生物学（英文版）：2

205 Why Do Some Genes Maintain More Than One Common Allele in a Population? When Mendel did his crosses of pea plants, he knew what a pea plant was supposed to look like: a small plant with green leaves, purple flowers, and smooth seeds. But if all pea plants were like that, he would never have been able to sort out the rules of heredity—in a cross of green peas with green peas, there would have been no visible differences to reveal the 3:1 pattern of gene segregation. The variant alleles that Mendel employed in his studies—yellow leaves, white flow- ers, wrinkled seeds—were rare “accidents” maintained in seed collections for their novelty. In nature, such unusual kinds of peas had never been encountered by Mendel. By the time Mendel’s work was rediscovered in 1900, Darwin had provided a ready explanation of why alterna- tive alleles seemed to be rare in natural populations. Nat- ural selection was simply scouring the population, cleansing it in each generation of less fit alternatives. While recombi- nation can complicate the process in interesting ways among sexual organisms like peas, asexual organisms like bacteria were predicted to be very sensitive to the effects of selection. Left to do its work, natural selection should crown as winner in bacterial population the best allele of each gene, producing a uniform population. Why do populations contain variants at all? In 1932 the famous geneticist Herman Muller formulated what has come to be called the “classical model,” explaining gene variation in natural populations of asexual organisms as a temporary, transient condition, new variations arising by random muta- tion only to be established or eliminated by selection. Except for the brief periods when populations are undergoing this periodic cleansing, they should remain genetically uniform. The removal of variants was proposed to be a very straightforward process. During the periodic cleansing pe- riods envisioned by Muller, his classical model operates under a “competitive exclusion” principle first proposed by Gause: whenever a new variant appears, it is weighed in the balance by natural selection, and either wins or loses. There are no ties. One version of the gene becomes univer- sal in the population, and the other is eliminated. Muller’s classical model thus makes a very straightfor- ward prediction: in nature, most populations of asexual organisms should be genetically uniform most of the time. However, this is not at all what is observed. Natural popu- lations of most species, including asexual ones like bacteria, appear to have lots of common variants—they are said to be “polymorphic.” So where are all of these variants coming from? Varia- tion in the environment, either spatial or temporal, can be used to explain how some polymorphisms arise. Selection favors one form at a particular place and time, a different form at a different place or time. In a nutshell, varying selection can encourage polymorphism. Is that all there is to it? Is it really impossible for more than one variant to become common in a population, if the population lives in a constant uniform environment, an en- vironment that does not vary from one place to another or from one time to another? Theory says so. Biologists that study microbial communities have begun to report that bacteria are not aware of Muller’s theory. Bacterial cultures started from a single cell living in simple unstructured environments rapidly become polymorphic. There is a way to reconcile theory and experiment. Per- haps the variant individuals in the population are interact- ing with one another. Muller’s theory assumes that every individual undergoes an independent trial by selection. But what if that’s not so? What if different kinds of individuals help each other out? Stable coexistence of variants in a population might be possible if interactions between them contribute to the welfare of both (what a biologist calls mu- tualism) or favors one (what a biologist calls commensal- ism). In essence, cooperation would be counterbalancing the effects of competition. Part .04 μm IV Reproduction and Heredity These bacterial cells are dividing.As the population grows, gene variants arise by mutation. Do the new variants persist, or are they eliminated by natural selection? Real People Doing Real Science The Experiment To investigate this intriguing possibility, Julian Adams and co-workers at the University of Michigan set out to see if polymorphism for metabolic abilities would de- velop spontaneously in bacteria growing in a uniform environment. For a bacterial subject they chose Escherichia coli (E. coli), a widely studied bacterium whose growth under laboratory conditions is well understood. Cultures of Escherichia coli can be maintained in chemostat culture for many hundreds of generations. A chemostat is a large container holding liquid culture medium. A little bit of the liquid is continuously removed, and an equal amount of fresh culture medium added to replace what leaves. The growth of the E. coliculture is limited by the amount of glucose remaining in the culture medium to feed the growing cells. Researchers inoculated a glucose-limited chemostat cul- ture media with the E. colistrain JA122, and maintained the continuous culture for 773 generations. A sample was taken from the chemostat after 773 generations and ana- lyzed for the presence of new strains of E. coli. Any varia- tion among the cells in the sample would indicate that polymorphism had arisen. To detect metabolic variation within the sample of growing cells, Adams’s team analyzed the rate of glucose uptake and the concentration of acetate, among other variables. By examining such biochemical parameters, the researchers could determine if the different strains were filling different metabolic “niches”—that is, using the metabolic environment in different ways. Metabolic niches were characterized by looking at the normal prod- ucts of aerobic fermentation, acetate and glycerol, which appear in the growth medium as a by-product of E. coli metabolism. To further classify the strains, batch cultures containing two strains were established to analyze interactions be- tween the two groups. The Results Three distinct variants were detected in the 773-generation E. coli, each being maintained at stable levels in the contin- uously growing culture. Clearly polymorphism can appear within an initially uniform bacterial population growing in a simple homogeneous environment. When mixed together and allowed to compete, one strain does not drive the other two to extinction, as theory had predicted. Instead, the three new strains, CV101, CV103, and CV116, all persist (see graph aabove). The three strains were then analyzed to see how they differed. CV103 exhibited the highest rate of glucose up- take and produced the most acetate (an end product of glu- cose aerobic fermentation). Is this difference important? To see, the CV103 strain was co-cultured with CV101. They maintained stable growth levels, which indicated that the contribution of the third strain, CV116, was not re- quired to maintain their growth. What is the difference between CV101 and CV103? CV101 could grow in culture filtrate of CV103 but in the reverse situation, CV103 could not grow. This indicates that CV103 secretes a substance upon which CV101 can grow. Is CV101 utilizing the acetate produced by CV103 as its carbon source? To test this possibility, CV101 and CV103 were grown together in media with acetate as the only carbon source. The results from this experiment are shown in graph b above and indicate that CV101 thrives on an acetate carbon source, while CV103 does not and requires an additional carbon source such as glucose. These results indicate that two of the strains are main- tained in polymorphism at stable levels because they have evolved different adaptations that allow them to coexist by filling different niches. One strain (CV101) is maintained in the population because it is able to use a metabolic by- product released by another strain (CV103). Generations 0.4 0.6 0.8 Frequency in population Population growth (A 420 nm)1.0 10 20 30 0.2 0.0 Time (hours) 0.02 0.04 0.06 10 20 30 40 0.00 CV101 strain CV103 strain CV116 strain (b)(a) CV101 strain Acetate media CV103 strain Maintaining stable polymorphism.(a) Three new strains emerge in culture and are maintained. (b) Two strains are grown on media containing acetate. The strain CV103 was found to excrete acetate, while the strain CV101 was found to thrive in media with acetate as the sole source of carbon. Population growth is measured by an increase in the turbidity of the liquid medium; turbidity is measured as an increase in light absorbance at a wavelength of 420 nm (A 420 nm). To explore this experiment further, go to the Virtual Lab at www.mhhe.com/raven6/vlab4.mhtml 207 11 How Cells Divide Concept Outline 11.1 Bacteria divide far more simply than do eukaryotes. Cell Division in Prokaryotes. Bacterial cells divide by splitting in two. 11.2 Chromosomes are highly ordered structures. Discovery of Chromosomes. All eukaryotic cells contain chromosomes, but different organisms possess differing numbers of chromosomes. The Structure of Eukaryotic Chromosomes. Proteins play an important role in packaging DNA in chromosomes. 11.3 Mitosis is a key phase of the cell cycle. Phases of the Cell Cycle. The cell cycle consists of three growth phases, a nuclear division phase, and a cytoplasmic division stage. Interphase: Preparing for Mitosis. In interphase, the cell grows, replicates its DNA, and prepares for cell division. Mitosis. In prophase, the chromosomes condense and microtubules attach sister chromosomes to opposite poles of the cell. In metaphase, chromosomes align along the center of the cell. In anaphase, the chromosomes separate; in telophase the spindle dissipates and the nuclear envelope reforms. Cytokinesis. In cytokinesis, the cytoplasm separates into two roughly equal halves. 11.4 The cell cycle is carefully controlled. General Strategy of Cell Cycle Control. At three points in the cell cycle, feedback from the cell determines whether the cycle will continue. Molecular Mechanisms of Cell Cycle Control. Special proteins regulate the “checkpoints” of the cell cycle. Cancer and the Control of Cell Proliferation. Cancer results from damage to genes encoding proteins that regulate the cell division cycle. A ll species of organisms—bacteria, alligators, the weeds in a lawn—grow and reproduce. From the smallest of creatures to the largest, all species produce offspring like themselves and pass on the hereditary information that makes them what they are. In this chapter, we begin our consideration of heredity with an examination of how cells reproduce (figure 11.1). The mechanism of cell reproduc- tion and its biological consequences have changed signifi- cantly during the evolution of life on earth. FIGURE 11.1 Cell division in bacteria.It’s hard to imagine fecal coliform bacteria as beautiful, but here is Escherichia coli,inhabitant of the large intestine and the biotechnology lab, spectacularly caught in the act of fission. cells are much larger than bacteria, and their genomes con- tain much more DNA. Eukaryotic DNA is contained in a number of linear chromosomes, whose organization is much more complex than that of the single, circular DNA mole- cules in bacteria. In chromosomes, DNA forms a complex with packaging proteins called histones and is wound into tightly condensed coils. Bacteria divide by binary fission. Fission begins in the middle of the cell. An active partitioning process ensures that one genome will end up in each daughter cell. 208 Part IV Reproduction and Heredity Cell Division in Prokaryotes In bacteria, which are prokaryotes and lack a nucleus, cell division consists of a simple procedure called binary fission (literally, “splitting in half”), in which the cell divides into two equal or nearly equal halves (figure 11.2). The genetic information, or genome, replicates early in the life of the cell. It exists as a single, circular, double-stranded DNA mole- cule. Fitting this DNA circle into the bacterial cell is a re- markable feat of packaging—fully stretched out, the DNA of a bacterium like Escherichia coli is about 500 times longer than the cell itself. The DNA circle is attached at one point to the cytoplas- mic surface of the bacterial cell’s plasma membrane. At a specific site on the DNA molecule called the replication ori- gin, a battery of more than 22 different proteins begins the process of copying the DNA (figure 11.3). When these en- zymes have proceeded all the way around the circle of DNA, the cell possesses two copies of the genome. These “daughter” genomes are attached side-by-side to the plasma membrane. The growth of a bacterial cell to about twice its initial size induces the onset of cell division. A wealth of recent ev- idence suggests that the two daughter chromosomes are ac- tively partitioned during this process. As this process pro- ceeds, the cell lays down new plasma membrane and cell wall materials in the zone between the attachment sites of the two daughter genomes. A new plasma membrane grows between the genomes; eventually, it reaches all the way into the center of the cell, dividing it in two. Because the mem- brane forms between the two genomes, each new cell is as- sured of retaining one of the genomes. Finally, a new cell wall forms around the new membrane. The evolution of the eukaryotes introduced several addi- tional factors into the process of cell division. Eukaryotic 11.1 Bacteria divide far more simply than do eukaryotes. FIGURE 11.2 Fission (40,000H11547).Bacteria divide by a process of simple cell fission. Note the newly formed plasma membrane between the two daughter cells. Replication origin FIGURE 11.3 How bacterial DNA replicates.The replication of the circular DNA molecule (blue) that constitutes the genome of a bacterium begins at a single site, called the replication origin. The replication enzymes move out in both directions from that site and make copies (red) of each strand in the DNA duplex. When the enzymes meet on the far side of the molecule, replication is complete. Discovery of Chromosomes Chromosomes were first observed by the German embryol- ogist Walther Fleming in 1882, while he was examining the rapidly dividing cells of salamander larvae. When Fleming looked at the cells through what would now be a rather primitive light microscope, he saw minute threads within their nuclei that appeared to be dividing lengthwise. Flem- ing called their division mitosis, based on the Greek word mitos,meaning “thread.” Chromosome Number Since their initial discovery, chromosomes have been found in the cells of all eukaryotes examined. Their number may vary enormously from one species to another. A few kinds of organisms—such as the Australian ant Myrmecia, the plant Haplopappus gracilis, a relative of the sunflower that grows in North American deserts; and the fungus Penicillium—have only 1 pair of chromosomes, while some ferns have more than 500 pairs (table 11.1). Most eukaryotes have between 10 and 50 chromosomes in their body cells. Human cells each have 46 chromosomes, consist- ing of 23 nearly identical pairs (figure 11.4). Each of these 46 chromosomes contains hundreds or thou- sands of genes that play important roles in determin- ing how a person’s body develops and functions. For this reason, possession of all the chromosomes is es- sential to survival. Humans missing even one chro- mosome, a condition called monosomy, do not sur- vive embryonic development in most cases. Nor does the human embryo develop properly with an extra copy of any one chromosome, a condition called tri- somy. For all but a few of the smallest chromosomes, trisomy is fatal, and even in those few cases, serious problems result. Individuals with an extra copy of the very small chromosome 21, for example, develop more slowly than normal and are mentally retarded, a condition called Down syndrome. All eukaryotic cells store their hereditary information in chromosomes, but different kinds of organisms utilize very different numbers of chromosomes to store this information. Chapter 11 How Cells Divide 209 11.2 Chromosomes are highly ordered structures. FIGURE 11.4 Human chromosomes.This photograph (950×) shows human chromosomes as they appear immediately before nuclear division. Each DNA molecule has already replicated, forming identical copies held together by a constriction called the centromere. Table 11.1 Chromosome Number in Selected Eukaryotes Total Number of Total Number of Total Number of Group Chromosomes Group Chromosomes Group Chromosomes FUNGI Neurospora(haploid) 7 Saccharomyces(a yeast) 16 INSECTS Mosquito 6 Drosophila 8 Honeybee 32 Silkworm 56 PLANTS Haplopappus gracilis 2 Garden pea 14 Corn 20 Bread wheat 42 Sugarcane 80 Horsetail 216 Adder’s tongue fern 1262 VERTEBRATES Opossum 22 Frog 26 Mouse 40 Human 46 Chimpanzee 48 Horse 64 Chicken 78 Dog 78 The Structure of Eukaryotic Chromosomes In the century since discovery of chromosomes, we have learned a great deal about their structure and composition. Composition of Chromatin Chromosomes are composed of chromatin, a complex of DNA and protein; most are about 40% DNA and 60% protein. A significant amount of RNA is also associated with chromosomes because chromosomes are the sites of RNA synthesis. The DNA of a chromosome is one very long, double-stranded fiber that extends unbroken through the entire length of the chromosome. A typical human chromosome contains about 140 million (1.4 × 10 8 ) nu- cleotides in its DNA. The amount of information one chromosome contains would fill about 280 printed books of 1000 pages each, if each nucleotide corresponded to a “word” and each page had about 500 words on it. Further- more, if the strand of DNA from a single chromosome were laid out in a straight line, it would be about 5 cen- timeters (2 inches) long. Fitting such a strand into a nu- cleus is like cramming a string the length of a football field into a baseball—and that’s only 1 of 46 chromosomes! In the cell, however, the DNA is coiled, allowing it to fit into a much smaller space than would otherwise be possible. Chromosome Coiling How can this long DNA fiber coil so tightly? If we gently disrupt a eukaryotic nucleus and examine the DNA with an electron microscope, we find that it resembles a string of beads (figure 11.5). Every 200 nucleotides, the DNA du- plex is coiled around a core of eight histone proteins, form- ing a complex known as a nucleosome. Unlike most proteins, which have an overall negative charge, histones are positively charged, due to an abundance of the basic amino acids arginine and lysine. They are thus strongly at- tracted to the negatively charged phosphate groups of the 210 Part IV Reproduction and Heredity Supercoil within chromosome Chromosomes Coiling within supercoil Chromatin Chromatin fiber Nucleosome DNA Central histone DNA double helix (duplex) DNA FIGURE 11.5 Levels of eukaryotic chromosomal organization. Nucleotides assemble into long double strands of DNA molecules. These strands require further packaging to fit into the cell nucleus. The DNA duplex is tightly bound to and wound around proteins called histones. The DNA-wrapped histones are called nucleosomes.The nucleosomes then coalesce into chromatin fibers, ultimately coiling around into supercoils that make up the form of DNA recognized as a chromosome. DNA. The histone cores thus act as “magnetic forms” that promote and guide the coiling of the DNA. Further coiling occurs when the string of nucleosomes wraps up into higher order coils called supercoils. Highly condensed portions of the chromatin are called heterochromatin. Some of these portions remain perma- nently condensed, so that their DNA is never expressed. The remainder of the chromosome, called euchromatin, is condensed only during cell division, when compact packag- ing facilitates the movement of the chromosomes. At all other times, euchromatin is present in an open configura- tion, and its genes can be expressed. The way chromatin is packaged when the cell is not dividing is not well under- stood beyond the level of nucleosomes and is a topic of in- tensive research. Chromosome Karyotypes Chromosomes may differ widely in appearance. They vary in size, staining properties, the location of the centromere (a constriction found on all chromosomes), the relative length of the two arms on either side of the centromere, and the positions of constricted regions along the arms. The partic- ular array of chromosomes that an individual possesses is called its karyotype (figure 11.6). Karyotypes show marked differences among species and sometimes even among indi- viduals of the same species. To examine a human karyotype, investigators collect a cell sample from blood, amniotic fluid, or other tissue and add chemicals that induce the cells in the sample to di- vide. Later, they add other chemicals to stop cell division at a stage when the chromosomes are most condensed and thus most easily distinguished from one another. The cells are then broken open and their contents, including the chromosomes, spread out and stained. To facilitate the examination of the karyotype, the chromosomes are usually photographed, and the outlines of the chromo- somes are cut out of the photograph and arranged in order (see figure 11.6). How Many Chromosomes Are in a Cell? With the exception of the gametes (eggs or sperm) and a few specialized tissues, every cell in a human body is diploid (2n). This means that the cell contains two nearly identical copies of each of the 23 types of chromosomes, for a total of 46 chromosomes. The haploid (1n) gametes contain only one copy of each of the 23 chromosome types, while certain tissues have unusual numbers of chromo- somes—many liver cells, for example, have two nuclei, while mature red blood cells have no nuclei at all. The two copies of each chromosome in body cells are called homol- ogous chromosomes, or homologues (Greek homologia, “agreement”). Before cell division, each homologue repli- cates, producing two identical sister chromatids joined at the centromere, a condensed area found on all eukaryotic chromosomes (figure 11.7). Hence, as cell division begins, a human body cell contains a total of 46 replicated chromo- somes, each composed of two sister chromatids joined by one centromere. The cell thus contains 46 centromeres and 92 chromatids (2 sister chromatids for each of 2 homo- logues for each of 23 chromosomes). The cell is said to contain 46 chromosomes rather than 92 because, by con- vention, the number of chromosomes is obtained by count- ing centromeres. Eukaryotic genomes are larger and more complex than those of bacteria. Eukaryotic DNA is packaged tightly into chromosomes, enabling it to fit inside cells. Haploid cells contain one set of chromosomes, while diploid cells contain two sets. Chapter 11 How Cells Divide 211 FIGURE 11.6 A human karyotype.The individual chromosomes that make up the 23 pairs differ widely in size and in centromere position. In this preparation, the chromosomes have been specifically stained to indicate further differences in their composition and to distinguish them clearly from one another. Sister chromatids Homologous chromosomes Centromere FIGURE 11.7 The difference between homologous chromosomes and sister chromatids.Homologous chromosomes are a pair of the same chromosome—say, chromosome number 16. Sister chromatids are the two replicas of a single chromosome held together by the centromeres after DNA replication. Phases of the Cell Cycle The increased size and more complex organization of eu- karyotic genomes over those of bacteria required radical changes in the process by which the two replicas of the genome are partitioned into the daughter cells during cell division. This division process is diagrammed as a cell cycle,consisting of five phases (figure 11.8). The Five Phases G 1 is the primary growth phase of the cell. For many or- ganisms, this encompasses the major portion of the cell’s life span. S is the phase in which the cell synthesizes a replica of the genome. G 2 is the second growth phase, in which preparations are made for genomic separation. During this phase, mitochondria and other organelles replicate, chromosomes condense, and microtubules begin to assemble at a spindle. G 1 , S, and G 2 together constitute interphase, the portion of the cell cycle be- tween cell divisions. M is the phase of the cell cycle in which the microtubu- lar apparatus assembles, binds to the chromosomes, and moves the sister chromatids apart. Called mitosis, this process is the essential step in the separation of the two daughter genomes. We will discuss mitosis as it occurs in animals and plants, where the process does not vary much (it is somewhat different among fungi and some protists). Although mitosis is a continuous process, it is traditionally subdivided into four stages: prophase, metaphase, anaphase, and telophase. C is the phase of the cell cycle when the cytoplasm di- vides, creating two daughter cells. This phase is called cytokinesis. In animal cells, the microtubule spindle helps position a contracting ring of actin that constricts like a drawstring to pinch the cell in two. In cells with a cell wall, such as plant cells, a plate forms between the di- viding cells. Duration of the Cell Cycle The time it takes to complete a cell cycle varies greatly among organisms. Cells in growing embryos can com- plete their cell cycle in under 20 minutes; the shortest known animal nuclear division cycles occur in fruit fly embryos (8 minutes). Cells such as these simply divide their nuclei as quickly as they can replicate their DNA, without cell growth. Half of the cycle is taken up by S, half by M, and essentially none by G 1 or G 2 . Because ma- ture cells require time to grow, most of their cycles are much longer than those of embryonic tissue. Typically, a dividing mammalian cell completes its cell cycle in about 24 hours, but some cells, like certain cells in the human liver, have cell cycles lasting more than a year. During the cycle, growth occurs throughout the G 1 and G 2 phases (referred to as “gap” phases, as they separate S from M), as well as during the S phase. The M phase takes only about an hour, a small fraction of the entire cycle. Most of the variation in the length of the cell cycle from one organism or tissue to the next occurs in the G 1 phase. Cells often pause in G 1 before DNA replication and enter a resting state called G 0 phase; they may re- main in this phase for days to years before resuming cell division. At any given time, most of the cells in an ani- mal’s body are in G 0 phase. Some, such as muscle and nerve cells, remain there permanently; others, such as liver cells, can resume G 1 phase in response to factors re- leased during injury. Most eukaryotic cells repeat a process of growth and division referred to as the cell cycle. The cycle can vary in length from a few minutes to several years. 212 Part IV Reproduction and Heredity 11.3 Mitosis is a key phase of the cell cycle. G 2 S G 1 C Metaphase Prophase Anaphase Telophase M Interphase (G 1 , S, G 2 phases) Mitosis (M) Cytokinesis (C) FIGURE 11.8 The cell cycle.Each wedge represents one hour of the 22-hour cell cycle in human cells growing in culture. G 1 represents the primary growth phase of the cell cycle, S the phase during which a replica of the genome is synthesized, and G 2 the second growth phase. Interphase: Preparing for Mitosis The events that occur during interphase, made up of the G 1 , S, and G 2 phases, are very important for the successful com- pletion of mitosis. During G 1 , cells undergo the major por- tion of their growth. During the S phase, each chromosome replicates to produce two sister chromatids, which remain at- tached to each other at the centromere. The centromere is a point of constriction on the chromosome, containing a specific DNA sequence to which is bound a disk of protein called a kinetochore. This disk functions as an attachment site for fibers that assist in cell division (figure 11.9). Each chromosome’s centromere is located at a characteristic site. The cell grows throughout interphase. The G 1 and G 2 segments of interphase are periods of active growth, when proteins are synthesized and cell organelles produced. The cell’s DNA replicates only during the S phase of the cell cycle. After the chromosomes have replicated in S phase, they remain fully extended and uncoiled. This makes them invis- ible under the light microscope. In G 2 phase, they begin the long process of condensation, coiling ever more tightly. Special motor proteins are involved in the rapid final conden- sation of the chromosomes that occurs early in mitosis. Also during G 2 phase, the cells begin to assemble the machinery they will later use to move the chromosomes to opposite poles of the cell. In animal cells, a pair of microtubule- organizing centers called centrioles replicate. All eukary- otic cells undertake an extensive synthesis of tubulin, the protein of which microtubules are formed. Interphase is that portion of the cell cycle in which the chromosomes are invisible under the light microscope because they are not yet condensed. It includes the G 1 , S, and G 2 phases. In the G 2 phase, the cell mobilizes its resources for cell division. Chapter 11 How Cells Divide 213 Metaphase chromosome Kinetochore Kinetochore microtubules Centromere region of chromosome Chromatid FIGURE 11.9 Kinetochores.In a metaphase chromosome, kinetochore microtubules are anchored to proteins at the centromere. A Vocabulary of Cell Division chromatin The complex of DNA and proteins of which eukaryotic chromosomes are composed. chromosome The structure within cells that contains the genes. In eukaryotes, it consists of a single linear DNA molecule as- sociated with proteins. The DNA is repli- cated during S phase, and the replicas sepa- rated during M phase. cytokinesis Division of the cytoplasm of a cell after nuclear division. euchromatin The portion of a chromo- some that is extended except during cell di- vision, and from which RNA is transcribed. heterochromatin The portion of a chro- mosome that remains permanently con- densed and, therefore, is not transcribed into RNA. Most centromere regions are heterochromatic. homologues Homologous chromosomes; in diploid cells, one of a pair of chromo- somes that carry equivalent genes. kinetochore A disk of protein bound to the centromere and attached to micro- tubules during mitosis, linking each chro- matid to the spindle apparatus. microtubule A hollow cylinder, about 25 nanometers in diameter, composed of sub- units of the protein tubulin. Microtubules lengthen by the addition of tubulin subunits to their end(s) and shorten by the removal of subunits. mitosis Nuclear division in which repli- cated chromosomes separate to form two genetically identical daughter nuclei. When accompanied by cytokinesis, it produces two identical daughter cells. nucleosome The basic packaging unit of eukaryotic chromosomes, in which the DNA molecule is wound around a cluster of histone proteins. Chromatin is composed of long strings of nucleosomes that resemble beads on a string. binary fission Asexual reproduction of a cell by division into two equal or nearly equal parts. Bacteria divide by binary fission. centromere A constricted region of a chromosome about 220 nucleotides in length, composed of highly repeated DNA sequences (satellite DNA). During mitosis, the centromere joins the two sister chro- matids and is the site to which the kineto- chores are attached. chromatid One of the two copies of a replicated chromosome, joined by a single centromere to the other strand. Mitosis Prophase: Formation of the Mitotic Apparatus When the chromosome condensation initiated in G 2 phase reaches the point at which individual condensed chromo- somes first become visible with the light microscope, the first stage of mitosis, prophase, has begun. The condensa- tion process continues throughout prophase; consequently, some chromosomes that start prophase as minute threads appear quite bulky before its conclusion. Ribosomal RNA synthesis ceases when the portion of the chromosome bear- ing the rRNA genes is condensed. Assembling the Spindle Apparatus. The assembly of the microtubular apparatus that will later separate the sister chromatids also continues during prophase. In ani- mal cells, the two centriole pairs formed during G 2 phase begin to move apart early in prophase, forming between them an axis of microtubules referred to as spindle fibers. By the time the centrioles reach the opposite poles of the cell, they have established a bridge of microtubules called the spindle apparatus between them. In plant cells, a similar bridge of microtubular fibers forms between op- posite poles of the cell, although centrioles are absent in plant cells. During the formation of the spindle apparatus, the nu- clear envelope breaks down and the endoplasmic reticulum reabsorbs its components. At this point, then, the micro- tubular spindle fibers extend completely across the cell, from one pole to the other. Their orientation determines the plane in which the cell will subsequently divide, through the center of the cell at right angles to the spindle apparatus. In animal cell mitosis, the centrioles extend a radial array of microtubules toward the plasma membrane when they reach the poles of the cell. This arrangement of mi- crotubules is called an aster. Although the aster’s func- tion is not fully understood, it probably braces the centri- oles against the membrane and stiffens the point of microtubular attachment during the retraction of the spindle. Plant cells, which have rigid cell walls, do not form asters. Linking Sister Chromatids to Opposite Poles. Each chromosome possesses two kinetochores, one attached to the centromere region of each sister chromatid (see fig- ure 11.9). As prophase continues, a second group of mi- crotubules appears to grow from the poles of the cell to- ward the centromeres. These microtubules connect the kinetochores on each pair of sister chromatids to the two poles of the spindle. Because microtubules extending from the two poles attach to opposite sides of the cen- tromere, they attach one sister chromatid to one pole and the other sister chromatid to the other pole. This arrangement is absolutely critical to the process of mito- sis; any mistakes in microtubule positioning can be disas- trous. The attachment of the two sides of a centromere to the same pole, for example, leads to a failure of the sis- ter chromatids to separate, so that they end up in the same daughter cell. Metaphase: Alignment of the Centromeres The second stage of mitosis, metaphase, is the phase where the chromosomes align in the center of the cell. When viewed with a light microscope, the chromosomes appear to array themselves in a circle along the inner cir- cumference of the cell, as the equator girdles the earth (fig- ure 11.10). An imaginary plane perpendicular to the axis of the spindle that passes through this circle is called the metaphase plate. The metaphase plate is not an actual struc- ture, but rather an indication of the future axis of cell divi- sion. Positioned by the microtubules attached to the kine- tochores of their centromeres, all of the chromosomes line up on the metaphase plate (figure 11.11). At this point, which marks the end of metaphase, their centromeres are neatly arrayed in a circle, equidistant from the two poles of the cell, with microtubules extending back towards the op- posite poles of the cell in an arrangement called a spindle because of its shape. 214 Part IV Reproduction and Heredity Chromosome Centrioles Metaphase plate Aster Spindle fibers FIGURE 11.10 Metaphase.In metaphase, the chromosomes array themselves in a circle around the spindle midpoint. Chapter 11 How Cells Divide 215 CYTOKINESIS ? plant cells: cell plate forms, dividing daughter cells ? animal cells: cleavage furrow forms at equator of cell and pinches inward until cell divides in two Prophase ? nuclear membrane disintegrates ? nucleolus disappears ? chromosomes condense ? mitotic spindle begins to form between centrioles ? kinetochores begin to mature and attach to spindle Metaphase ? kinetochores attach chromosomes to mitotic spindle and align them along metaphase plate at equator of cell Anaphase ? kinetochore microtubules shorten, separating chromosomes to opposite poles ? polar microtubules elongate, preparing cell for cytokinesis Telophase ? chromosomes reach poles of cell ? kinetochores disappear ? polar microtubules continue to elongate, preparing cell for cytokinesis ? nuclear membrane re-forms ? nucleolus reappears ? chromosomes decondense Nucleolus Nucleus Cytoplasm Cell wall Microtubules Cell nucleus Condensed chromosomes Chromosomes Centromere and kinetochore Mitotic spindle Mitotic spindle microtubules Chromosomes aligned on metaphase plate Kinetochore microtubules Polar microtubules Chromatids Spindle microtubules (pink) Cell plate Daughter nuclei and nucleoli Microtubule FIGURE 11.11 Mitosis and cytokinesis.Mitosis (separation of the two genomes) occurs in four stages—prophase, metaphase, anaphase, and telophase— and is followed by cytokinesis (division into two separate cells). In this depiction, the chromosomes of the African blood lily, Haemanthus katharinae, are stained blue, and microtubules are stained red. Anaphase and Telophase: Separation of the Chromatids and Reformation of the Nuclei Of all the stages of mitosis, anaphase is the shortest and the most beautiful to watch. It starts when the centromeres divide. Each centromere splits in two, freeing the two sister chromatids from each other. The centromeres of all the chromosomes separate simultaneously, but the mechanism that achieves this synchrony is not known. Freed from each other, the sister chromatids are pulled rapidly toward the poles to which their kinetochores are at- tached. In the process, two forms of movement take place simultaneously, each driven by microtubules. First, the poles move apart as microtubular spindle fibers physically anchored to opposite poles slide past each other, away from the center of the cell (figure 11.12). Because an- other group of microtubules attach the chromosomes to the poles, the chromosomes move apart, too. If a flexible membrane surrounds the cell, it becomes visibly elongated. Second, the centromeres move toward the poles as the mi- crotubules that connect them to the poles shorten. This shortening process is not a contraction; the microtubules do not get any thicker. Instead, tubulin subunits are re- moved from the kinetochore ends of the microtubules by the organizing center. As more subunits are removed, the chromatid-bearing microtubules are progressively disas- sembled, and the chromatids are pulled ever closer to the poles of the cell. When the sister chromatids separate in anaphase, the accurate partitioning of the replicated genome—the es- sential element of mitosis—is complete. In telophase, the spindle apparatus disassembles, as the microtubules are broken down into tubulin monomers that can be used to construct the cytoskeletons of the daughter cells. A nu- clear envelope forms around each set of sister chromatids, which can now be called chromosomes because each has its own centromere. The chromosomes soon begin to un- coil into the more extended form that permits gene ex- pression. One of the early group of genes expressed are the rRNA genes, resulting in the reappearance of the nucleolus. During prophase, microtubules attach the centromeres joining pairs of sister chromatids to opposite poles of the spindle apparatus. During metaphase, each chromosome is drawn to a ring along the inner circumference of the cell by the microtubules extending from the centromere to the two poles of the spindle apparatus. During anaphase, the poles of the cell are pushed apart by microtubular sliding, and the sister chromatids are drawn to opposite poles by the shortening of the microtubules attached to them. During telophase, the spindle is disassembled, nuclear envelopes are reestablished, and the normal expression of genes present in the chromosomes is reinitiated. 