec-
trophoretic gel, and then using a
radioactive probe to identify the
fragments on the gel, one can obtain
a pattern of bands often unique for each region of DNA
analyzed. These “DNA fingerprints” are used in forensic
analysis during criminal investigations. RFLPs are also
useful as markers to identify particular groups of people
at risk for some genetic disorders.
Making an Intron-Free Copy of a Eukaryotic
Gene
Recall from chapter 15 that eukaryotic genes are encoded
in exons separated by numerous nontranslated introns.
When the gene is transcribed to produce the primary tran-
script, the introns are cut out during RNA processing to
produce the mature mRNA transcript. When transferring
eukaryotic genes into bacteria, it is desirable to transfer
DNA already processed this way, instead of the raw eu-
karyotic DNA, because bacteria lack the enzymes to carry
out the processing. To do this, genetic engineers first iso-
late from the cytoplasm the mature mRNA corresponding
to a particular gene. They then use an enzyme called re-
verse transcriptase to make a DNA version of the mature
mRNA transcript (figure 19.11). The single strand of
DNA can then serve as a template for the synthesis of a
complementary strand. In this way, one can produce a
double-stranded molecule of DNA that contains a gene
lacking introns. This molecule is called complementary
DNA, or cDNA.
400 Part V Molecular Genetics
Restriction endonuclease
cutting sites
Single base-pair
change
Sequence duplication
(a) Three different
DNA duplexes
(b) Cut DNA
(c) Gel electrophoresis of
restriction fragments
Larger
fragments
Smaller
fragments
– ++
– +
– ++
FIGURE 19.10
Restriction fragment length polymorphism (RFLP) analysis. (a) Three samples of DNA
differ in their restriction sites due to a single base-pair substitution in one case and a
sequence duplication in another case. (b) When the samples are cut with a restriction
endonuclease, different numbers and sizes of fragments are produced. (c) Gel electrophoresis
separates the fragments, and different banding patterns result.
Intron (noncoding region) Exon (coding region)
Eukaryotic DNA
Primary RNA
transcript
Transcription
Mature mRNA transcript
Introns are cut out
and coding regions are
spliced together
mRNA-cDNA hybrid
Isolation of mRNA
Addition of reverse
transcriptase
Addition of mRNA-
degrading enzymes
DNA polymerase
Double-stranded cDNA
gene without introns
FIGURE 19.11
The formation of cDNA. A mature mRNA transcript is isolated
from the cytoplasm of a cell. The enzyme reverse transcriptase is
then used to make a DNA strand complementary to the processed
mRNA. That newly made strand of DNA is the template for the
enzyme DNA polymerase, which assembles a complementary
DNA strand along it, producing cDNA, a double-stranded DNA
version of the intron-free mRNA.
Sequencing DNA: The Sanger Method
Most DNA sequencing is currently done using the “chain
termination” technique developed initially by Frederick
Sanger, for which he earned his second Nobel Prize (figure
19.12). (1) A short single-stranded primer is added to the
end of a single-stranded DNA fragment of unknown se-
quence. The primer provides a 3′ end for DNA poly-
merase. (2) The primed fragment is added, along with
DNA polymerase and a supply of all four deoxynucleotides
(d-nucleotides), to four synthesis tubes. Each contains a
different dideoxynucleotide (dd-nucleotide); such nu-
cleotides lack both the 2′ and the 3′ —OH groups and are
thus chain-terminating. The first tube, for example, con-
tains ddATP and stops synthesis whenever ddA is incorpo-
rated into DNA instead of dATP. Because of the relatively
low concentration of ddATP compared to dATP, ddA will
not necessarily be added to the first A site; this tube will
contain a series of fragments of different lengths, corre-
sponding to the different distances the polymerase traveled
from the primer before a ddA was incorporated. (3) These
fragments can be separated according to size by elec-
trophoresis. (4) A radioactive label (here dATP*) allows
the fragments to be visualized on X-ray film, and the
newly made sequence can be read directly from the film.
Try it. (5) The original fragment has the complementary
sequence.
Techniques such as Southern blotting and PCR enable
investigators to identify specific genes and produce
them in large quantities, while RFLP analysis and the
Sanger method identify individuals and unknown gene
sequences.
Chapter 19 Gene Technology 401
1. A primer is added to one
end of a single-stranded
DNA of unknown sequence.
2. The primed DNA fragment is
combined with DNA polymerase
and free nucleotides and then
is added to four tubes. Each tube
contains a different, chain-
terminating dideoxynucleotide.
3. DNA polymerase adds
nucleotides to the single-
stranded DNA. Fragments
of different sizes are produced
when a dideoxynucleotide is
added and terminates
synthesis. These fragments
are separated by size in
gel electrophoresis.
4. The radioactive label (dATP*) allows the
gel pattern to be visualized on X-ray film.
Each column on the gel corresponds to one
of the four nucleotides, and each band in the
gel corresponds to a DNA fragment that ends
with the nucleotide of the column. The sequence
of the newly synthesized DNA can be read from
bottom to top.
5. The DNA sequence of interest is
complementary to the DNA sequence
from the gel.
3H11032 5H11032
AACA
AACA
T
Primer
Single-stranded DNA of
unknown sequence
Reaction products
Template
TGT
GC C CTTTTAG GAAAG
TTGT
dda
dda
dda
dda
TTGT
TTGT
TTGT
dATP* (radioactively labeled)
dGTP, dCTP, dTTP
DNA polymerase
ddATP ddCTP
Reaction
mixtures
Gel electrophoresis
X-ray film
Sequence
of new
strand
is read
Known primer
sequence
Sequence
of original
fragment
Small
fragments
Large
fragments
ddGTP ddTTP
A
C
T
A
G
T
G
A
C
T
C
T
A
G
C
T
G
A
T
C
A
C
T
G
A
G
A
T
C
G
T
G
T
T
A
C
A
A
A CGT
FIGURE 19.12
The Sanger dideoxynucleotide sequencing method.
DNA Sequence Technology
The 1980s saw an explosion of interest in biotechnology,
the application of genetic engineering to practical human
problems. Let us examine some of the major areas where
these techniques have been put to use.
Genome Sequencing
Genetic engineering techniques are enabling us to learn a
great deal more about the human genome. Several clonal
libraries of the human genome have been assembled,
using large-size restriction fragments. Any cloned gene
can now be localized to a specific chromosomal site by
using probes to detect in situ hybridization (that is, bind-
ing between the probe and a complementary sequence on
the chromosome). Genes are now being mapped at an as-
tonishing rate: genes that contribute to dyslexia, obesity,
and cholesterol-proof blood are some of the important
ones that were mapped in 1994 and 1995 alone! With an
understanding of where specific genes are located in the
human genome and how they work, it is not difficult to
imagine a future in which virtually any genetic disease
could be treated or perhaps even cured with gene ther-
apy. As we mentioned in chapter 13, some success has al-
ready been reported in treating patients who have cystic
fibrosis with a genetically corrected version of the cystic
fibrosis gene.
An exciting scientific by-product of the human genome
project has been the complete genome sequencing of many
microorganisms with smaller genomes, on the order of a
few Mb (table 19.1). In general, about half of the genes
prove to have a known function; what the other half of the
genes are doing is a complete mystery. The first eukaryotic
genome to be sequenced in its entirety was that of brewer’s
yeast Saccharomyces cerevisiae; many of its approximately
6000 genes have a similar structure to some human genes.
The complete sequences of many much larger genomes
have recently been completed, including the malarial Plas-
modium parasite (30 Mb), the nematode (100 Mb), the plant
Arabidopsis (100 Mb) (figure 19.13), the fruit fly Drosophila
(120 Mb), and the mouse (300 Mb).
The international scientific community has over the last
several years mounted a major effort to sequence the entire
human genome. Because the human genome contains some
3000 Mb (million nucleotide base-pairs), this task has pre-
sented no small challenge. Rapid progress was made possi-
ble by the use of so-called shotgun cloning techniques, in
which the entire genome is first fragmented, then each of
the fragments is sequenced by automated machines, and fi-
nally computers use overlaps to order the fragments. All
but a small portion of the sequence was completed by the
beginning of the year 2000.
402 Part V Molecular Genetics
19.3 Biotechnology is producing a scientific revolution.
FIGURE 19.13
Part of the genome sequence of the plant Arabidopsis. Data
from an automated DNA-sequencing run shows the nucleotide
sequence for a small section of the Arabidopsis genome. Automated
DNA sequencing has greatly increased the speed at which
genomes can be sequenced.