216 Part IV Reproduction and Heredity Metaphase Late anaphase Pole Overlapping microtubules Pole Overlapping microtubules PolePole 2 μm FIGURE 11.12 Microtubules slide past each other as the chromosomes separate.In these electron micrographs of dividing diatoms, the overlap of the microtubules lessens markedly during spindle elongation as the cell passes from metaphase to anaphase. Cytokinesis Mitosis is complete at the end of telophase. The eukaryotic cell has partitioned its replicated genome into two nuclei positioned at opposite ends of the cell. While mitosis was going on, the cytoplasmic organelles, including mitochon- dria and chloroplasts (if present), were reassorted to areas that will separate and become the daughter cells. The repli- cation of organelles takes place before cytokinesis, often in the S or G 2 phase. Cell division is still not complete at the end of mitosis, however, because the division of the cell proper has not yet begun. The phase of the cell cycle when the cell actually divides is called cytokinesis. It generally involves the cleavage of the cell into roughly equal halves. Cytokinesis in Animal Cells In animal cells and the cells of all other eukaryotes that lack cell walls, cytokinesis is achieved by means of a constricting belt of actin filaments. As these filaments slide past one an- other, the diameter of the belt decreases, pinching the cell and creating a cleavage furrow around the cell’s circumfer- ence (figure 11.13a). As constriction proceeds, the furrow deepens until it eventually slices all the way into the center of the cell. At this point, the cell is divided in two (figure 11.13b). Cytokinesis in Plant Cells Plant cells possess a cell wall far too rigid to be squeezed in two by actin filaments. Instead, these cells assemble mem- brane components in their interior, at right angles to the spindle apparatus (figure 11.14). This expanding membrane partition, called a cell plate, continues to grow outward until it reaches the interior surface of the plasma mem- brane and fuses with it, effectively dividing the cell in two. Cellulose is then laid down on the new membranes, creat- ing two new cell walls. The space between the daughter cells becomes impregnated with pectins and is called a middle lamella. Cytokinesis in Fungi and Protists In fungi and some groups of protists, the nuclear mem- brane does not dissolve and, as a result, all the events of mi- tosis occurs entirely within the nucleus. Only after mitosis is complete in these organisms does the nucleus then divide into two daughter nuclei, and one nucleus goes to each daughter cell during cytokinesis. This separate nuclear di- vision phase of the cell cycle does not occur in plants, ani- mals, or most protists. After cytokinesis in any eukaryotic cell, the two daughter cells contain all of the components of a complete cell. While mitosis ensures that both daughter cells contain a full complement of chromosomes, no similar mechanism ensures that organelles such as mitochondria and chloro- plasts are distributed equally between the daughter cells. However, as long as some of each organelle are present in each cell, the organelles can replicate to reach the number appropriate for that cell. C`ytokinesis is the physical division of the cytoplasm of a eukaryotic cell into two daughter cells. Chapter 11 How Cells Divide 217 (b)FIGURE 11.13 Cytokinesis in animal cells. (a) A cleavage furrow forms around a dividing sea urchin egg (30×). (b) The completion of cytokinesis in an animal cell. The two daughter cells are still joined by a thin band of cytoplasm occupied largely by microtubules. Cell wall Nuclei Vesicles containing membrane components fusing to form cell plate FIGURE 11.14 Cytokinesis in plant cells.In this photograph and companion drawing, a cell plate is forming between daughter nuclei. Once the plate is complete, there will be two cells. General Strategy of Cell Cycle Control The events of the cell cycle are coordinated in much the same way in all eukaryotes. The control system human cells utilize first evolved among the protists over a billion years ago; today, it operates in essentially the same way in fungi as it does in humans. The goal of controlling any cyclic process is to adjust the duration of the cycle to allow sufficient time for all events to occur. In principle, a variety of methods can achieve this goal. For example, an internal “clock” can be employed to allow adequate time for each phase of the cycle to be completed. This is how many organisms con- trol their daily activity cycles. The disadvantage of using such a clock to control the cell cycle is that it is not very flexible. One way to achieve a more flexible and sensitive regulation of a cycle is simply to let the completion of each phase of the cycle trigger the beginning of the next phase, as a runner passing a baton starts the next leg in a relay race. Until recently, biologists thought this type of mechanism controlled the cell division cycle. However, we now know that eukaryotic cells employ a separate, cen- tralized controller to regulate the process: at critical points in the cell cycle, further progress depends upon a central set of “go/no-go” switches that are regulated by feedback from the cell. This mechanism is the same one engineers use to con- trol many processes. For example, the furnace that heats a home in the winter typically goes through a daily heat- ing cycle. When the daily cycle reaches the morning “turn on” checkpoint, sensors report whether the house temperature is below the set point (for example, 70°F). If it is, the thermostat triggers the furnace, which warms the house. If the house is already at least that warm, the thermostat does not start up the furnace. Similarly, the cell cycle has key checkpoints where feedback signals from the cell about its size and the condition of its chro- mosomes can either trigger subsequent phases of the cycle, or delay them to allow more time for the current phase to be completed. Architecture of the Control System Three principal checkpoints control the cell cycle in eu- karyotes (figure 11.15): Cell growth is assessed at the G 1 checkpoint. Lo- cated near the end of G 1 , just before entry into S phase, this checkpoint makes the key decision of whether the cell should divide, delay division, or enter a resting stage (figure 11.16). In yeasts, where researchers first studied this checkpoint, it is called START. If conditions are fa- vorable for division, the cell begins to copy its DNA, initiating S phase. The G 1 checkpoint is where the more complex eukaryotes typically arrest the cell cycle if envi- ronmental conditions make cell division impossible, or if the cell passes into G 0 for an extended period. The success of DNA replication is assessed at the G 2 checkpoint. The second checkpoint, which occurs at the end of G 2 , triggers the start of M phase. If this checkpoint is passed, the cell initiates the many molecu- lar processes that signal the beginning of mitosis. Mitosis is assessed at the M checkpoint. Occurring at metaphase, the third checkpoint triggers the exit from mitosis and cytokinesis and the beginning of G 1 . The cell cycle is controlled at three checkpoints. 218 Part IV Reproduction and Heredity 11.4 The cell cycle is carefully controlled. G 2 M S G 2 checkpoint M checkpoint G 1 checkpoint G 1 C FIGURE 11.15 Control of the cell cycle.Cells use a centralized control system to check whether proper conditions have been achieved before passing three key “checkpoints” in the cell cycle. proceed to S? pause? withdraw to Go? FIGURE 11.16 The G 1 checkpoint. Feedback from the cell determines whether the cell cycle will proceed to the S phase, pause, or withdraw into G 0 for an extended rest period. Molecular Mechanisms of Cell Cycle Control Exactly how does a cell achieve central control of the divi- sion cycle? The basic mechanism is quite simple. A set of proteins sensitive to the condition of the cell interact at the checkpoints to trigger the next events in the cycle. Two key types of proteins participate in this interaction: cyclin- dependent protein kinases and cyclins (figure 11.17). The Cyclin Control System Cyclin-dependent protein kinases (Cdks) are enzymes that phosphorylate (add phosphate groups to) the serine and threonine amino acids of key cellular enzymes and other proteins. At the G 2 checkpoint, for example, Cdks phosphorylate histones, nuclear membrane filaments, and the microtubule-associated proteins that form the mitotic spindle. Phosphorylation of these components of the cell division machinery initiates activities that carry the cycle past the checkpoint into mitosis. Cyclins are proteins that bind to Cdks, enabling the Cdks to function as enzymes. Cyclins are so named because they are destroyed and resynthesized during each turn of the cell cycle (figure 11.18). Different cyclins regulate the G 1 and G 2 cell cycle checkpoints. The G 2 Checkpoint. During G 2 , the cell gradually accu- mulates G 2 cyclin (also called mitotic cyclin). This cyclin binds to Cdk to form a complex called MPF (mitosis-pro- moting factor). At first, MPF is not active in carrying the cycle past the G 2 checkpoint. But eventually, other cellular enzymes phosphorylate and so activate a few molecules of MPF. These activated MPFs in turn increase the activity of the enzymes that phosphorylate MPF, setting up a positive feedback that leads to a very rapid increase in the cellular concentration of activated MPF. When the level of acti- vated MPF exceeds the threshold necessary to trigger mito- sis, G 2 phase ends. MPF sows the seeds of its own destruction. The length of time the cell spends in M phase is determined by the activity of MPF, for one of its many functions is to activate proteins that destroy cyclin. As mitosis proceeds to the end of metaphase, Cdk levels stay relatively con- stant, but increasing amounts of G 2 cyclin are degraded, causing progressively less MPF to be available and so ini- tiating the events that end mitosis. After mitosis, the gradual accumulation of new cyclin starts the next turn of the cell cycle. The G 1 Checkpoint. The G 1 checkpoint is thought to be regulated in a similar fashion. In unicellular eukaryotes such as yeasts, the main factor triggering DNA replication is cell size. Yeast cells grow and divide as rapidly as possi- ble, and they make the START decision by comparing the volume of cytoplasm to the size of the genome. As a cell grows, its cytoplasm increases in size, while the amount of DNA remains constant. Eventually a threshold ratio is reached that promotes the production of cyclins and thus triggers the next round of DNA replication and cell division. Chapter 11 How Cells Divide 219 Cyclin Cyclin-dependent kinase (Cdk) FIGURE 11.17 A complex of two proteins triggers passage through cell cycle checkpoints.Cdk is a protein kinase that activates numerous cell proteins by phosphorylating them. Cyclin is a regulatory protein required to activate Cdk; in other words, Cdk does not function unless cyclin is bound to it. Trigger mitosis MPF G 2 checkpoint G 1 checkpoint G 1 cyclin Mitotic cyclin Cdk Trigger DNA replication G 1 G 2 S M Start kinase M-phase-promoting factor C P P FIGURE 11.18 How cell cycle control works. As the cell cycle passes through the G 1 and G 2 checkpoints, Cdk becomes associated with different cyclins and, as a result, activates different cellular processes. At the completion of each phase, the cyclins are degraded, bringing Cdk activity to a halt until the next set of cyclins appears. Controlling the Cell Cycle in Multicellular Eukaryotes The cells of multicellular eukaryotes are not free to make individual decisions about cell division, as yeast cells are. The body’s organization cannot be maintained without se- verely limiting cell proliferation, so that only certain cells divide, and only at appropriate times. The way that cells in- hibit individual growth of other cells is apparent in mam- malian cells growing in tissue culture: a single layer of cells expands over a culture plate until the growing border of cells comes into contact with neighboring cells, and then the cells stop dividing. If a sector of cells is cleared away, neighboring cells rapidly refill that sector and then stop di- viding again. How are cells able to sense the density of the cell culture around them? Each growing cell apparently binds minute amounts of positive regulatory signals called growth factors, proteins that stimulate cell division (such as MPF). When neighboring cells have used up what little growth factor is present, not enough is left to trigger cell division in any one cell. Growth Factors and the Cell Cycle As you may recall from chapter 7 (cell-cell interactions), growth factors work by triggering intracellular signaling systems. Fibroblasts, for example, possess numerous recep- tors on their plasma membranes for one of the first growth factors to be identified: platelet-derived growth factor (PDGF). When PDGF binds to a membrane receptor, it initiates an amplifying chain of internal cell signals that stimulates cell division. PDGF was discovered when inves- tigators found that fibroblasts would grow and divide in tis- sue culture only if the growth medium contained blood serum (the liquid that remains after blood clots); blood plasma (blood from which the cells have been removed without clotting) would not work. The researchers hypoth- esized that platelets in the blood clots were releasing into the serum one or more factors required for fibroblast growth. Eventually, they isolated such a factor and named it PDGF. Growth factors such as PDGF override cellular controls that otherwise inhibit cell division. When a tissue is injured, a blood clot forms and the release of PDGF trig- gers neighboring cells to divide, helping to heal the wound. Only a tiny amount of PDGF (approximately 10 –10 M) is required to stimulate cell division. Characteristics of Growth Factors. Over 50 different proteins that function as growth factors have been isolated (table 11.2 lists a few), and more undoubtedly exist. A spe- cific cell surface receptor “recognizes” each growth factor, its shape fitting that growth factor precisely. When the growth factor binds with its receptor, the receptor reacts by triggering events within the cell (figure 11.19). The cellular selectivity of a particular growth factor depends upon which target cells bear its unique receptor. Some growth 220 Part IV Reproduction and Heredity Table 11.2 Growth Factors of Mammalian Cells Growth Range of Factor Specificity Effects Epidermal growth factor (EGF) Erythropoietin Fibroblast growth factor (FGF) Insulin-like growth factor Interleukin-2 Mitosis-promoting factor (MPF) Nerve growth factor (NGF) Platelet-derived growth factor (PDGF) Transforming growth factor β(TGF-H9252) Broad Narrow Broad Broad Narrow Broad Narrow Broad Broad Stimulates cell proliferation in many tissues; plays a key role in regulating embryonic development Required for proliferation of red blood cell precursors and their maturation into erythrocytes (red blood cells) Initiates the proliferation of many cell types; inhibits maturation of many types of stem cells; acts as a signal in embryonic development Stimulates metabolism of many cell types; potentiates the effects of other growth factors in promoting cell proliferation Triggers the division of activated T lymphocytes during the immune response Regulates entrance of the cell cycle into the M phase Stimulates the growth of neuron processes during neural development Promotes the proliferation of many connective tissues and some neuroglial cells Accentuates or inhibits the responses of many cell types to other growth factors; often plays an important role in cell differentiation factors, like PDGF and epidermal growth factor (EGF), af- fect a broad range of cell types, while others affect only specific types. For example, nerve growth factor (NGF) promotes the growth of certain classes of neurons, and ery- thropoietin triggers cell division in red blood cell precur- sors. Most animal cells need a combination of several dif- ferent growth factors to overcome the various controls that inhibit cell division. The G 0 Phase. If cells are deprived of appropriate growth factors, they stop at the G 1 checkpoint of the cell cycle. With their growth and division arrested, they remain in the G 0 phase, as we discussed earlier. This nongrowing state is distinct from the interphase stages of the cell cycle, G 1 , S, and G 2 . It is the ability to enter G 0 that accounts for the in- credible diversity seen in the length of the cell cycle among different tissues. Epithelial cells lining the gut di- vide more than twice a day, constantly renewing the lin- ing of the digestive tract. By contrast, liver cells divide only once every year or two, spending most of their time in G 0 phase. Mature neurons and muscle cells usually never leave G 0 . Two groups of proteins, cyclins and Cdks, interact to regulate the cell cycle. Cells also receive protein signals called growth factors that affect cell division. Chapter 11 How Cells Divide 221 NucleusCytoplasm Cell division Nuclear membrane Growth factor Protein kinase cascade myc Rb Nuclear pores Rb myc Chromosome Cdk Cell surface receptor P P P P P FIGURE 11.19 The cell proliferation-signaling pathway.Binding of a growth factor sets in motion a cascading intracellular signaling pathway (described in chapter 7), which activates nuclear regulatory proteins that trigger cell division. In this example, when the nuclear protein Rb is phosphorylated, another nuclear protein (myc) is released and is then able to stimulate the production of Cdk proteins. Cancer and the Control of Cell Proliferation The unrestrained, uncontrolled growth of cells, called cancer, is addressed more fully in chapter 18. However, cancer certainly deserves mention in a chapter on cell di- vision, as it is essentially a disease of cell division—a fail- ure of cell division control. Recent work has identified one of the culprits. Working independently, cancer scientists have repeatedly identified what has proven to be the same gene! Officially dubbed p53 (researchers italicize the gene symbol to differentiate it from the protein), this gene plays a key role in the G 1 checkpoint of cell division. The gene’s product, the p53 protein, monitors the integrity of DNA, checking that it is undamaged. If the p53 protein detects damaged DNA, it halts cell division and stimu- lates the activity of special enzymes to repair the damage. Once the DNA has been repaired, p53 allows cell division to continue. In cases where the DNA is irreparable, p53 then directs the cell to kill itself, activating an apoptosis (cell suicide) program (see chapter 17 for a discussion of apoptosis). By halting division in damaged cells, p53 prevents the development of many mutated cells, and it is therefore con- sidered a tumor-suppressor gene (even though its activities are not limited to cancer prevention). Scientists have found that p53 is entirely absent or damaged beyond use in the majority of cancerous cells they have examined! It is pre- cisely because p53 is nonfunctional that these cancer cells are able to repeatedly undergo cell division without being halted at the G 1 checkpoint (figure 11.20). To test this, sci- entists administered healthy p53 protein to rapidly dividing cancer cells in a petri dish: the cells soon ceased dividing and died. Scientists at Johns Hopkins University School of Medi- cine have further reported that cigarette smoke causes mu- tations in the p53 gene. This study, published in 1995, rein- forced the strong link between smoking and cancer described in chapter 18. 222 Part IV Reproduction and Heredity DNA damage is caused by heat, radiation, or chemicals. DNA repair enzyme p53 allows cells with repaired DNA to divide. Stage 1 DNA damage is caused by heat, radiation, or chemicals. Stage 1 The p53 protein fails to stop cell division and repair DNA. Cell divides without repair to damaged DNA. Stage 2 Damaged cells continue to divide. If other damage accumulates, the cell can turn cancerous. Stage 3 Cell division stops, and p53 triggers enzymes to repair damaged region. Stage 2 p53 triggers the destruction of cells damaged beyond repair. Cancer cell ABNORMAL p53 NORMAL p53 FIGURE 11.20 Cell division and p53 protein.Normal p53 protein monitors DNA, destroying cells with irreparable damage to their DNA. Abnormal p53 protein fails to stop cell division and repair DNA. As damaged cells proliferate, cancer develops. Growth Factors and Cancer How do growth factors influence the cell cycle? As you have seen, there are two different approaches, one positive and the other negative. Proto-oncogenes. PDGF and many other growth fac- tors utilize the positive approach, stimulating cell divi- sion. They trigger passage through the G 1 checkpoint by aiding the formation of cyclins and so activating genes that promote cell division. Genes that normally stimulate cell division are sometimes called proto-oncogenes because mutations that cause them to be overexpressed or hyper- active convert them into oncogenes (Greek onco, “can- cer”), leading to the excessive cell proliferation that is characteristic of cancer. Even a single mutation (creating a heterozygote) can lead to cancer if the other cancer- preventing genes are nonfunctional. Geneticists, using Mendel’s terms, call such mutations of proto-oncogenes dominant. Some 30 different proto-oncogenes are known. Some act very quickly after stimulation by growth factors. Among the most intensively studied of these are myc, fos, and jun, all of which cause unrestrained cell growth and division when they are overexpressed. In a normal cell, the myc proto-oncogene appears to be important in regu- lating the G 1 checkpoint. Cells in which myc expression is prevented will not divide, even in the presence of growth factors. A critical activity of myc and other genes in this group of immediately responding proto-oncogenes is to stimulate a second group of “delayed response” genes, in- cluding those that produce cyclins and Cdk proteins (fig- ure 11.21). Tumor-suppressor Genes. Other growth factors utilize a negative approach to cell cycle control. They block pas- sage through the G 1 checkpoint by preventing cyclins from binding to Cdk, thus inhibiting cell division. Genes that normally inhibit cell division are called tumor-suppressor genes. When mutated, they can also lead to unrestrained cell division, but only if both copies of the gene are mutant. Hence, these cancer-causing mutations are recessive. The most thoroughly understood of the tumor-suppressor genes is the retinoblastoma (Rb) gene. This gene was orig- inally cloned from children with a rare form of eye cancer inherited as a recessive trait, implying that the normal gene product was a cancer suppressor that helped keep cell division in check. The Rb gene encodes a protein pre- sent in ample amounts within the nucleus. This protein interacts with many key regulatory proteins of the cell cycle, but how it does so depends upon its state of phos- phorylation. In G 0 phase, the Rb protein is dephosphory- lated. In this state, it binds to and ties up a set of regula- tory proteins, like myc and fos, needed for cell proliferation, blocking their action and so inhibiting cell division (see figure 11.19). When phosphorylated, the Rb protein releases its captive regulatory proteins, freeing them to act and so promoting cell division. Growth fac- tors lessen the inhibition the Rb protein imposes by acti- vating kinases that phosphorylate it. Free of Rb protein inhibition, cells begin to produce cyclins and Cdk, pass the G 1 checkpoint, and proceed through the cell cycle. Figure 11.22 summarizes the types of genes that can cause cancer when mutated. The progress of mitosis is regulated by the interaction of two key classes of proteins, cyclin-dependent protein kinases and cyclins. Some growth factors accelerate the cell cycle by promoting cyclins and Cdks, others suppress it by inhibiting their action. Chapter 11 How Cells Divide 223 0 8 16 24Time (h) CG 0 G 2 G 1 SM Growth factor Levels of myc protein FIGURE 11.21 The role of myc in triggering cell division.The addition of a growth factor leads to transcription of the mycgene and rapidly increasing levels of the myc protein. This causes G 0 cells to enter the S phase and begin proliferating. Growth factor receptor More per cell in many breast cancers Ras protein Activated by mutations of ras in 20–30% of all cancers Src kinase Activated by mutations in 2–5% of all cancers Rb protein Mutated in 40% of all cancers p53 protein Mutated in 50% of all cancers Key proteins associated with human cancers Growth factor receptor Ras protein Src kinase p53 protein Rb protein Cell cycle checkpoints Mammalian cell Cytoplasm Nucleus FIGURE 11.22 Mutations cause cancer.Mutations in genes encoding key components of the cell division-signaling pathway are responsible for many cancers. Among them are proto-oncogenes encoding growth factor receptors, such as ras protein, and kinase enzymes, such as src, that aid ras function. Mutations that disrupt tumor- suppressor proteins, such as Rb and p53, also foster cancer development. 224 Part IV Reproduction and Heredity Chapter 11 Summary Questions Media Resources 11.1 Bacteria divide far more simply than do eukaryotes. ? Bacterial cells divide by simple binary fission. ? The two replicated circular DNA molecules attach to the plasma membrane at different points, and fission is initiated between those points. 1.How is the genome replicated prior to binary fission in a bacterial cell? ? Eukaryotic DNA forms a complex with histones and other proteins and is packaged into chromosomes. ? In eukaryotic cells, DNA replication is completed during the S phase of the cell cycle, and during the G 2 phase the cell makes its final preparation for mitosis. ? Along with G 1 , these two phases constitute the portion of the cell cycle called interphase, which alternates with mitosis and cytokinesis. 2.What are nucleosomes composed of, and how do they participate in the coiling of DNA? 3.What are the differences between heterochromatin and euchromatin? 4.What is a karyotype? How are chromosomes distinguished from one another in a karyotype? 11.2 Chromosomes are highly ordered structures. ? The first stage of mitosis is prophase, during which the mitotic spindle apparatus forms. ? In the second stage of mitosis, metaphase, the chromosomes are arranged in a circle around the periphery of the cell. ? At the beginning of the third stage of mitosis, anaphase, the centromeres joining each pair of sister chromatids separate, freeing the sister chromatids from each other. ? After the chromatids physically separate, they are pulled to opposite poles of the cell by the microtubules attached to their centromeres. ? In the fourth and final stage of mitosis, telophase, the mitotic apparatus is disassembled, the nuclear envelope re-forms, and the chromosomes uncoil. ? When mitosis is complete, the cell divides in two, so that the two sets of chromosomes separated by mitosis end up in different daughter cells. 5.Which phases of the cell cycle is generally the longest in the cells of a mature eukaryote? 6.What happens to the chromosomes during S phase? 7.What changes with respect to ribosomal RNA occur during prophase? 8.What event signals the initiation of metaphase? 9.What molecular mechanism seems to be responsible for the movement of the poles during anaphase? 10.Describe three events that occur during telophase. 11.How is cytokinesis in animal cells different from that in plant cells? 11.3 Mitosis is a key phase of the cell cycle. ? The cell cycle is regulated by two types of proteins, cyclins and cyclin-dependent protein kinases, which permit progress past key “checkpoints” in the cell cycle only if the cell is ready to proceed further. ? Failures of cell cycle regulation can lead to uncontrolled cell growth and lie at the root of cancer. 12.What aspects of the cell cycle are controlled by the G 1 , G 2 , and M checkpoints? How are cyclins and cyclin-dependent protein kinases involved in cell cycle regulation at checkpoints? 11.4 The cell cycle is carefully controlled. http://www.mhhe.com/raven6e http://www.biocourse.com ? Cell Division Introduction ? Prokaryotes ? Scientists on Science: Ribozymes ? Art Activity: Mitosis Overview ? Art Activity: Plant Cell Mitosis ? Mitosis ? Mitosis ? Student Research: Nuclear Division in Drosophila ? Chromosomes ? Exploration: Regulating the cell cycle 225 12 Sexual Reproduction and Meiosis Concept Outline 12.1 Meiosis produces haploid cells from diploid cells. Discovery of Reduction Division. Sexual reproduction does not increase chromosome number because gamete production by meiosis involves a decrease in chromosome number. Individuals produced from sexual reproduction inherit chromosomes from two parents. 12.2 Meiosis has three unique features. Unique Features of Meiosis. Three unique features of meiosis are synapsis, homologous recombination, and reduction division. 12.3 The sequence of events during meiosis involves two nuclear divisions. Prophase I. Homologous chromosomes pair intimately, and undergo crossing over that locks them together. Metaphase I. Spindle microtubules align the chromosomes in the central plane of the cell. Completing Meiosis. The second meiotic division is like a mitotic division, but has a very different outcome. 12.4 The evolutionary origin of sex is a puzzle. Why Sex? Sex may have evolved as a mechanism to repair DNA, or perhaps as a means for contagious elements to spread. Sexual reproduction increases genetic variability by shuffling combinations of genes. M ost animals and plants reproduce sexually. Gametes of opposite sex unite to form a cell that, dividing re- peatedly by mitosis, eventually gives rise to an adult body with some 100 trillion cells. The gametes that give rise to the initial cell are the products of a special form of cell divi- sion called meiosis (figure 12.1), the subject of this chapter. Far more intricate than mitosis, the details of meiosis are not as well understood. The basic process, however, is clear. Also clear are the profound consequences of sexual reproduction: it plays a key role in generating the tremen- dous genetic diversity that is the raw material of evolution. FIGURE 12.1 Plant cells undergoing meiosis (600×). This preparation of pollen cells of a spiderwort, Tradescantia, was made by freezing the cells and then fracturing them. It shows several stages of meiosis. number of chromosomes in each cell would become impos- sibly large. For example, in just 10 generations, the 46 chromosomes present in human cells would increase to over 47,000 (46 × 2 10 ). The number of chromosomes does not explode in this way because of a special reduction division that occurs during gamete formation, producing cells with half the normal number of chromosomes. The subsequent fusion of two of these cells ensures a consistent chromosome number from one generation to the next. This reduction division process, known as meiosis, is the subject of this chapter. The Sexual Life Cycle Meiosis and fertilization together constitute a cycle of re- production. Two sets of chromosomes are present in the somatic cells of adult individuals, making them diploid cells (Greek diploos, “double” + eidos, “form”), but only one set is present in the gametes, which are thus haploid (Greek haploos, “single” + ploion, “vessel”). Reproduction that involves this alternation of meiosis and fertilization is called sexual reproduction. Its outstanding characteristic is that offspring inherit chromosomes from two parents (figure 12.2). You, for example, inherited 23 chromosomes from your mother, contributed by the egg fertilized at your conception, and 23 from your father, contributed by the sperm that fertilized that egg. 226 Part IV Reproduction and Heredity Discovery of Reduction Division Only a few years after Walther Fleming’s discovery of chromosomes in 1882, Belgian cytologist Pierre-Joseph van Beneden was surprised to find different numbers of chro- mosomes in different types of cells in the roundworm As- caris. Specifically, he observed that the gametes (eggs and sperm) each contained two chromosomes, while the so- matic (nonreproductive) cells of embryos and mature indi- viduals each contained four. Fertilization From his observations, van Beneden proposed in 1887 that an egg and a sperm, each containing half the complement of chromosomes found in other cells, fuse to produce a sin- gle cell called a zygote. The zygote, like all of the somatic cells ultimately derived from it, contains two copies of each chromosome. The fusion of gametes to form a new cell is called fertilization, or syngamy. Reduction Division It was clear even to early investigators that gamete forma- tion must involve some mechanism that reduces the num- ber of chromosomes to half the number found in other cells. If it did not, the chromosome number would double with each fertilization, and after only a few generations, the 12.1 Meiosis produces haploid cells from diploid cells. Haploid egg Diploid zygote Haploid sperm FIGURE 12.2 Diploid cells carry chromosomes from two parents. A diploid cell contains two versions of each chromosome, one contributed by the haploid egg of the mother, the other by the haploid sperm of the father. Somatic Tissues. The life cycles of all sexually reproduc- ing organisms follow the same basic pattern of alternation between the diploid and haploid chromosome numbers (figures 12.3 and 12.4). After fertilization, the resulting zy- gote begins to divide by mitosis. This single diploid cell eventually gives rise to all of the cells in the adult. These cells are called somatic cells, from the Latin word for “body.” Except when rare accidents occur, or in special variation-creating situations such as occur in the immune system, every one of the adult’s somatic cells is genetically identical to the zygote. In unicellular eukaryotic organisms, including most pro- tists, individual cells function as gametes, fusing with other gamete cells. The zygote may undergo mitosis, or it may divide immediately by meiosis to give rise to haploid indi- viduals. In plants, the haploid cells that meiosis produces divide by mitosis, forming a multicellular haploid phase. Certain cells of this haploid phase eventually differentiate into eggs or sperm. Germ-Line Tissues. In animals, the cells that will eventu- ally undergo meiosis to produce gametes are set aside from somatic cells early in the course of development. These cells are often referred to as germ-line cells. Both the somatic cells and the gamete-producing germ-line cells are diploid, but while somatic cells undergo mitosis to form genetically identical, diploid daughter cells, gamete-producing germ- line cells undergo meiosis, producing haploid gametes. Meiosis is a process of cell division in which the number of chromosomes in certain cells is halved during gamete formation. In the sexual life cycle, there is an alternation of diploid and haploid generations. Chapter 12 Sexual Reproduction and Meiosis 227 Haploid (n) Gametes Sperm (n) Egg (n) Diploid (2n) Diploid (2n) multicellular organism Diploid (2n) zygote Diploid (2n) germ-line cells Meiosis Mitosis Gamete formation Germ cell formation Mitosis Haploid (n) cells Haploid (n) multicellular organism Fertilization FIGURE 12.3 Alternation of generations. In sexual reproduction, haploid cells or organisms alternate with diploid cells or organisms. Male (diploid) 2n Meiosis Grows into adult male or adult female Sperm (haploid) n Diploid (2n) Zygote (diploid) 2n Fertilization Female (diploid) 2n Meiosis Haploid (n) Egg (haploid) n FIGURE 12.4 The sexual life cycle. In animals, the completion of meiosis is followed soon by fertilization. Thus, the vast majority of the life cycle is spent in the diploid stage. Unique Features of Meiosis The mechanism of cell division varies in important details in different organisms. This is particularly true of chromo- somal separation mechanisms, which differ substantially in protists and fungi from the process in plants and animals that we will describe here. Meiosis in a diploid organism consists of two rounds of division, mitosis of one. Although meiosis and mitosis have much in common, meiosis has three unique features: synapsis, homologous recombina- tion, and reduction division. Synapsis The first unique feature of meiosis happens early during the first nuclear division. Following chromosome replica- tion, homologous chromosomes, or homologues (see chapter 11), pair all along their length. The process of forming these complexes of homologous chromosomes is called synapsis Homologous Recombination The second unique feature of meiosis is that genetic ex- change occurs between the homologous chromosomes while they are thus physically joined (figure 12.5a). The exchange process that occurs between paired chromosomes is called crossing over. Chromosomes are then drawn together along the equatorial plane of the dividing cell; subse- quently, homologues are pulled by microtubules toward opposite poles of the cell. When this process is complete, the cluster of chromosomes at each pole contains one of the two homologues of each chromosome. Each pole is haploid, containing half the number of chromosomes pres- ent in the original diploid cell. Sister chromatids do not separate from each other in the first nuclear division, so each homologue is still composed of two chromatids. Reduction Division The third unique feature of meiosis is that the chromosomes do not replicate between the two nuclear divisions, so that at the end of meiosis, each cell contains only half the original complement of chromosomes (figure 12.5b). In most re- spects, the second meiotic division is identical to a normal mitotic division. However, because of the crossing over that occurred during the first division, the sister chromatids in meiosis II are not identical to each other. Meiosis is a continuous process, but it is most easily stud- ied when we divide it into arbitrary stages. The stages of meiosis are traditionally called meiosis I and meiosis II. Like mitosis, each stage is subdivided further into prophase, metaphase, anaphase, and telophase (figure 12.6). In meio- sis, however, prophase I is more complex than in mitosis. In meiosis, homologous chromosomes become intimately associated and do not replicate between the two nuclear divisions. 228 Part IV Reproduction and Heredity 12.2 Meiosis has three unique features. SYNAPSIS Homologue Homologue Region of close association, where crossing over occurs (a) Centromere Sister chromatids REDUCTION DIVISION Diploid germ-line cell Haploid gametes Chromosome duplication Meiosis I Meiosis II (b) FIGURE 12.5 Unique features of meiosis. (a) Synapsis draws homologous chromosomes together, creating a situation where the two chromosomes can physically exchange parts, a process called crossing over. (b) Reduction division, by omitting a chromosome duplication before meiosis II, produces haploid gametes, thus ensuring that chromosome number remains stable during the reproduction cycle. Chapter 12 Sexual Reproduction and Meiosis 229 Cell division Cell division Cell division Synapsis and crossing over Pairing of homologous chromosomes Chromosome replication Chromosome replication Paternal homologue Maternal homologue MEIOSIS MITOSIS ME I O SIS I MEI O SI S I I FIGURE 12.6 A comparison of meiosis and mitosis. Meiosis involves two nuclear divisions with no DNA replication between them. It thus produces four daughter cells, each with half the original number of chromosomes. Crossing over occurs in prophase I of meiosis. Mitosis involves a single nuclear division after DNA replication. It thus produces two daughter cells, each containing the original number of chromosomes. Prophase I In prophase I of meiosis, the DNA coils tighter, and indi- vidual chromosomes first become visible under the light microscope as a matrix of fine threads. Because the DNA has already replicated before the onset of meiosis, each of these threads actually consists of two sister chromatids joined at their centromeres. In prophase I, homologous chromosomes become closely associated in synapsis, ex- change segments by crossing over, and then separate. An Overview Prophase I is traditionally divided into five sequential stages: leptotene, zygotene, pachytene, diplotene, and dia- kinesis. Leptotene. Chromosomes condense tightly. Zygotene. A lattice of protein is laid down between the homologous chromosomes in the process of synap- sis, forming a structure called a synaptonemal complex (figure 12.7). Pachytene. Pachytene begins when synapsis is com- plete (just after the synaptonemal complex forms; figure 12.8), and lasts for days. This complex, about 100 nm across, holds the two replicated chromosomes in precise register, keeping each gene directly across from its part- ner on the homologous chromosome, like the teeth of a zipper. Within the synaptonemal complex, the DNA du- plexes unwind at certain sites, and single strands of DNA form base-pairs with complementary strands on the other homologue. The synaptonemal complex thus provides the structural framework that enables crossing over between the homologous chromosomes. As you 230 Part IV Reproduction and Heredity 12.3 The sequence of events during meiosis involves two nuclear divisions. Chromosome homologues Synaptonemal complex FIGURE 12.7 Structure of the synaptonemal complex. A portion of the synaptonemal complex of the ascomycete Neotiella rutilans, a cup fungus. Interphase Leptotene Zygotene Pachytene Diplotene followed by diakinesis Chromatid 1 Chromatid 2 Chromatid 3 Chromatid 4 Disassembly of the synaptonemal complex Formation of the synaptonemal complex Chromatid 1 Chromatid 2 Chromatid 3 Chromatid 4 Paternal sister chromatids Maternal sister chromatids Time Crossing over can occur between homologous chromosomes FIGURE 12.8 Time course of prophase I. The five stages of prophase I represent stages in the formation and subsequent disassembly of the synaptonemal complex, the protein lattice that holds homologous chromosomes together during synapsis. will see, this has a key impact on how the homologues separate later in meiosis. Diplotene. At the beginning of diplotene, the protein lattice of the synaptonemal complex disassem- bles. Diplotene is a period of in- tense cell growth. During this pe- riod the chromosomes decondense and become very active in tran- scription. Diakinesis. At the beginning of diakinesis, the transition into metaphase, transcription ceases and the chromosomes recondense. Synapsis During prophase, the ends of the chromatids attach to the nuclear envelope at specific sites. The sites the homologues attach to are adjacent, so that the members of each homologous pair of chromosomes are brought close together. They then line up side by side, ap- parently guided by heterochromatin sequences, in the process called synapsis. Crossing Over Within the synaptonemal complex, recombination is thought to be carried out during pachytene by very large protein assemblies called recombination nodules. A nod- ule’s diameter is about 90 nm, spanning the central element of the synaptonemal complex. Spaced along the synaptone- mal complex, these recombination nodules act as large multienzyme “recombination machines,” each nodule bringing about a recombination event. The details of the crossing over process are not well understood, but involve a complex series of events in which DNA segments are ex- changed between nonsister or sister chromatids. In hu- mans, an average of two or three such crossover events occur per chromosome pair. When crossing over is complete, the synaptonemal com- plex breaks down, and the homologous chromosomes are released from the nuclear envelope and begin to move away from each other. At this point, there are four chromatids for each type of chromosome (two homologous chromo- somes, each of which consists of two sister chromatids). The four chromatids do not separate completely, however, because they are held together in two ways: (1) the two sis- ter chromatids of each homologue, recently created by DNA replication, are held near by their common cen- tromeres; and (2) the paired homologues are held together at the points where crossing over occurred within the synaptonemal complex. Chiasma Formation Evidence of crossing over can often be seen under the light microscope as an X-shaped structure known as a chiasma (Greek, “cross”; plural, chiasmata; figure 12.9). The pres- ence of a chiasma indicates that two chromatids (one from each homologue) have exchanged parts (figure 12.10). Like small rings moving down two strands of rope, the chias- mata move to the end of the chromosome arm as the ho- mologous chromosomes separate. Synapsis is the close pairing of homologous chromosomes that takes place early in prophase I of meiosis. Crossing over occurs between the paired DNA strands, creating the chromosomal configurations known as chiasmata. The two homologues are locked together by these exchanges and they do not disengage readily. Chapter 12 Sexual Reproduction and Meiosis 231 FIGURE 12.9 Chiasmata. This micrograph shows two distinct crossovers, or chiasmata. FIGURE 12.10 The results of crossing over. During crossing over, nonsister (shown above) or sister chromatids may exchange segments. Metaphase I By metaphase I, the second stage of meiosis I, the nuclear envelope has dispersed and the microtubules form a spin- dle, just as in mitosis. During diakinesis of prophase I, the chiasmata move down the paired chromosomes from their original points of crossing over, eventually reaching the ends of the chromosomes. At this point, they are called terminal chiasmata. Terminal chiasmata hold the homologous chromosomes together in metaphase I, so that only one side of each centromere faces outward from the complex; the other side is turned inward toward the other homologue (figure 12.11). Consequently, spindle microtubules are able to attach to kinetochore proteins only on the outside of each centromere, and the cen- tromeres of the two homologues attach to microtubules originating from opposite poles. This one-sided attach- ment is in marked contrast to the attachment in mitosis, when kinetochores on both sides of a centromere bind to microtubules. Each joined pair of homologues then lines up on the metaphase plate. The orientation of each pair on the spin- dle axis is random: either the maternal or the paternal ho- mologue may orient toward a given pole (figure 12.12). Figure 12.13 illustrates the alignment of chromosomes dur- ing metaphase I. Chiasmata play an important role in aligning the chromosomes on the metaphase plate. 232 Part IV Reproduction and Heredity Metaphase I Anaphase I Meiosis I Chiasmata Mitosis Metaphase Anaphase Kinetochores of sister chromatids remain separate; microtubules attach to both kinetochores on opposite sides of the centromere. Microtubules pull sister chromatids apart. Chiasmata hold homologues together. The kinetochores of sister chromatids fuse and function as one. Microtubules can attach to only one side of each centromere. Microtubules pull the homologous chromosomes apart, but sister chromatids are held together. FIGURE 12.11 Chiasmata created by crossing over have a key impact on how chromosomes align in metaphase I. In the first meiotic division, the chiasmata hold one sister chromatid to the other sister chromatid; consequently, the spindle microtubules can bind to only one side of each centromere, and the homologous chromosomes are drawn to opposite poles. In mitosis, microtubules attach to both sides of each centromere; when the microtubules shorten, the sister chromatids are split and drawn to opposite poles. FIGURE 12.12 Random orientation of chromosomes on the metaphase plate. The number of possible chromosome orientations equals 2 raised to the power of the number of chromosome pairs. In this hypothetical cell with three chromosome pairs, eight (2 3 ) possible orientations exist, four of them illustrated here. Each orientation produces gametes with different combinations of parental chromosomes. Chapter 12 Sexual Reproduction and Meiosis 233 Prophase II Metaphase IIAnaphase II Interphase Prophase I Meiosis I Meiosis II Metaphase I Anaphase I Telophase I Telophase II FIGURE 12.13 The stages of meiosis in a lily. Note the arrangement of chromosomes in metaphase I. Completing Meiosis After the long duration of prophase and metaphase, which together make up 90% or more of the time meiosis I takes, meiosis I rapidly concludes. Anaphase I and telophase I proceed quickly, followed—without an intervening period of DNA synthesis—by the second meiotic division. Anaphase I In anaphase I, the microtubules of the spindle fibers begin to shorten. As they shorten, they break the chias- mata and pull the centromeres toward the poles, drag- ging the chromosomes along with them. Because the mi- crotubules are attached to kinetochores on only one side of each centromere, the individual centromeres are not pulled apart to form two daughter centromeres, as they are in mitosis. Instead, the entire centromere moves to one pole, taking both sister chromatids with it. When the spindle fibers have fully contracted, each pole has a com- plete haploid set of chromosomes consisting of one mem- ber of each homologous pair. Because of the random ori- entation of homologous chromosomes on the metaphase plate, a pole may receive either the maternal or the pater- nal homologue from each chromosome pair. As a result, the genes on different chromosomes assort indepen- dently; that is, meiosis I results in the independent as- sortment of maternal and paternal chromosomes into the gametes. Telophase I By the beginning of telophase I, the chromosomes have segregated into two clusters, one at each pole of the cell. Now the nuclear membrane re-forms around each daugh- ter nucleus. Because each chromosome within a daughter nucleus replicated before meiosis I began, each now con- tains two sister chromatids attached by a common cen- tromere. Importantly, the sister chromatids are no longer iden- tical, because of the crossing over that occurred in prophase I (figure 12.14). Cytokinesis may or may not occur after telophase I. The second meiotic division, meiosis II, occurs after an interval of variable length. The Second Meiotic Division After a typically brief interphase, in which no DNA synthe- sis occurs, the second meiotic division begins. Meiosis II resembles a normal mitotic division. Prophase II, metaphase II, anaphase II, and telophase II follow in quick succession. Prophase II. At the two poles of the cell the clusters of chromosomes enter a brief prophase II, each nuclear envelope breaking down as a new spindle forms. Metaphase II. In metaphase II, spindle fibers bind to both sides of the centromeres. Anaphase II. The spindle fibers contract, splitting the centromeres and moving the sister chromatids to oppo- site poles. Telophase II. Finally, the nuclear envelope re-forms around the four sets of daughter chromosomes. The final result of this division is four cells containing haploid sets of chromosomes (figure 12.15). No two are alike, because of the crossing over in prophase I. Nuclear envelopes then form around each haploid set of chromo- somes. The cells that contain these haploid nuclei may de- velop directly into gametes, as they do in animals. Alterna- tively, they may themselves divide mitotically, as they do in plants, fungi, and many protists, eventually producing greater numbers of gametes or, as in the case of some plants and insects, adult individuals of varying ploidy. During meiosis I, homologous chromosomes move toward opposite poles in anaphase I, and individual chromosomes cluster at the two poles in telophase I. At the end of meiosis II, each of the four haploid cells contains one copy of every chromosome in the set, rather than two. Because of crossing over, no two cells are the same. These haploid cells may develop directly into gametes, as in animals, or they may divide by mitosis, as in plants, fungi, and many protists. 234 Part IV Reproduction and Heredity FIGURE 12.14 After meiosis I, sister chromatids are not identical. So-called “harlequin” chromosomes, each containing one fluorescent DNA strand, illustrate the reciprocal exchange of genetic material during meiosis I between sister chromatids. Chapter 12 Sexual Reproduction and Meiosis 235 MEIOSIS Germ-line cell Haploid gametes PROPHASE I II TELOPHASE I II ANAPHASE II I II I METAPHASE FIGURE 12.15 How meiosis works. Meiosis consists of two rounds of cell division and produces four haploid cells. Why Sex? Not all reproduction is sexual. In asexual reproduction, an individual inherits all of its chromosomes from a sin- gle parent and is, therefore, genetically identical to its parent. Bacterial cells reproduce asexually, undergoing binary fission to produce two daughter cells containing the same genetic information. Most protists reproduce asexually except under conditions of stress; then they switch to sexual reproduction. Among plants, asexual re- production is common, and many other multicellular or- ganisms are also capable of reproducing asexually. In ani- mals, asexual reproduction often involves the budding off of a localized mass of cells, which grows by mitosis to form a new individual. Even when meiosis and the production of gametes occur, there may still be reproduction without sex. The development of an adult from an unfertilized egg, called parthenogenesis, is a common form of reproduction in arthropods. Among bees, for example, fertilized eggs de- velop into diploid females, but unfertilized eggs develop into haploid males. Parthenogenesis even occurs among the vertebrates. Some lizards, fishes, and amphibians are capable of reproducing in this way; their unfertilized eggs undergo a mitotic nuclear division without cell cleavage to produce a diploid cell, which then develops into an adult. Recombination Can Be Destructive If reproduction can occur without sex, why does sex occur at all? This question has generated considerable discussion, particularly among evolutionary biologists. Sex is of great evolutionary advantage for populations or species, which benefit from the variability generated in meiosis by random orientation of chromosomes and by crossing over. How- ever, evolution occurs because of changes at the level of in- dividual survival and reproduction, rather than at the popu- lation level, and no obvious advantage accrues to the progeny of an individual that engages in sexual reproduc- tion. In fact, recombination is a destructive as well as a con- structive process in evolution. The segregation of chromo- somes during meiosis tends to disrupt advantageous combinations of genes more often than it creates new, bet- ter adapted combinations; as a result, some of the diverse progeny produced by sexual reproduction will not be as well adapted as their parents were. In fact, the more com- plex the adaptation of an individual organism, the less likely that recombination will improve it, and the more likely that recombination will disrupt it. It is, therefore, a puzzle to know what a well-adapted individual gains from participat- ing in sexual reproduction, as all of its progeny could main- tain its successful gene combinations if that individual sim- ply reproduced asexually. The Origin and Maintenance of Sex There is no consensus among evolutionary biologists re- garding the evolutionary origin or maintenance of sex. Conflicting hypotheses abound. Alternative hypotheses seem to be correct to varying degrees in different organisms. The DNA Repair Hypothesis. If recombination is often detrimental to an individual’s progeny, then what benefit promoted the evolution of sexual reproduction? Although the answer to this question is unknown, we can gain some insight by examining the protists. Meiotic recombination is often absent among the protists, which typically undergo sexual reproduction only occasionally. Often the fusion of two haploid cells occurs only under stress, creating a diploid zygote. Why do some protists form a diploid cell in response to stress? Several geneticists have suggested that this oc- curs because only a diploid cell can effectively repair cer- tain kinds of chromosome damage, particularly double- strand breaks in DNA. Both radiation and chemical events within cells can induce such breaks. As organisms became larger and longer-lived, it must have become in- creasingly important for them to be able to repair such damage. The synaptonemal complex, which in early stages of meiosis precisely aligns pairs of homologous chromo- somes, may well have evolved originally as a mechanism for repairing double-strand damage to DNA, using the undamaged homologous chromosome as a template to re- pair the damaged chromosome. A transient diploid phase would have provided an opportunity for such repair. In yeast, mutations that inactivate the repair system for dou- ble-strand breaks of the chromosomes also prevent cross- ing over, suggesting a common mechanism for both synapsis and repair processes. The Contagion Hypothesis. An unusual and interesting alternative hypothesis for the origin of sex is that it arose as a secondary consequence of the infection of eukaryotes by mobile genetic elements. Suppose a replicating transpos- able element were to infect a eukaryotic lineage. If it pos- sessed genes promoting fusion with uninfected cells and synapsis, the transposable element could readily copy itself onto homologous chromosomes. It would rapidly spread by infection through the population, until all members con- tained it. The bizarre mating type “alleles” found in many fungi are very nicely explained by this hypothesis. Each of several mating types is in fact not an allele but an “id- iomorph.” Idiomorphs are genes occupying homologous positions on the chromosome but having such dissimilar sequences that they cannot be of homologous origin. These idiomorph genes may simply be the relics of several ancient infections by transposable elements. 236 Part IV Reproduction and Heredity 12.3 The evolutionary origin of sex is a puzzle. The Red Queen Hypothesis. One evolutionary ad- vantage of sex may be that it allows populations to “store” recessive alleles that are currently bad but have promise for reuse at some time in the future. Because populations are constrained by a changing physical and biological environment, selection is constantly acting against such alleles, but in sexual species can never get rid of those sheltered in heterozygotes. The evolution of most sexual species, most of the time, thus manages to keep pace with ever-changing physical and biological constraints. This “treadmill evolution” is sometimes called the “Red Queen hypothesis,” after the Queen of Hearts in Lewis Carroll’s Through the Looking Glass, who tells Alice, “Now, here, you see, it takes all the running you can do, to keep in the same place.” Miller’s Ratchet. The geneticist Herman Miller pointed out in 1965 that asexual populations incorporate a kind of mutational ratchet mechanism—once harmful mutations arise, asexual populations have no way of eliminating them, and they accumulate over time, like turning a ratchet. Sex- ual populations, on the other hand, can employ recombina- tion to generate individuals carrying fewer mutations, which selection can then favor. Sex may just be a way to keep the mutational load down. The Evolutionary Consequences of Sex While our knowledge of how sex evolved is sketchy, it is abundantly clear that sexual reproduction has an enormous impact on how species evolve today, because of its ability to rapidly generate new genetic combinations. Independent assortment (figure 12.16), crossing over, and random fertil- ization each help generate genetic diversity. Whatever the forces that led to sexual reproduction, its evolutionary consequences have been profound. No genetic process generates diversity more quickly; and, as you will see in later chapters, genetic diversity is the raw material of evolution, the fuel that drives it and determines its poten- tial directions. In many cases, the pace of evolution appears to increase as the level of genetic diversity increases. Pro- grams for selecting larger stature in domesticated animals such as cattle and sheep, for example, proceed rapidly at first, but then slow as the existing genetic combinations are exhausted; further progress must then await the generation of new gene combinations. Racehorse breeding provides a graphic example: thoroughbred racehorses are all descen- dants of a small initial number of individuals, and selection for speed has accomplished all it can with this limited amount of genetic variability—the winning times in major races ceased to improve decades ago. Paradoxically, the evolutionary process is thus both revolutionary and conservative. It is revolutionary in that the pace of evolutionary change is quickened by genetic recombination, much of which results from sexual repro- duction. It is conservative in that evolutionary change is not always favored by selection, which may instead pre- serve existing combinations of genes. These conservative pressures appear to be greatest in some asexually repro- ducing organisms that do not move around freely and that live in especially demanding habitats. In vertebrates, on the other hand, the evolutionary premium appears to have been on versatility, and sexual reproduction is the predominant mode of reproduction by an overwhelming margin. The close association between homologous chromosomes that occurs during meiosis may have evolved as mechanisms to repair chromosomal damage, although several alternative mechanisms have also been proposed. Chapter 12 Sexual Reproduction and Meiosis 237 Paternal gamete Diploid offspring Maternal gamete Homologous pairs Potential gametes FIGURE 12.16 Independent assortment increases genetic variability. Independent assortment contributes new gene combinations to the next generation because the orientation of chromosomes on the metaphase plate is random. In the cells shown above with three chromosome pairs, eight different gametes can result, each with different combinations of parental chromosomes. 238 Part IV Reproduction and Heredity Chapter 12 Summary Questions Media Resources 12.1 Meiosis produces haploid cells from diploid cells. ? Meiosis is a special form of nuclear division that produces the gametes of the sexual cycle. It involves two chromosome separations but only one chromosome replication. 1. What are the cellular products of meiosis called, and are they haploid or diploid? What is the cellular product of syngamy called, and is it haploid or diploid? ? The three unique features of meiosis are synapsis, homologous recombination, and reduction division. 2. What three unique features distinguish meiosis from mitosis? 12.2 Meiosis has three unique features. ? The crossing over that occurs between homologues during synapsis is an essential element of meiosis. ? Because crossing over binds the homologues together, only one side of each homologue is accessible to the spindle fibers. Hence, the spindle fibers separate the paired homologues rather than the sister chromatids. ? At the end of meiosis I, one homologue of each chromosome type is present at each of the two poles of the dividing nucleus. The homologues still consist of two chromatids, which may differ from each other as a result of crossing over that occurred during synapsis. ? No further DNA replication occurs before the second nuclear division, which is essentially a mitotic division occurring at each of the two poles. ? The sister chromatids of each chromosome are separated, resulting in the formation of four daughter nuclei, each with half the number of chromosomes that were present before meiosis. ? Cytokinesis typically but not always occurs at this point. When it does, each daughter nucleus has one copy of every chromosome. 3. What are synaptonemal complexes? How do they participate in crossing over? At what stage during meiosis are they formed? 4. How many chromatids are present for each type of chromosome at the completion of crossing over? What two structures hold the chromatids together at this stage? 5. How is the attachment of spindle microtubules to centromeres in metaphase I of meiosis different from that which occurs in metaphase of mitosis? What effect does this difference have on the movement of chromosomes during anaphase I? 6. What mechanism is responsible for the independent assortment of chromosomes? 12.3 The sequence of events during meiosis involves two nuclear divisions. ? In asexual reproduction, mitosis produces offspring genetically identical to the parent. ? Meiosis is thought to have evolved initially as a mechanism to repair double-strand breaks in DNA, in which the broken chromosome is paired with its homologue while it is being repaired. ? The evolutionary significance of meiosis is that it generates large amounts of recombination, rapidly reshuffling gene combinations, producing variability upon which evolutionary processes can act. 7. What is one of the current scientific explanations for the evolution of synapsis? 8. By what three mechanisms does sexual reproduction increase genetic variability? How does this increase in genetic variability affect the evolution of species? 12.4 The evolutionary origin of sex is a puzzle. http://www.mhhe.com/raven6e http://www.biocourse.com ? Art Activity: Meiosis I ? Meiosis ? Meiosis ? Evolution of Sex ? Review of Cell Division 239 13 Patterns of Inheritance Concept Outline 13.1 Mendel solved the mystery of heredity. Early Ideas about Heredity: The Road to Mendel. Before Mendel, the mechanism of inheritance was not known. Mendel and the Garden Pea. Mendel experimented with heredity in edible peas counted his results. What Mendel Found. Mendel found that alternative traits for a character segregated among second-generation progeny in the ratio 3:1. Mendel proposed that information for a trait rather than the trait itself is inherited. How Mendel Interpreted His Results. Mendel found that one alternative of a character could mask the other in heterozygotes, but both could subsequently be expressed in homozygotes of future generations. Mendelian Inheritance Is Not Always Easy to Analyze. A variety of factors can influence the Mendelian segregation of alleles. 13.2 Human genetics follows Mendelian principles. Most Gene Disorders Are Rare. Tay-Sachs disease is due to a recessive allele. Multiple Alleles: The ABO Blood Groups. The human ABO blood groups are determined by three Igene alleles. Patterns of Inheritance Can Be Deduced from Pedigrees. Hemophilia is sex-linked. Gene Disorders Can Be Due to Simple Alterations of Proteins. Sickle cell anemia is caused by a single amino acid change. Some Defects May Soon Be Curable. Cystic fibrosis may soon be cured by gene replacement therapy. 13.3 Genes are on chromosomes. Chromosomes: The Vehicles of Mendelian Inheritance. Mendelian segregation reflects the random assortment of chromosomes in meiosis. Genetic Recombination. Crossover frequency reflect the physical distance between genes. Human Chromosomes. Humans possess 23 pairs of chromosomes, one of them determining the sex. Human Abnormalities Due to Alterations in Chromosome Number. Loss or addition of chromosomes has serious consequences. Genetic Counseling. Some gene defects can be detected early in pregnancy. E very living creature is a product of the long evolu- tionary history of life on earth. While all organisms share this history, only humans wonder about the processes that led to their origin. We are still far from understanding everything about our origins, but we have learned a great deal. Like a partially completed jigsaw puzzle, the boundaries have fallen into place, and much of the internal structure is becoming apparent. In this chapter, we will discuss one piece of the puzzle—the enigma of heredity. Why do groups of people from dif- ferent parts of the world often differ in appearance (fig- ure 13.1)? Why do the members of a family tend to re- semble one another more than they resemble members of other families? FIGURE 13.1 Human beings are extremely diverse in appearance.The differences between us are partly inherited and partly the result of environmental factors we encounter in our lives. 240 Part IV Reproduction and Heredity Early Ideas about Heredity: The Road to Mendel As far back as written records go, patterns of resemblance among the members of particular families have been noted and commented on (figure 13.2). Some familial features are unusual, such as the protruding lower lip of the European royal family Hapsburg, evident in pictures and descriptions of family members from the thirteenth century onward. Other characteristics, like the occur- rence of redheaded children within families of redheaded parents, are more common (figure 13.3). Inherited fea- tures, the building blocks of evolution, will be our con- cern in this chapter. Classical Assumption 1: Constancy of Species Two concepts provided the basis for most of the thinking about heredity before the twentieth century. The first is that heredity occurs within species. For a very long time peo- ple believed that it was possible to obtain bizarre compos- ite animals by breeding (crossing) widely different species. The minotaur of Cretan mythology, a creature with the body of a bull and the torso and head of a man, is one ex- ample. The giraffe was thought to be another; its scien- tific name, Giraffa camelopardalis, suggests the belief that it was the result of a cross between a camel and a leopard. From the Middle Ages onward, however, people discov- ered that such extreme crosses were not possible and that variation and heredity occur mainly within the boundaries of a particular species. Species were thought to have been maintained without significant change from the time of their creation. Classical Assumption 2: Direct Transmission of Traits The second early concept related to heredity is that traits are transmitted directly. When variation is inherited by off- spring from their parents, what is transmitted? The ancient Greeks suggested that the parents’ body parts were trans- mitted directly to their offspring. Hippocrates called this type of reproductive material gonos, meaning “seed.” Hence, a characteristic such as a misshapen limb was the result of material that came from the misshapen limb of a parent. Information from each part of the body was sup- posedly passed along independently of the information from the other parts, and the child was formed after the hereditary material from all parts of the parents’ bodies had come together. This idea was predominant until fairly recently. For ex- ample, in 1868, Charles Darwin proposed that all cells and tissues excrete microscopic granules, or “gemmules,” that 13.1 Mendel solved the mystery of heredity. FIGURE 13.2 Heredity is responsible for family resemblance.Family resemblances are often strong—a visual manifestation of the mechanism of heredity. This is the Johnson family, the wife and daughters of one of the authors. While each daughter is different, all clearly resemble their mother. FIGURE 13.3 Red hair is inherited.Many different traits are inherited in human families. This redhead is exhibiting one of these traits. are passed to offspring, guiding the growth of the corresponding part in the developing embryo. Most similar theories of the direct transmission of hereditary material assumed that the male and female contributions blend in the offspring. Thus, parents with red and brown hair would produce children with reddish brown hair, and tall and short parents would produce children of interme- diate height. Koelreuter Demonstrates Hybridization between Species Taken together, however, these two con- cepts lead to a paradox. If no variation en- ters a species from outside, and if the varia- tion within each species blends in every generation, then all members of a species should soon have the same appearance. Obviously, this does not happen. Individu- als within most species differ widely from each other, and they differ in characteris- tics that are transmitted from generation to generation. How could this paradox be resolved? Ac- tually, the resolution had been provided long before Darwin, in the work of the German botanist Josef Koelreuter. In 1760, Koelreuter carried out successful hy- bridizations of plant species, crossing dif- ferent strains of tobacco and obtaining fer- tile offspring. The hybrids differed in appearance from both parent strains. When individuals within the hybrid generation were crossed, their offspring were highly vari- able. Some of these offspring resembled plants of the hy- brid generation (their parents), but a few resembled the original strains (their grandparents). The Classical Assumptions Fail Koelreuter’s work represents the beginning of modern genetics, the first clues pointing to the modern theory of heredity. Koelreuter’s experiments provided an impor- tant clue about how heredity works: the traits he was studying could be masked in one generation, only to reappear in the next. This pattern contradicts the theory of direct transmission. How could a trait that is transmit- ted directly disappear and then reappear? Nor were the traits of Koelreuter’s plants blended. A contemporary ac- count stated that the traits reappeared in the third gener- ation “fully restored to all their original powers and properties.” It is worth repeating that the offspring in Koelreuter’s crosses were not identical to one another. Some resembled the hybrid generation, while others did not. The alternative forms of the characters Koelreuter was studying were distributed among the off- spring. Referring to a heritable feature as a character, a modern geneticist would say the alternative forms of each character were segregating among the progeny of a mat- ing, meaning that some offspring exhibited one alternative form of a character (for ex- ample, hairy leaves), while other offspring from the same mating exhibited a different alternative (smooth leaves). This segrega- tion of alternative forms of a character, or traits, provided the clue that led Gregor Mendel to his understanding of the nature of heredity. Knight Studies Heredity in Peas Over the next hundred years, other inves- tigators elaborated on Koelreuter’s work. Prominent among them were English gentleman farmers trying to improve vari- eties of agricultural plants. In one such se- ries of experiments, carried out in the 1790s, T. A. Knight crossed two true- breeding varieties (varieties that remain uniform from one generation to the next) of the garden pea, Pisum sativum (fig- ure13.4). One of these varieties had pur- ple flowers, and the other had white flow- ers. All of the progeny of the cross had purple flowers. Among the offspring of these hybrids, however, were some plants with purple flowers and others, less common, with white flowers. Just as in Koelreuter’s earlier studies, a trait from one of the parents disappeared in one generation only to reappear in the next. In these deceptively simple results were the makings of a scientific revolution. Nevertheless, another century passed before the process of gene segregation was fully appreci- ated. Why did it take so long? One reason was that early workers did not quantify their results. A numerical record of results proved to be crucial to understanding the process. Knight and later experimenters who carried out other crosses with pea plants noted that some traits had a “stronger tendency” to appear than others, but they did not record the numbers of the different classes of progeny. Sci- ence was young then, and it was not obvious that the num- bers were important. Early geneticists demonstrated that some forms of an inherited character (1) can disappear in one generation only to reappear unchanged in future generations; (2) segregate among the offspring of a cross; and (3) are more likely to be represented than their alternatives. Chapter 13 Patterns of Inheritance 241 FIGURE 13.4 The garden pea, Pisum sativum.Easy to cultivate and able to produce many distinctive varieties, the garden pea was a popular experimental subject in investigations of heredity as long as a century before Gregor Mendel’s experiments. Mendel and the Garden Pea The first quantitative studies of inheritance were carried out by Gregor Mendel, an Austrian monk (figure 13.5). Born in 1822 to peasant parents, Mendel was educated in a monastery and went on to study science and mathematics at the University of Vienna, where he failed his examina- tions for a teaching certificate. He returned to the monastery and spent the rest of his life there, eventually becoming abbot. In the garden of the monastery (figure 13.6), Mendel initiated a series of experiments on plant hy- bridization. The results of these experiments would ulti- mately change our views of heredity irrevocably. Why Mendel Chose the Garden Pea For his experiments, Mendel chose the garden pea, the same plant Knight and many others had studied earlier. The choice was a good one for several reasons. First, many earlier investigators had produced hybrid peas by crossing different varieties. Mendel knew that he could expect to observe segregation of traits among the offspring. Second, a large number of true-breeding varieties of peas were available. Mendel initially examined 32. Then, for further study, he selected lines that differed with respect to seven easily distinguishable traits, such as round versus wrinkled seeds and purple versus white flowers, a character that Knight had studied. Third, pea plants are small and easy to grow, and they have a relatively short generation time. Thus, one can conduct experiments involving numerous plants, grow several generations in a single year, and obtain results relatively quickly. A fourth advantage of studying peas is that the sexual or- gans of the pea are enclosed within the flower (figure 13.7). The flowers of peas, like those of many flowering plants, contain both male and female sex organs. Furthermore, the gametes produced by the male and female parts of the same flower, unlike those of many flowering plants, can fuse to form viable offspring. Fertilization takes place automati- cally within an individual flower if it is not disturbed, resulting in offspring that are the progeny from a single indi- vidual. Therefore, one can either let individual flowers engage in self- fertilization, or remove the flower’s male parts before fertilization and intro- duce pollen from a strain with a different trait, thus performing cross-pollination which results in cross-fertilization. 