Table 19.1 Genome Sequencing Projects
Genome
Organism Size (Mb) Description
ARCHAEBACTERIA
Methanococcus jannaschi 1.7 Extreme thermophile
EUBACTERIA
Escherichia coli 4.6 Laboratory standard
FUNGI
Saccharomyces cerevisiae 13 Baker’s yeast
PROTIST
Plasmodium 30 Malarial parasite
PLANT
Arabidopsis thaliana 100 Relative of mustard plant
ANIMAL
Caenorhabditis elegans 100 Nematode
Drosophila melanogaster 120 Fruit fly
Mus musculus 300 Mouse
Homo sapiens 3000 Human
DNA Fingerprinting
Figure 19.14 shows the DNA fingerprints a prosecuting
attorney presented in a rape trial in 1987. They consisted
of autoradiographs, parallel bars on X-ray film resembling
the line patterns of the universal price code found on gro-
ceries. Each bar represents the position of a DNA restric-
tion endonuclease fragment produced by techniques simi-
lar to those described in figures 19.4 and 19.10. The lane
with many bars represents a standardized control. Two
different probes were used to identify the restriction frag-
ments. A vaginal swab had been taken from the victim
within hours of her attack; from it semen was collected
and the semen DNA analyzed for its restriction endonu-
clease patterns.
Compare the restriction endonuclease patterns of the
semen to that of the suspect Andrews. You can see that the
suspect’s two patterns match that of the rapist (and are not
at all like those of the victim). Clearly the semen collected
from the rape victim and the blood sample from the sus-
pect came from the same person. The suspect was Tom-
mie Lee Andrews, and on November 6, 1987, the jury re-
turned a verdict of guilty. Andrews became the first person
in the United States to be convicted of a crime based on
DNA evidence.
Since the Andrews verdict, DNA fingerprinting has
been admitted as evidence in more than 2000 court cases
(figure 19.15). While some probes highlight
profiles shared by many people, others are
quite rare. Using several probes, identity can
be clearly established or ruled out.
Just as fingerprinting revolutionized
forensic evidence in the early 1900s, so DNA
fingerprinting is revolutionizing it today. A
hair, a minute speck of blood, a drop of
semen can all serve as sources of DNA to
damn or clear a suspect. As the man who an-
alyzed Andrews’ DNA says: “It’s like leaving
your name, address, and social security num-
ber at the scene of the crime. It’s that pre-
cise.” Of course, laboratory analyses of DNA
samples must be carried out properly—
sloppy procedures could lead to a wrongful
conviction. After widely publicized instances
of questionable lab procedures, national
standards are being developed.
The genomes of several organisms have
been completely sequenced. When DNA
is digested with restriction
endonucleases, distinctive profiles on
electrophoresis gels can be used to
identify the individual that was the source
of the tissue.
Chapter 19 Gene Technology 403
Victim
Rapist’s semen
Suspect’s blood
Victim
Rapist’s semen
Suspect’s blood
FIGURE 19.14
Two of the DNA profiles that led to the conviction of
Tommie Lee Andrews for rape in 1987. The two DNA probes
seen here were used to characterize DNA isolated from the
victim, the semen left by the rapist, and the suspect. The dark
channels are multiband controls. There is a clear match between
the suspect’s DNA and the DNA of the rapist’s semen in these.
FIGURE 19.15
The DNA profiles of O. J. Simpson and blood samples from the murder
scene of his former wife from his highly publicized and controversial
murder trial in 1995.
Biochips
A biochip, also called a gene microarray, is a square of glass
smaller than a postage stamp, covered with millions of
strands of DNA like blades of grass. Biochips were in-
vented nine years ago by gene scientist Stephen Fodor. In a
flash of insight, he saw that photolithography, the process
used to etch semiconductor circuits into silicon, could also
be used to assemble particular DNA molecules on a chip—
a biochip.
Think of the chip surface as a field of assembly sites,
much as a TV screen is a field of colored dots. Just as a
scanning beam moves over each individual TV dot instruct-
ing it to be red, green, or blue (the three components of
color), so a scanning beam moves over each biochip spot,
commanding the addition there of a base to a growing
strand of DNA. A computer, by varying the wavelength of
the scanning beam, determines which of four possible nu-
cleotides is added to the growing DNA strand anchored to
each spot. When the entire chip has been scanned, each
DNA strand has been lengthened one nucleotide unit. The
computer repeats the process, layer by layer, until each
DNA strand is an entire gene or gene fragment. One
biochip made in this way contains hundreds of thousands of
specific gene sequences.
How could you use such a biochip to delve into a per-
son’s genes? All you would have to do is to obtain a little of
the person’s DNA, say from a blood sample or even a bit of
hair. Flush fluid containing the DNA over the biochip sur-
face. Every place that the DNA has a gene matching one of
the biochip strands, it will stick to it in a way the computer
can detect.
Now here is where it gets interesting. The mad rush
to sequence the human genome is over. The gene re-
search firm Celera has recently announced it has essen-
tially completed the sequence, with over 90% of genes
done. Already the researchers are busily comparing their
consensus “reference sequence” to the DNA of individual
people, and noting any differences they detect. Called
single nucleotide polymorphisms, or SNPs (pronounced
“snips”), these spot differences in the identity of particu-
lar nucleotides collectively record every way in which a
particular individual differs from the reference sequence.
Some SNPs cause diseases like cystic fibrosis or sickle
cell anemia. Others may give you red hair or elevated
cholesterol in your blood. As the human genome project
charges toward completion, its researchers are excitedly
assembling a huge database of SNPs. Research indicates
that SNPs can be expected to occur at a frequency of
about one per thousand nucleotides, scattered about ran-
domly over the chromosomes. Each of us thus differs
from the standard "type sequence" in several thousand
nucleotide SNPs. Everything genetic about you that is
diferent from a stranger you meet is caused by a few
thousand SNPs; otherwise you and that stranger are
identical.
How Biochips Can Be Used to Screen for Cancer
One of the biggest decisions facing an oncologist (cancer
doctor) treating a tumor is to select the proper treatment.
Most cancer cells look alike, although the tumors may in
fact be caused by quite different forms of cancer. If the on-
cologist could clearly identify the cancer, very targeted
therapies might be possible. Unable to tell the difference
for sure, however, oncologists take no chances. Tumors are
treated with therapy that attacks all cancers, usually with
severe side effects.
This year Boston researchers Todd Golub and Eric
Lander took a vital step towards treating cancer, using new
DNA technology to sniff out the differences between dif-
ferent forms of a deadly cancer of the immune system.
Golub and Lander worked with biochips.
The way to tell the difference between two kinds of can-
cer is to compare the mutations that led to the cancer in
the first place. Biologists call such gene changes mutations.
The mutations that cause many lung cancers are caused by
a tobacco-induced alteration of a single DNA nucleotide in
one gene. Such spot differences between the version of a
gene one person has and another person has, or a cancer
patient has, are examples of SNPs.
Golub and Lander obtained bone marrow cells from pa-
tients with two types of leukemia (cancer of white blood
cells), and exposed DNA from each to biochips containing
all known human genes, 6817 in all (figure 19.16). Using
high-speed computer programs, Golub and Lander exam-
ined each of the 6817 positions on the chip. The two
forms of leukemia each showed gene changes from normal,
but, importantly, the changes were different in each case!
Each had their own characteristic SNP.
Biochips thus may offer a quick and reliable way to iden-
tify any type of cancer. Just look and see what SNP is
present.
The Use of Gene Chips Will Soon
Be Widespread
Biochip technology is likely to dominate medicine in the
coming millennium, a prospect both exciting and scary. Re-
searchers have announced plans to compile a database of
hundreds of thousands of SNPs over the next two years.
Screening SNPs and comparing them to known SNP data-
bases will soon allow doctors to screen each of us for copies
of genes leading to genetic diseases. Many genetic diseases
are associated with SNPs, including cystic fibrosis and
muscular dystrophy.
Biochips Raise Critical Issues of Personal Privacy
The scary part is SNPs on chips. Researchers plan to have
identified some 300,000 different SNPs by 2001, all of
which could reside on a single biochip. When your DNA is
flushed over a SNP biochip, the sequences that light up
404 Part V Molecular Genetics
will instantly reveal your SNP profile. The genetic charac-
teristics that make you you, genes that might affect your
health, your behavior, your future potential—all are there
to be read by anyone clever enough to interpret the profile.