242 Part IV Reproduction and Heredity FIGURE 13.5 Gregor Johann Mendel.Cultivating his plants in the garden of a monastery in Brunn, Austria (now Brno, Czech Republic), Mendel studied how differences among varieties of peas were inherited when the varieties were crossed. Similar experiments had been done before, but Mendel was the first to quantify the results and appreciate their significance. FIGURE 13.6 The garden where Mendel carried out his plant-breeding experiments.Gregor Mendel did his key scientific experiments in this small garden in a monastery. Mendel’s Experimental Design Mendel was careful to focus on only a few specific differ- ences between the plants he was using and to ignore the countless other differences he must have seen. He also had the insight to realize that the differences he selected to ana- lyze must be comparable. For example, he appreciated that trying to study the inheritance of round seeds versus tall height would be useless. Mendel usually conducted his experiments in three stages: 1. First, he allowed pea plants of a given variety to pro- duce progeny by self-fertilization for several genera- tions. Mendel thus was able to assure himself that the traits he was studying were indeed constant, transmitted unchanged from generation to genera- tion. Pea plants with white flowers, for example, when crossed with each other, produced only off- spring with white flowers, regardless of the number of generations. 2. Mendel then performed crosses between varieties exhibiting alternative forms of characters. For ex- ample, he removed the male parts from the flower of a plant that produced white flowers and fertilized it with pollen from a purple-flowered plant. He also carried out the reciprocal cross, using pollen from a white-flowered individual to fertilize a flower on a pea plant that produced purple flowers (fig- ure13.8). 3. Finally, Mendel permitted the hy- brid offspring produced by these crosses to self-pollinate for several generations. By doing so, he al- lowed the alternative forms of a character to segregate among the progeny. This was the same exper- imental design that Knight and others had used much earlier. But Mendel went an important step farther: he counted the numbers of offspring exhibiting each trait in each succeeding generation. No one had ever done that before. The quantitative results Mendel obtained proved to be of supreme importance in revealing the process of heredity. Mendel’s experiments with the garden pea involved crosses between true-breeding varieties, followed by a generation or more of inbreeding. Chapter 13 Patterns of Inheritance 243 Petals Anther H20040 Carpel H20038 FIGURE 13.7 Structure of the pea flower (longitudinal section).In a pea plant flower, the petals enclose the male anther (containing pollen grains, which give rise to haploid sperm) and the female carpel (containing ovules, which give rise to haploid eggs). This ensures that self-fertilization will take place unless the flower is disturbed. Pollen transferred from white flower to stigma of purple flower Anthers removed All purple flowers result FIGURE 13.8 How Mendel conducted his experiments.Mendel pushed aside the petals of a white flower and collected pollen from the anthers. He then placed that pollen onto the stigma (part of the carpel) of a purple flower whose anthers had been removed, causing cross- fertilization to take place. All the seeds in the pod that resulted from this pollination were hybrids of the white-flowered male parent and the purple-flowered female parent. After planting these seeds, Mendel observed the pea plants they produced. All of the progeny of this cross had purple flowers. What Mendel Found The seven characters Mendel studied in his experiments possessed several variants that differed from one another in ways that were easy to recognize and score (figure 13.9). We will examine in detail Mendel’s crosses with flower color. His experiments with other characters were similar, and they produced similar results. The F 1 Generation When Mendel crossed two contrasting varieties of peas, such as white-flowered and purple-flowered plants, the hybrid offspring he obtained did not have flowers of in- termediate color, as the theory of blending inheritance would predict. Instead, in every case the flower color of the offspring resembled one of their parents. It is custom- ary to refer to these offspring as the first filial ( filius is 244 Part IV Reproduction and Heredity Character Flower color Seed color Seed shape Pod color Pod shape Flower position Plant height Dominant vs. recessive trait F 2 generation Dominant form Recessive form Ratio 3.15:1 3.01:1 2.96:1 2.82:1 2.95:1 3.14:1 2.84:1 705 224 6022 2001 5474 1850 428 152 882 299 651 207 787 277 Purple White Yellow Green Round Wrinkled Green Yellow Inflated Constricted Axial Terminal Tall Dwarf X X X X X X X FIGURE 13.9 Mendel’s experimental results.This table illustrates the seven characters Mendel studied in his crosses of the garden pea and presents the data he obtained from these crosses. Each pair of traits appeared in the F 2 generation in very close to a 3:1 ratio. Latin for “son”), or F 1 , generation. Thus, in a cross of white-flowered with purple-flowered plants, the F 1 off- spring all had purple flowers, just as Knight and others had reported earlier. Mendel referred to the trait expressed in the F 1 plants as dominant and to the alternative form that was not ex- pressed in the F 1 plants as recessive. For each of the seven pairs of contrasting traits that Mendel examined, one of the pair proved to be dominant and the other recessive. The F 2 Generation After allowing individual F 1 plants to mature and self- pollinate,Mendel collected and planted the seeds from each plant to see what the offspring in the second filial, or F 2 , generation would look like. He found, just as Knight had earlier, that some F 2 plants exhibited white flowers, the recessive trait. Hidden in the F 1 generation, the recessive form reappeared among some F 2 individuals. Believing the proportions of the F 2 types would pro- vide some clue about the mechanism of heredity, Mendel counted the numbers of each type among the F 2 progeny (figure 13.10). In the cross between the purple-flowered F 1 plants, he counted a total of 929 F 2 individuals (see figure 13.9). Of these, 705 (75.9%) had purple flowers and 224 (24.1%) had white flowers. Approximately 1 ?4 of the F 2 individuals exhibited the recessive form of the character. Mendel obtained the same numerical result with the other six characters he examined: 3 ?4 of the F 2 in- dividuals exhibited the dominant trait, and 1 ?4 displayed the recessive trait. In other words, the dominant:recessive ratio among the F 2 plants was always close to 3:1. Mendel carried out similar experiments with other traits, such as wrinkled versus round seeds (figure 13.11), and obtained the same result. Chapter 13 Patterns of Inheritance 245 FIGURE 13.10 A page from Mendel’s notebook. FIGURE 13.11 Seed shape: a Mendelian character.One of the differences Mendel studied affected the shape of pea plant seeds. In some varieties, the seeds were round, while in others, they were wrinkled. A Disguised 1:2:1 Ratio Mendel went on to examine how the F 2 plants passed traits on to subse- quent generations. He found that the recessive 1 ?4were always true-breeding. In the cross of white-flowered with purple-flowered plants, for example, the white-flowered F 2 individuals reli- ably produced white-flowered off- spring when they were allowed to self- fertilize. By contrast, only 1 ?3 of the dominant purple-flowered F 2 individ- uals ( 1 ?4 of all F 2 offspring) proved true-breeding, while 2 ?3 were not. This last class of plants produced dominant and recessive individuals in the third filial (F 3 ) generation in a 3:1 ratio. This result suggested that, for the en- tire sample, the 3:1 ratio that Mendel observed in the F 2 generation was re- ally a disguised 1:2:1 ratio: 1 ?4 pure- breeding dominant individuals, 1 ?2 not- pure-breeding dominant individuals, and 1 ?4 pure-breeding recessive indi- viduals (figure 13.12). Mendel’s Model of Heredity From his experiments, Mendel was able to understand four things about the nature of heredity. First, the plants he crossed did not produce progeny of intermediate appearance, as a theory of blending inheritance would have predicted. Instead, differ- ent plants inherited each alternative intact, as a discrete characteristic that either was or was not visible in a par- ticular generation. Second, Mendel learned that for each pair of alterna- tive forms of a character, one alterna- tive was not expressed in the F 1 hy- brids, although it reappeared in some F 2 individuals. The trait that “disap- peared” must therefore be latent (present but not expressed) in the F 1 individuals. Third, the pairs of alter- native traits examined segregated among the progeny of a particular cross, some individuals exhibiting one trait, some the other. Fourth, these al- ternative traits were expressed in the F 2 generation in the ratio of 3 ?4 domi- nant to 1 ?4 recessive. This characteris- tic 3:1 segregation is often referred to as the Mendelian ratio. 246 Part IV Reproduction and Heredity P (parental) generation Cross- fertilize : : F 1 generation F 3 generation Purple White 3 : 1 3 : 1 1 True-breeding dominant 1 True-breeding recessive Self-fertilize White Purple 2 Not-true-breeding dominant Purple F 2 generation Purple FIGURE 13.12 The F 2 generation is a disguised 1:2:1 ratio.By allowing the F 2 generation to self- fertilize, Mendel found from the offspring (F 3 ) that the ratio of F 2 plants was one true- breeding dominant, two not-true-breeding dominant, and one true-breeding recessive. To explain these results, Mendel proposed a simple model. It has become one of the most famous models in the history of science, containing simple assumptions and mak- ing clear predictions. The model has five elements: 1. Parents do not transmit physiological traits directly to their offspring. Rather, they transmit discrete infor- mation about the traits, what Mendel called “factors.” These factors later act in the offspring to produce the trait. In modern terms, we would say that information about the alternative forms of characters that an indi- vidual expresses is encoded by the factors that it re- ceives from its parents. 2. Each individual receives two factors that may code for the same trait or for two alternative traits for a char- acter. We now know that there are two factors for each character present in each individual because these factors are carried on chromosomes, and each adult individual is diploid. When the individual forms gametes (eggs or sperm), they contain only one of each kind of chromosome (see chapter 12); the ga- metes are haploid. Therefore, only one factor for each character of the adult organism is contained in the gamete. Which of the two factors ends up in a partic- ular gamete is randomly determined. 3. Not all copies of a factor are identical. In modern terms, the alternative forms of a factor, leading to al- ternative forms of a character, are called alleles. When two haploid gametes containing exactly the same allele of a factor fuse during fertilization to form a zygote, the offspring that develops from that zygote is said to be homozygous; when the two haploid ga- metes contain different alleles, the individual off- spring is heterozygous. In modern terminology, Mendel’s factors are called genes. We now know that each gene is composed of a particular DNA nucleotide sequence (see chapter 3). The particular location of a gene on a chromosome is referred to as the gene’s locus(plural, loci). 4. The two alleles, one contributed by the male gamete and one by the female, do not influence each other in any way. In the cells that develop within the new in- dividual, these alleles remain discrete. They neither blend with nor alter each other. (Mendel referred to them as “uncontaminated.”) Thus, when the individ- ual matures and produces its own gametes, the alleles for each gene segregate randomly into these gametes, as described in element 2. 5. The presence of a particular allele does not ensure that the trait encoded by it will be expressed in an in- dividual carrying that allele. In heterozygous individ- uals, only one allele (the dominant one) is expressed, while the other (recessive) allele is present but unex- pressed. To distinguish between the presence of an allele and its expression, modern geneticists refer to the totality of alleles that an individual contains as the individual’s genotype and to the physical appearance of that individual as its phenotype.The phenotype of an individual is the observable outward manifestation of its genotype, the result of the functioning of the enzymes and proteins encoded by the genes it carries. In other words, the genotype is the blueprint, and the phenotype is the visible outcome. These five elements, taken together, constitute Mendel’s model of the hereditary process. Many traits in humans also exhibit dominant or recessive inheritance, similar to the traits Mendel studied in peas (table 13.1). When Mendel crossed two contrasting varieties, he found all of the offspring in the first generation exhibited one (dominant) trait, and none exhibited the other (recessive) trait. In the following generation, 25% were pure-breeding for the dominant trait, 50% were hybrid for the two traits and exhibited the dominant trait, and 25% were pure-breeding for the recessive trait. Chapter 13 Patterns of Inheritance 247 Table 13.1 Some Dominant and Recessive Traits in Humans Recessive Traits Phenotypes Dominant Traits Phenotypes Albinism Alkaptonuria Red-green color blindness Cystic fibrosis Duchenne muscular dystrophy Hemophilia Sickle cell anemia Lack of melanin pigmentation Inability to metabolize homogenistic acid Inability to distinguish red or green wavelengths of light Abnormal gland secretion, leading to liver degeneration and lung failure Wasting away of muscles during childhood Inability to form blood clots Defective hemoglobin that causes red blood cells to curve and stick together Middigital hair Brachydactyly Huntington’s disease Phenylthiocarbamide (PTC) sensitivity Camptodactyly Hypercholesterolemia (the most common human Mendelian disorder—1 in 500) Polydactyly Presence of hair on middle segment of fingers Short fingers Degeneration of nervous system, starting in middle age Ability to taste PTC as bitter Inability to straighten the little finger Elevated levels of blood cholesterol and risk of heart attack Extra fingers and toes How Mendel Interpreted His Results Does Mendel’s model predict the results he actually ob- tained? To test his model, Mendel first expressed it in terms of a simple set of symbols, and then used the symbols to interpret his results. It is very instructive to do the same. Consider again Mendel’s cross of purple-flowered with white-flowered plants. We will assign the symbol P to the dominant allele, associated with the production of purple flowers, and the symbol p to the recessive allele, associated with the production of white flowers. By convention, ge- netic traits are usually assigned a letter symbol referring to their more common forms, in this case “P” for purple flower color. The dominant allele is written in upper case, as P; the recessive allele (white flower color) is assigned the same symbol in lower case, p. In this system, the genotype of an individual that is true- breeding for the recessive white-flowered trait would be designated pp. In such an individual, both copies of the al- lele specify the white-flowered phenotype. Similarly, the genotype of a true-breeding purple-flowered individual would be designated PP, and a heterozygote would be des- ignated Pp (dominant allele first). Using these conventions, and denoting a cross between two strains with ×, we can symbolize Mendel’s original cross as pp × PP. The F 1 Generation Using these simple symbols, we can now go back and re- examine the crosses Mendel carried out. Because a white- flowered parent (pp) can produce only p gametes, and a pure purple-flowered (homozygous dominant) parent (PP) can produce only P gametes, the union of an egg and a sperm from these parents can produce only het- erozygous Pp offspring in the F 1 generation. Because the P allele is dominant, all of these F 1 individuals are ex- pected to have purple flowers. The p allele is present in these heterozygous individuals, but it is not phenotypi- cally expressed. This is the basis for the latency Mendel saw in recessive traits. The F 2 Generation When F 1 individuals are allowed to self-fertilize, the P and p alleles segregate randomly during gamete forma- tion. Their subsequent union at fertilization to form F 2 individuals is also random, not being influenced by which alternative alleles the individual gametes carry. What will the F 2 individuals look like? The possibilities may be visu- alized in a simple diagram called a Punnett square, named after its originator, the English geneticist Reginald Crundall Punnett (figure 13.13). Mendel’s model, ana- 248 Part IV Reproduction and Heredity P Pp p P Pp ppp p (a) (b) P Pp p Pp P Pp p Pp pp Pp Pp pp PpP PP Pp p Gametes Gametes FIGURE 13.13 A Punnett square.(a) To make a Punnett square, place the different possible types of female gametes along one side of a square and the different possible types of male gametes along the other. (b) Each potential zygote can then be represented as the intersection of a vertical line and a horizontal line. lyzed in terms of a Punnett square, clearly predicts that the F 2 generation should consist of 3 ?4 purple-flowered plants and 1 ?4 white-flowered plants, a phenotypic ratio of 3:1 (figure 13.14). The Laws of Probability Can Predict Mendel’s Results A different way to express Mendel’s result is to say that there are three chances in four ( 3 ?4) that any particular F 2 individual will exhibit the dominant trait, and one chance in four ( 1 ?4) that an F 2 individual will express the recessive trait. Stating the results in terms of probabilities allows simple predictions to be made about the outcomes of crosses. If both F 1 parents are Pp (heterozygotes), the probability that a particular F 2 individual will be pp (ho- mozygous recessive) is the probability of receiving a p ga- mete from the male ( 1 ?2) times the probability of receiving a p gamete from the female ( 1 ?2), or 1 ?4. This is the same operation we perform in the Punnett square illustrated in figure 13.13. The ways probability theory can be used to analyze Mendel’s results is discussed in detail on page251. Further Generations As you can see in figure 13.14, there are really three kinds of F 2 individuals: 1 ?4are pure-breeding, white-flowered indi- viduals (pp); 1 ?2 are heterozygous, purple-flowered individu- als (Pp); and 1 ?4 are pure-breeding, purple-flowered individ- uals (PP). The 3:1 phenotypic ratio is really a disguised 1:2:1 genotypic ratio. Mendel’s First Law of Heredity: Segregation Mendel’s model thus accounts in a neat and satisfying way for the segregation ratios he observed. Its central assump- tion—that alternative alleles of a character segregate from each other in heterozygous individuals and remain dis- tinct—has since been verified in many other organisms. It is commonly referred to as Mendel’s First Law of Hered- ity, or the Law of Segregation. As you saw in chapter 12, the segregational behavior of alternative alleles has a simple physical basis, the alignment of chromosomes at random on the metaphase plate during meiosis I. It is a tribute to the intellect of Mendel’s analysis that he arrived at the cor- rect scheme with no knowledge of the cellular mechanisms of inheritance; neither chromosomes nor meiosis had yet been described. Chapter 13 Patterns of Inheritance 249 Purple (Pp) Purple (PP ) Pp p p P P P p F 1 generation F 2 generation White (pp) Purple (Pp) Pp ppPp PP PpPp Pp Pp Gametes Gametes Gametes Gametes FIGURE 13.14 Mendel’s cross of pea plants differing in flower color.All of the offspring of the first cross (the F 1 generation) are Ppheterozygotes with purple flowers. When two heterozygous F 1 individuals are crossed, three kinds of F 2 offspring are possible: PP homozygotes (purple flowers); Ppheterozygotes (also purple flowers); and pphomozygotes (white flowers). Therefore, in the F 2 generation, the ratio of dominant to recessive phenotypes is 3:1. However, the ratio of genotypes is 1:2:1 (1 PP: 2 Pp: 1 pp). The Testcross To test his model further, Mendel devised a simple and powerful procedure called the testcross.Consider a purple- flowered plant. It is impossible to tell whether such a plant is homozygous or heterozygous simply by looking at its phenotype. To learn its genotype, you must cross it with some other plant. What kind of cross would provide the answer? If you cross it with a homozygous dominant indi- vidual, all of the progeny will show the dominant pheno- type whether the test plant is homozygous or heterozygous. It is also difficult (but not impossible) to distinguish be- tween the two possible test plant genotypes by crossing with a heterozygous individual. However, if you cross the test plant with a homozygous recessive individual, the two possible test plant genotypes will give totally different re- sults (figure 13.15): Alternative 1: unknown individual homozygous dominant (PP). PP × pp: all offspring have purple flowers (Pp) Alternative 2: unknown individual heterozygous (Pp). Pp × pp: 1 ?2of offspring have white flowers (pp) and 1 ?2have purple flowers (Pp) To perform his testcross, Mendel crossed heterozygous F 1 individuals back to the parent homozygous for the reces- sive trait. He predicted that the dominant and recessive traits would appear in a 1:1 ratio, and that is what he ob- served. For each pair of alleles he investigated, Mendel ob- served phenotypic F 2 ratios of 3:1 (see figure 13.14) and testcross ratios very close to 1:1, just as his model predicted. Testcrosses can also be used to determine the genotype of an individual when two genes are involved. Mendel car- ried out many two-gene crosses, some of which we will dis- cuss. He often used testcrosses to verify the genotypes of particular dominant-appearing F 2 individuals. Thus, an F 2 individual showing both dominant traits (A_ B_) might have any of the following genotypes: AABB, AaBB, AABb, or AaBb. By crossing dominant-appearing F 2 individuals with homozygous recessive individuals (that is, A_ B_ × aabb), Mendel was able to determine if either or both of the traits bred true among the progeny, and so to determine the genotype of the F 2 parent: AABB trait A breeds true trait B breeds true AaBB ________________ trait B breeds true AABb trait A breeds true ________________ AaBb ________________ ________________ 250 Part IV Reproduction and Heredity if PP if Pp Dominant phenotype (unknown genotype) Half of offspring are white; therefore, unknown flower is heterozygous. All offspring are purple; therefore, unknown flower is homozygous dominant. PPP p p p pp pp pp ppPp Pp p p Pp PpPp Pp Alternative 1 Alternative 2 Homozygous recessive (white) Homozygous recessive (white) ? FIGURE 13.15 A testcross.To determine whether an individual exhibiting a dominant phenotype, such as purple flowers, is homozygous or heterozygous for the dominant allele, Mendel crossed the individual in question with a plant that he knew to be homozygous recessive, in this case a plant with white flowers. Chapter 13 Patterns of Inheritance 251 Probability and Allele Distribution The probability that the three children will be two boys and one girl is: 3p 2 q= 3 ×( 1 ?2) 2 ×( 1 ?2) = 3 ?8 To test your understanding, try to esti- mate the probability that two parents het- erozygous for the recessive allele producing albinism (a) will have one albino child in a family of three. First, set up a Punnett square: Father’s Gametes Aa Mother’s A AA Aa Gametes a Aa aa You can see that one-fourth of the chil- dren are expected to be albino (aa). Thus, for any given birth the probability of an al- bino child is 1 ?4. This probability can be sym- bolized by q. The probability of a nonalbino child is 3 ?4, symbolized by p. Therefore, the probability that there will be one albino child among the three children is: 3p 2 q= 3 ×( 3 ?4) 2 ×( 1 ?4) = 27 ?64, or 42% This means that the chance of having one albino child in the three is 42%. Many, although not all, alternative alleles produce discretely different phenotypes. Mendel’s pea plants were tall or dwarf, had purple or white flowers, and produced round or wrinkled seeds. The eye color of a fruit fly may be red or white, and the skin color of a human may be pigmented or al- bino. When only two alternative alleles exist for a given character, the distribution of phenotypes among the offspring of a cross is referred to as a binomial distribution. As an example, consider the distribution of sexes in humans. Imagine that a couple has chosen to have three children. How likely is it that two of the children will be boys and one will be a girl? The frequency of any particular possibility is referred to as its probability of occurrence. Let p symbol- ize the probability of having a boy at any given birth and q symbolize the probability of having a girl. Since any birth is equally likely to produce a girl or boy: p = q = 1 ?2 Table 13.A shows eight possible gender combinations among the three children. The sum of the probabilities of the eight possible combinations must equal one. Thus: p 3 + 3p 2 q+ 3pq 2 + q 3 = 1 Table 13.A Binomial Distribution of the Sexes of Children in Human Families Composition Order of Family of Birth Calculation Probability 3 boys bbb p × p × pp 3 2 boys and 1 girl bbg p × p × qp 2 q bgb p × q × pp 2 q 3p 2 q gbb q × p × 2 q 1 boy and 2 girls ggb q × q × pp 2 gbg q × p × qpq 2 3pq 2 bgg p × q × 2 3 girls ggg q × q × qq 3 erozygous individual with one copy of that allele has the same appearance as a homozy- gous individual with two copies of it. gene The basic unit of heredity; a se- quence of DNA nucleotides on a chromo- some that encodes a polypeptide or RNA molecule and so determines the nature of an individual’s inherited traits. genotype The total set of genes present in the cells of an organism. This term is often also used to refer to the set of alleles at a single gene. haploid Having only one set of chromo- somes. Gametes, certain animals, protists and fungi, and certain stages in the life cycle of plants are haploid. heterozygote A diploid individual carry- ing two different alleles of a gene on two homologous chromosomes. Most human beings are heterozygous for many genes. homozygote A diploid individual carry- ing identical alleles of a gene on both ho- mologous chromosomes. locus The location of a gene on a chromosome. phenotype The realized expression of the genotype; the observable manifestation of a trait (affecting an individual’s structure, phys- iology, or behavior) that results from the bio- logical activity of the DNA molecules. recessive allele An allele whose pheno- typic effect is masked in heterozygotes by the presence of a dominant allele. allele One of two or more alternative forms of a gene. diploid Having two sets of chromo- somes, which are referred to as homologues. Animals and plants are diploid in the dom- inant phase of their life cycles as are some protists. dominant allele An allele that dictates the appearance of heterozygotes. One allele is said to be dominant over another if a het- Vocabulary of Genetics Mendel’s Second Law of Heredity: Independent Assortment After Mendel had demonstrated that different traits of a given character (alleles of a given gene) segregate inde- pendently of each other in crosses, he asked whether dif- ferent genes also segregate independently. Mendel set out to answer this question in a straightforward way. He first established a series of pure-breeding lines of peas that dif- fered in just two of the seven characters he had studied. He then crossed contrasting pairs of the pure-breeding lines to create heterozygotes. In a cross involving differ- ent seed shape alleles (round, R, and wrinkled, r) and dif- ferent seed color alleles (yellow, Y, and green, y), all the F 1 individuals were identical, each one heterozygous for both seed shape (Rr) and seed color (Yy). The F 1 individu- als of such a cross are dihybrids, individuals heterozygous for both genes. The third step in Mendel’s analysis was to allow the di- hybrids to self-fertilize. If the alleles affecting seed shape and seed color were segregating independently, then the probability that a particular pair of seed shape alleles would occur together with a particular pair of seed color alleles would be simply the product of the individual prob- abilities that each pair would occur separately. Thus, the probability that an individual with wrinkled green seeds (rryy) would appear in the F 2 generation would be equal to the probability of observing an individual with wrinkled seeds ( 1 ?4) times the probability of observing one with green seeds ( 1 ?4), or 1 ?16. Because the gene controlling seed shape and the gene controlling seed color are each represented by a pair of alternative alleles in the dihybrid individuals, four types of gametes are expected: RY, Ry, rY, and ry. Therefore, in the F 2 generation there are 16 possible combinations of alleles, each of them equally probable (figure 13.16). Of these, 9 possess at least one dominant allele for each gene (signified R__Y__, where the dash indicates the presence of either allele) and, thus, should have round, yellow seeds. Of the rest, 3 possess at least one dominant R allele but are homozygous recessive for color (R__yy); 3 others possess at least one dominant Y allele but are homozy- gous recessive for shape (rrY__); and 1 combination among the 16 is homozygous recessive for both genes (rryy). The hypothesis that color and shape genes assort independently thus predicts that the F 2 generation will display a 9:3:3:1 phenotypic ratio: nine individuals with round, yellow seeds, three with round, green seeds, three with wrinkled, yellow seeds, and one with wrinkled, green seeds (see figure 13.16). What did Mendel actually observe? From a total of 556 seeds from dihybrid plants he had allowed to self-fertilize, he observed: 315 round yellow (R__Y__), 108 round green (R__yy), 101 wrinkled yellow (rrY__), and 32 wrinkled green (rryy). These results are very close to a 9:3:3:1 ratio (which would be 313:104:104:35). Consequently, the two genes appeared to assort completely independently of each other. Note that this independent assortment of different genes in no way alters the independent segregation of individual pairs of alleles. Round versus wrinkled seeds occur in a ratio of approximately 3:1 (423:133); so do yellow versus green seeds (416:140). Mendel obtained similar results for other pairs of traits. Mendel’s discovery is often referred to as Mendel’s Second Law of Heredity, or the Law of Independent Assortment. Genes that assort independently of one an- other, like the seven genes Mendel studied, usually do so because they are located on different chromosomes, which segregate independently during the meiotic process of ga- mete formation. A modern restatement of Mendel’s Second Law would be that genes that are located on different chromo- somes assort independently during meiosis. Mendel summed up his discoveries about heredity in two laws. Mendel’s First Law of Heredity states that alternative alleles of a trait segregate independently; his Second Law of Heredity states that genes located on different chromosomes assort independently. 252 Part IV Reproduction and Heredity RY RY Ry rY ry Ry rY ry RRYY RRYy RrYY RrYy F 1 generation F 2 generation 9/16 are round, yellow 3/16 are round, green 3/16 are wrinkled, yellow 1/16 are wrinkled, green Wrinkled, green seeds (rryy) Round, yellow seeds (RRYY) X All round, yellow seeds (RrYy) RRYy RRyy RrYy Rryy RrYY RrYy rrYY rrYy RrYy Rryy rrYy rryy Sperm Eggs FIGURE 13.16 Analyzing a dihybrid cross.This Punnett square shows the results of Mendel’s dihybrid cross between plants with round yellow seeds and plants with wrinkled green seeds. The ratio of the four possible combinations of phenotypes is predicted to be 9:3:3:1, the ratio that Mendel found. Mendelian Inheritance Is Not Always Easy to Analyze Although Mendel’s results did not receive much notice during his lifetime, three different investigators indepen- dently rediscovered his pioneering paper in 1900, 16 years after his death. They came across it while searching the lit- erature in preparation for publishing their own findings, which closely resembled those Mendel had presented more than three decades earlier. In the decades following the re- discovery of Mendel, many investigators set out to test Mendel’s ideas. However, scientists attempting to confirm Mendel’s theory often had trouble obtaining the same sim- ple ratios he had reported. Often, the expression of the genotype is not straightforward. Most phenotypes reflect the action of many genes that act sequentially or jointly, and the phenotype can be affected by alleles that lack com- plete dominance and the environment. Continuous Variation Few phenotypes are the result of the action of only one gene. Instead, most characters reflect the action of poly- genes, many genes that act sequentially or jointly. When multiple genes act jointly to influence a character such as height or weight, the character often shows a range of small differences. Because all of the genes that play a role in de- termining phenotypes such as height or weight segregate independently of one another, one sees a gradation in the degree of difference when many individuals are examined (figure 13.17). We call this gradation continuous varia- tion. The greater the number of genes that influence a character, the more continuous the expected distribution of the versions of that character. How can one describe the variation in a character such as the height of the individuals in figure 13.17? Individuals range from quite short to very tall, with average heights more common than either extreme. What one often does is to group the variation into categories—in this case, by measuring the heights of the individuals in inches, round- ing fractions of an inch to the nearest whole number. Each height, in inches, is a separate phenotypic category. Plot- ting the numbers in each height category produces a his- togram, such as that in figure 13.17. The histogram ap- proximates an idealized bell-shaped curve, and the variation can be characterized by the mean and spread of that curve. Pleiotropic Effects Often, an individual allele will have more than one effect on the phenotype. Such an allele is said to be pleiotropic. When the pioneering French geneticist Lucien Cuenot studied yellow fur in mice, a dominant trait, he was unable to obtain a true-breeding yellow strain by crossing individ- ual yellow mice with each other. Individuals homozygous for the yellow allele died, because the yellow allele was pleiotropic: one effect was yellow coat color, but another was a lethal developmental defect. A pleiotropic allele may be dominant with respect to one phenotypic consequence (yellow fur) and recessive with respect to another (lethal developmental defect). In pleiotropy, one gene affects many traits, in marked contrast to polygeny, where many genes affect one trait. Pleiotropic effects are difficult to predict, because the genes that affect a trait often perform other functions we may know nothing about. Pleiotropic effects are characteristic of many inherited disorders, such as cystic fibrosis and sickle cell anemia, both discussed later in this chapter. In these disorders, multiple symptoms can be traced back to a single gene defect. In cys- tic fibrosis, patients exhibit clogged blood vessels, overly sticky mucus, salty sweat, liver and pancreas failure, and a battery of other symptoms. All are pleiotropic effects of a single defect, a mutation in a gene that encodes a chloride ion transmembrane channel. In sickle cell anemia, a defect in the oxygen-carrying hemoglobin molecule causes anemia, heart failure, increased susceptibility to pneumonia, kidney failure, enlargement of the spleen, and many other symp- toms. It is usually difficult to deduce the nature of the pri- mary defect from the range of a gene’s pleiotropic effects. Chapter 13 Patterns of Inheritance 253 Number of individuals 30 20 10 0 5'0'' 5'6'' Height 6'0'' FIGURE 13.17 Height is a continuously varying trait. The photo shows variation in height among students of the 1914 class of the Connecticut Agricultural College. Because many genes contribute to height and tend to segregate independently of one another, the cumulative contribution of different combinations of alleles to height forms a continuous distribution of possible height, in which the extremes are much rarer than the intermediate values. Lack of Complete Dominance Not all alternative alleles are fully dominant or fully recessive in het- erozygotes. Some pairs of alleles in- stead produce a heterozygous pheno- type that is either intermediate between those of the parents (incom- plete dominance), or representative of both parental phenotypes (codomi- nance). For example, in the cross of red and white flowering Japanese four o’- clocks described in figure 13.18, all the F 1 offspring had pink flowers—indicat- ing that neither red nor white flower color was dominant. Does this example of incomplete dominance argue that Mendel was wrong? Not at all. When two of the F 1 pink flowers were crossed, they produced red-, pink-, and white-flowered plants in a 1:2:1 ratio. Heterozygotes are simply intermediate in color. Environmental Effects The degree to which an allele is ex- pressed may depend on the environ- ment. Some alleles are heat-sensitive, for example. Traits influenced by such alleles are more sensitive to temperature or light than are the products of other alleles. The arctic foxes in figure 13.19, for example, make fur pigment only when the weather is warm. Similarly, the ch allele in Hi- malayan rabbits and Siamese cats encodes a heat-sensitive version of tyrosinase, one of the enzymes mediating the production of melanin, a dark pigment. The ch version of the enzyme is inactivated at temperatures above about 33°C. At the surface of the body and head, the temperature is above 33°C and the tyrosinase enzyme is inactive, while it is more active at body extremities such as the tips of the ears and tail, where the temperature is below 33°C. The dark melanin pigment this enzyme produces causes the ears, snout, feet, and tail of Himalayan rabbits and Siamese cats to be black. 254 Part IV Reproduction and Heredity F 1 generation F 2 generation C R C R C R C R C R C W C R C W C R C W C R C W All C R C W C W C W C W C W 1 : 2 : 1 C R C R :C R C W :C W C W Eggs Sperm FIGURE 13.18 Incomplete dominance.In a cross between a red-flowered Japanese four o’clock, genotype C R C R ,and a white-flowered one (C W C W ), neither allele is dominant. The heterozygous progeny have pink flowers and the genotype C R C W .If two of these heterozygotes are crossed, the phenotypes of their progeny occur in a ratio of 1:2:1 (red:pink:white). (a) (b) FIGURE 13.19 Environmental effects on an allele.(a) An arctic fox in winter has a coat that is almost white, so it is difficult to see the fox against a snowy background. (b) In summer, the same fox’s fur darkens to a reddish brown, so that it resembles the color of the surrounding tundra. Heat-sensitive alleles control this color change. Epistasis In the tests of Mendel’s ideas that followed the rediscovery of his work, scientists had trouble obtaining Mendel’s simple ratios particularly with dihybrid crosses. Recall that when individuals heterozygous for two different genes mate (a dihybrid cross), four different phenotypes are possible among the progeny: off- spring may display the dominant phenotype for both genes, either one of the genes, or for neither gene. Sometimes, however, it is not possi- ble for an investigator to identify successfully each of the four pheno- typic classes, because two or more of the classes look alike. Such situations proved confusing to investigators following Mendel. One example of such difficulty in identification is seen in the analysis of particular varieties of corn, Zea mays. Some commercial varieties exhibit a purple pigment called anthocyanin in their seed coats, while others do not. In 1918, geneticist R. A. Emerson crossed two pure-breeding corn vari- eties, neither exhibiting anthocyanin pigment. Surprisingly, all of the F 1 plants produced purple seeds. When two of these pigment- producing F 1 plants were crossed to produce an F 2 generation, 56% were pigment producers and 44% were not. What was happening? Emerson correctly deduced that two genes were involved in producing pigment, and that the second cross had thus been a dihybrid cross. Mendel had predicted 16 equally possible ways gametes could combine. How many of these were in each of the two types Emerson obtained? He multiplied the fraction that were pigment producers (0.56) by 16 to obtain 9, and multiplied the fraction that were not (0.44) by 16 to ob- tain 7. Thus, Emerson had a modified ratio of 9:7 in- stead of the usual 9:3:3:1 ratio. Why Was Emerson’s Ratio Modified? When genes act sequentially, as in a biochemical pathway, an allele ex- pressed as a defective enzyme early in the pathway blocks the flow of material through the rest of the pathway. This makes it impossible to judge whether the later steps of the pathway are functioning properly. Such gene inter- action, where one gene can interfere with the expression of another gene, is the basis of the phenomenon called epistasis. The pigment anthocyanin is the product of a two-step biochemical pathway: Enzyme 1 Enzyme 2 Starting molecule–→ Intermediate–→ Anthocyanin (Colorless) (Colorless) (Purple) To produce pigment, a plant must possess at least one functional copy of each enzyme gene (figure 13.20). The dominant alleles encode functional enzymes, but the reces- sive alleles encode nonfunctional enzymes. Of the 16 geno- types predicted by random assortment, 9 contain at least one dominant allele of both genes; they produce purple progeny. The remaining 7 genotypes lack dominant alleles at either or both loci (3 + 3 + 1 = 7) and so are phenotypi- cally the same (nonpigmented), giving the phenotypic ratio of 9:7 that Emerson observed. The inability to see the ef- fect of enzyme 2 when enzyme 1 is nonfunctional is an ex- ample of epistasis. Chapter 13 Patterns of Inheritance 255 AB AB Ab aB ab Ab aB ab AABB AABb AaBB AaBb F 2 generation 9/16 purple 7/16 white F 1 generation All purple (AaBb) X AABb AAbb AaBb Aabb AaBB AaBb aaBB aaBb AaBb Aabb aaBb aabb Eggs Sperm White (aaBB) White (AAbb) FIGURE 13.20 How epistasis affects grain color.The purple pigment found in some varieties of corn is the product of a two-step biochemical pathway. Unless both enzymes are active (the plant has a dominant allele for each of the two genes, Aand B), no pigment is expressed. Other Examples of Epistasis In many animals, coat color is the result of epistatic inter- actions among genes. Coat color in Labrador retrievers, a breed of dog, is due primarily to the interaction of two genes. The E gene determines if dark pigment (eumelanin) will be deposited in the fur or not. If a dog has the geno- type ee, no pigment will be deposited in the fur, and it will be yellow. If a dog has the genotype EE or Ee (E_), pigment will be deposited in the fur. A second gene, the B gene, determines how dark the pigment will be. This gene controls the distribution of melanosomes in a hair. Dogs with the genotype E_bb will have brown fur and are called chocolate labs. Dogs with the genotype E_B_ will have black fur. But, even in yellow dogs, the B gene does have some effect. Yellow dogs with the genotype eebb will have brown pigment on their nose, lips, and eye rims, while yellow dogs with the genotype eeB_ will have black pigment in these areas. The interaction among these alleles is illustrated in figure 13.21. The genes for coat color in this breed have been found, and a genetic test is available to determine the coat colors in a litter of puppies. A variety of factors can disguise the Mendelian segregation of alleles. Among them are the continuous variation that results when many genes contribute to a trait, incomplete dominance and codominance that produce heterozygotes unlike either parent, environmental influences on the expression of phenotypes, and gene interactions that produce epistasis. 256 Part IV Reproduction and Heredity No dark pigment in fur ee eebb eeB_ Yellow fur, brown nose, lips, eye rims Yellow fur, black nose, lips, eye rims Yellow Lab Dark pigment in fur E_ E_bb E_B_ Brown fur, nose, lips, eye rims Black fur, nose, lips, eye rims Chocolate Lab Black Lab FIGURE 13.21 The effect of epistatic interactions on coat color in dogs. The coat color seen in Labrador retrievers is an example of the interaction of two genes, each with two alleles. The Egene determines if the pigment will be deposited in the fur, and the Bgene determines how dark the pigment will be. Random changes in genes, called mutations, occur in any population. These changes rarely improve the functioning of the proteins those genes encode, just as randomly chang- ing a wire in a computer rarely improves the computer’s functioning. Mutant alleles are usually recessive to other al- leles. When two seemingly normal individuals who are het- erozygous for such an allele produce offspring homozygous for the allele, the offspring suffer the detrimental effects of the mutant allele. When a detrimental allele occurs at a sig- nificant frequency in a population, the harmful effect it produces is called a gene disorder. Most Gene Disorders Are Rare Tay-Sachs disease is an incurable hereditary disorder in which the nervous system deteriorates. Affected children appear normal at birth and usually do not develop symp- toms until about the eighth month, when signs of mental deterioration appear. The children are blind within a year after birth, and they rarely live past five years of age. Tay-Sachs disease is rare in most human populations, occurring in only 1 of 300,000 births in the United States. However, the disease has a high incidence among Jews of Eastern and Central Europe (Ashkenazi), and among American Jews, 90% of whom trace their ancestry to East- ern and Central Europe. In these populations, it is esti- mated that 1 in 28 individuals is a heterozygous carrier of the disease, and approximately 1 in 3500 infants has the disease. Because the disease is caused by a recessive allele, most of the people who carry the defective allele do not themselves develop symptoms of the disease. The Tay-Sachs allele produces the disease by encoding a nonfunctional form of the enzyme hexosaminidase A. This enzyme breaks down gangliosides, a class of lipids occurring within the lysosomes of brain cells (figure 13.22). As a re- sult, the lysosomes fill with gangliosides, swell, and eventu- ally burst, releasing oxidative enzymes that kill the cells. There is no known cure for this disorder. Not All Gene Defects Are Recessive Not all hereditary disorders are recessive. Huntington’s disease is a hereditary condition caused by a dominant al- lele that leads to the progressive deterioration of brain cells (figure 13.23). Perhaps 1 in 24,000 individuals develops the disorder. Because the allele is dominant, every individual that carries the allele expresses the disorder. Nevertheless, the disorder persists in human populations because its symptoms usually do not develop until the affected individ- uals are more than 30 years old, and by that time most of those individuals have already had children. Consequently, the allele is often transmitted before the lethal condition develops. A person who is heterozygous for Huntington’s disease has a 50% chance of passing the disease to his or her children (even though the other parent does not have the disorder). In contrast, the carrier of a recessive disorder such as cystic fibrosis has a 50% chance of passing the allele to offspring and must mate with another carrier to risk bearing a child with the disease. Most gene defects are rare recessives, although some are dominant. Chapter 13 Patterns of Inheritance 257 13.2 Human genetics follows Mendelian principles. Percent of normal enzyme function 100 50 Tay-Sachs (homozygous recessive) Carrier (heterozygous) Normal (homozygous dominant) 0 FIGURE 13.22 Tay-Sachs disease.Homozygous individuals (left bar) typically have less than 10% of the normal level of hexosaminidase A (right bar), while heterozygous individuals (middle bar) have about 50% of the normal level—enough to prevent deterioration of the central nervous system. Age in years Huntington’s disease Percent of total with Huntington's allele af fected by the disease 0 0 25 50 75 100 10 20 4030 50 60 70 80 FIGURE 13.23 Huntington’s disease is a dominant genetic disorder.It is because of the late age of onset of this disease that it persists despite the fact that it is dominant and fatal. Multiple Alleles: The ABO Blood Groups A gene may have more than two alleles in a population, and most genes possess several different alleles. Often, no single allele is dominant; instead, each allele has its own effect, and the alleles are considered codominant. A human gene with more than one codominant allele is the gene that determines ABO blood type. This gene en- codes an enzyme that adds sugar molecules to lipids on the surface of red blood cells. These sugars act as recognition markers for the immune system. The gene that encodes the enzyme, designated I, has three common alleles: I B , whose product adds galactose; I A , whose product adds galac- tosamine; and i, which codes for a protein that does not add a sugar. Different combinations of the three I gene alleles occur in different individuals because each person possesses two copies of the chromosome bearing the I gene and may be homozygous for any allele or heterozygous for any two. An individual heterozygous for the I A and I B alleles produces both forms of the enzyme and adds both galactose and galactosamine to the surfaces of red blood cells. Because both alleles are expressed simultaneously in heterozygotes, the I A and I B alleles are codominant. Both I A and I B are dominant over the i allele because both I A or I B alleles lead to sugar addition and the i allele does not. The different combinations of the three alleles produce four different phenotypes (figure 13.24): 1. Type A individuals add only galactosamine. They are either I A I A homozygotes or I A iheterozygotes. 2. Type B individuals add only galactose. They are ei- ther I B I B homozygotes or I B iheterozygotes. 3. Type AB individuals add both sugars and are I A I B het- erozygotes. 4. Type O individuals add neither sugar and are ii ho- mozygotes. These four different cell surface phenotypes are called the ABO blood groups or, less commonly, the Land- steiner blood groups, after the man who first described them. As Landsteiner noted, a person’s immune system can distinguish between these four phenotypes. If a type A individual receives a transfusion of type B blood, the recip- ient’s immune system recognizes that the type B blood cells possess a “foreign” antigen (galactose) and attacks the donated blood cells, causing the cells to clump, or aggluti- nate. This also happens if the donated blood is type AB. However, if the donated blood is type O, no immune at- tack will occur, as there are no galactose antigens on the surfaces of blood cells produced by the type O donor. In general, any individual’s immune system will tolerate a transfusion of type O blood. Because neither galactose nor galactosamine is foreign to type AB individuals (whose red blood cells have both sugars), those individuals may re- ceive any type of blood. The Rh Blood Group Another set of cell surface markers on human red blood cells are the Rh blood group antigens, named for the rhe- sus monkey in which they were first described. About 85% of adult humans have the Rh cell surface marker on their red blood cells, and are called Rh-positive. Rh-negative persons lack this cell surface marker because they are ho- mozygous for the recessive gene encoding it. If an Rh-negative person is exposed to Rh-positive blood, the Rh surface antigens of that blood are treated like foreign invaders by the Rh-negative person’s immune sys- tem, which proceeds to make antibodies directed against the Rh antigens. This most commonly happens when an Rh-negative woman gives birth to an Rh-positive child (whose father is Rh-positive). At birth, some fetal red blood cells cross the placental barrier and enter the mother’s bloodstream, where they induce the production of “anti- Rh” antibodies. In subsequent pregnancies, the mother’s antibodies can cross back to the new fetus and cause its red blood cells to clump, leading to a potentially fatal condition called erythroblastosis fetalis. Many blood group genes possess multiple alleles, several of which may be common. 258 Part IV Reproduction and Heredity I A I A I A I B I A i I A I A I B I B I B i I A i I B i ii I A I A or I B or i or I B or i Possible alleles from female Possible alleles from male A AB BBlood types O FIGURE 13.24 Multiple alleles control the ABO blood groups.Different combinations of the three Igene alleles result in four different blood type phenotypes: type A (either I A I A homozygotes or I A i heterozygotes), type B (either I B I B homozygotes or I B i heterozygotes), type AB (I A I B heterozygotes), and type O (iihomozygotes). Patterns of Inheritance Can Be Deduced from Pedigrees When a blood vessel ruptures, the blood in the immediate area of the rupture forms a solid gel called a clot. The clot forms as a result of the polymerization of protein fibers cir- culating in the blood. A dozen proteins are involved in this process, and all must function properly for a blood clot to form. A mutation causing any of these proteins to lose their activity leads to a form of hemophilia, a hereditary condi- tion in which the blood is slow to clot or does not clot at all. Hemophilias are recessive disorders, expressed only when an individual does not possess any copy of the nor- mal allele and so cannot produce one of the proteins nec- essary for clotting. Most of the genes that encode the blood-clotting proteins are on autosomes, but two (desig- nated VIII and IX) are on the X chromosome. These two genes are sex-linked: any male who inherits a mutant allele of either of the two genes will develop hemophilia because his other sex chromosome is a Y chromosome that lacks any alleles of those genes. The most famous instance of hemophilia, often called the Royal hemophilia, is a sex-linked form that arose in one of the parents of Queen Victoria of England (1819–1901; figure 13.25). In the five generations since Queen Victoria, 10 of her male descendants have had he- mophilia. The present British royal family has escaped the disorder because Queen Victo- ria’s son, King Edward VII, did not inherit the defective allele, and all the subsequent rulers of England are his descendants. Three of Victoria’s nine chil- dren did receive the defective allele, however, and they car- ried it by marriage into many of the other royal families of Europe (figure 13.26), where it is still being passed to future generations—except in Russia, where all of the five children of Victoria’s granddaughter Alexandra were killed soon after the Russian revolution in 1917. (Speculation that one daughter, Anastasia, survived ended in 1999 when DNA analysis confirmed the identity of her remains.) Family pedigrees can reveal the mode of inheritance of a hereditary trait. Chapter 13 Patterns of Inheritance 259 FIGURE 13.25 Queen Victoria of England, surrounded by some of her descendants in 1894.Of Victoria’s four daughters who lived to bear children, two, Alice and Beatrice, were carriers of Royal hemophilia. Two of Alice’s daughters are standing behind Victoria (wearing feathered boas): Princess Irene of Prussia (right), and Alexandra (left), who would soon become Czarina of Russia. Both Irene and Alexandra were also carriers of hemophilia. George III Edward Duke of Kent Louis II Grand Duke of Hesse King Edward VII Duke of Windsor Queen Elizabeth II Prince Philip Margaret Princess Diana Prince Charles Anne Andrew Edward William Henry King George VI King George V Earl of Mountbatten Viscount Tremation Alfonso Jamie GonzaloPrince Sigismond Prussian Royal House British Royal House Spanish Royal House Russian Royal House Henry Anastasia Alexis ? ? ? ? ? ? ? Waldemar Queen VictoriaPrince Albert Frederick III I II III IV V VI VII Generation Victoria Alice Alfred Arthur Leopold Beatrice Prince Henry HelenaDuke of Hesse No hemophilia No hemophilia German Royal House Juan King Juan Carlos No evidence of hemophilia No evidence of hemophilia Irene Czar Nicholas II Czarina Alexandra Earl of Athlone Princess Alice Queen Eugenie Alfonso King of Spain Maurice Leopold FIGURE 13.26 The Royal hemophilia pedigree.Queen Victoria’s daughter Alice introduced hemophilia into the Russian and Austrian royal houses, and Victoria’s daughter Beatrice introduced it into the Spanish royal house. Victoria’s son Leopold, himself a victim, also transmitted the disorder in a third line of descent. Half-shaded symbols represent carriers with one normal allele and one defective allele; fully shaded symbols represent affected individuals. Gene Disorders Can Be Due to Simple Alterations of Proteins Sickle cell anemia is a heritable disorder first noted in Chicago in 1904. Afflicted individuals have defective mol- ecules of hemoglobin, the protein within red blood cells that carries oxygen. Consequently, these individuals are unable to properly transport oxygen to their tissues. The defective hemoglobin molecules stick to one another, forming stiff, rod-like structures and resulting in the for- mation of sickle-shaped red blood cells (figure 13.27). As a result of their stiffness and irregular shape, these cells have difficulty moving through the smallest blood vessels; they tend to accumulate in those vessels and form clots. People who have large proportions of sickle-shaped red blood cells tend to have intermittent illness and a short- ened life span. The hemoglobin in the defective red blood cells dif- fers from that in normal red blood cells in only one of hemoglobin’s 574 amino acid sub- units. In the defective hemoglobin, the amino acid valine replaces a glu- tamic acid at a single position in the protein. Interestingly, the position of the change is far from the active site of hemoglobin where the iron- bearing heme group binds oxygen. Instead, the change occurs on the outer edge of the protein. Why then is the result so catastrophic? The sickle cell mutation puts a very non- polar amino acid on the surface of the hemoglobin protein, creating a “sticky patch” that sticks to other such patches—nonpolar amino acids tend to associate with one another in polar environments like water. As one hemoglobin adheres to another, ever-longer chains of hemoglobin molecules form. Individuals heterozygous for the sickle cell allele are generally indis- tinguishable from normal persons. However, some of their red blood cells show the sickling characteristic when they are exposed to low levels of oxygen. The allele responsible for sickle cell anemia is particularly common among people of African descent; about 9% of African Americans are heterozygous for this allele, and about 0.2% are homozygous and therefore have the dis- order. In some groups of people in Africa, up to 45% of all individuals are heterozygous for this allele, and 6% are homozygous. What factors determine the high fre- quency of sickle cell anemia in Africa? It turns out that heterozygosity for the sickle cell anemia allele increases resistance to malaria, a common and serious disease in central Africa (figure 13.28). We will discuss this situa- tion in detail in chapter 21. Sickle cell anemia is caused by a single-nucleotide change in the gene for hemoglobin, producing a protein with a nonpolar amino acid on its surface that tends to make the molecules clump together. 260 Part IV Reproduction and Heredity FIGURE 13.27 Sickle cell anemia.In individuals homozygous for the sickle cell trait, many of the red blood cells have sickle or irregular shapes, such as the cell on the far right. Sickle cell allele in Africa 1–5% 5–10% 10–20% P. falciparum malaria in Africa Malaria FIGURE 13.28 The sickle cell allele increases resistance to malaria.The distribution of sickle cell anemia closely matches the occurrence of malaria in central Africa. This is not a coincidence. The sickle cell allele, when heterozygous, increases resistance to malaria, a very serious disease. Some Defects May Soon Be Curable Some of the most common and serious gene defects result from single recessive mutations, including many of the defects listed in table 13.2. Recent developments in gene technology have raised the hope that this class of disor- ders may be curable. Perhaps the best example is cystic fibrosis (CF), the most common fatal genetic disorder among Caucasians. Cystic fibrosis is a fatal disease in which the body cells of affected individuals secrete a thick mucus that clogs the airways of the lungs. These same secretions block the ducts of the pancreas and liver so that the few patients who do not die of lung disease die of liver failure. There is no known cure. Cystic fibrosis results from a defect in a single gene, called cf, that is passed down from parent to child. One in 20 individuals possesses at least one copy of the defective gene. Most carriers are not afflicted with the disease; only those children who inherit a copy of the defective gene from each parent succumb to cystic fibrosis—about 1 in 2500 infants. The function of the cf gene has proven difficult to study. In 1985 the first clear clue was obtained. An investigator, Paul Quinton, seized on a commonly observed characteris- tic of cystic fibrosis patients, that their sweat is abnormally salty, and performed the following experiment. He isolated a sweat duct from a small piece of skin and placed it in a so- lution of salt (NaCl) that was three times as concentrated as the NaCl inside the duct. He then monitored the move- ment of ions. Diffusion tends to drive both the sodium (Na + ) and the chloride (Cl – ) ions into the duct because of the higher outer ion concentrations. In skin isolated from normal individuals, Na + and Cl – ions both entered the duct, as expected. In skin isolated from cystic fibrosis individuals, however, only Na + ions entered the duct—no Cl – ions en- tered. For the first time, the molecular nature of cystic fi- brosis became clear. Cystic fibrosis is a defect in a plasma membrane protein called CFTR (cystic fibrosis transmem- brane conductance regulator) that normally regulates pas- sage of Cl – ions into and out of the body’s cells. CFTR does not function properly in cystic fibrosis patients (see figure 4.8). The defective cf gene was isolated in 1987, and its posi- tion on a particular human chromosome (chromosome 7) was pinpointed in 1989. In 1990 a working cf gene was suc- cessfully transferred via adenovirus into human lung cells growing in tissue culture. The defective cells were “cured,” becoming able to transport chloride ions across their plasma membranes. Then in 1991, a team of researchers successfully transferred a normal human cf gene into the lung cells of a living animal—a rat. The cf gene was first in- serted into a cold virus that easily infects lung cells, and the virus was inhaled by the rat. Carried piggyback, the cf gene entered the rat lung cells and began producing the normal human CFTR protein within these cells! Tests of gene transfer into CF patients were begun in 1993, and while a great deal of work remains to be done (the initial experi- ments were not successful), the future for cystic fibrosis pa- tients for the first time seems bright. Cystic fibrosis, and other genetic disorders, are potentially curable if ways can be found to successfully introduce normal alleles of the genes into affected individuals. Chapter 13 Patterns of Inheritance 261 Table 13.2 Some Important Genetic Disorders Dominant/ Frequency among Disorder Symptom Defect Recessive Human Births Cystic fibrosis Sickle cell anemia Tay-Sachs disease Phenylketonuria Hemophilia Huntington’s disease Muscular dystrophy (Duchenne) Hypercholesterolemia Mucus clogs lungs, liver, and pancreas Poor blood circulation Deterioration of central nervous system in infancy Brain fails to develop in infancy Blood fails to clot Brain tissue gradually deteriorates in middle age Muscles waste away Excessive cholesterol levels in blood, leading to heart disease Failure of chloride ion transport mechanism Abnormal hemoglobin molecules Defective enzyme (hexosaminidase A) Defective enzyme (phenylalanine hydroxylase) Defective blood clotting factor VIII Production of an inhibitor of brain cell metabolism Degradation of myelin coating of nerves stimulating muscles Abnormal form of cholesterol cell surface receptor Recessive Recessive Recessive Recessive Sex-linked recessive Dominant Sex-linked recessive Dominant 1/2500 (Caucasians) 1/625 (African Americans) 1/3500 (Ashkenazi Jews) 1/12,000 1/10,000 (Caucasian males) 1/24,000 1/3700 (males) 1/500 Chromosomes: The Vehicles of Mendelian Inheritance Chromosomes are not the only kinds of structures that seg- regate regularly when eukaryotic cells divide. Centrioles also divide and segregate in a regular fashion, as do the mi- tochondria and chloroplasts (when present) in the cyto- plasm. Therefore, in the early twentieth century it was by no means obvious that chromosomes were the vehicles of hereditary information. The Chromosomal Theory of Inheritance A central role for chromosomes in heredity was first sug- gested in 1900 by the German geneticist Karl Correns, in one of the papers announcing the rediscovery of Mendel’s work. Soon after, observations that similar chromosomes paired with one another during meiosis led directly to the chromosomal theory of inheritance, first formulated by the American Walter Sutton in 1902. Several pieces of evidence supported Sutton’s theory. One was that reproduction involves the initial union of only two cells, egg and sperm. If Mendel’s model were correct, then these two gametes must make equal hereditary contribu- tions. Sperm, however, contain little cytoplasm, suggesting that the hereditary material must reside within the nuclei of the gametes. Furthermore, while diploid individuals have two copies of each pair of homologous chromosomes, ga- metes have only one. This observation was consistent with Mendel’s model, in which diploid individuals have two copies of each heritable gene and gametes have one. Finally, chromosomes segregate during meiosis, and each pair of ho- mologues orients on the metaphase plate independently of every other pair. Segregation and independent assortment were two characteristics of the genes in Mendel’s model. A Problem with the Chromosomal Theory However, investigators soon pointed out one problem with this theory. If Mendelian characters are determined by genes located on the chromosomes, and if the independent assortment of Mendelian traits reflects the independent as- sortment of chromosomes in meiosis, why does the number of characters that assort independently in a given kind of organism often greatly exceed the number of chromosome pairs the organism possesses? This seemed a fatal objec- tion, and it led many early researchers to have serious reservations about Sutton’s theory. Morgan’s White-Eyed Fly The essential correctness of the chromosomal theory of heredity was demonstrated long before this paradox was re- solved. A single small fly provided the proof. In 1910 Thomas Hunt Morgan, studying the fruit fly Drosophila melanogaster, detected a mutant male fly, one that differed strikingly from normal flies of the same species: its eyes were white instead of red (figure 13.29). Morgan immediately set out to determine if this new trait would be inherited in a Mendelian fashion. He first crossed the mutant male to a normal female to see if red or white eyes were dominant. All of the F 1 progeny had red eyes, so Morgan concluded that red eye color was domi- nant over white. Following the experimental procedure that Mendel had established long ago, Morgan then crossed the red-eyed flies from the F 1 generation with each other. Of the 4252 F 2 progeny Morgan examined, 782 (18%) had white eyes. Although the ratio of red eyes to white eyes in the F 2 progeny was greater than 3:1, the re- sults of the cross nevertheless provided clear evidence that eye color segregates. However, there was something about the outcome that was strange and totally unpredicted by Mendel’s theory—all of the white-eyed F 2 flies were males! How could this result be explained? Perhaps it was im- possible for a white-eyed female fly to exist; such individu- als might not be viable for some unknown reason. To test this idea, Morgan testcrossed the female F 1 progeny with the original white-eyed male. He obtained both white-eyed and red-eyed males and females in a 1:1:1:1 ratio, just as Mendelian theory predicted. Hence, a female could have white eyes. Why, then, were there no white-eyed females among the progeny of the original cross? 262 Part IV Reproduction and Heredity 13.3 Genes are on chromosomes. FIGURE 13.29 Red-eyed (normal) and white-eyed (mutant) Drosophila.The white-eyed defect is hereditary, the result of a mutation in a gene located on the X chromosome. By studying this mutation, Morgan first demonstrated that genes are on chromosomes. Sex Linkage The solution to this puzzle involved sex. In Drosophila, the sex of an individual is determined by the number of copies of a particular chromosome, the X chromosome, that an individual possesses. A fly with two X chromosomes is a fe- male, and a fly with only one X chromosome is a male. In males, the single X chromosome pairs in meiosis with a dis- similar partner called the Y chromosome.The female thus produces only X gametes, while the male produces both X and Y gametes. When fertilization involves an X sperm, the result is an XX zygote, which develops into a female; when fertilization involves a Y sperm, the result is an XY zygote, which develops into a male. The solution to Morgan’s puzzle is that the gene caus- ing the white-eye trait in Drosophila resides only on the X chromosome—it is absent from the Y chromosome. (We now know that the Y chromosome in flies carries almost no functional genes.) A trait determined by a gene on the X chromosome is said to be sex-linked. Knowing the white-eye trait is recessive to the red-eye trait, we can now see that Morgan’s result was a natural consequence of the Mendelian assortment of chromosomes (fig- ure13.30). Morgan’s experiment was one of the most important in the history of genetics because it presented the first clear evidence that the genes determining Mendelian traits do indeed reside on the chromosomes, as Sutton had pro- posed. The segregation of the white-eye trait has a one-to- one correspondence with the segregation of the X chromo- some. In other words, Mendelian traits such as eye color in Drosophila assort independently because chromosomes do. When Mendel observed the segregation of alternative traits in pea plants, he was observing a reflection of the meiotic segregation of chromosomes. Mendelian traits assort independently because they are determined by genes located on chromosomes that assort independently in meiosis. Chapter 13 Patterns of Inheritance 263 H11003 H11003 Y chromosome X chromosome with white-eye gene X chromosome with red-eye gene FemaleMale FemaleMale FemalesMales Parents F 1 generation F 2 generation FIGURE 13.30 Morgan’s experiment demonstrating the chromosomal basis of sex linkage in Drosophila.The white-eyed mutant male fly was crossed with a normal female. The F 1 generation flies all exhibited red eyes, as expected for flies heterozygous for a recessive white-eye allele. In the F 2 generation, all of the white-eyed flies were male. Genetic Recombination Morgan’s experiments led to the gen- eral acceptance of Sutton’s chromoso- mal theory of inheritance. Scientists then attempted to resolve the paradox that there are many more indepen- dently assorting Mendelian genes than chromosomes. In 1903 the Dutch ge- neticist Hugo de Vries suggested that this paradox could be resolved only by assuming that homologous chromo- somes exchange elements during meiosis. In 1909, French cytologist F.A. Janssens provided evidence to support this suggestion. Investigating chiasmata produced during amphibian meiosis, Janssens noticed that of the four chromatids involved in each chi- asma, two crossed each other and two did not. He suggested that this cross- ing of chromatids reflected a switch in chromosomal arms between the pater- nal and maternal homologues, involv- ing one chromatid in each homologue. His suggestion was not accepted widely, primarily because it was diffi- cult to see how two chromatids could break and rejoin at exactly the same position. Crossing Over Later experiments clearly established that Janssens was indeed correct. One of these experiments, performed in 1931 by American geneticist Curt Stern, is described in figure 13.31. Stern studied two sex-linked eye char- acters in Drosophila strains whose X chromosomes were visibly abnormal at both ends. He first examined many flies and identified those in which an exchange had occurred with respect to the two eye characters. He then stud- ied the chromosomes of those flies to see if their X chro- mosomes had exchanged arms. Stern found that all of the individuals that had exchanged eye traits also possessed chromosomes that had exchanged abnormal ends. The conclusion was inescapable: genetic exchanges of charac- ters such as eye color involve the physical exchange of chromosome arms, a phenomenon called crossing over. Crossing over creates new combinations of genes, and is thus a form of genetic recombination. The chromosomal exchanges Stern demonstrated pro- vide the solution to the paradox, because crossing over can occur between homologues anywhere along the length of the chromosome, in locations that seem to be randomly determined. Thus, if two different genes are located relatively far apart on a chromosome, crossing over is more likely to occur somewhere between them than if they are located close together. Two genes can be on the same chromosome and still show independent as- sortment if they are located so far apart on the chromo- some that crossing over occurs regularly between them (figure 13.32). 