To what extent are you your genes? Scientists fight about
this question, and no one really knows the answer. It is clear
that much of what each of us is like is strongly affected by
our genetic makeup. Researchers have proven beyond any
real dispute that intelligence and major personality traits
like aggressiveness and inquisitiveness are about 80% herita-
ble (that is, 80% of the variation in these traits reflects varia-
tion in genes).
Your SNP profile will reflect all of this variation, a table
of contents of your chromosomes, a molecular window to
who you are. When millions of such SNP profiles have been
gathered over the coming years, computers will be able to
identify other individuals with profiles like yours, and, by
examining health records, standard personality tests, and the
like, correlate parts of your profile with particular traits.
Even behavioral characteristics involving many genes, which
until now have been thought too complex to ever analyze,
cannot resist a determined assault by a computer comparing
SNP profiles.
A biochip is a discrete collection of gene fragments on a
stamp-sized chip that can be used to screen for the
presence of particular gene variants. Biochips allow
rapid screening of gene profiles, a tool that promises to
have a revolutionary impact on medicine and society.
Chapter 19 Gene Technology 405
1. DNA is obtained from the
bone marrow cells of patients
with two types of leukemia.
3. High speed computer programs
examine the biochips and identify
any SNPs, or single nucleotide
polymorphisms.
4. The SNP profiles from each
type of leukemia patient are
examined. Leukemia 1 exhibits a
different SNP than leukemia 2.
Thus, the two types of leukemia
are associated with two different
gene changes.
2. The DNA is exposed to
biochips containing all known
human genes.
Leukemia
patient # 1
Leukemia
patient # 2
Bone
marrow
cells
Bone
marrow
cells
DNA DNA
Biochip
Leukemia 1
SNP profile
Leukemia 2
SNP profile
FIGURE 19.16
Biochips can help in identifying precise forms of cancer.
Medical Applications
Pharmaceuticals
The first and perhaps most obvious commercial applica-
tion of genetic engineering was the introduction of genes
that encode clinically important proteins into bacteria.
Because bacterial cells can be grown cheaply in bulk (fer-
mented in giant vats, like the yeasts that make beer), bac-
teria that incorporate recombinant genes can synthesize
large amounts of the proteins those genes specify. This
method has been used to produce several forms of human
insulin and interferon, as well as other commercially
valuable proteins such as growth hormone (figure 19.17)
and erythropoietin, which stimulates red blood cell
production.
Among the medically important proteins now manufac-
tured by these approaches are atrial peptides, small pro-
teins that may provide a new way to treat high blood pres-
sure and kidney failure. Another is tissue plasminogen
activator, a human protein synthesized in minute amounts
that causes blood clots to dissolve and may be effective in
preventing and treating heart attacks and strokes.
A problem with this general approach has been the diffi-
culty of separating the desired protein from the others the
bacteria make. The purification of proteins from such com-
plex mixtures is both time-consuming and expensive, but it
is still easier than isolating the proteins from the tissues of
animals (for example, insulin from hog pancreases), which
is how such proteins used to be obtained. Recently, how-
ever, researchers have succeeded in producing RNA tran-
scripts of cloned genes; they can then use the transcripts to
produce only these proteins in a test tube containing the
transcribed RNA, ribosomes, cofactors, amino acids,
tRNA, and ATP.
Gene Therapy
In 1990, researchers first attempted to combat genetic de-
fects by the transfer of human genes. When a hereditary
disorder is the result of a single defective gene, an obvious
way to cure the disorder is to add a working copy of the
gene. This approach is being used in an attempt to combat
cystic fibrosis, and it offers potential for treating muscular
dystrophy and a variety of other disorders (table 19.2). One
of the first successful attempts was the transfer of a gene
encoding the enzyme adenosine deaminase into the bone
marrow of two girls suffering from a rare blood disorder
caused by the lack of this enzyme. However, while many
clinical trials are underway, no others have yet proven suc-
cessful. This extremely promising approach will require a
lot of additional effort.
406 Part V Molecular Genetics
FIGURE 19.17
Genetically engineered human growth hormone. These two
mice are genetically identical, but the large one has one extra
gene: the gene encoding human growth hormone. The gene was
added to the mouse’s genome by genetic engineers and is now a
stable part of the mouse’s genetic endowment.
Table 19.2 Diseases Being Treated
in Clinical Trials of Gene Therapy
Disease
Cancer (melanoma, renal cell, ovarian, neuroblastoma, brain,
head and neck, lung, liver, breast, colon, prostate,
mesothelioma, leukemia, lymphoma, multiple myeloma)
SCID (severe combined immunodeficiency)
Cystic fibrosis
Gaucher’s disease
Familial hypercholesterolemia
Hemophilia
Purine nucleoside phosphorylase deficiency
Alpha-1 antitrypsin deficiency
Fanconi’s anemia
Hunter’s syndrome
Chronic granulomatous disease
Rheumatoid arthritis
Peripheral vascular disease
AIDS
Piggyback Vaccines
Another area of potential significance involves the use of
genetic engineering to produce subunit vaccines against
viruses such as those that cause herpes and hepatitis. Genes
encoding part of the protein-polysaccharide coat of the
herpes simplex virus or hepatitis B virus are spliced into a
fragment of the vaccinia (cowpox) virus genome (figure
19.18). The vaccinia virus, which British physician Edward
Jenner used almost 200 years ago in his pioneering vaccina-
tions against smallpox, is now used as a vector to carry the
herpes or hepatitis viral coat gene into cultured mammalian
cells. These cells produce many copies of the recombinant
virus, which has the outside coat of a herpes or hepatitis
virus. When this recombinant virus is injected into a mouse
or rabbit, the immune system of the infected animal pro-
duces antibodies directed against the coat of the recombi-
nant virus. It therefore develops an immunity to herpes or
hepatitis virus. Vaccines produced in this way are harmless
because the vaccinia virus is benign and only a small frag-
ment of the DNA from the disease-causing virus is intro-
duced via the recombinant virus.
The great attraction of this approach is that it does not
depend upon the nature of the viral disease. In the future,
similar recombinant viruses may be injected into humans to
confer resistance to a wide variety of viral diseases.
In 1995, the first clinical trials began of a novel new kind
of DNA vaccine, one that depends not on antibodies but
rather on the second arm of the body’s immune defense,
the so-called cellular immune response, in which blood
cells known as killer T cells attack infected cells. The in-
fected cells are attacked and destroyed when they stick
fragments of foreign proteins onto their outer surfaces that
the T cells detect (the discovery by Peter Doherty and Rolf
Zinkernagel that infected cells do so led to their receiving
the Nobel Prize in Physiology or Medicine in 1996). The
first DNA vaccines spliced an influenza virus gene encod-
ing an internal nucleoprotein into a plasmid, which was
then injected into mice. The mice developed strong cellular
immune responses to influenza. New and controversial, the
approach offers great promise.
Genetic engineering has produced commercially
valuable proteins, gene therapies, and, possibly, new
and powerful vaccines.
Chapter 19 Gene Technology 407
Human immune
response
Gene specifying
herpes simplex
surface protein
Harmless vaccinia
(cowpox) virus
1. DNA is extracted.
2. Herpes simplex
gene is isolated.
3. Vaccinia DNA is
extracted and cleaved.
4. Fragment containing
surface gene combines
with cleaved vaccinia DNA.
5. Harmless engineered virus
(the vaccine) with surface like
herpes simplex is injected into
the human body.
6. Antibodies directed
against herpes simplex
viral coat are made.
Herpes simplex virus
FIGURE 19.18
Strategy for constructing a subunit vaccine for herpes simplex.
Agricultural Applications
Another major area of genetic engineering activity is ma-
nipulation of the genes of key crop plants. In plants the pri-
mary experimental difficulty has been identifying a suitable
vector for introducing recombinant DNA. Plant cells do
not possess the many plasmids that bacteria do, so the
choice of potential vectors is limited. The most successful
results thus far have been obtained with the Ti (tumor-
inducing) plasmid of the plant bacterium Agrobacterium
tumefaciens, which infects broadleaf plants such as tomato,
tobacco, and soybean. Part of the Ti plasmid integrates
into the plant DNA, and researchers have succeeded in at-
taching other genes to this portion of the plasmid (figure
19.19). The characteristics of a number of plants have been
altered using this technique, which should be valuable in
improving crops and forests. Among the features scientists
would like to affect are resistance to disease, frost, and
other forms of stress; nutritional balance and protein con-
tent; and herbicide resistance. Unfortunately, Agrobac-
terium generally does not infect cereals such as corn, rice,
and wheat, but alternative methods can be used to intro-
duce new genes into them.