264 Part IV Reproduction and Heredity car B car + B + car + B + car + B + B + B + B + B + B + B + B + B + car + car + car + car + B + B + F 1 female Abnormality at another locus of X chromosome Abnormality at one locus of X chromosome car B car B car B car car car carcarcar B B car car car No crossing over Crossing over during meiosis in F 1 female Fertilization by sperm from carnation F 1 male Fertilization by sperm from carnation F 1 male carnation, bar Parental combinations of both genetic traits and chromosome abnormalities carnationnormal bar Recombinant combinations of both genetic traits and chromosome abnormalities B FIGURE 13.31 Stern’s experiment demonstrating the physical exchange of chromosomal arms during crossing over.Stern monitored crossing over between two genes, the recessive carnation eye color (car) and the dominant bar-shaped eye (B), on chromosomes with physical peculiarities visible under a microscope. Whenever these genes recombined through crossing over, the chromosomes recombined as well. Therefore, the recombination of genes reflects a physical exchange of chromosome arms. The “+” notation on the alleles refers to the wild-type allele, the most common allele at a particular gene. Using Recombination to Make Genetic Maps Because crossing over is more frequent between two genes that are relatively far apart than between two that are close together, the frequency of crossing over can be used to map the relative positions of genes on chromosomes. In a cross, the proportion of progeny exhibiting an exchange between two genes is a measure of the frequency of crossover events between them, and thus indicates the relative distance sepa- rating them. The results of such crosses can be used to con- struct a genetic map that measures distance between genes in terms of the frequency of recombination. One “map unit” is defined as the distance within which a crossover event is expected to occur in an average of 1% of gametes. A map unit is now called a centimorgan, after Thomas Hunt Morgan. In recent times new technologies have allowed geneti- cists to create gene maps based on the relative positions of specific gene sequences called restriction sites because they are recognized by DNA-cleaving enzymes called restriction endonucleases. Restriction maps, discussed in chapter 19, have largely supplanted genetic recombination maps for detailed gene analysis because they are far easier to pro- duce. Recombination maps remain the method of choice for genes widely separated on a chromosome. The Three-Point Cross. In constructing a genetic map, one simultaneously monitors recombination among three or more genes located on the same chromosome, referred to as syntenic genes. When genes are close enough to- gether on a chromosome that they do not assort indepen- dently, they are said to be linked to one another. A cross involving three linked genes is called a three-point cross. Data obtained by Morgan on traits encoded by genes on the X chromosome of Drosophila were used by his student A. H. Sturtevant, to draw the first genetic map (figure 13.33). By convention, the most common allele of a gene is often denoted with the symbol “+” and is designated as wild type. All other alleles are denoted with just the spe- cific letters. Chapter 13 Patterns of Inheritance 265 Chromosome number Flower color Location of genes 1 Seed color 2 3 Flower position 4 Pod shape Plant height Pod color 5 6 7 Seed shape FIGURE 13.32 The chromosomal locations of the seven genes studied by Mendel in the garden pea.The genes for plant height and pod shape are very close to each other and rarely recombine. Plant height and pod shape were not among the characters Mendel examined in dihybrid crosses. One wonders what he would have made of the linkage he surely would have detected had he tested these characters. Five traits y Yellow body color w White eye color v Vermilion eye color m Miniature wing r Rudimentary wing Recombination frequencies y and w 0.010 v and m 0.030 v and r 0.269 v and w 0.300 v and y 0.322 w and m 0.327 y and m 0.355 w and r 0.450 Genetic map .58 .34 .31 .01 0 r m v w y FIGURE 13.33 The first genetic map.This map of the X chromosome of Drosophilawas prepared in 1913 by A. H. Sturtevant, a student of Morgan. On it he located the relative positions of five recessive traits that exhibited sex linkage by estimating their relative recombination frequencies in genetic crosses. Sturtevant arbitrarily chose the position of the yellowgene as zero on his map to provide a frame of reference. The higher the recombination frequency, the farther apart the two genes. Analyzing a Three-Point Cross. The first genetic map was constructed by A. H. Sturtevant, a student of Morgan’s in 1913. He studied several traits of Drosophila, all of which exhibited sex linkage and thus were encoded by genes re- siding on the same chromosome (the X chromosome). Here we will describe his study of three traits: y, yellow body color (the normal body color is gray), w, white eye color (the normal eye color is red), and m, miniature wing (the normal wing is 50% longer). Sturtevant carried out the mapping cross by crossing a female fly homozygous for the three recessive alleles with a normal male fly that carried none of them. All of the prog- eny were heterozygotes. Such a cross is conventionally rep- resented by a diagram like the one that follows, in which the lines represent gene locations and + indicates the nor- mal, or “wild-type” allele. Each female fly participating in a cross possesses two homologous copies of the chromosome being mapped, and both chromosomes are represented in the diagram. Crossing over occurs between these two copies in meiosis. y w m × y + w + m + P generation _______ _______ y w m (Y chromosome) ↓ y w m F 1 generation _______ females y + w + m + These heterozygous females, the F 1 generation, are the key to the mapping procedure. Because they are heterozy- gous, any crossing over that occurs during meiosis will, if it occurs between where these genes are located, produce ga- metes with different combinations of alleles for these genes—in other words, recombinant chromosomes. Thus, a crossover between the homologous X chromosomes of such a female in the interval between the y and w genes will yield recombinant [ yw + ] and [ y + w] chromosomes, which are different combinations than we started with. In the dia- gram below, the crossed lines between the chromosomes indicate where the crossover occurs. (In the parental chro- mosomes of this cross, w is always linked with y and y + linked with w + .) y w m y w + m + → _______ y + w + m + y + w m In order to see all the recombinant types that might be present among the gametes of these heterozygous flies, Sturtevant conducted a testcross. He crossed female het- erozygous flies to males recessive for all three traits and examined the progeny. Because males contribute either a Y chromosome with no genes on it or an X chromosome with recessive alleles at all three loci, the male contribu- tion does not disguise the potentially recombinant female chromosomes. Table 13.3 summarizes the results Sturtevant obtained. The parentals are represented by the highest number of progeny and the double crossovers (progeny in which two crossovers occurred) by the lowest number. To analyze his data, Sturtevant considered the traits in pairs and deter- mined which involved a crossover event. 1. For the body trait ( y) and the eye trait (w), the first two classes, [y + w + ] and [y w], involve no crossovers (they are parental combinations). In table 13.3, no progeny numbers are tabulated for these two classes on the “body-eye” column (a dash appears instead). 2. The next two classes have the same body-eye combi- nation as the parents, [y + w + ] and [y w], so again no numbers are entered as recombinants under body-eye crossover type. 3. The next two classes, [y + w] and [yw + ], do not have the same body-eye combinations as the parent chro- mosomes, so the observed numbers of progeny are recorded, 16 and 12, respectively. 4. The last two classes also differ from parental chromo- somes in body-eye combination, so again the ob- served numbers of each class are recorded, 1 and 0. 5. The sum of the numbers of observed progeny that are recombinant for body ( y) and eye (w) is 16 +12 + 1, or 29. Because the total number of progeny is 2205, this represents 29/2205, or 0.01315. The per- centage of recombination between y and w is thus 1.315%, or 1.3 centimorgans. To estimate the percentage of recombination between eye (w) and wing (m), one proceeds in the same manner, obtaining a value of 32.608%, or 32.6 centimorgans. Simi- larly, body (y) and wing (m) are separated by a recombina- tion distance of 33.832%, or 33.8 centimorgans. From this, then, we can construct our genetic map. The biggest distance, 33.8 centimorgans, separates the two out- side genes, which are evidently y and m. The gene w is be- tween them, near y. y w m 1.3 32.6 33.8 The two distances 1.3 and 32.6 do not add up to 33.8 but rather to 33.9. The difference, 0.1, represents chromo- somes in which two crossovers occurred, one between y and w and another between w and m. These chromosomes do not exhibit recombination between yand m. Genetic maps such as this are key tools in genetic analy- sis, permitting an investigator reliably to predict how a newly discovered trait, once it has been located on the chromosome map, will recombine with many others. 266 Part IV Reproduction and Heredity The Human Genetic Map Genetic maps of human chromosomes (figure 13.34) are of great importance. Knowing where particular genes are lo- cated on human chromosomes can often be used to tell whether a fetus at risk of inheriting a genetic disorder actu- ally has the disorder. The genetic-engineering techniques described in chapter 19 have begun to permit investigators to isolate specific genes and determine their nucleotide se- quences. It is hoped that knowledge of differences at the gene level may suggest successful therapies for particular genetic disorders and that knowledge of a gene’s location on a chromosome will soon permit the substitution of nor- mal alleles for dysfunctional ones. Because of the great po- tential of this approach, investigators are working hard to assemble a detailed map of the entire human genome, the Human Genome Project, described in chapter 19. Ini- tially, this map will consist of a “library” of thousands of small fragments of DNA whose relative positions are known. Investigators wishing to study a particular gene will first use techniques described in chapter 19 to screen this library and determine which fragment carries the gene of interest. They will then be able to analyze that fragment in detail. In parallel with this mammoth undertaking, the other, smaller genomes have already been sequenced, in- cluding those of yeasts and several bacteria. Progress on the human genome is rapid, and the full map is expected within the next 10 years. Gene maps locate the relative positions of different genes on the chromosomes of an organism. Traditionally produced by analyzing the relative amounts of recombination in genetic crosses, gene maps are increasingly being made by analyzing the sizes of fragments made by restriction enzymes. Chapter 13 Patterns of Inheritance 267 Table 13.3 Sturtevant’s Results Phenotypes Crossover Types Number of Body Eye Wing Progeny Body-Eye Eye-Wing Body-Wing Parental y + w + m + 758 — — — ywm 700 — — — Single crossover y + w + m 401 — 401 401 ywm + 317 — 317 317 y + wm 16 16 — 16 yw + m + 12 12 — 12 Double crossover y + wm + 111— yw + m 000 TOTAL 2205 29 719 746 Recombination frequency (%) 1.315 32.608 33.832 Duchenne muscular dystrophy Becker muscular dystrophy Ichthyosis, X-linked Placental steroid sulfatase deficiency Kallmann syndrome Chondrodysplasia punctata, X-linked recessive Hypophosphatemia Aicardi syndrome Hypomagnesemia, X-linked Ocular albinism Retinoschisis Adrenal hypoplasia Glycerol kinase deficiency Incontinentia pigmenti Wiskott-Aldrich syndrome Menkes syndrome Charcot-Marie-Tooth neuropathy Choroideremia Cleft palate, X-linked Spastic paraplegia, X-linked, uncomplicated Deafness with stapes fixation PRPS-related gout Lowe syndrome Lesch-Nyhan syndrome HPRT-related gout Hunter syndrome Hemophilia B Hemophilia A G6PD deficiency: favism Drug-sensitive anemia Chronic hemolytic anemia Manic-depressive illness, X-linked Colorblindness, (several forms) Dyskeratosis congenita TKCR syndrome Adrenoleukodystrophy Adrenomyeloneuropathy Emery-Dreifuss muscular dystrophy Diabetes insipidus, renal Myotubular myopathy, X-linked Androgen insensitivity Chronic granulomatous disease Retinitis pigmentosa-3 Norrie disease Retinitis pigmentosa-2 Sideroblastic anemia Aarskog-Scott syndrome PGK deficiency hemolytic anemia Anhidrotic ectodermal dysplasia Agammaglobulinemia Kennedy disease Pelizaeus-Merzbacher disease Alport syndrome Fabry disease Lymphoproliferative syndrome Albinism-deafness syndrome Fragile-X syndrome Immunodeficiency, X-linked, with hyper IgM Ornithine transcarbamylase deficiency FIGURE 13.34 The human X chromosome gene map.Over 59 diseases have been traced to specific segments of the X chromosome. Many of these disorders are also influenced by genes on other chromosomes. Human Chromosomes Each human somatic cell normally has 46 chromosomes, which in meiosis form 23 pairs. By convention, the chro- mosomes are divided into seven groups (designated A through G), each characterized by a different size, shape, and appearance. The differences among the chromosomes are most clearly visible when the chromosomes are arranged in order in a karyotype (figure 13.35). Tech- niques that stain individual segments of chromosomes with different-colored dyes make the identification of chromo- somes unambiguous. Like a fingerprint, each chromosome always exhibits the same pattern of colored bands. Human Sex Chromosomes Of the 23 pairs of human chromosomes, 22 are perfectly matched in both males and females and are called auto- somes. The remaining pair, the sex chromosomes, con- sist of two similar chromosomes in females and two dissim- ilar chromosomes in males. In humans, females are designated XX and males XY. One of the sex chromosomes in the male (the Y chromosome) is highly condensed and bears few functional genes. Because few genes on the Y chromosome are expressed, recessive alleles on a male’s single X chromosome have no active counterpart on the Y chromosome. Some of the active genes the Y chromosome does possess are responsible for the features associated with “maleness” in humans. Consequently, any individual with at leastone Y chromosome is a male. Sex Chromosomes in Other Organisms The structure and number of sex chromosomes vary in dif- ferent organisms (table 13.4). In the fruit fly Drosophila, fe- males are XX and males XY, as in humans and most other vertebrates. However, in birds, the male has two Z chro- mosomes, and the female has a Z and a W chromosome. In some insects, such as grasshoppers, there is no Y chromo- some—females are XX and males are characterized as XO (the O indicates the absence of a chromosome). Sex Determination In humans a specific gene located on the Y chromosome known as SRY plays a key role in development of male sex- ual characteristics. This gene is expressed early in develop- ment, and acts to masculinize genitalia and secondary sex- ual organs that would otherwise be female. Lacking a Y chromosome, females fail to undergo these changes. Among fishes and in some species of reptiles, environ- mental changes can cause changes in the expression of this sex-determining gene, and thus of the sex of the adult individual. 268 Part IV Reproduction and Heredity FIGURE 13.35 A human karyotype.This karyotype shows the colored banding patterns, arranged by class A–G. Table 13.4 Sex Determination in Some Organisms Female Male Humans, Drosophila XX XY Birds ZW ZZ Grasshoppers XX XO Honeybees Diploid Haploid Barr Bodies Although males have only one copy of the X chromosome and females have two, female cells do not produce twice as much of the proteins en- coded by genes on the X chromo- some. Instead, one of the X chromo- somes in females is inactivated early in embryonic development, shortly after the embryo’s sex is determined. Which X chromosome is inactivated varies randomly from cell to cell. If a woman is heterozygous for a sex- linked trait, some of her cells will ex- press one allele and some the other. The inactivated and highly con- densed X chromosome is visible as a darkly staining Barr body attached to the nuclear membrane (figure 13.36). X-inactivation is not restricted to humans. The patches of color on tortoiseshell and calico cats are a fa- miliar result of this process. The gene for orange coat color is located on the X chromosome. The O allele spec- ifies orange fur, and the o allele specifies black fur. Early in development, one X chromosome is inactivated in the cells that will become skin cells. If the remaining active X carries the O allele, then the patch of skin that results from that cell will have orange fur. If it carries the o al- lele, then the fur will be black. Because X-inactivation is a random process, the orange and black patches appear randomly in the cat’s coat. Because only females have two copies of the X chromosome, only they can be heterozy- gous at the O gene, so almost all calico cats are females (figure 13.37). The exception is male cats that have the genotype XXY; the XXY genotype is discussed in the next section. The white on a calico cat is due to the ac- tion of an allele at another gene, the white spotting gene. One of the 23 pairs of human chromosomes carries the genes that determine sex. The gene determining maleness is located on a version of the sex chromosome called Y, which has few other transcribed genes. Chapter 13 Patterns of Inheritance 269 FIGURE 13.36 Barr bodies.In the developing female embryo, one of the X chromosomes (determined randomly) condenses and becomes inactivated. These condensed X chromosomes, called Barr bodies, then attach to the nuclear membrane. FIGURE 13.37 A calico cat. The coat coloration of this cat is due to the random inactivation of her X chromosome during early development. The female is heterozygous for orange coat color, but because only one coat color allele is expressed, she exhibits patches of orange and black fur. Zygote MitosisRandom inactivation Barr body Some cells Other cells Embryo XX Human Abnormalities Due to Alterations in Chromosome Number Occasionally, homologues or sister chromatids fail to separate properly in meiosis, leading to the acquisition or loss of a chromosome in a gamete. This condition, called primary nondisjunc- tion, can result in individuals with se- vere abnormalities if the affected gamete forms a zygote. Nondisjunction Involving Autosomes Almost all humans of the same sex have the same karyotype, for the same reason that all automobiles have engines, trans- missions, and wheels: other arrange- ments don’t work well. Humans who have lost even one copy of an autosome (called monosomics) do not survive development. In all but a few cases, humans who have gained an extra autosome (called trisomics) also do not survive. However, five of the smallest autosomes—those numbered 13, 15, 18, 21, and 22—can be present in hu- mans as three copies and still allow the individual to survive for a time. The presence of an extra chromosome 13, 15, or 18 causes severe developmental defects, and infants with such a genetic makeup die within a few months. In con- trast, individuals who have an extra copy of chromosome 21 or, more rarely, chromosome 22, usually survive to adult- hood. In such individuals, the maturation of the skeletal system is delayed, so they generally are short and have poor muscle tone. Their mental development is also affected, and children with trisomy 21 or trisomy 22 are always men- tally retarded. Down Syndrome. The developmental defect produced by trisomy 21 (figure 13.38) was first described in 1866 by J. Langdon Down; for this reason, it is called Down syn- drome (formerly “Down’s syndrome”). About 1 in every 750 children exhibits Down syndrome, and the frequency is similar in all racial groups. Similar conditions also occur in chimpanzees and other related primates. In humans, the defect is associated with a particular small portion of chro- mosome 21. When this chromosomal segment is present in three copies instead of two, Down syndrome results. In 97% of the human cases examined, all of chromosome 21 is present in three copies. In the other 3%, a small portion of chromosome 21 containing the critical segment has been added to another chromosome by a process called transloca- tion (see chapter 18); it exists along with the normal two copies of chromosome 21. This condition is known as translocation Down syndrome. Not much is known about the developmental role of the genes whose extra copies produces Down syndrome, al- though clues are beginning to emerge from current re- search. Some researchers suspect that the gene or genes that produce Down syndrome are similar or identical to some of the genes associated with cancer and with Alzheimer’s disease. The reason for this suspicion is that one of the human cancer-causing genes (to be described in chapter 18) and the gene causing Alzheimer’s disease are located on the segment of chromosome 21 associated with Down syndrome. Moreover, cancer is more common in children with Down syndrome. The incidence of leukemia, for example, is 11 times higher in children with Down syn- drome than in unaffected children of the same age. How does Down syndrome arise? In humans, it comes about almost exclusively as a result of primary nondisjunc- tion of chromosome 21 during egg formation. The cause of these primary nondisjunctions is not known, but their inci- dence, like that of cancer, increases with age (figure 13.39). In mothers younger than 20 years of age, the risk of giving birth to a child with Down syndrome is about 1 in 1700; in mothers 20 to 30 years old, the risk is only about 1 in 1400. In mothers 30 to 35 years old, however, the risk rises to 1 in 750, and by age 45, the risk is as high as 1 in 16! Primary nondisjunctions are far more common in women than in men because all of the eggs a woman will ever produce have developed to the point of prophase in meiosis I by the time she is born. By the time she has chil- dren, her eggs are as old as she is. In contrast, men produce new sperm daily. Therefore, there is a much greater chance for problems of various kinds, including those that cause primary nondisjunction, to accumulate over time in the ga- metes of women than in those of men. For this reason, the age of the mother is more critical than that of the father in couples contemplating childbearing. 270 Part IV Reproduction and Heredity 23 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y 1 FIGURE 13.38 Down syndrome.As shown in this male karyotype, Down syndrome is associated with trisomy of chromosome 21. A child with Down syndrome sitting on his father’s knee. Nondisjunction Involving the Sex Chromosomes Individuals that gain or lose a sex chromosome do not gen- erally experience the severe developmental abnormalities caused by similar changes in autosomes. Such individuals may reach maturity, but they have somewhat abnormal features. The X Chromosome. When X chromosomes fail to separate during meiosis, some of the gametes that are produced possess both X chromosomes and so are XX ga- metes; the other gametes that result from such an event have no sex chromosome and are designated “O” (figure13.40). If an XX gamete combines with an X gamete, the re- sulting XXX zygote develops into a female with one func- tional X chromosome and two Barr bodies. She is sterile but usually normal in other respects. If an XX gamete in- stead combines with a Y gamete, the effects are more seri- ous. The resulting XXY zygote develops into a sterile male who has many female body characteristics and, in some cases, diminished mental capacity. This condition, called Klinefelter syndrome, occurs in about 1 out of every 500 male births. If an O gamete fuses with a Y gamete, the resulting OY zygote is nonviable and fails to develop further because hu- mans cannot survive when they lack the genes on the X chromosome. If, on the other hand, an O gamete fuses with an X gamete, the XO zygote develops into a sterile female of short stature, with a webbed neck and immature sex or- gans that do not undergo changes during puberty. The mental abilities of an XO individual are in the low-normal range. This condition, called Turner syndrome, occurs roughly once in every 5000 female births. The Y Chromosome. The Y chromosome can also fail to separate in meiosis, leading to the formation of YY ga- metes. When these gametes combine with X gametes, the XYY zygotes develop into fertile males of normal appear- ance. The frequency of the XYY genotype (Jacob’s syn- drome) is about 1 per 1000 newborn males, but it is ap- proximately 20 times higher among males in penal and mental institutions. This observation has led to the highly controversial suggestion that XYY males are inherently an- tisocial, a suggestion supported by some studies but not by others. In any case, most XYY males do not develop pat- terns of antisocial behavior. Gene dosage plays a crucial role in development, so humans do not tolerate the loss or addition of chromosomes well. Autosome loss is always lethal, and an extra autosome is with few exceptions lethal too. Additional sex chromosomes have less serious consequences, although they can lead to sterility. Chapter 13 Patterns of Inheritance 271 100.0 30.0 20.0 10.0 Incidence of Down syndrome per 1000 live births 3.0 2.0 1.0 0.3 15 20 25 30 35 Age of mother 40 45 50 FIGURE 13.39 Correlation between maternal age and the incidence of Down syndrome.As women age, the chances they will bear a child with Down syndrome increase. After a woman reaches 35, the frequency of Down syndrome increases rapidly. Female (Triple X syndrome) Female (Turner syndrome) Male (Klinefelter syndrome) Nonviable X Y Nondisjunction Eggs Male Female XX XY XX O Sperm XXX XO XXY OY FIGURE 13.40 How nondisjunction can produce abnormalities in the number of sex chromosomes.When nondisjunction occurs in the production of female gametes, the gamete with two X chromosomes (XX) produces Klinefelter males (XXY) and XXX females. The gamete with no X chromosome (O) produces Turner females (XO) and nonviable OY males lacking any X chromosome. Genetic Counseling Although most genetic disorders cannot yet be cured, we are learning a great deal about them, and progress toward successful therapy is being made in many cases. In the ab- sence of a cure, however, the only recourse is to try to avoid producing children with these conditions. The process of identifying parents at risk of producing children with genetic defects and of assessing the genetic state of early embryos is called genetic counseling. If a genetic defect is caused by a recessive allele, how can potential parents determine the likelihood that they carry the allele? One way is through pedigree analysis, often employed as an aid in genetic counseling. By ana- lyzing a person’s pedigree, it is sometimes possible to es- timate the likelihood that the person is a carrier for cer- tain disorders. For example, if one of your relatives has been afflicted with a recessive genetic disorder such as cystic fibrosis, it is possible that you are a heterozygous carrier of the recessive allele for that disorder. When a couple is expecting a child, and pedigree analysis indi- cates that both of them have a significant probability of being heterozygous carriers of a recessive allele responsi- ble for a serious genetic disorder, the pregnancy is said to be a high-risk pregnancy. In such cases, there is a sig- nificant probability that the child will exhibit the clinical disorder. Another class of high-risk pregnancies is that in which the mothers are more than 35 years old. As we have seen, the frequency of birth of infants with Down syndrome in- creases dramatically in the pregnancies of older women (see figure 13.39). When a pregnancy is diagnosed as being high-risk, many women elect to undergo amniocentesis, a procedure that per- mits the prenatal diagnosis of many genetic disorders. In the fourth month of pregnancy, a sterile hypodermic needle is inserted into the expanded uterus of the mother, removing a small sample of the amniotic fluid bathing the fetus (figure 13.41). Within the fluid are free-floating cells derived from the fetus; once removed, these cells can be grown in cul- tures in the laboratory. During amniocentesis, the position of the needle and that of the fetus are usually observed by means of ultrasound. The sound waves used in ultrasound are not harmful to mother or fetus, and they permit the per- son withdrawing the amniotic fluid to do so without damag- ing the fetus. In addition, ultrasound can be used to examine the fetus for signs of major abnormalities. In recent years, physicians have increasingly turned to a new, less invasive procedure for genetic screening called chorionic villi sampling. In this procedure, the physician removes cells from the chorion, a membranous part of the placenta that nourishes the fetus. This procedure can be used earlier in pregnancy (by the eighth week) and yields results much more rapidly than does amniocentesis. To test for certain genetic disorders, genetic counselors can look for three things in the cultures of cells obtained from amniocentesis or chorionic villi sampling. First, analysis of the karyotype can reveal aneuploidy (extra or missing chromosomes) and gross chromosomal alterations. Second, in many cases it is possible to test directly for the proper functioning of enzymes involved in genetic disorders. The lack of normal enzymatic activity signals the presence of the disorder. Thus, the lack of the enzyme responsible for breaking down phenylalanine signals PKU (phenylke- 272 Part IV Reproduction and Heredity Amniotic fluid Fetal cells Hypodermic syringe Uterus FIGURE 13.41 Amniocentesis.A needle is inserted into the amniotic cavity, and a sample of amniotic fluid, containing some free cells derived from the fetus, is withdrawn into a syringe. The fetal cells are then grown in culture and their karyotype and many of their metabolic functions are examined. tonuria), the absence of the enzyme responsible for the breakdown of gangliosides indicates Tay-Sachs disease, and so forth. Third, genetic counselors can look for an association with known genetic markers. For sickle cell anemia, Hunt- ington’s disease, and one form of muscular dystrophy (a genetic disorder characterized by weakened muscles), in- vestigators have found other mutations on the same chro- mosomes that, by chance, occur at about the same place as the mutations that cause those disorders. By testing for the presence of these other mutations, a genetic counselor can identify individuals with a high probability of possess- ing the disorder-causing mutations. Finding such muta- tions in the first place is a little like searching for a needle in a haystack, but persistent efforts have proved successful in these three disorders. The associated mutations are de- tectable because they alter the length of the DNA seg- ments that restriction enzymes produce when they cut strands of DNA at particular places (see chapter 18). Therefore, these mutations produce what are called re- striction fragment length polymorphisms, or RFLPs (figure 13.42). Many gene defects can be detected early in pregnancy, allowing for appropriate planning by the prospective parents. Chapter 13 Patterns of Inheritance 273 Short fragment Medium-length fragment Cut Short fragment Medium-length fragment Cut Cut AATTC CTTAA G G AATTC CTTAA G G AATTC CTTAA G G Gel electrophoresis Long Short Cut Cut Gel electrophoresis Long Short Long-length fragment Long-length fragment AATTC CTTAA G G AATTC CTTAA G GAAATTC TTTAAG (a) No mutation (b) Mutation FIGURE 13.42 RFLPs.Restriction fragment length polymorphisms (RFLPs) are playing an increasingly important role in genetic identification. In (a), the restriction endonuclease cuts the DNA molecule in three places, producing two fragments. In (b), the mutation of a single nucleotide from G to A (see top fragment) alters a restriction endonuclease cutting site. Now the enzyme no longer cuts the DNA molecule at that site. As a result, a single long fragment is obtained, rather than two shorter ones. Such a change is easy to detect when the fragments are subjected to a technique called gel electrophoresis. 274 Part IV Reproduction and Heredity Chapter 13 Summary Questions Media Resources 13.1 Mendel solved the mystery of heredity. ? Koelreuter noted the basic facts of heredity a century before Mendel. He found that alternative traits segregate in crosses and may mask each other’s appearance. Mendel, however, was the first to quantify his data, counting the numbers of each alternative type among the progeny of crosses. ? By counting progeny types, Mendel learned that the alternatives that were masked in hybrids (the F 1 generation) appeared only 25% of the time in the F 2 generation. This finding, which led directly to Mendel’s model of heredity, is usually referred to as the Mendelian ratio of 3:1 dominant-to-recessive traits. ? When two genes are located on different chromosomes, the alleles assort independently. ? Because phenotypes are often influenced by more than one gene, the ratios of alternative phenotypes observed in crosses sometimes deviate from the simple ratios predicted by Mendel. 1.Why weren’t the implications of Koelreuter’s results recognized for a century? 2.What characteristics of the garden pea made this organism a good choice for Mendel’s experiments on heredity? 3.To determine whether a purple-flowered pea plant of unknown genotype is homozygous or heterozygous, what type of plant should it be crossed with? 4.In a dihybrid cross between two heterozygotes, what fraction of the offspring should be homozygous recessive for both traits? ? Some genetic disorders are relatively common in human populations; others are rare. Many of the most important genetic disorders are associated with recessive alleles, which are not eliminated from the human population, even though their effects in homozygotes may be lethal. 5.Why is Huntington’s disease maintained at its current frequency in human populations? 13.2 Human genetics follows Mendelian principles. ? The first clear evidence that genes reside on chromosomes was provided by Thomas Hunt Morgan, who demonstrated that the segregation of the white-eye trait in Drosophilais associated with the segregation of the X chromosome, which is involved in sex determination. ? The first genetic evidence that crossing over occurs between chromosomes was provided by Curt Stern, who showed that when two Mendelian traits exchange during a cross, so do visible abnormalities on the ends of the chromosomes bearing those traits. ? The frequency of crossing over between genes can be used to construct genetic maps. ? Primary nondisjunction results when chromosomes do not separate during meiosis, leading to gametes with missing or extra chromosomes. In humans, the loss of an autosome is invariably fatal. 6.When Morgan crossed a white-eyed male fly with a normal red-eyed female, and then crossed two of the red-eyed progeny, about 1 ?4of the offspring were white-eyed—but they were ALL male! Why? 7.What is primary nondisjunction? How is it related to Down syndrome? 8.Is an individual with Klinefelter syndrome genetically male or female? Why? 13.3 Genes are on chromosomes. http://www.mhhe.com/raven6e http://www.biocourse.com ? Exploration: Heredity in families ? Introduction to Classic Genetics ? Monohybrid Cross ? Dihybrid Cross ? Experiments: Probability and Hypothesis Testing in Biology ? Beyond Mendel ? On Science Article: Advances in Gene Therapy ? Experiment: Muller- Lethal Mutations in Populations ? Exploration: Down Syndrome ? Exploration: Constructing a Genetic Map ? Exploration: Gene Segregation within families ? Exploration: Making a Restriction Map ? Exploration: Cystic Fibrosis ? Recombination ? Introduction to Chromosomes Sex Chromosomes ? Abnormal Chromosomes Mendelian Genetics Problems cow in the herd has horns. Some of the calves born that year, however, grow horns. You remove them from the herd and make certain that no horned adult has gotten into your pasture. Despite your efforts, more horned calves are born the next year. What is the reason for the appearance of the horned calves? If your goal is to maintain a herd consisting entirely of polled cattle, what should you do? 4. An inherited trait among humans in Norway causes affected individuals to have very wavy hair, not unlike that of a sheep. The trait, called woolly, is very evident when it occurs in families; no child possesses woolly hair unless at least one parent does. Imagine you are a Norwegian judge, and you have before you a woolly- haired man suing his normal-haired wife for divorce because their first child has woolly hair but their sec- ond child has normal hair. The husband claims this constitutes evidence of his wife’s infidelity. Do you accept his claim? Justify your decision. 5. In human beings, Down syndrome, a serious develop- mental abnormality, results from the presence of three copies of chromosome 21 rather than the usual two copies. If a female exhibiting Down syndrome mates with a normal male, what proportion of her offspring would you expect to be affected? 6. Many animals and plants bear recessive alleles for al- binism, a condition in which homozygous individuals lack certain pigments. An albino plant, for example, lacks chlorophyll and is white, and an albino human lacks melanin. If two normally pigmented persons het- erozygous for the same albinism allele marry, what pro- portion of their children would you expect to be albino? 7. You inherit a racehorse and decide to put him out to stud. In looking over the stud book, however, you discover that the horse’s grandfather exhibited a rare disorder that causes brittle bones. The disorder is hereditary and results from homozygosity for a reces- sive allele. If your horse is heterozygous for the allele, it will not be possible to use him for stud because the genetic defect may be passed on. How would you de- termine whether your horse carries this allele? 8. In the fly Drosophila, the allele for dumpy wings (d) is recessive to the normal long-wing allele (d + ), and the allele for white eye (w) is recessive to the normal red- eye allele (w + ). In a cross of d + d + w + w × d + dww, what proportion of the offspring are expected to be “nor- mal” (long wings, red eyes)? What proportion are ex- pected to have dumpy wings and white eyes? 9. Your instructor presents you with a Drosophila with red eyes, as well as a stock of white-eyed flies and an- other stock of flies homozygous for the red-eye allele. You know that the presence of white eyes in Drosophila is caused by homozygosity for a recessive allele. How would you determine whether the single red-eyed fly was heterozygous for the white-eye allele? Chapter 13 Patterns of Inheritance 275 P generation Round seeds Wrinkled seeds F 1 generation (all round seeds) F 2 generation Round seeds (3) Wrinkled seeds (1) 2. The annual plant Haplopappus gracilis has two pairs of chromosomes (1 and 2). In this species, the probabil- ity that two characters a and b selected at random will be on the same chromosome is equal to the probabil- ity that they will both be on chromosome 1 ( 1 ?2 × 1 ?2 = 1 ?4, or 0.25), plus the probability that they will both be on chromosome 2 (also 1 ?2 × 1 ?2 = 1 ?4, or 0.25), for an overall probability of 1 ?2, or 0.5. In general, the proba- bility that two randomly selected characters will be on the same chromosome is equal to 1 ?n where n is the number of chromosome pairs. Humans have 23 pairs of chromosomes. What is the probability that any two human characters selected at random will be on the same chromosome? 3. Among Hereford cattle there is a dominant allele called polled; the individuals that have this allele lack horns. Suppose you acquire a herd consisting entirely of polled cattle, and you carefully determine that no 1. The illustration below describes Mendel’s cross of wrinkled and round seed characters. (Hint: Do you ex- pect all the seeds in a pod to be the same?) What is wrong with this diagram? 10. Some children are born with recessive traits (and, therefore, must be homozygous for the recessive al- lele specifying the trait), even though neither of the parents exhibits the trait. What can account for this? 11. You collect two individuals of Drosophila, one a young male and the other a young, unmated female. Both are normal in appearance, with the red eyes typical of Drosophila. You keep the two flies in the same bottle, where they mate. Two weeks later, the offspring they have produced all have red eyes. From among the offspring, you select 100 individu- als, some male and some female. You cross each in- dividually with a fly you know to be homozygous for the recessive allele sepia, which produces black eyes when homozygous. Examining the results of your 100 crosses, you observe that in about half of the crosses, only red-eyed flies were produced. In the other half, however, the progeny of each cross consists of about 50% red-eyed flies and 50% black-eyed flies. What were the genotypes of your original two flies? 12. Hemophilia is a recessive sex-linked human blood disease that leads to failure of blood to clot nor- mally. One form of hemophilia has been traced to the royal family of England, from which it spread throughout the royal families of Europe. For the purposes of this problem, assume that it originated as a mutation either in Prince Albert or in his wife, Queen Victoria. a. Prince Albert did not have hemophilia. If the dis- ease is a sex-linked recessive abnormality, how could it have originated in Prince Albert, a male, who would have been expected to exhibit sex- linked recessive traits? b. Alexis, the son of Czar Nicholas II of Russia and Empress Alexandra (a granddaughter of Victoria), had hemophilia, but their daughter Anastasia did not. Anastasia died, a victim of the Russian revo- lution, before she had any children. Can we as- sume that Anastasia would have been a carrier of the disease? Would your answer be different if the disease had been present in Nicholas II or in Alexandra? 13. In 1986, National Geographic magazine conducted a survey of its readers’ abilities to detect odors. About 7% of Caucasians in the United States could not smell the odor of musk. If neither parent could smell musk, none of their children were able to smell it. On the other hand, if the two parents could smell musk, their children generally could smell it, too, but a few of the children in those families were unable to smell it. Assuming that a single pair of alleles governs this trait, is the ability to smell musk best explained as an example of dominant or recessive inheritance? 