A recent advance in genetically manipulated fruit is Cal-
gene’s “Flavr Savr” tomato, which has been approved for
sale by the USDA. The tomato has been engineered to in-
hibit genes that cause cells to produce ethylene. In toma-
toes and other plants, ethylene acts as a hormone to speed
fruit ripening. In Flavr Savr tomatoes, inhibition of ethyl-
ene production delays ripening. The result is a tomato that
can stay on the vine longer and that resists overripening
and rotting during transport to market.
Herbicide Resistance
Recently, broadleaf plants have been genetically engineered
to be resistant to glyphosate, the active ingredient in
Roundup, a powerful, biodegradable herbicide that kills
most actively growing plants (figure 19.20). Glyphosate
works by inhibiting an enzyme called EPSP synthetase,
which plants require to produce aromatic amino acids. Hu-
mans do not make aromatic amino acids; they get them
from their diet, so they are unaffected by glyphosate. To
make glyphosate-resistant plants, agricultural scientists
used a Ti plasmid to insert extra copies of the EPSP syn-
thetase genes into plants. These engineered plants produce
20 times the normal level of EPSP synthetase, enabling
them to synthesize proteins and grow despite glyphosate’s
suppression of the enzyme. In later experiments, a bacterial
form of the EPSP synthetase gene that differs from the
408 Part V Molecular Genetics
Plant genetic engineering
Agrobacterium
Gene
of interest
Plasmid
1. Plasmid is removed and
cut open with restriction
endonuclease.
2. Gene is isolated
from the chromosome
of another organism.
3. New gene is
inserted into plasmid.
4. Plasmid is put
back into
Agrobacterium.
5. When mixed with plant
cells, Agrobacterium
duplicates the plasmid.
6. The bacterium transfers
the new gene into a
chromosome of the
plant cell.
7. The plant cell divides,
and each daughter cell
receives the new gene,
giving the whole plant
a new trait.
FIGURE 19.19
The Ti plasmid. This Agrobacterium tumefaciens plasmid is used in plant genetic engineering.
plant form by a single nucleotide was introduced into
plants via Ti plasmids; the bacterial enzyme in these plants
is not inhibited by glyphosate.
These advances are of great interest to farmers because a
crop resistant to Roundup would never have to be weeded
if the field were simply treated with the herbicide. Because
Roundup is a broad-spectrum herbicide, farmers would no
longer need to employ a variety of different herbicides,
most of which kill only a few kinds of weeds. Furthermore,
glyphosate breaks down readily in the environment, unlike
many other herbicides commonly used in agriculture. A
plasmid is actively being sought for the introduction of the
EPSP synthetase gene into cereal plants, making them also
glyphosate-resistant.
Nitrogen Fixation
A long-range goal of agricultural genetic engineering is to
introduce the genes that allow soybeans and other legume
plants to “fix” nitrogen into key crop plants. These so-called
nif genes are found in certain symbiotic root-colonizing
bacteria. Living in the root nodules of legumes, these bacte-
ria break the powerful triple bond of atmospheric nitrogen
gas, converting N
2
into NH
3
(ammonia). The plants then
use the ammonia to make amino acids and other nitrogen-
containing molecules. Other plants lack these bacteria and
cannot fix nitrogen, so they must obtain their nitrogen from
the soil. Farmland where these crops are grown soon be-
comes depleted of nitrogen, unless nitrogenous fertilizers
are applied. Worldwide, farmers applied over 60 million
metric tons of such fertilizers in 1987, an expensive under-
taking. Farming costs would be much lower if major crops
like wheat and corn could be engineered to carry out bio-
logical nitrogen fixation. However, introducing the
nitrogen-fixing genes from bacteria into plants has proved
difficult because these genes do not seem to function prop-
erly in eukaryotic cells. Researchers are actively experiment-
ing with other species of nitrogen-fixing bacteria whose
genes might function better in plant cells.
Insect Resistance
Many commercially important plants are attacked by in-
sects, and the traditional defense against such attacks is to
apply insecticides. Over 40% of the chemical insecticides
used today are targeted against boll weevils, bollworms, and
other insects that eat cotton plants. Genetic engineers are
now attempting to produce plants that are resistant to in-
sect pests, removing the need to use many externally ap-
plied insecticides.
The approach is to insert into crop plants genes encod-
ing proteins that are harmful to the insects that feed on the
plants but harmless to other organisms. One such insectici-
dal protein has been identified in Bacillus thuringiensis, a soil
bacterium. When the tomato hornworm caterpillar ingests
this protein, enzymes in the caterpillar’s stomach convert it
into an insect-specific toxin, causing paralysis and death.
Because these enzymes are not found in other animals, the
protein is harmless to them. Using the Ti plasmid, scien-
tists have transferred the gene encoding this protein into
tomato and tobacco plants. They have found that these
transgenic plants are indeed protected from attack by the
insects that would normally feed on them. In 1995, the
EPA approved altered forms of potato, cotton, and corn.
The genetically altered potato can kill the Colorado potato
beetle, a common pest. The altered cotton is resistant to
cotton bollworm, budworm, and pink bollworm. The corn
has been altered to resist the European corn borer and
other mothlike insects.
Monsanto scientists screening natural compounds ex-
tracted from plant and soil samples have recently isolated a
new insect-killing compound from a fungus, the enzyme
cholesterol oxidase. Apparently, the enzyme disrupts mem-
branes in the insect gut. The fungus gene, called the Boll-
gard gene after its discoverer, has been successfully inserted
into a variety of crops. It kills a wide range of insects, in-
cluding the cotton boll weevil and the Colorado potato
beetle, both serious agricultural pests. Field tests began in
1996.
Some insect pests attack plant roots, and B. thuringiensis
is being employed to counter that threat as well. This bac-
terium does not normally colonize plant roots, so biologists
have introduced the B. thuringiensis insecticidal protein
gene into root-colonizing bacteria, especially strains of
Pseudomonas. Field testing of this promising procedure has
been approved by the Environmental Protection Agency.
Chapter 19 Gene Technology 409
FIGURE 19.20
Genetically engineered herbicide resistance. All four of these
petunia plants were exposed to equal doses of the herbicide
Roundup. The two on top were genetically engineered to be
resistant to glyphosate, the active ingredient of Roundup, while
the two on the bottom were not.
The Real Promise of Plant Genetic Engineering
In the last decade the cultivation of genetically modified
crops of corn, cotton, and soybeans has become com-
monplace in the United States—in 1999, over half of the
72 million acres planted with soybeans in the United
States were planted with seeds genetically modified to be
herbicide resistant, with the result that less tillage has
been needed, and as a consequence soil erosion has been
greatly lessened. These benefits, while significant, have
been largely confined to farmers, making their cultivation
of crops cheaper and more efficient. The food that the
public gets is the same, it just costs less to get it to the
table.
Like the first act of a play, these developments have
served mainly to set the stage for the real action, which is
only now beginning to happen. The real promise of plant
genetic engineering is to produce genetically modified
plants with desirable traits that directly benefit the con-
sumer.
One recent advance, nutritionally improved rice, gives
us a hint of what is to come. In developing countries large
numbers of people live on simple diets that are poor
sources of vitamins and minerals (what botanists called
"micronutrients"). Worldwide, the two major micronutri-
ent deficiencies are iron, which affects 1.4 billion women,
24% of the world population, and vitamin A, affecting 40
million children, 7% of the world population. The defi-
ciencies are especially severe in developing countries where
the major staple food is rice. In recent research, Swiss bio-
engineer Ingo Potrykus and his team at the Institute of
Plant Sciences, Zurich, have gone a long way towards solv-
ing this problem. Supported by the Rockefeller Founda-
tion and with results to be made free to developing coun-
tries, the work is a model of what plant genetic engineering
can achieve.
To solve the problem of dietary iron deficiency among
rice eaters, Potrykus first asked why rice is such a poor
source of dietary iron. The problem, and the answer,
proved to have three parts:
1. Too little iron. The proteins of rice endosperm have
unusually low amounts of iron. To solve this prob-
lem, a ferritin gene was transferred into rice from
beans (figure 19.21). Ferritin is a protein with an ex-
traordinarily high iron content, and so greatly in-
creased the iron content of the rice.
2. Inhibition of iron absorption by the intestine. Rice con-
tains an unusually high concentration of a chemical
called phytate, which inhibits iron reabsorption in the
intestine—it stops your body from taking up the iron
in the rice. To solve this problem, a gene encoding an
enzyme that destroys phytate was transferred into rice
from a fungus.
3. Too little sulfur for efficient iron absorption. Sulfur is
required for iron uptake, and rice has very little of it.
To solve this problem, a gene encoding a particularly
sulfur-rich metallothionin protein was transferred
into rice from wild rice.
To solve the problem of vitamin A deficiency, the same
approach was taken. First, the problem was identified. It
turns out rice only goes part way toward making beta-
carotene (provitamin A); there are no enzymes in rice to
catalyze the last four steps. To solve the problem, genes en-
coding these four enzymes were added to rice from a famil-
iar flower, the daffodil.
Potrykus's development of transgenic rice to combat
dietary deficiencies involved no subtle tricks, just
straightforward bioengineering and the will to get the job
done. The transgenic rice he has developed will directly
improve the lives of millions of people. His work is rep-
410 Part V Molecular Genetics
Daffodil
Ferritin gene is
transferred into
rice from beans.
Phytase gene is
transferred into
rice from a fungus.
Metallothionin gene
is transferred into
rice from wild rice.
Enzymes for beta-carotene
synthesis are transferred
into rice from daffodils.
Fe Pt S
Rice
chromosome
A
1
A
2
A
3
A
4
Ferritin protein
increases iron
content of rice.
Phytate, which
inhibits iron reabsorption,
is destroyed by the
phytase enzyme.
Metallothionin protein
supplies extra sulfur
to increase iron uptake.
Beta-carotene, a
precursor to vitamin A,
is synthesized.
Beans Aspergillus fungus Wild rice
FIGURE 19.21
Transgenic rice. Developed
by Swiss bioengineer Ingo
Potrykus, transgenic rice
offers the promise of
improving the diets of
people in rice-consuming
developing countries, where
iron and vitamin A
deficiencies are a serious
problem.
resentative of the very real promise of genetic engineer-
ing to help meet the challenges of the coming new
millennium.
The list of gene modifications that directly aid con-
sumers will only grow. In Holland, Dutch bioengineers an-
nounced last month that they are genetically engineering
plants to act as vaccine-producing factories! To petunias
they have added a gene for a vaccine against dog par-
vovirus, hiding the gene within the petunia genes that di-
rect nectar production. The drug is produced in the nec-
tar, collected by bees, and extracted from the honey. It is
hard to believe this isn't science fiction. Clearly, the real
promise of plant genetic engineering lies ahead, and not
very far.
Farm Animals
The gene encoding the growth hormone somatotropin
was one of the first to be cloned successfully. In 1994,
Monsanto received federal approval to make its recombi-
nant bovine somatotropin (BST) commercially available,
and dairy farmers worldwide began to add the hormone
as a supplement to their cows’ diets, increasing the ani-
mals’ milk production (figure 19.22). Genetically engi-
neered somatotropin is also being tested to see if it in-
creases the muscle weight of cattle and pigs, and as a
treatment for human disorders in which the pituitary
gland fails to make adequate levels of somatotropin, pro-
ducing dwarfism. BST ingested in milk or meat has no
effect on humans, because it is a protein and is digested
in the stomach. Nevertheless, BST has met with some
public resistance, due primarily to generalized fears of
gene technology. Some people mistrust milk produced
through genetic engineering, even though the milk itself
is identical to other milk. Problems concerning public
perception are not uncommon as gene technology makes
an even greater impact on our lives.
Transgenic animals engineered to have specific desirable
genes are becoming increasingly available to breeders.
Now, instead of selectively breeding for several generations
to produce a racehorse or a stud bull with desirable quali-
ties, the process can be shortened by simply engineering
such an animal right at the start.
Gene technology is revolutionizing agriculture,
increasing yields and resistance to pests, and producing
animals with desirable traits.
Chapter 19 Gene Technology 411
Bovine somatotropin
production
Escherichia coli
Gene
of interest
Cow DNA
Plasmid
1. Plasmid is removed
and cut open with
restriction endonuclease.
2. Cow somatotropin
gene is isolated
from cow cell.
3. Somatotropin gene is
inserted into bacterial
plasmid.
4. Plasmid is reintroduced
into bacterium.
5. Bacteria producing
bovine somatotropin
are grown in
fermentation tanks.
6. Somatotropin is
removed from
bacteria and purified.
7. Bovine somatotropin
is administered to
cow to enhance
milk production.
FIGURE 19.22
The production of bovine somatotropin (BST) through genetic
engineering. Although BST is functional, harmless, and sanctioned by the
FDA, much controversy exists over whether it is actually desirable.
Cloning
The difficulty in using transgenic animals to improve live-
stock is in getting enough of them. Breeding produces off-
spring only slowly, and recombination acts to undo the
painstaking work of the genetic engineer. Ideally, one
would like to “Xerox” many exact genetic copies of the
transgenic strain—but until 1997 it was commonly ac-
cepted that adult animals can’t be cloned. Now the holy
grail of agricultural genetic engineers seems within reach.
In 1997, scientists announced the first successful cloning of
differentiated vertebrate tissue, a lamb grown from a cell
taken from an adult sheep. This startling result promises to
revolutionize agricultural science.
Spemann’s “Fantastical Experiment”
The idea of cloning animals was first suggested in 1938 by
German embryologist Hans Spemann (called the “father of
modern embryology”), who proposed what he called a
“fantastical experiment”: remove the nucleus from an egg
cell, and put in its place a nucleus from another cell.
It was 14 years before technology advanced far enough
for anyone to take up Spemann’s challenge. In 1952, two
American scientists, Robert Briggs and T. J. King, used
very fine pipettes to suck the nucleus from a frog egg (frog
eggs are unusually large, making the experiment feasible)
and transfer a nucleus sucked from a body cell of an adult
frog into its place. The experiment did not work when
done this way, but partial success was achieved 18 years
later by the British developmental biologist John Gurdon,
who in 1970 inserted nuclei from advanced frog embryos
rather than adult tissue. The frog eggs developed into tad-
poles, but died before becoming adults.
The Path to Success
For 14 years, nuclear transplant experiments were at-
tempted without success. Technology continued to advance
however, until finally in 1984, Steen Willadsen, a Danish
embryologist working in Texas, succeeded in cloning a
sheep using a nucleus from a cell of an early embryo. This
exciting result was soon replicated by others in a host of
other organisms, including cattle, pigs, and monkeys.
Only early embryo cells seemed to work, however. Re-
searchers became convinced that animal embryo cells be-
come irreversibly “committed” after the first few cell divi-
sions. After that, nuclei from differentiated animal cells
cannot be used to clone entire organisms.
We now know this conclusion to have been unwar-
ranted. The key advance for unraveling this puzzle was
made in Scotland by geneticist Keith Campbell, a specialist
in studying the cell cycle of agricultural animals. By the
early 1990s, knowledge of how the cell cycle is controlled,
advanced by cancer research, had led to an understanding
that cells don’t divide until conditions are appropriate. Just
as a washing machine checks that the water has completely
emptied before initiating the spin cycle, so the cell checks
that everything needed is on hand before initiating cell di-
vision. Campbell reasoned: “Maybe the egg and the do-
nated nucleus need to be at the same stage in the cell
cycle.”
This proved to be a key insight. In 1994 researcher Neil
First, and in 1995 Campbell himself working with repro-
ductive biologist Ian Wilmut, succeeded in cloning farm
animals from advanced embryos by first starving the cells,
so that they paused at the beginning of the cell cycle at the
G
1
checkpoint. Two starved cells are thus synchronized at
the same point in the cell cycle.
412 Part V Molecular Genetics
Nucleus containing
source DNA
Mammary cell is extracted
and grown in nutrient-
deficient solution that arrests
the cell cycle.
Egg cell is extracted.
Nucleus is removed
from egg cell with a
micropipette.
Mammary cell is inserted
inside covering of egg cell.