14. A couple with a newborn baby is troubled that the child does not resemble either of them. Suspecting that a mix-up occurred at the hospital, they check the blood type of the infant. It is type O. As the father is type A and the mother type B, they conclude a mix- up must have occurred. Are they correct? 15. Mabel’s sister died of cystic fibrosis as a child. Mabel does not have the disease, and neither do her parents. Mabel is pregnant with her first child. If you were a genetic counselor, what would you tell her about the probability that her child will have cystic fibrosis? 16. How many chromosomes would you expect to find in the karyotype of a person with Turner syndrome? 17. A woman is married for the second time. Her first husband has blood type A and her child by that marriage has type O. Her new husband has type B blood, and when they have a child its blood type is AB. What is the woman’s blood genotype and blood type? 18. Two intensely freckled parents have five children. Three eventually become intensely freckled and two do not. Assuming this trait is governed by a single pair of alleles, is the expression of intense freckles best explained as an example of dominant or recessive inheritance? 19. Total color blindness is a rare hereditary disorder among humans. Affected individuals can see no col- ors, only shades of gray. It occurs in individuals ho- mozygous for a recessive allele, and it is not sex- linked. A man whose father is totally color blind intends to marry a woman whose mother is totally color blind. What are the chances they will produce offspring who are totally color blind? 20. A normally pigmented man marries an albino woman. They have three children, one of whom is an albino. What is the genotype of the father? 21. Four babies are born in a hospital, and each has a dif- ferent blood type: A, B, AB, and O. The parents of these babies have the following pairs of blood groups: A and B, O and O, AB and O, and B and B. Which baby belongs to which parents? 22. A couple both work in an atomic energy plant, and both are exposed daily to low-level background radia- tion. After several years, they have a child who has Duchenne muscular dystrophy, a recessive genetic defect caused by a mutation on the X chromosome. Neither the parents nor the grandparents have the disease. The couple sue the plant, claiming that the abnormality in their child is the direct result of radiation-induced mutation of their gametes, and that the company should have protected them from this radiation. Before reaching a decision, the judge hear- ing the case insists on knowing the sex of the child. Which sex would be more likely to result in an award of damages, and why? 276 Part IV Reproduction and Heredity 277 Can Cancer Tumors Be Starved to Death? One of the most exciting recent developments in the war against cancer is the report that it might be possible to starve cancer tumors to death. Many laboratories have begun to look into this possibility, although it’s not yet clear that the approach will actually work to cure cancer. One of the most exciting and frustrating things about watching a developing science story like this one is that you can't flip ahead and read the ending—in the real world of research, you never know how things are going to turn out. This story starts when a Harvard University researcher, Dr. Judah Folkman, followed up on a familiar observation made by many oncologists (cancer specialists), that removal of a primary tumor often leads to more rapid growth of secondary tumors. "Perhaps," Folkman reasoned, "the pri- mary tumor is producing some substance that inhibits the growth of the other tumors." Such a substance could be a powerful weapon against cancer. Folkman set out to see if he could isolate a chemical from primary tumors that inhibited the growth of sec- ondary ones. Three years ago he announced he had found two. He called them angiostatin and endostatin. To understand how these two proteins work, put your- self in the place of a tumor. To grow, a tumor must obtain from the body's blood supply all the food and nutrients it needs to make more cancer cells. To facilitate this neces- sary grocery shopping, tumors leak out substances into the surrounding tissues that encourage angiogenesis, the for- mation of small blood vessels. This call for more blood vessels insures an ever-greater flow of blood to the tumor as it grows larger. When examined, Folkman's two cancer inhibitors turned out to be angiogenesis inhibitors. Angiostatin and endostatin kill a tumor by cutting off its blood supply. This may sound like an unlikely approach to curing cancer, but think about it—the cells of a growing tumor require a plentiful supply of food and nutrients to fuel their produc- tion of new cancer cells. Cut this off, and the tumor cells die, literally starving to death. By producing factors like angiostatin and endostatin, the primary tumor holds back the growth of any competing tumors, allowing the primary tumor to hog the available resources for its own use (see above). In laboratory tests the angiogenesis inhibitors caused tumors in mice to regress to microscopic size, a result that electrified researchers all over the world. Other scientists were soon trying to replicate this exciting result. Some have succeeded, others not. Five major laboratories have isolated their own angiogenesis inhibitors and published findings of antitumor activity. The National Cancer Institute is proceeding with tests of angiostatin and other angiogenesis inhibitors in humans. Preliminary results are encouraging. While not a cure-all for all cancers, angiogenesis inhibitors seem very effective against some, particularly solid-tumor cancers. Gaining a better understanding of how tumors induce angiogenesis has become a high priority of cancer research. One promising line of research concerns hypoxia. As a solid tumor grows and outstrips its blood supply, its interior be- comes hypoxic (oxygen depleted). In response to hypoxia, it appears that genes are turned on that promote survival under low oxygen pressure, including ones that increase blood flow to the tumor by promoting angiogenesis. Un- derstanding this process may give important clues as to how angiogenesis inhibitors work to inhibit tumor growth. So how does a lowering of oxygen pressure within a tumor promote blood vessel formation? Dr. Randall Johnson of the University of California, San Diego, is studying one important response by a tumor to hypoxia—the induction of a gene-specific transcription factor (that is, a protein that activates the transcription of a particular gene) that pro- motes angiogenesis. Called HIF-1, for hypoxia inducible factor-1, this transcription factor appears to induce the tran- scription of genes necessary for blood vessel formation. Part 1. Primary tumor produces the angiogenesis inhibitor endostatin. 2. Endostatin inhibits formation of new blood vessels. 3. Lacking a blood supply, secondary tumor cannot grow. Primary tumor Secondary tumor Muscle tissue Blood vessel 2 3 1 V Molecular Genetics How primary tumors kill off the competition.Tumors require an ample blood supply to fuel their growth. The growth of new blood vessels is called angiogenesis. Inhibiting angiogenesis offers a possible way to block tumor growth. Real People Doing Real Science The Experiment In order to examine the involvement of the hypoxia- inducible transcriptional factor (HIF-1) in angiogenesis, Johnson and his co-workers were faced with the problem that HIF-1 has many other effects on cell growth. To get a clear look at its role in angiogenesis, the researchers turned to embryonic stem cells. Embryonic stem cells are cells harvested from early embryos, before they have differenti- ated, while they are still capable of unlimited division. Be- cause such stem cells have the capacity to form tumors (ter- atocarcinomas) when injected into certain kinds of mice, they offer a good natural laboratory in which to study how HIF-1 might influence cancer growth. The research team first prepared a mutant HIF-1 embryonic stem cell line in which the function of the transcription factor encoded by HIF-1 was completely destroyed or null. The researchers then grew these HIF-1 null stem cells under hypoxic conditions. If HIF-1 genes indeed foster tumor growth in normal cells by promoting angiogenesis, then it would be expected that these nullcells would be un- able to promote tumor growth in this way. The researchers tested the ability of null cells to promote tumor growth by injecting HIF-1α null cells into laboratory mice, and in control experiments injecting wild- type stem cells. The injected cells were allowed to grow and form tumors in both null and control host animals. The tumors that formed were then examined and measured for differences. To get a closer look at what was really going on, the null and wild-type cells were compared in their ability to actually form new blood vessels. This was done by examining levels of mRNA of a growth factor that plays a key role in the for- mation and growth of blood vessels. This factor is a protein called vascular endothelial growth factor (VEGF). The lev- els of VEGF mRNA in the cells were determined by hybridizing cDNA VEGF probes to mRNA isolated from tumors, and measuring in each instance how much tumor mRNA bound to the cDNA probe. In parallel studies, anti- bodies were used to determine levels of VEGF protein. The Results The researchers found that the nullcells were greatly compro- mised in their ability to form tumors compared to the wild- type cells with the effects becoming more significant over time (see graph a above). Tumors were five times larger in wild- type cells than in the HIF-1 null cells after 21 days. Clearly knocking out HIF-1 retards tumor growth significantly. This decrease in the size of tumors produced by null cells is further supported by the results of the VEGF pro- tein analysis (see graph b above). Levels of the protein VEGF rise in wild-type cells under conditions of hypoxia, increasing the immediate availability of oxygen to the tumor by promoting capillary formation. The researchers found levels of VEGF protein were lower in null cell tu- mors, and responded to hypoxia at a lower rate. Both the decrease in tumor size and the lower level of VEGF in the HIF-1 null cells supports the hypothesis that HIF-1 plays an essential role in promoting angiogenesis in a tumor, responding to a hypoxic condition by increasing the levels of VEGF. Do the angiogenesis inhibitors like angiostatin, being tested as cancer cures, in fact act by inhibiting VEGF? The sorts of experiments being carried out in Johnson’s labora- tory, and in many other cancer centers, should soon cast light on this still-murky question. 9 days 21 days Days in culture 3 4 5 T umor weight (g) 6 0 2 1 48 Hours of hypoxic treatment 72 75 150 225 VEGF (pg/ml) 300 0 Wild-type cells HIF-1α null cells Wild-type cells HIF-1α null cells (b)(a) Tumor growth in HIF-1α null cells and wild-type cells. (a) The size of tumors formed by the HIF-1α null cells were significantly smaller compared to those formed by wild-type cells. (b) HIF-1α nullcells had significantly lower levels of VEGF protein production under hypoxic conditions compared to wild-type cells. VEGF promotes the formation of capillaries. To explore this experiment further, go to the Virtual Lab at www.mhhe.com/raven6/vlab5.mhtml 279 14 DNA: The Genetic Material Concept Outline 14.1 What is the genetic material? The Hammerling Experiment: Cells Store Hereditary Information in the Nucleus Transplantation Experiments: Each Cell Contains a Full Set of Genetic Instructions The Griffith Experiment: Hereditary Information Can Pass between Organisms The Avery and Hershey-Chase Experiments: The Active Principle Is DNA 14.2 What is the structure of DNA? The Chemical Nature of Nucleic Acids. Nucleic acids are polymers containing four nucleotides. The Three-Dimensional Structure of DNA. The DNA molecule is a double helix, with two strands held together by base-pairing. 14.3 How does DNA replicate? The Meselson–Stahl Experiment: DNA Replication Is Semiconservative The Replication Process. DNA is replicated by the enzyme DNA polymerase III, working in concert with many other proteins. DNA replicates by assembling a complementary copy of each strand semidiscontinuously. Eukaryotic DNA Replication. Eukaryotic chromosomes consist of many zones of replication. 14.4 What is a gene? The One-Gene/One-Polypeptide Hypothesis. A gene encodes all the information needed to express a functional protein or RNA molecule. How DNA Encodes Protein Structure. The nucleotide sequence of a gene dictates the amino acid sequence of the protein it encodes. T he realization that patterns of heredity can be ex- plained by the segregation of chromosomes in meio- sis raised a question that occupied biologists for over 50 years: What is the exact nature of the connection between hereditary traits and chromosomes? This chapter de- scribes the chain of experiments that have led to our cur- rent understanding of the molecular mechanisms of heredity (figure 14.1). The experiments are among the most elegant in science. Just as in a good detective story, each conclusion has led to new questions. The intellectual path taken has not always been a straight one, the best questions not always obvious. But however erratic and lurching the course of the experimental journey, our pic- ture of heredity has become progressively clearer, the image more sharply defined. FIGURE 14.1 DNA.The hereditary blueprint in each cell of all living organisms is a very long, slender molecule called deoxyribonucleic acid (DNA). In this experiment, the initial flower-shaped cap was somewhat intermediate in shape, unlike the disk-shaped caps of subsequent generations. Hammerling speculated that this initial cap, which resembled that of A. crenulata, was formed from instructions already present in the trans- planted stalk when it was excised from the original A. crenulata cell. In contrast, all of the caps that regenerated subsequently used new information derived from the foot of the A. mediterraneacell the stalk had been grafted onto. In some unknown way, the original instructions that had been present in the stalk were eventually “used up.” We now understand that genetic instructions (in the form of messenger RNA, discussed in chapter 15) pass from the nu- cleus in the foot upward through the stalkto the developing cap. Hereditary information in Acetabularia is stored in the foot of the cell, where the nucleus resides. 280 Part V Molecular Genetics The Hammerling Experiment: Cells Store Hereditary Information in the Nucleus Perhaps the most basic question one can ask about heredi- tary information is where it is stored in the cell. To answer this question, Danish biologist Joachim Hammerling, working at the Max Plank Institute for Marine Biology in Berlin in the 1930s, cut cells into pieces and observed the pieces to see which were able to express hereditary infor- mation. For this experiment, Hammerling needed cells large enough to operate on conveniently and differentiated enough to distinguish the pieces. He chose the unicellular green alga Acetabularia, which grows up to 5 cm, as a model organism for his investigations. Just as Mendel used pea plants and Sturtevant used fruit flies as model or- ganisms, Hammerling picked an organism that was suited to the specific experimental question he wanted to answer, assuming that what he learned could then be applied to other organisms. Individuals of the genus Acetabulariahave distinct foot, stalk, and cap regions; all are differentiated parts of a sin- gle cell. The nucleus is located in the foot. As a prelimi- nary experiment, Hammerling amputated the caps of some cells and the feet of others. He found that when he amputated the cap, a new cap regenerated from the re- maining portions of the cell (foot and stalk). When he amputated the foot, however, no new foot regenerated from the cap and stalk. Hammerling, therefore, hypothe- sized that the hereditary information resided within the foot of Acetabularia. Surgery on Single Cells To test his hypothesis, Hammerling selected individuals from two species of the genus Acetabularia in which the caps look very different from one another: A. mediterranea has a disk-shaped cap, and A. crenulata has a branched, flower-like cap. Hammerling grafted a stalk from A. crenu- lata to a foot from A. mediterranea (figure 14.2). The cap that regenerated looked somewhat like the cap of A. crenu- lata,though not exactly the same. Hammerling then cut off this regenerated cap and found that a disk-shaped cap exactly like that of A. mediterranea formed in the second regeneration and in every regeneration thereafter. This experiment supported Hammerling’s hypothesis that the instructions specifying the kind of cap are stored in the foot of the cell, and that these instructions must pass from the foot through the stalk to the cap. 14.1 What is the genetic material? Nucleus in base determines type of cap regenerated A. crenulata A. mediterranea FIGURE 14.2 Hammerling’s Acetabularia reciprocal graft experiment. Hammerling grafted a stalk of each species of Acetabulariaonto the foot of the other species. In each case, the cap that eventually developed was dictated by the nucleus-containing foot rather than by the stalk. Transplantation Experiments: Each Cell Contains a Full Set of Genetic Instructions Because the nucleus is contained in the foot of Acetabu- laria, Hammerling’s experiments suggested that the nu- cleus is the repository of hereditary information in a cell. A direct test of this hypothesis was carried out in 1952 by American embryologists Robert Briggs and Thomas King. Using a glass pipette drawn to a fine tip and work- ing with a microscope, Briggs and King removed the nu- cleus from a frog egg. Without the nucleus, the egg did not develop. However, when they replaced the nucleus with one removed from a more advanced frog embryo cell, the egg developed into an adult frog. Clearly, the nucleus was directing the egg’s development (fig- ure14.3). Successfully Transplanting Nuclei Can every nucleus in an organism direct the development of an entire adult individual? The experiment of Briggs and King did not answer this question definitively, because the nuclei they transplanted from frog embryos into eggs often caused the eggs to develop abnormally. Two experiments performed soon afterward gave a clearer answer to the question. In the first, John Gurdon, working with another species of frog at Oxford and Yale, transplanted nuclei from tadpole cells into eggs from which the nuclei had been removed. The experiments were difficult—it was nec- essary to synchronize the division cycles of donor and host. However, in many experiments, the eggs went on to de- velop normally, indicating that the nuclei of cells in later stages of development retain the genetic information nec- essary to direct the development of all other cells in an in- dividual. Totipotency in Plants In the second experiment, F. C. Steward at Cornell Uni- versity in 1958 placed small fragments of fully developed carrot tissue (isolated from a part of the vascular system called the phloem) in a flask containing liquid growth medium. Steward observed that when individual cells broke away from the fragments, they often divided and developed into multicellular roots. When he immobilized the roots by placing them in a solid growth medium, they went on to develop normally into entire, mature plants. Steward’s ex- periment makes it clear that, even in adult tissues, the nu- clei of individual plant cells are “totipotent”—each contains a full set of hereditary instructions and can generate an en- tire adult individual. As you will learn in chapter 19, animal cells, like plant cells, can be totipotent, and a single adult animal cell can generate an entire adult animal. Hereditary information is stored in the nucleus of eukaryotic cells. Each nucleus in any eukaryotic cell contains a full set of genetic instructions. Chapter 14 DNA: The Genetic Material 281 Egg (two nucleoli) Tadpole (one nucleolus) UV light destroys nucleus, or it is removed with micropipette. Epithelial cells are isolated from tadpole intestine. Nucleus is removed in micropipette. Epithelial cell nucleus is inserted into enucleate egg. No growth Embryo Embryo Tadpole Abnormal embryo Occasionally, an adult frog develops. Its cells possess one nucleolus. 1 2 3 FIGURE 14.3 Briggs and King’s nuclear transplant experiment.Two strains of frogs were used that differed from each other in the number of nucleoli their cells possessed. The nucleus was removed from an egg of one strain, either by sucking the egg nucleus into a micropipette or, more simply, by destroying it with ultraviolet light. A nucleus obtained from a differentiated cell of the other strain was then injected into this enucleate egg. The hybrid egg was allowed to develop. One of three results was obtained in individual experiments: (1) no growth occurred, perhaps reflecting damage to the egg cell during the nuclear transplant operation; (2) normal growth and development occurred up to an early embryo stage, but subsequent development was not normal and the embryo did not survive; and (3) normal growth and development occurred, eventually leading to the development of an adult frog. That frog was of the strain that contributed the nucleus and not of the strain that contributed the egg. Only a few experiments gave this third result, but they serve to clearly establish that the nucleus directs frog development. The Griffith Experiment: Hereditary Information Can Pass between Organisms The identification of the nucleus as the repository of hereditary information focused attention on the chromo- somes, which were already suspected to be the vehicles of Mendelian inheritance. Specifically, biologists wondered how the genes, the units of hereditary information studied by Mendel, were actually arranged in the chromosomes. They knew that chromosomes contained both protein and deoxyribonucleic acid (DNA). Which of these held the genes? Starting in the late 1920s and continuing for about 30 years, a series of investigations addressed this question. In 1928, British microbiologist Frederick Griffith made a series of unexpected observations while experimenting with pathogenic (disease-causing) bacteria. When he in- fected mice with a virulent strain of Streptococcus pneumoniae bacteria (then known as Pneumococcus), the mice died of blood poisoning. However, when he infected similar mice with a mutant strain of S. pneumoniae that lacked the viru- lent strain’s polysaccharide coat, the mice showed no ill ef- fects. The coat was apparently necessary for virulence. The normal pathogenic form of this bacterium is referred to as the S form because it forms smooth colonies on a culture dish. The mutant form, which lacks an enzyme needed to manufacture the polysaccharide capsule, is called the R form because it forms rough colonies. To determine whether the polysaccharide coat itself had a toxic effect, Griffith injected dead bacteria of the virulent S strain into mice; the mice remained perfectly healthy. As a control, he injected mice with a mixture containing dead S bacteria of the virulent strain and live coatless R bacteria, each of which by itself did not harm the mice (figure 14.4). Unexpectedly, the mice developed disease symptoms and many of them died. The blood of the dead mice was found to contain high levels of live, virulent Streptococcus type S bacteria, which had surface proteins characteristic of the live (previously R) strain. Somehow, the information speci- fying the polysaccharide coat had passed from the dead, virulent S bacteria to the live, coatless R bacteria in the mixture, permanently transforming the coatless R bacteria into the virulent S variety. Transformation is the transfer of genetic material from one cell to another and can alter the genetic makeup of the recipient cell. Hereditary information can pass from dead cells to living ones, transforming them. 282 Part V Molecular Genetics Mice die; their blood contains live pathogenic strain of S. pneumoniae Mixture of heat-killed pathogenic and live nonpathogenic strains of S. pneumoniae + Heat-killed pathogenic strain of S. pneumoniae Live pathogenic strain of S. pneumoniae Live nonpathogenic strain of S. pneumoniae Polysaccharide coat Mice liveMice die Mice live(2)(1) (3) (4) FIGURE 14.4 Griffith’s discovery of transformation.(1) The pathogenic of the bacterium Streptococcus pneumoniaekills many of the mice it is injected into. The bacterial cells are covered with a polysaccharide coat, which the bacteria themselves synthesize. (2) Interestingly, an injection of live, coatless bacteria produced no ill effects. However, the coat itself is not the agent of disease. (3) When Griffith injected mice with dead bacteria that possessed polysaccharide coats, the mice were unharmed. (4) But when Griffith injected a mixture of dead bacteria with polysaccharide coats and live bacteria without such coats, many of the mice died, and virulent bacteria with coats were recovered. Griffith concluded that the live cells had been “transformed” by the dead ones; that is, genetic information specifying the polysaccharide coat had passed from the dead cells to the living ones. The Avery and Hershey-Chase Experiments: The Active Principle Is DNA The Avery Experiments The agent responsible for transforming Streptococcus went undiscovered until 1944. In a classic series of experiments, Oswald Avery and his coworkers Colin MacLeod and Maclyn McCarty characterized what they referred to as the “transforming principle.” They first prepared the mixture of dead S Streptococcus and live R Streptococcus that Griffith had used. Then Avery and his colleagues removed as much of the protein as they could from their preparation, eventu- ally achieving 99.98% purity. Despite the removal of nearly all protein, the transforming activity was not reduced. Moreover, the properties of the transforming principle re- sembled those of DNA in several ways: 1. When the purified principle was analyzed chemically, the array of elements agreed closely with DNA. 2. When spun at high speeds in an ultracentrifuge, the transforming principle migrated to the same level (density) as DNA. 3. Extracting the lipid and protein from the purified transforming principle did not reduce its activity. 4. Protein-digesting enzymes did not affect the princi- ple’s activity; nor did RNA-digesting enzymes. 5. The DNA-digesting enzyme DNase destroyed all transforming activity. The evidence was overwhelming. They concluded that “a nucleic acid of the deoxyribose type is the fundamental unit of the transforming principle of Pneumococcus Type III”—in essence, that DNA is the hereditary material. The Hershey–Chase Experiment Avery’s results were not widely accepted at first, as many biologists preferred to believe that proteins were the repos- itory of hereditary information. Additional evidence sup- porting Avery’s conclusion was provided in 1952 by Alfred Hershey and Martha Chase, who experimented with bacte- riophages, viruses that attack bacteria. Viruses, described in more detail in chapter 33, consist of either DNA or RNA (ribonucleic acid) surrounded by a protein coat. When a lytic (potentially cell-rupturing) bacteriophage in- fects a bacterial cell, it first binds to the cell’s outer surface and then injects its hereditary information into the cell. There, the hereditary information directs the production of thousands of new viruses within the bacterium. The bacter- ial cell eventually ruptures, or lyses, releasing the newly made viruses. To identify the hereditary material injected into bacter- ial cells at the start of an infection, Hershey and Chase used the bacteriophage T2, which contains DNA rather than RNA. They labeled the two parts of the viruses, the DNA and the protein coat, with different radioactive isotopes that would serve as tracers. In some experiments, the viruses were grown on a medium containing an isotope of phosphorus, 32 P, and the isotope was incorporated into the phosphate groups of newly synthesized DNA molecules. In other experiments, the viruses were grown on a medium containing 35 S, an isotope of sulfur, which is incorporated into the amino acids of newly synthesized protein coats. The 32 P and 35 S isotopes are easily distinguished from each other because they emit particles with different energies when they decay. After the labeled viruses were permitted to infect bacte- ria, the bacterial cells were agitated violently to remove the protein coats of the infecting viruses from the surfaces of the bacteria. This procedure removed nearly all of the 35 S label (and thus nearly all of the viral protein) from the bac- teria. However, the 32 P label (and thus the viral DNA) had transferred to the interior of the bacteria (figure 14.5) and was found in viruses subsequently released from the in- fected bacteria. Hence, the hereditary information injected into the bacteria that specified the new generation of viruses was DNA and not protein. Avery’s experiments demonstrate conclusively that DNA is Griffith’s transforming material. The hereditary material of bacteriophages is DNA and not protein. Chapter 14 DNA: The Genetic Material 283 Protein coat labeled with 35 S DNA labeled with 32 P Bacteriophages infect bacterial cells. T2 bacteriophages are labeled with radioactive isotopes. Bacterial cells are agitated to remove protein coats. 35 S radioactivity found in the medium 32 P radioactivity found in the bacterial cells FIGURE 14.5 The Hershey and Chase experiment.Hershey and Chase found that 35 S radioactivity did not enter infected bacterial cellsand 32 P radioactivity did. They concluded that viral DNA, not protein,was responsible for directing the production of new viruses. The Chemical Nature of Nucleic Acids A German chemist, Friedrich Miescher, discovered DNA in 1869, only four years after Mendel’s work was published. Miescher extracted a white substance from the nuclei of human cells and fish sperm. The proportion of nitrogen and phosphorus in the substance was different from that in any other known constituent of cells, which convinced Mi- escher that he had discovered a new biological substance. He called this substance “nuclein,” because it seemed to be specifically associated with the nucleus. Levene’s Analysis: DNA Is a Polymer Because Miescher’s nuclein was slightly acidic, it came to be called nucleic acid. For 50 years biologists did little research on the substance, because nothing was known of its function in cells. In the 1920s, the basic structure of nucleic acids was determined by the biochemist P. A. Levene, who found that DNA contains three main com- ponents (figure 14.6): (1)phosphate (PO 4 ) groups; (2)five-carbon sugars; and (3)nitrogen-containing bases called purines (adenine, A, and guanine, G) and pyrim- idines (thymine, T, and cytosine, C; RNA contains uracil, U, instead of T). From the roughly equal propor- tions of these components, Levene concluded correctly that DNA and RNA molecules are made of repeating units of the three components. Each unit, consisting of a sugar attached to a phosphate group and a base, is called a nucleotide. The identity of the base distinguishes one nucleotide from another. To identify the various chemical groups in DNA and RNA, it is customary to number the carbon atoms of the base and the sugar and then refer to any chemical group attached to a carbon atom by that number. In the sugar, four of the carbon atoms together with an oxygen atom form a five-membered ring. As illustrated in figure 14.7, the carbon atoms are numbered 1′ to 5′, proceeding clockwise from the oxygen atom; the prime symbol (′) in- dicates that the number refers to a carbon in a sugar rather than a base. Under this numbering scheme, the phosphate group is attached to the 5′ carbon atom of the sugar, and the base is attached to the 1′ carbon atom. In addition, a free hydroxyl (—OH) group is attached to the 3′carbon atom. The 5′ phosphate and 3′ hydroxyl groups allow DNA and RNA to form long chains of nucleotides, because these two groups can react chemically with each other. The reaction between the phosphate group of one nu- cleotide and the hydroxyl group of another is a dehydra- tion synthesis, eliminating a water molecule and forming a covalent bond that links the two groups (figure 14.8). The linkage is called a phosphodiester bond because 284 Part V Molecular Genetics N N C N C C N C C O – P O HO O – H HC H H Adenine H H HO OH Deoxyribose (DNA only) Phosphate H O C CC CHH H H OH NH 2 C Cytosine C N CH CH O NH 2 N N C N C C C Guanine Purines O Pyrimidines N H C Uracil (RNA only) CC H H C O O N HH N H C Thymine (DNA only) C N C H CH 3 H C O H H 2 N O N HC H HO OH OH Ribose (RNA only) O C CC CHH H H OH C HN 14.2 What is the structure of DNA? FIGURE 14.6 Nucleotide subunits of DNA and RNA.The nucleotide subunits of DNA and RNA are composed of three elements: a five-carbon sugar (deoxyribose in DNA and ribose in RNA), a phosphate group, and a nitrogenous base (either a purine or a pyrimidine). OH CH 2 O 4H11032 5H11032 3H11032 2H11032 1H11032 PO 4 Base FIGURE 14.7 Numbering the carbon atoms in a nucleotide.The carbon atoms in the sugar of the nucleotide are numbered 1′to 5′, proceeding clockwise from the oxygen atom. The “prime” symbol (′) indicates that the carbon belongs to the sugar rather than the base. the phosphate group is now linked to the two sugars by means of a pair of ester (P— O—C) bonds. The two-unit polymer re- sulting from this reaction still has a free 5′ phosphate group at one end and a free 3′ hydroxyl group at the other, so it can link to other nucleotides. In this way, many thousands of nucleotides can join together in long chains. Linear strands of DNA or RNA, no mat- ter how long, will almost always have a free 5′ phosphate group at one end and a free 3′ hydroxyl group at the other. Therefore, every DNA and RNA molecule has an in- trinsic directionality, and we can refer un- ambiguously to each end of the molecule. By convention, the sequence of bases is usu- ally expressed in the 5′-to-3′ direction. Thus, the base sequence “GTCCAT” refers to the sequence, 5′pGpTpCpCpApT—OH 3′ where the phosphates are indicated by “p.” Note that this is not the same molecule as that represented by the reverse sequence: 5′pTpApCpCpTpG—OH 3′ Levene’s early studies indicated that all four types of DNA nucleotides were present in roughly equal amounts. This result, which later proved to be erroneous, led to the mistaken idea that DNA was a simple polymer in which the four nucleotides merely repeated (for instance, GCAT . . . GCAT . . . GCAT . . . GCAT . . .). If the sequence never varied, it was difficult to see how DNA might contain the hereditary information; this was why Avery’s conclusion that DNA is the transforming princi- ple was not readily accepted at first. It seemed more plau- sible that DNA was simply a structural element of the chromosomes, with proteins playing the central genetic role. Chargaff’s Analysis: DNA Is Not a Simple Repeating Polymer When Levene’s chemical analysis of DNA was repeated using more sensitive tech- niques that became available after World War II, quite a different result was ob- tained. The four nucleotides were not pre- sent in equal proportions in DNA mole- cules after all. A careful study carried out by Erwin Chargaff showed that the nu- cleotide composition of DNA molecules varied in complex ways, depending on the source of the DNA (table 14.1). This strongly suggested that DNA was not a simple repeating polymer and might have the information-encoding properties ge- netic material must have. Despite DNA’s complexity, however, Chargaff observed an important underlying regularity in double- stranded DNA: the amount of adenine present in DNA always equals the amount of thymine, and the amount of guanine always equals the amount of cytosine. These findings are com- monly referred to as Chargaff’s rules: 1. The proportion of A always equals that of T, and the proportion of G always equals that of C: A = T, and G = C. 2. It follows that there is always an equal proportion of purines (A and G) and pyrimidines (C and T). A single strand of DNA or RNA consists of a series of nucleotides joined together in a long chain. In all natural double-stranded DNA molecules, the proportion of A equals that of T, and the proportion of G equals that of C. Chapter 14 DNA: The Genetic Material 285 Table 14.1 Chargaff’s Analysis of DNA Nucleotide Base Compositions Base Composition (Mole Percent) Organism A T G C Escherichia coli (K12) 26.0 23.9 24.9 25.2 Mycobacterium tuberculosis 15.1 14.6 34.9 35.4 Yeast 31.3 32.9 18.7 17.1 Herring 27.8 27.5 22.2 22.6 Rat 28.6 28.4 21.4 21.5 Human 30.9 29.4 19.9 19.8 Source: Data from E. Chargaff and J. Davidson (editors), The Nucleic Acides, 1955, Academic Press, New York, NY. OH O 3H11032 5H11032 PO 4 Base CH 2 O Base CH 2 O P O C O - O FIGURE 14.8 A phosphodiester bond. The Three- Dimensional Structure of DNA As it became clear that DNA was the molecule that stored the hereditary information, investigators began to puzzle over how such a seemingly simple molecule could carry out such a complex function. Franklin: X-ray Diffraction Patterns of DNA The significance of the regularities pointed out by Chargaff were not im- mediately obvious, but they became clear when a British chemist, Ros- alind Franklin (figure 14.9a), carried out an X-ray diffraction analysis of DNA. In X-ray diffraction, a mole- cule is bombarded with a beam of X rays. When individual rays encounter atoms, their path is bent or dif- fracted, and the diffraction pattern is recorded on photographic film. The patterns resemble the ripples created by tossing a rock into a smooth lake (figure 14.9b). When carefully ana- lyzed, they yield information about the three-dimensional structure of a molecule. X-ray diffraction works best on substances that can be prepared as perfectly regular crystalline arrays. However, it was impossible to obtain true crystals of natural DNA at the time Franklin conducted her analysis, so she had to use DNA in the form of fibers. Franklin worked in the labora- tory of British biochemist Maurice Wilkins, who was able to prepare more uniformly oriented DNA fibers than anyone had previously. Using these fibers, Franklin succeeded in obtaining crude diffraction informa- tion on natural DNA. The diffrac- tion patterns she obtained suggested that the DNA molecule had the shape of a helix, or corkscrew, with a diameter of about 2 nanometers and a complete helical turn every 3.4 nanometers (figure 14.9c). 