Electric shock opens cell
membranes and triggers
cell division.
Preparation Cell fusion Cell division
FIGURE 19.23
Wilmut’s animal cloning experiment. Wilmut combined a nucleus from a mammary cell and an egg cell (with its nucleus removed) to
successfully clone a sheep.
Wilmut’s Lamb
Wilmut then set out to attempt the key breakthrough, the
experiment that had eluded researchers since Spemann
proposed it 59 years before: to transfer the nucleus from an
adult differentiated cell into an enucleated egg, and allow
the resulting embryo to grow and develop in a surrogate
mother, hopefully producing a healthy animal.
Wilmut removed mammary cells from the udder of a
six-year-old sheep (figure 19.23). The origin of these cells,
gave the clone its name, “Dolly” after the country singer
Dolly Parton. The cells were grown in tissue culture, and
some frozen so that in the future it would be possible with
genetic fingerprinting to prove that a clone was indeed ge-
netically identical with the six-year-old sheep.
In preparation for cloning, Wilmut’s team reduced for
five days the concentration of serum on which the sheep
mammary cells were subsisting. In parallel preparation,
eggs obtained from a ewe were enucleated, the nucleus of
each egg carefully removed with a micropipette.
Mammary cells and egg cells were then surgically com-
bined in January of 1996, the mammary cells inserted in-
side the covering around the egg cell. Wilmut then applied
a brief electrical shock. A neat trick, this causes the plasma
membranes surrounding the two cells to become leaky, so
that the contents of the mammary cell passes into the egg
cell. The shock also kick-starts the cell cycle, causing the
cell to begin to divide.
After six days, in 30 of 277 tries, the dividing embryo
reached the hollow-ball “blastula” stage, and 29 of these
were transplanted into surrogate mother sheep. A little
over five months later, on July 5, 1997, one sheep gave
birth to a lamb. This lamb, “Dolly,” was the first successful
clone generated from a differentiated animal cell.
The Future of Cloning
Wilmut’s successful cloning of fully differentiated sheep
cells is a milestone event in gene technology. Even though
his procedure proved inefficient (only one of 277 trials suc-
ceeded), it established the point beyond all doubt that
cloning of adult animal cells can be done. In the following
four years researchers succeeded in greatly improving the
efficiency of cloning. Seizing upon the key idea in
Wilmut’s experiment, to clone a resting-stage cell, they
have returned to the nuclear transplant procedure pio-
neered by Briggs and King. It works well. Many different
mammals have been successfully cloned including mice,
pigs, and cattle.
Transgenic cloning can be expected to have a major im-
pact on medicine as well as agriculture. Animals with
human genes can be used to produce rare hormones. For
example, sheep that have recently been genetically engi-
neered to secrete a protein called alpha-1 antitrypsin (help-
ful in relieving the symptoms of cystic fibrosis) into their
milk may be cloned, greatly cheapening the production of
this expensive drug.
It is impossible not to speculate on the possibility of
cloning a human. There is no reason to believe such an ex-
periment would not work, but many reasons to question
whether it should be done. Because much of Western
thought is based on the concept of human individuality, we
can expect the possibility of human cloning to engender
considerable controversy.
Recent experiments have demonstrated the possibility
of cloning differentiated mammalian tissue, opening the
door for the first time to practical transgenic cloning of
farm animals.
Chapter 19 Gene Technology 413
Embryo
Embryo is implanted
into surrogate mother.
Embryo begins to
develop in vitro.
After a five-month
pregancy, a lamb
genetically identical
to the sheep from
which the mammary
cell was extracted is
born.
Development Implantation Birth of clone Growth to adulthood
Stem Cells
Since the isolation of embryonic stem cells in 1998, labs all
over the world have been exploring the possibility of using
stem cells to restore damaged or lost tissue. Exciting results
are now starting to come in.
What is a stem cell? At the dawn of a human life, a
sperm fertilizes an egg to create a single cell destined to be-
come a child. As development commences, that cell begins
to divide, producing a small ball of a few dozen cells. At
this very early point, each of these cells is identical. We call
these cells embryonic stem cells. Each one of them is capable
by itself of developing into a healthy individual. In cattle
breeding, for example, these cells are frequently separated
by the breeder and used to produce multiple clones of valu-
able offspring.
The exciting promise of these embryonic stem cells is
that, because they can develop into any tissue, they may
give us the ability to restore damaged heart or spine tissue
(figure 19.24). Experiments have already been tried suc-
cessfully in mice. Heart muscle cells have been grown from
mouse embryonic stem cells and successfully integrated
with the heart tissue of a living mouse. This suggests that
the damaged heart muscle of heart attack victims might be
reparable with stem cells, and that injured spinal cords
might be repairable. These very promising experiments are
being pursued aggressively. They are, however, quite con-
troversial, as embryonic stem cells are typically isolated
from tissue of discarded or aborted embryos, raising serious
ethical issues.
Tissue-Specific Stem Cells
New results promise a neat way around the ethical maze
presented by stem cells derived from embryos. Go back for
a moment to what we were saying about how a human
child develops. What happens next to the embryonic stem
cells? They start to take different developmental paths.
Some become destined to form nerve tissue and, after this
decision is taken, cannot ever produce any other kind of
cell. They are then called nerve stem cells. Others become
specialized to produce blood, still others muscle. Each
major tissue is represented by its own kind of tissue-specific
stem cell. Now here’s the key point: as development pro-
ceeds, these tissue-specific stem cells persist. Even in
adults. So why not use these adult cells, rather than embry-
onic stem cells?
Transplanted Tissue-Specific Stem Cells Cure
MS in Mice
In pathfinding 1999 laboratory experiments by Dr. Evan
Snyder of Harvard Medical School, tissue-specific stem
cells were able to restore lost brain tissue. He and his co-
workers injected neural stem cells (immediate descendants
of embryonic stem cells able to become any kind of neural
cell) into the brains of newborn mice with a disease resem-
bling multiple sclerosis (MS). These mice lacked the cells
that maintain the layers of myelin insulation around signal-
conducting nerves. The injected stem cells migrated all
over the brain, and were able to convert themselves into
the missing type of cell. The new cells then proceeded to
repair the ravages of the disease by replacing the lost insu-
lation of signal-conducting nerve cells. Many of the treated
mice fully recovered. In mice at least, tissue-specific stem
cells offer a treatment for MS.
The approach seems very straightforward, and should
apply to humans. Indeed, blood stem cells are already rou-
tinely used in humans to replenish the bone marrow of can-
cer patients after marrow-destroying therapy. The problem
414 Part V Molecular Genetics
Once sperm cell and egg
cell have joined, cell cleavage
produces a blastocyst. The
inner cell mass of the
blastocyst develops into the
human embryo.
Biologists have cultured
embryonic stem cells from
both the inner cell mass and
embryonic germ cells, which
escape early differentiation.
Egg
Sperm
Blastocyst
Embryo
Embryonic stem-cell
culture
Inner cell
mass
FIGURE 19.24
Using embryonic stem cells to restore
damaged tissue. Embyronic stem cells can
develop into any body tissue. Methods for
growing the tissue and using it to repair
damaged tissue in adults, such as the brain
cells of multiple sclerosis patients, heart
muscle, and spinal nerves, are being
developed.
with extending the approach to other kinds of tissue-
specific stem cells is that it has not always been easy to find
the kind of tissue-specific stem cell you want.
Transplanted Stem Cells Reverse Juvenile
Diabetes in Mice
Very promising experiments carried out in 2000 by Dr.
Ammon Peck and a team of researchers at the University of
Florida concern a particularly vexing problem, that of
type 1 or juvenile diabetes. A person with juvenile diabetes
lacks insulin-producing pancreas cells, because their im-
mune system has mistakenly turned against them and de-
stroyed them. They are no longer able to produce enough
insulin to control their blood sugar levels and must take in-
sulin daily. Adding back new insulin-producing cells called
islet cells has been tried many times, but doesn’t work well.
Immune cells continue to destroy them.
Peck and his team reasoned, why not add instead the
stem cells that produce islet cells? They would be able to
produce a continuous supply of new islet cells, replacing
those lost to immune attack. Because there would always be
cells to make insulin, the diabetes would be cured.
No one knew just what such a stem cell looked like, but
the researchers knew they come from the epithelial cells
that line the pancreas ducts. Surely some must still lurk
there unseen. So the research team took a bunch of these
epithelial cells from mice and grew them in tissue culture
until they had lots of them.
Were the stem cells they sought present in the cell cul-
ture they had prepared? Yes. In laboratory dishes the cell
culture produced insulin in response to sugar, indicating
islet cells had developed in the growing culture, islet cells
that must have been produced from stem cells.
Now on to juvenile diabetes. The scientists injected
their cell culture into the pancreas of mice specially bred to
develop juvenile diabetes. Unable to manufacture their own
insulin because they had no islet cells, these diabetic mice
could not survive without daily insulin. What happened?
The diabetes was reversed! The mice no longer required
insulin.
Impatient to see in more detail what had happened, the
researchers sacrificed the mice and examined the cells of
their pancreas. The mice appeared to have perfectly normal
islet cells.
One might have wished the researchers waited a little
longer before terminating the experiment. It is not clear
whether the cure was transitory or long term. Still, there is
no escaping the conclusion that injection of a culture of
adult stem cells cured their juvenile diabetes.
While certainly encouraging, a mouse is not a human,
and there is no guarantee the approach will work in hu-
mans. But there is every reason to believe it might. The ex-
periment is being repeated now with humans. People suf-
fering from juvenile diabetes are being treated with human
pancreatic duct cells obtained from people who have died
and donated their organs for research. No ethical issues
arise from using cells of adult organ donors, and initial re-
sults look promising.
Transplanted stem cells may allow us to replace
damaged or lost tissue, offering cures for many
disorders that cannot now be treated. Current work
focuses on tissue-specific stem cells, which do not
present the ethical problems that embryonic stem
cells do.
Chapter 19 Gene Technology 415
For use in therapy, the
embryonic stem cells are
genetically engineered to match
the patient's immune system:
the stem cells' self-recognition
genes are replaced with the
patient's self-recognition genes.
The stem cells are grown to
produce whatever type of tissue
is needed by the patient.
The tissue cells are injected into
the patient where needed. Once
in place, the tissue cells
respond to local chemical
signals, adding to or replacing
damaged cells.
Embryonic
stem cell
Patient
Tissue cells
Patient's self-recognition genes
Ethics and Regulation
The advantages afforded by genetic engineering are revolu-
tionizing our lives. But what are the disadvantages, the po-
tential costs and dangers of genetic engineering? Many
people, including influential activists and members of the
scientific community, have expressed concern that genetic
engineers are “playing God” by tampering with genetic
material. For instance, what would happen if one frag-
mented the DNA of a cancer cell, and then incorporated
the fragments at random into vectors that were propagated
within bacterial cells? Might there not be a danger that
some of the resulting bacteria would transmit an infective
form of cancer? Could genetically engineered products ad-
ministered to plants or animals turn out to be dangerous
for consumers after several generations? What kind of un-
foreseen impact on the ecosystem might “improved” crops
have? Is it ethical to create “genetically superior” organ-
isms, including humans?
How Do We Measure the Potential Risks of
Genetically Modified Crops?
While the promise of genetic engineering is very much in
evidence, this same genetic engineering has this summer
been the cause of outright war between researchers and
protesters in England. In June 1999, British protesters at-
tacked an experimental plot of genetically modified (GM)
sugar beets; the following August they destroyed a test field
of GM canola (used for cooking oil and animal feed). The
contrast could not be more marked between American ac-
ceptance of genetically modified crops on the one hand,
and European distrust of genetically modified foods, on the
other. The intense feelings generated by this dispute point
to the need to understand how we measure the risks asso-
ciated with the genetic engineering of plants.
Two sets of risks need to be considered. The first stems
from eating genetically modified foods, the other concerns
potential ecological effects.
Is Eating Genetically Modified Food Dangerous? Pro-
testers worry that genetically modified food may have been
rendered somehow dangerous. To sort this out, it is useful
to bear in mind that bioengineers modify crops in two quite
different ways. One class of gene modification makes the
crop easier to grow; a second class of modification is in-
tended to improve the food itself.
The introduction of Roundup-resistant soybeans to Eu-
rope is an example of the first class of modification. This
modification has been very popular with farmers in the
United States, who planted half their crop with these soy-
beans in 1999. They like GM soybeans because the beans
can be raised without intense cultivation (weeds are killed
with Roundup herbicide instead), which both saves money
and lessens soil erosion. But is the soybean that results nu-
tritionally different? No. The gene that confers Roundup
resistance in soybeans does so by protecting the plant's
ability to manufacture so-called "aromatic" amino acids. In
unprotected weeds, by contrast, Roundup blocks this man-
ufacturing process, killing the weed. Because humans don't
make any aromatic amino acids anyway (we get them in our
diets), Roundup doesn't hurt us. The GM soybean we eat is
nutritionally the same as an "organic" one, just cheaper to
produce.
In the second class of modification, where a gene is
added to improve the nutritional character of some food,
the food will be nutritionally different. In each of these in-
stances, it is necessary to examine the possibility that con-
sumers may prove allergic to the product of the intro-
duced gene. In one instance, for example, addition of a
methionine-enhancing gene from Brazil nut into soybeans
(which are deficient in this amino acid) was discontinued
when six of eight individuals allergic to Brazil nuts pro-
duced antibodies to the GM soybeans, suggesting the pos-
sibility of a reverse reaction. Instead, methionine levels in
GM crops are being increased with genes from sunflowers.
Screening for allergy problems is now routine.
On both scores, then, the risk of bioengineering to the
food supply seems to be very slight. GM foods to date
seem completely safe.
Are GM Crops Harmful to the Environment? What
are we to make of the much-publicized report that
Monarch butterflies might be killed by eating pollen blow-
ing out of fields planted with GM corn? First, it should
come as no surprise. The GM corn (so-called Bt corn) was
engineered to contain an insect-killing toxin (harmless to
people) in order to combat corn borer pests. Of course it
will kill any butterflies or other insects in the immediate
vicinity of the field. However, focus on the fact that the
GM corn fields do not need to be sprayed with pesticide to
control the corn borer. An estimated $9 billion in damage
is caused annually by the application of pesticides in the
United States, and billions of insects and other animals, in-
cluding an estimated 67 million birds, are killed each year.
This pesticide-induced murder of wildlife is far more dam-
aging ecologically than any possible effects of GM crops on
butterflies.
Will pests become resistant to the GM toxin? Not
nearly as fast as they now become resistant to the far higher
levels of chemical pesticide we spray on crops.
How about the possibility that introduced genes will
pass from GM crops to their wild or weedy relatives? This
sort of gene flow happens naturally all the time, and so this
is a legitimate question. But so what if genes for resistance
to Roundup herbicide spread from cultivated sugar beets to
wild populations of sugar beets in Europe? Why would that
be a problem? Besides, there is almost never a potential rel-
ative around to receive the modified gene from the GM
crop. There are no wild relatives of soybeans in Europe, for
example. Thus, there can be no gene escape from GM soy-
beans in Europe, any more than genes can flow from you to
other kinds of animals.
416 Part V Molecular Genetics
On either score, then, the risk of bioengineering to the
environment seems to be very slight. Indeed, in some cases
it lessens the serious environmental damage produced by
cultivation and agricultural pesticides.
Should We Label Genetically Modified Foods?
While there seems little tangible risk in the genetic modifi-
cation of crops, public assurance that these risks are being
carefully assessed is important. Few issues manage to raise
the temperature of discussions about plant genetic engi-
neering more than labeling of genetically modified (GM)
crops. Agricultural producers have argued that there are no
demonstrable risks, so that a GM label can only have the
function of scaring off wary consumers. Consumer advo-
cates respond that consumers have every right to make that
decision, and to the information necessary to make it.
In considering this matter, it is important to separate
two quite different issues, the need for a label, and the right
of the public to have one. Every serious scientific investi-
gation of the risks of GM foods has concluded that they are
safe—indeed, in the case of soybeans and many other crops
modified to improve cultivation, the foods themselves are
not altered in any detectable way, and no nutritional test
could distinguish them from "organic" varieties. So there
seems to be little if any health need for a GM label for ge-
netically engineered foods.
The right of the public to know what it is eating is a very
different issue. There is widespread fear of genetic manip-
ulation in Europe, because it is unfamiliar. People there
don't trust their regulatory agencies as we do here, because
their agencies have a poor track record of protecting them.
When they look at genetically modified foods, they are
haunted by past experiences of regulatory ineptitude. In
England they remember British regulators' failure to pro-
tect consumers from meat infected with mad cow disease.
It does no good whatsoever to tell a fearful European
that there is no evidence to warrant fear, no trace of data
supporting danger from GM crops. A European consumer
will simply respond that the harm is not yet evident, that
we don't know enough to see the danger lurking around
the corner. "Slow down," the European consumers say.
"Give research a chance to look around all the corners.
Lets be sure." No one can argue against caution, but it is
difficult to imagine what else researchers can look into—
safety has been explored very thoroughly. The fear re-
mains, though, for the simple reason that no amount of in-
formation can remove it. Like a child scared of a monster
under the bed, looking under the bed again doesn't help—
the monster still might be there next time. And that means
we are going to have to have GM labels, for people have
every right to be informed about something they fear.
What should these labels be like? A label that only says
"GM FOOD" simply acts as a brand—like a POISON
label, it shouts a warning to the public of lurking danger.
Why not instead have a GM label that provides informa-
tion to the consumer, that tells the consumer what regula-
tors know about that product?
(For Bt corn): The production of this food was made
more efficient by the addition of genes that made plants
resistant to pests so that less pesticides were required to
grow the crop.
(For Roundup-ready soybeans): Genes have been added
to this crop to render it resistant to herbicides—this re-
duces soil erosion by lessening the need for weed-
removing cultivation.
(For high beta-carotene rice): Genes have been added to
this food to enhance its beta-carotene content and so
combat vitamin A deficiency.
GM food labels that in each instance actually tell con-
sumers what has been done to the gene-modified crop
would go a long way toward hastening public acceptance of
gene technology in the kitchen.
Genetic engineering affords great opportunities for
progress in medicine and food production, although
many are concerned about possible risks. On balance,
the risks appear slight, and the potential benefits
substantial.
Chapter 19 Gene Technology 417
CALVIN AND HOBBES
?1995 Watterson. Dist. by
Universal Press Syndicate.
Reprinted with permission.
All rights reserved.
418 Part V Molecular Genetics
Chapter 19
Summary Questions Media Resources
19.1 The ability to manipulate DNA has led to a new genetics.
? Genetic engineering involves the isolation of specific
genes and their transfer to new genomes.
? An important component of genetic engineering
technology is a special class of enzymes called
restriction endonucleases, which cleave DNA
molecules into fragments.
? The first such recombinant DNA was made by
Cohen and Boyer in 1973, when they inserted a frog
ribosomal RNA gene into a bacterial plasmid.
1. Why do the ends of the DNA
fragments created by restriction
endonucleases enable fragments
from different genomes to be
spliced together?
? Genetic engineering experiments consist of four
stages: isolation of DNA, production of recombinant
DNA, cloning, and screening for the gene(s) of
interest.
? Preliminary screening can be accomplished by
making the desired clones resistant to an antibiotic;
hybridization can then be employed to identify the
gene of interest.
? Gene technologies, including PCR, Southern
blotting, RFLP analysis, and the Sanger method,
enable researchers to isolate genes and produce them
in large quantities.
2. Describe the procedure used
to eliminate clones that have not
incorporated a vector in a
genetic engineering experiment.
3. What is used as a probe in a
Southern blot? With what does
the probe hybridize? How are
the regions of hybridization
visualized?
19.2 Genetic engineering involves easily understood procedures.
? Extensive research on the human genome has yielded
important information about the location of genes,
such as those that may be involved in dyslexia,
obesity, and resistance to high blood cholesterol
levels.
? Gene splicing holds great promise as a clinical tool,
particularly in the prevention of disease with
bioengineered vaccines.
? A major focus of genetic engineering activity has been
agriculture, where genes conferring resistance to
herbicides or insect pests have been incorporated into
crop plants.
? Recent experiments open the way for cloning of
genetically altered animals and suggest that human
cloning is feasible.
? The impact of genetic engineering has skyrocketed
over the past decade, providing many useful
innovations for society; its moral and ethical aspects
still provide a topic for heated debates.
4. What is the primary vector
used to introduce genes into
plant cells? What types of plants
are generally infected by this
vector? Describe three examples
of how this vector has been used
for genetic engineering, and
explain the agricultural
significance of each example.
5. How is the genetic
engineering of bovine
somatotropin (BST) used to
increase milk production in the
dairy industry? What effect
would BST in milk have on
persons who drink it?
19.3 Biotechnology is producing a scientific revolution.
www.mhhe.com www.biocourse.com
? Experiment:
Cohen/Boyer/Berg-
The first Genetically
Engineered Organism
? Student Research:
Homeobox Genes in
the Medicinal Leech
? Polymerase Chain
Reaction
? Recombinant
? On Science Article:
How Genetic
Engineering is Done
? Exploration: DNA
from Real Court Cases
On Science Articles:
? The Real Promise of
Plant Genetic
Engineering
? Should We Label
Genetically Modified
Foods?
? Measuring Risks of
Genetically Modified
Crops
? The Search for the
Natural Relatives of
Cassava
? Renouncing the
Terminator
? Frankenstein Grass is
Poised to Invade my
Back Yard
? The Road to Dolly
? Should a Clone Have
Rights?
? Who Should Own the
Secrets of Your Genes?
419
Catching evolution in action
A hundred years ago Charles Darwin’s theory of evolution
by natural selection was taught as the foundation of biology
in public schools throughout the United States. Then
something happened. In the 1920s, conservative religious
groups began to argue against the teaching of evolution in
our nation's schools. Darwinism, they said, contradicted
the revealed word of God in the Bible and thus was a direct
attack on their religious beliefs. Many of you will have read
about the 1925 Scopes "monkey trial" or seen the move
about it, Inherit the Wind. In the backwash of this contro-
versy, evolution for the first time in this century disap-
peared from the schools. Textbook publishers and local
school boards, in a wish to avoid the dispute, simply chose
not to teach evolution. By 1959, 100 years after Darwin's
book, a famous American geneticist cried in anguish, "A
hundred years without Darwin is enough!" What he meant
was that the theory of evolution by natural selection has be-
come the central operating concept of the science of biol-
ogy, organic evolution being one of the most solidly vali-
dated facts of science. How could we continue to hide this
truth from our children, crippling their understanding of
science?
In the 1970s, Darwin reappeared in our nation's schools,
part of the wave of concern about science that followed
Sputnik. Not for long, however. Cries from creationists for
equal time in the classroom soon had evolution out of our
classrooms again. Only in recent years, amid considerable
uproar, have states like California succeeded in reforming
their school curriculums, focusing on evolution as the cen-
tral principle of biology. In other states, teaching Darwin
remains controversial.
While Darwin’s proposal that evolution occurs as the
result of natural selection remains controversial in many
local school boards, it is accepted by practically every biol-
ogist who has examined it seriously. In this section, we will
review the evidence supporting Darwin’s theory. Evolu-
tionary biology is unlike most other fields of biology in
which hypotheses are tested directly with experimental
methods. To study evolution, we need to investigate what
happened in the past, sometimes many millions of years
ago. In this way, evolutionary biology is similar to astron-
omy and history, relying on observation and deduction
rather than experiment and induction to examine ideas
about past events.
Nonetheless, evolutionary biology is not entirely an ob-
servational science. Darwin was right about many things,
but one area in which he was mistaken concerns the pace
at which evolution occurs. Darwin thought that evolution
occurred at a very slow, almost imperceptible, pace. How-
ever, in recent years many case studies of natural popula-
tions have demonstrated that in some circumstances evolu-
tionary change can occur rapidly. In these instances, it is
possible to establish experimental studies to directly test
evolutionary hypotheses. Although laboratory studies on
fruit flies and other organisms have been common for
more than 50 years, it has only been in recent years that
scientists have started conducting experimental studies of
evolution in nature.
To conduct experimental tests of evolution, it is first nec-
essary to identify a population in nature upon which strong
selection might be operating (see above). Then, by manipu-
lating the strength of the selection, an investigator can pre-
dict what outcome selection might produce, then look and
see the actual effect on the population.
Part
VI
Evolution
The evolution of protective coloration in guppies. In pools
below waterfalls where predation is high, guppies are drab
colored. In the absence of the highly predatory pike cichlid,
guppies in pools above waterfalls are much more colorful and
attractive to females. The evolution of these differences can be
experimentally tested.