286 Part V Molecular Genetics G???C G???C Minor groove Minor groove Major groove Major groove 3.4 nm 0.34 nm 3H110325H11032 3H11032 5H11032 2 nm C???G G???C G???C G???C C???G TA TA TA TA TA TA TA (a) (b) FIGURE 14.9 Rosalind Franklin’s X-ray diffraction patterns suggested the shape of DNA. (a) Rosalind Franklin developed techniques for taking X-ray diffraction pictures of fibers of DNA. (b) This is the telltale X-ray diffraction photograph of DNA fibers made in 1953 by Rosalind Franklin in the laboratory of Maurice Wilkins. (c) The X- ray diffraction studies of Rosalind Franklin suggested the dimensions of the double helix. (c) Watson and Crick: A Model of the Double Helix Learning informally of Franklin’s re- sults before they were published in 1953, James Watson and Francis Crick, two young investigators at Cambridge University, quickly worked out a likely structure for the DNA molecule (figure 14.10), which we now know was substantially cor- rect. They analyzed the problem de- ductively, first building models of the nucleotides, and then trying to assemble the nucleotides into a mol- ecule that matched what was known about the structure of DNA. They tried various possibilities before they finally hit on the idea that the mole- cule might be a simple double helix, with the bases of two strands pointed inward toward each other, forming base-pairs. In their model, base- pairs always consist of purines, which are large, pointing toward pyrim- idines, which are small, keeping the diameter of the molecule a constant 2 nanometers. Because hydrogen bonds can form between the bases in a base-pair, the double helix is stabi- lized as a duplex DNA molecule composed of two antiparallel strands, one chain running 3′ to 5′ and the other 5′to 3′. The base-pairs are planar (flat) and stack 0.34 nm apart as a result of hydrophobic in- teractions, contributing to the over- all stability of the molecule. The Watson–Crick model ex- plained why Chargaff had obtained the results he had: in a double helix, adenine forms two hydrogen bonds with thymine, but it will not form hy- drogen bonds properly with cytosine. Similarly, guanine forms three hydro- gen bonds with cytosine, but it will not form hydrogen bonds properly with thymine. Consequently, adenine and thymine will always occur in the same proportions in any DNA mole- cule, as will guanine and cytosine, be- cause of this base-pairing. The DNA molecule is a double helix, the strands held together by base-pairing. Chapter 14 DNA: The Genetic Material 287 OH H11032 end H11032 end Phosphodiester bond Hydrogen bonds between nitrogenous bases Sugar-phosphate "backbone" P P P P P O O O O O O A T G C T A C G G O O O O P P P P C P O 3 5 FIGURE 14.10 DNA is a double helix.(a) In a DNA duplex molecule, only two base-pairs are possible: adenine (A) can pair with thymine (T), and guanine (G) can pair with cytosine (C). An A-T base-pair has two hydrogen bonds, while a G-C base-pair has three. (b) James Watson (far left), and Francis Crick (left) deduced the structure of DNA in 1953 from Chargaff’s rules and Franklin’s diffraction studies. (a) (b) The Meselson–Stahl Experiment: DNA Replication Is Semiconservative The Watson–Crick model immediately suggested that the basis for copying the genetic information is comple- mentarity. One chain of the DNA molecule may have any conceivable base sequence, but this sequence com- pletely determines the sequence of its partner in the du- plex. For example, if the sequence of one chain is 5′- ATTGCAT-3′, the sequence of its partner must be 3′-TAACGTA-5′. Thus, each chain in the duplex is a complement of the other. The complementarity of the DNA duplex provides a ready means of accurately duplicating the molecule. If one were to “unzip” the molecule, one would need only to as- semble the appropriate complementary nucleotides on the exposed single strands to form two daughter duplexes with the same sequence. This form of DNA replication is called semiconservative,because while the sequence of the origi- nal duplex is conserved after one round of replication, the duplex itself is not. Instead, each strand of the duplex be- comes part of another duplex. Two other hypotheses of gene replication were also proposed. The conservative model stated that the parental double helix would remain intact and generate DNA copies consisting of entirely new molecules. The disper- sive model predicted that parental DNA would become dispersed throughout the new copy so that each strand of all the daughter molecules would be a mixture of old and new DNA. The three hypotheses of DNA replication were evalu- ated in 1958 by Matthew Meselson and Franklin Stahl of the California Institute of Technology. These two scien- tists grew bacteria in a medium containing the heavy iso- tope of nitrogen, 15 N, which became incorporated into the bases of the bacterial DNA. After several generations, the DNA of these bacteria was denser than that of bacteria grown in a medium containing the lighter isotope of nitro- gen, 14 N. Meselson and Stahl then transferred the bacteria from the 15 N medium to the 14 N medium and collected the DNA at various intervals. By dissolving the DNA they had collected in a heavy salt called cesium chloride and then spinning the solution at very high speeds in an ultracentrifuge, Meselson and Stahl were able to separate DNA strands of different den- sities. The enormous centrifugal forces generated by the ultracentrifuge caused the cesium ions to migrate toward the bottom of the centrifuge tube, creating a gradient of cesium concentration, and thus of density. Each DNA strand floats or sinks in the gradient until it reaches the position where its density exactly matches the density of the cesium there. Because 15 N strands are denser than 14 N strands, they migrate farther down the tube to a denser region of the cesium gradient. The DNA collected immediately after the transfer was all dense. However, after the bacteria completed their first round of DNA replication in the 14 N medium, the density of their DNA had decreased to a value intermediate be- tween 14 N-DNA and 15 N-DNA. After the second round of replication, two density classes of DNA were observed, one intermediate and one equal to that of 14 N-DNA (figure 14.11). Meselson and Stahl interpreted their results as follows: after the first round of replication, each daughter DNA du- plex was a hybrid possessing one of the heavy strands of the parent molecule and one light strand; when this hybrid du- plex replicated, it contributed one heavy strand to form an- other hybrid duplex and one light strand to form a light du- plex (figure 14.12). Thus, this experiment clearly confirmed the prediction of the Watson-Crick model that DNA repli- cates in a semiconservative manner. The basis for the great accuracy of DNA replication is complementarity. A DNA molecule is a duplex, containing two strands that are complementary mirror images of each other, so either one can be used as a template to reconstruct the other. 288 Part V Molecular Genetics 14.3 How does DNA replicate? FIGURE 14.11 The key result of the Meselson and Stahl experiment.These bands of DNA, photographed on the left and scanned on the right, are from the density-gradient centrifugation experiment of Meselson and Stahl. At 0 generation, all DNA is heavy; after one replication all DNA has a hybrid density; after two replications, all DNA is hybrid or light. Chapter 14 DNA: The Genetic Material 289 2. Bacteria were then allowed to grow in a medium containing a light isotope of nitrogen. 1. Bacteria were grown in a medium containing a heavy isotope of nitrogen. 3. At various times, the DNA from bacterial cells was extracted. 4. The DNA was suspended in a cesium chloride solution. DNA Bacterial cell 1 23 Sample at 0 minutes Sample at 20 minutes 4 Sample at 40 minutes Centrifugation 1234 Control group (unlabeled DNA) Labeled parent DNA (both strands heavy) F 1 generation DNA (one heavy/ light hybrid molecule) F 2 generation DNA (one unlabeled molecule, one heavy/light hybrid molecule) 15 N medium 14 14 N medium 14 N mediumN medium FIGURE 14.12 The Meselson and Stahl experiment: evidence demonstrating semiconservative replication.Bacterial cells were grown for several generations in a medium containing a heavy isotope of nitrogen ( 15 N) and then were transferred to a new medium containing the normal lighter isotope ( 14 N). At various times thereafter, samples of the bacteria were collected, and their DNA was dissolved in a solution of cesium chloride, which was spun rapidly in a centrifuge. Because the cesium ion is so massive, it tends to settle toward the bottom of the spinning tube, establishing a gradient of cesium density. DNA molecules sink in the gradient until they reach a place where their density equals that of the cesium; they then “float” at that position. DNA containing 15 N is denser than that containing 14 N, so it sinks to a lower position in the cesium gradient. After one generation in 14 N medium, the bacteria yielded a single band of DNA with a density between that of 14 N-DNA and 15 N-DNA, indicating that only one strand of each duplex contained 15 N. After two generations in 14 N medium, two bands were obtained; one of intermediate density (in which one of the strands contained 15 N) and one of low density (in which neither strand contained 15 N). Meselson and Stahl concluded that replication of the DNA duplex involves building new molecules by separating strands and assembling new partners on each of these templates. The Replication Process To be effective, DNA replication must be fast and accurate. The machinery responsible has been the subject of inten- sive study for 40 years, and we now know a great deal about it. The replication of DNA begins at one or more sites on the DNA molecule where there is a specific sequence of nucleotides called a replication origin (figure 14.13). There the DNA replicating enzyme DNA polymerase III and other enzymes begin a complex process that catalyzes the addition of nucleotides to the growing complementary strands of DNA (figure 14.14). Table 14.2 lists the proteins involved in DNA replication in bacteria. Before consider- ing the replication process in detail, let’s take a closer look at DNA polymerase III. DNA Polymerase III The first DNA polymerase enzyme to be characterized, DNA polymerase I of the bacterium Escherichia coli, is a rel- atively small enzyme that plays a key supporting role in 290 Part V Molecular Genetics Parental DNA duplex Replication origin Template strands New strands Two daughter DNA duplexes FIGURE 14.13 Origins of replication. At a site called the replication origin, the DNA duplex opens to create two separate strands, each of which can be used as a template for a new strand. Eukaryotic DNA has multiple origins of replication. O O O O O O O O O O O OHOH O O O O O O O O O O O P P PPP P P P P P P P P P P P P P P P Pyrophosphate 3H11032 3H11032 3H11032 3H11032 5H11032 5H11032 5H110325H11032 Sugar- phosphate backbone New strandTemplate strand New strandTemplate strand P P P P P P OH OH OH T T G C A A A A T G C T T G C A A A A T G C DNA polymerase III FIGURE 14.14 How nucleotides are added in DNA replication. DNA polymerase III, along with other enzymes, catalyzes the addition of nucleotides to the growing complementary strand of DNA. When a nucleotide is added, two of its phosphates are lost as pyrophosphate. DNA replication. The true E. coli replicating enzyme, dubbed DNA polymerase III, is some 10 times larger and far more complex in structure. We know more about DNA polymerase III than any other organism’s DNA poly- merase, and so will describe it in detail here. Other DNA polymerases are thought to be broadly similar. DNA polymerase III contains 10 different kinds of polypeptide chains, as illustrated in figure 14.15. The en- zyme is a dimer, with two similar multisubunit complexes. Each complex catalyzes the replication of one DNA strand. A variety of different proteins play key roles within each complex. The subunits include a single large catalytic α subunit that catalyzes 5′ to 3′ addition of nucleotides to a growing chain, a smaller ε subunit that proofreads 3′ to 5′ for mistakes, and a ring-shaped β 2 dimer subunit that clamps the polymerase III complex around the DNA dou- ble helix. Polymerase III progressively threads the DNA through the enzyme complex, moving it at a rapid rate, some 1000 nucleotides per second (100 full turns of the helix, 0.34 micrometers). Chapter 14 DNA: The Genetic Material 291 Table 14.2 DNA Replication Proteins of E. coli Size Molecules Protein Role (kd) per Cell Helicase Primase Single-strand binding protein DNA gyrase DNA polymerase III DNA polymerase I DNA ligase Unwinds the double helix Synthesizes RNA primers Stabilizes single- stranded regions Relieves torque Synthesizes DNA Erases primer and fills gaps Joins the ends of DNA segments 300 60 74 400 ~ ~ 900 103 74 20 50 300 250 20 300 300 FIGURE 14.15 The DNA polymerase III complex.(a) The complex contains 10 kinds of protein chains. The protein is a dimer because both strands of the DNA duplex must be replicated simultaneously. The catalytic (α) subunits, the proofreading (ε) subunits, and the “sliding clamp” (β 2 ) subunits (yellowand blue) are labeled. (b) The “sliding clamp” units encircle the DNA template and (c) move it through the catalytic subunit like a rope drawn through a ring. (a) H9252 2 H9252 2 H9251 H9280H9280 H9251 (c)(b) The Need for a Primer One of the features of DNA polymerase III is that it can add nucleotides only to a chain of nucleotides that is al- ready paired with the parent strands. Hence, DNA poly- merase cannot link the first nucleotides in a newly synthe- sized strand. Instead, another enzyme, an RNA polymerase called primase, constructs an RNA primer, a sequence of about 10 RNA nucleotides complementary to the parent DNA template. DNA polymerase III recognizes the primer and adds DNA nucleotides to it to construct the new DNA strands. The RNA nucleotides in the primers are then re- placed by DNA nucleotides. The Two Strands of DNA Are Assembled in Different Ways Another feature of DNA polymerase III is that it can add nucleotides only to the 3′ end of a DNA strand (the end with an —OH group attached to a 3′ carbon atom). This means that replication always proceeds in the 5′→3′direc- tion on a growing DNA strand. Because the two parent strands of a DNA molecule are antiparallel, the new strands are oriented in opposite directions along the parent templates at each replication fork (figure 14.16). Therefore, the new strands must be elongated by different mechanisms! The leading strand, which elongates toward the replication fork, is built up simply by adding nucleotides continuously to its growing 3′ end. In contrast, the lagging strand, which elongates away from the replication fork, is synthe- sized discontinuously as a series of short segments that are later connected. These segments, called Okazaki frag- ments, are about 100 to 200 nucleotides long in eukaryotes and 1000 to 2000 nucleotides long in prokaryotes. Each Okazaki fragment is synthesized by DNA polymerase III in the 5′→3′ direction, beginning at the replication fork and moving away from it. When the polymerase reaches the 5′ end of the lagging strand, another enzyme, DNA ligase, attaches the fragment to the lagging strand. The DNA is further unwound, new RNA primers are constructed, and DNA polymerase III then jumps ahead 1000 to 2000 nu- cleotides (toward the replication fork) to begin construct- ing another Okazaki fragment. If one looks carefully at electron micrographs showing DNA replication in progress, one can sometimes see that one of the parent strands near the replication fork appears single-stranded over a distance of about 1000 nucleotides. Because the syn- thesis of the leading strand is continuous, while that of the lagging strand is discontinuous, the overall replication of DNA is said to be semidiscontinuous. The Replication Process The replication of the DNA double helix is a complex process that has taken decades of research to understand. It takes place in five interlocking steps: 292 Part V Molecular Genetics 5H11032 5H11032 3H11032 3H11032 Leading strand Lagging strand DNA ligase DNA polymerase I Okazaki fragment RNA primer First subunit of DNA polymerase III Single-strand binding proteins Second subunit of DNA polymerase III Primase Helicase 3H11032 5H11032 Parental DNA helix 3H11032 5H11032 FIGURE 14.16 A DNA replication fork.Helicase enzymes separate the strands of the double helix, and single-strand binding proteins stabilize the single-stranded regions. Replication occurs by two mechanisms. (1) Continuous synthesis:After primase adds a short RNA primer, DNA polymerase III adds nucleotides to the 3′end of the leading strand. DNA polymerase I then replaces the RNA primer with DNA nucleotides. (2) Discontinuous synthesis:Primase adds a short RNA primer (green) ahead of the 5′end of the lagging strand. DNA polymerase III then adds nucleotides to the primer until the gap is filled in. DNA polymerase I replaces the primer with DNA nucleotides, and DNA ligase attaches the short segment of nucleotides to the lagging strand. 1. Opening up the DNA double helix. The very sta- ble DNA double helix must be opened up and its strands separated from each other for semiconserva- tive replication to occur. Stage one: Initiating replication. The binding of ini- tiator proteins to the replication origin starts an in- tricate series of interactions that opens the helix. Stage two: Unwinding the duplex. After initiation, “unwinding” enzymes called helicases bind to and move along one strand, shouldering aside the other strand as they go. Stage three: Stabilizing the single strands. The un- wound portion of the DNA double helix is stabilized by single-strand binding protein, which binds to the exposed single strands, protecting them from cleavage and preventing them from rewinding. Stage four: Relieving the torque generated by unwinding. For replication to proceed at 1000 nucleotides per second, the parental helix ahead of the replication fork must rotate 100 revolutions per second! To re- lieve the resulting twisting, called torque, enzymes known as topisomerases—or, more informally, gy- rases—cleave a strand of the helix, allow it to swivel around the intact strand, and then reseal the broken strand. 2. Building a primer. New DNA cannot be synthe- sized on the exposed templates until a primer is con- structed, as DNA polymerases require 3′ primers to initiate replication. The necessary primer is a short stretch of RNA, added by a specialized RNA poly- merase called primase in a multisubunit complex in- formally called a primosome. Why an RNA primer, rather than DNA? Starting chains on exposed tem- plates introduces many errors; RNA marks this initial stretch as “temporary,” making this error-prone stretch easy to excise later. 3. Assembling complementary strands. Next, the dimeric DNA polymerase III then binds to the repli- cation fork. While the leading strand complexes with one half of the polymerase dimer, the lagging strand is thought to loop around and complex with the other half of the polymerase dimer (figure 14.17). Moving in concert down the parental double helix, DNA polymerase III catalyzes the formation of comple- mentary sequences on each of the two single strands at the same time. 4. Removing the primer. The enzyme DNA poly- merase I now removes the RNA primer and fills in the gap, as well as any gaps between Okazaki frag- ments. 5. Joining the Okazaki fragments. After any gaps between Okazaki fragments are filled in, the enzyme DNA ligase joins the fragments to the lagging strand. DNA replication involves many different proteins that open and unwind the DNA double helix, stabilize the single strands, synthesize RNA primers, assemble new complementary strands on each exposed parental strand—one of them discontinuously—remove the RNA primer, and join new discontinuous segments on the lagging strand. Chapter 14 DNA: The Genetic Material 293 Leading strand Lagging strand DNA polymerase III 3H11032 3H11032 3H11032 5H11032 5H11032 5H11032 RNA primer FIGURE 14.17 How DNA polymerase III works.This diagram presents a current view of how DNA polymerase III works. Note that the DNA on the lagging strand is folded to allow the dimeric DNA polymerase III molecule to replicate both strands of the parental DNA duplex simultaneously. This brings the 3′end of each completed Okazaki fragment close to the start site for the next fragment. Eukaryotic DNA Replication In eukaryotic cells, the DNA is packaged in nucleosomes within chromosomes (figure 14.18). Each individual zone of a chromosome replicates as a discrete section called a replication unit, or replicon, which can vary in length from 10,000 to 1 million base-pairs; most are about 100,000 base-pairs long. Each replication unit has its own origin of replication, and multiple units may be undergo- ing replication at any given time, as can be seen in elec- tron micrographs of replicating chromosomes (figure 14.19). Each unit replicates in a way fundamentally simi- lar to prokaryotic DNA replication, using similar en- zymes. The advantage of having multiple origins of repli- cation in eukaryotes is speed: replication takes approximately eight hours in humans cells, but if there were only one origin, it would take 100 times longer. Regulation of the replication process ensures that only one copy of the DNA is ultimately produced. How a cell achieves this regulation is not yet completely clear. It may involve periodic inhibitor or initiator proteins on the DNA molecule itself. Eukaryotic chromosomes have multiple origins of replication. 294 Part V Molecular Genetics FIGURE 14.18 DNA of a single human chromosome.This chromosome has been “exploded,” or relieved, of most of its packaging proteins. The residual protein scaffolding appears as the dark material in the lower part of the micrograph. 1 2 3 4 Parent strand Daughter strand Point of separation FIGURE 14.19 Eukaryotic chromosomes possess numerous replication forks spaced along their length.Four replication units (each with two replication forks) are producing daughter strands (a) in this electron micrograph, as indicated in redin the (b) corresponding drawing. (a) (b) The One-Gene/One-Polypeptide Hypothesis As the structure of DNA was being solved, other biologists continued to puzzle over how the genes of Mendel were re- lated to DNA. Garrod: Inherited Disorders Can Involve Specific Enzymes In 1902, a British physician, Archibald Garrod, was work- ing with one of the early Mendelian geneticists, his coun- tryman William Bateson, when he noted that certain dis- eases he encountered among his patients seemed to be more prevalent in particular families. By examining sev- eral generations of these families, he found that some of the diseases behaved as if they were the product of simple recessive alleles. Garrod concluded that these disorders were Mendelian traits and that they had resulted from changes in the hereditary information in an ancestor of the affected families. Garrod investigated several of these dis- orders in detail. In alkaptonuria the pa- tients produced urine that contained ho- mogentisic acid (alkapton). This substance oxidized rapidly when exposed to air, turning the urine black. In normal individuals, homogentisic acid is broken down into simpler substances. With considerable insight, Garrod concluded that patients suffering from alkaptonuria lacked the enzyme necessary to catalyze this breakdown. He speculated that many other inherited diseases might also reflect enzyme deficiencies. Beadle and Tatum: Genes Specify Enzymes From Garrod’s finding, it took but a short leap of intu- ition to surmise that the information encoded within the DNA of chromosomes acts to specify particular enzymes. This point was not actually established, however, until 1941, when a series of experiments by Stanford University geneticists George Beadle and Edward Tatum provided definitive evidence on this point. Beadle and Tatum delib- erately set out to create Mendelian mutations in chromo- somes and then studied the effects of these mutations on the organism (figure 14.20). Chapter 14 DNA: The Genetic Material 295 14.4 What is a gene? Wild-type Neurospora Minimal medium Products of one meiosis Select one of the spores Grow on complete medium Minimal control Nucleic acid CholinePyridoxine RiboflavinArginine Minimal media supplemented with: ThiamineFolic acid NiacinInositolp-Amino benzoic acid Test on minimal medium to confirm presence of mutation Growth on complete medium X rays or ultraviolet light Asexual spores Meiosis FIGURE 14.20 Beadle and Tatum’s procedure for isolating nutritional mutants in Neurospora.This fungus grows easily on an artificial medium in test tubes. In this experiment, spores were irradiated to increase the frequency of mutation; they were then placed on a “complete” medium that contained all of the nutrients necessary for growth. Once the fungal colonies were established on the complete medium, individual spores were transferred to a “minimal” medium that lacked various substances the fungus could normally manufacture. Any spore that would not grow on the minimal medium but would grow on the complete medium contained one or more mutations in genes needed to produce the missing nutrients. To determine which gene had mutated, the minimal medium was supplemented with particular substances. The mutation illustrated here produced an arginine mutant, a collection of cells that lost the ability to manufacture arginine. These cells will not grow on minimal medium but will grow on minimal medium with only arginine added. A Defined System. One of the reasons Beadle and Tatum’s experiments produced clear-cut results is that the researchers made an excellent choice of experimental organ- ism. They chose the bread mold Neurospora, a fungus that can be grown readily in the laboratory on a defined medium (a medium that contains only known substances such as glu- cose and sodium chloride, rather than some uncharacterized mixture of substances such as ground-up yeasts). Beadle and Tatum exposed Neurospora spores to X rays, expecting that the DNA in some of the spores would experience damage in regions encoding the ability to make compounds needed for normal growth (see figure 14.20). DNA changes of this kind are called mutations, and organisms that have undergone such changes (in this case losing the ability to synthesize one or more compounds) are called mutants. Initially, they al- lowed the progeny of the irradiated spores to grow on a de- fined medium containing all of the nutrients necessary for growth, so that any growth-deficient mutants resulting from the irradiation would be kept alive. Isolating Growth-Deficient Mutants. To determine whether any of the progeny of the irradiated spores had mutations causing metabolic deficiencies, Beadle and Tatum placed subcultures of individual fungal cells on a “minimal” medium that contained only sugar, ammonia, salts, a few vitamins, and water. Cells that had lost the abil- ity to make other compounds necessary for growth would not survive on such a medium. Using this approach, Beadle and Tatum succeeded in identifying and isolating many growth-deficient mutants. Identifying the Deficiencies. Next the researchers added various chemicals to the minimal medium in an at- tempt to find one that would enable a given mutant strain to grow. This procedure allowed them to pinpoint the na- ture of the biochemical deficiency that strain had. The ad- dition of arginine, for example, permitted several mutant strains, dubbed argmutants, to grow. When their chromo- somal positions were located, the argmutations were found to cluster in three areas (figure 14.21). One-Gene/One-Polypeptide For each enzyme in the arginine biosynthetic pathway, Beadle and Tatum were able to isolate a mutant strain with a defective form of that enzyme, and the mutation was al- ways located at one of a few specific chromosomal sites. Most importantly, they found there was a different site for each enzyme. Thus, each of the mutants they examined had a defect in a single enzyme, caused by a mutation at a single site on one chromosome. Beadle and Tatum concluded that genes produce their effects by specifying the structure of enzymes and that each gene encodes the structure of one enzyme. They called this relationship the one-gene/one- enzyme hypothesis. Because many enzymes contain mul- tiple protein or polypeptide subunits, each encoded by a separate gene, the relationship is today more commonly re- ferred to as “one-gene/one-polypeptide.” Enzymes are responsible for catalyzing the synthesis of all the parts of an organism. They mediate the assembly of nucleic acids, proteins, carbohydrates, and lipids. There- fore, by encoding the structure of enzymes and other pro- teins, DNA specifies the structure of the organism itself. Genetic traits are expressed largely as a result of the activities of enzymes. Organisms store hereditary information by encoding the structures of enzymes and other proteins in their DNA. 296 Part V Molecular Genetics Chromosome Gene cluster 1 Enzyme E Glutamate Ornithine Citruline Arginosuccinate Arginine Enzyme F Enzyme G Enzyme H Encoded enzyme Substrate in biochemical pathway Gene cluster 2 Gene cluster 3 arg-Harg-G arg-F arg-E FIGURE 14.21 Evidence for the “one-gene/one-polypeptide” hypothesis.The chromosomal locations of the many arginine mutants isolated by Beadle and Tatum cluster around three locations. These locations correspond to the locations of the genes encoding the enzymes that carry out arginine biosynthesis. How DNA Encodes Protein Structure What kind of information must a gene encode to specify a protein? For some time, the answer to that question was not clear, as protein structure seemed impossibly complex. Sanger: Proteins Consist of Defined Sequences of Amino Acids The picture changed in 1953, the same year in which Wat- son and Crick unraveled the structure of DNA. That year, the English biochemist Frederick Sanger, after many years of work, announced the complete sequence of amino acids in the protein insulin. Insulin, a small protein hormone, was the first protein for which the amino acid sequence was determined. Sanger’s achievement was extremely signifi- cant because it demonstrated for the first time that proteins consisted of definable sequences of amino acids—for any given form of insulin, every molecule has the same amino acid sequence. Sanger’s work soon led to the sequencing of many other proteins, and it became clear that all enzymes and other proteins are strings of amino acids arranged in a certain definite order. The information needed to specify a protein such as an enzyme, therefore, is an ordered list of amino acids. Ingram: Single Amino Acid Changes in a Protein Can Have Profound Effects Following Sanger’s pioneering work, Vernon Ingram in 1956 discovered the molecular basis of sickle cell anemia, a protein defect inherited as a Mendelian disorder. By ana- lyzing the structures of normal and sickle cell hemoglobin, Ingram, working at Cambridge University, showed that sickle cell anemia is caused by a change from glutamic acid to valine at a single position in the protein (figure 14.22). The alleles of the gene encoding hemoglobin differed only in their specification of this one amino acid in the hemo- globin amino acid chain. These experiments and other related ones have finally brought us to a clear understanding of the unit of heredity. The characteristics of sickle cell anemia and most other hereditary traits are defined by changes in protein structure brought about by an alteration in the sequence of amino acids that make up the protein. This sequence in turn is dictated by the order of nucleotides in a particular region of the chromosome. For example, the critical change lead- ing to sickle cell disease is a mutation that replaces a single thymine with an adenine at the position that codes for glu- tamic acid, converting the position to valine. The sequence of nucleotides that determines the amino acid sequence of a protein is called a gene. Although most genes encode pro- teins or subunits of proteins, some genes are devoted to the production of special forms of RNA, many of which play important roles in protein synthesis themselves. A half-century of experimentation has made clear that DNA is the molecule responsible for the inheritance of traits, and that this molecule is divided into functional units called genes. Chapter 14 DNA: The Genetic Material 297 Normal hemoglobin H9252 chain Valine Histidine Leucine Threonine Proline Glutamic acid Sickle cell anemia hemoglobin H9252 chain Valine Histidine Leucine Threonine Proline Glutamic acid Glutamic acid Valine FIGURE 14.22 The molecular basis of a hereditary disease.Sickle cell anemia is produced by a recessive allele of the gene that encodes the hemoglobin βchains. It represents a change in a single amino acid, from glutamic acid to valine at the sixth position in the chains, which consequently alters the tertiary structure of the hemoglobin molecule, reducing its ability to carry oxygen. 298 Part V Molecular Genetics Chapter 14 Summary Questions Media Resources 14.1 What is the genetic material? ? Eukaryotic cells store hereditary information within the nucleus. ? In viruses, bacteria, and eukaryotes, the hereditary information resides in nucleic acids. The transfer of nucleic acids can lead to the transfer of hereditary traits. ? When radioactively labeled DNA viruses infect bacteria, the DNA but not the protein coat of the viruses enters the bacterial cells, indicating that the hereditary material is DNA rather than protein. 1.In Hammerling’s experiments on Acetabularia,what happened when a stalk from A. crenulata was grafted to a foot from A. mediterranea? 2.How did Hershey and Chase determine which component of bacterial viruses contains the viruses’ hereditary information? ? Chargaff showed that the proportion of adenine in DNA always equals that of thymine, and the proportion of guanine always equals that of cytosine. ? DNA has the structure of a double helix, consisting of two chains of nucleotides held together by hydrogen bonds between adenines and thymines, and between guanines and cytosines. 3.What is the three- dimensional shape of DNA, and how does this shape fit with Chargaff’s observations on the proportions of purines and pyrimidines in DNA? 4.How did Meselson and Stahl show that DNA replication is semiconservative? 14.2 What is the structure of DNA? ? During the S phase of the cell cycle, the hereditary message in DNA is replicated with great accuracy. ? During replication, the DNA duplex is unwound, and two new strands are assembled in opposite directions along the original strands. One strand elongates by the continuous addition of nucleotides to its growing end; the other is constructed by the addition of segments containing 100 to 2000 nucleotides, which are then joined to the end of that strand. 5.How is the leading strand of a DNA duplex replicated? How is the lagging strand replicated? What is the basis for the requirement that the leading and lagging strands be replicated by different mechanisms? 14.3 How does DNA replicate? ? Most hereditary traits reflect the actions of enzymes. ? The traits are hereditary because the information necessary to specify the structure of the enzymes is stored within the DNA. ? Each enzyme is encoded by a specific region of the DNA called a gene. 6.What hypothesis did Beadle and Tatum test in their experiments on Neurospora? What did they do to change the DNA in individuals of this organism? How did they determine whether any of these changes affected enzymes in biosynthetic pathways? 14.4 What is a gene? http://www.mhhe.com/raven6e http://www.biocourse.com ? Experiment: Griffith/Hershey/ Chase-DNA is the Genetic Material ? DNA Structure ? DNA Packaging ? Nucleic Acid ? DNA Structure ? Experiment: Kornbert-Isolating DNA Poly merase ? DNA Replication ? DNA Replication ? Student Research: Microsatellites in Rabbits Experiment ? Meselson-Stahl— DNA Replication is Semiconservative ? Okazaki: DNA Synthesis is Discontinous ? Scientists on Science: The Future of Molecular Biology ? Experiment: Ephrussi/Beadle/ Tatum—Genes Encode Enzymes 299 15 Genes and How They Work Concept Outline 15.1 The Central Dogma traces the flow of gene- encoded information. Cells Use RNA to Make Protein. The information in genes is expressed in two steps, first being transcribed into RNA, and the RNA then being translated into protein. 15.2 Genes encode information in three-nucleotide code words. The Genetic Code. The sequence of amino acids in a protein is encoded in the sequence of nucleotides in DNA, three nucleotides encoding an amino acid. 15.3 Genes are first transcribed, then translated. Transcription. The enzyme RNA polymerase unwinds the DNA helix and synthesizes an RNA copy of one strand. Translation. mRNA is translated by activating enzymes that select tRNAs to match amino acids. Proteins are synthesized on ribosomes, which provide a framework for the interaction of tRNA and mRNA. 15.4 Eukaryotic gene transcripts are spliced. The Discovery of Introns. Eukaryotic genes contain extensive material that is not translated. Differences between Bacterial and Eukaryotic Gene Expression. Gene expression is broadly similar in bacteria and eukaryotes, although it differs in some respects. E very cell in your body contains the hereditary instruc- tions specifying that you will have arms rather than fins, hair rather than feathers, and two eyes rather than one. The color of your eyes, the texture of your fingernails, and all of the other traits you receive from your parents are recorded in the cells of your body. As we have seen, this in- formation is contained in long molecules of DNA (figure 15.1). The essence of heredity is the ability of cells to use the information in their DNA to produce particular pro- teins, thereby affecting what the cells will be like. In that sense, proteins are the tools of heredity. In this chapter, we will examine how proteins are synthesized from the infor- mation in DNA, using both prokaryotes and eukaryotes as models. FIGURE 15.1 The unraveled chromosome of an E. coli bacterium. This com- plex tangle of DNA represents the full set of assembly instructions for the living organism E. coli. These RNA molecules, together with ribosomal proteins and certain enzymes, constitute a system that reads the ge- netic messages encoded by nucleotide sequences in the DNA and produces the polypeptides that those sequences specify. As we will see, biologists have also learned to read these messages. In so doing, they have learned a great deal about what genes are and how they are able to dictate what a protein will be like and when it will be made. The Central Dogma All organisms, from the simplest bacteria to ourselves, use the same basic mechanism of reading and expressing genes, so fundamental to life as we know it that it is often referred to as the “Central Dogma”: Information passes from the genes (DNA) to an RNA copy of the gene, and the RNA copy directs the sequential assembly of a chain of amino acids (figure 15.5). Said briefly, DNA → RNA → protein 300 Part V Molecular Genetics Cells Use RNA to Make Protein To find out how a eukaryotic cell uses its DNA to direct the production of particular proteins, you must first ask where in the cell the proteins are made. We can answer this ques- tion by placing cells in a medium containing radioactively labeled amino acids for a short time. The cells will take up the labeled amino acids and incorporate them into proteins. If we then look to see where in the cells radioactive proteins first appear, we will find that it is not in the nucleus, where the DNA is, but rather in the cytoplasm, on large RNA- protein aggregates called ribosomes (figure 15.2). These polypeptide-making factories are very complex, composed of several RNA molecules and over 50 different proteins (figure 15.3). Protein synthesis involves three different sites on the ribosome surface, called the P, A, and E sites, dis- cussed later in this chapter. Kinds of RNA The class of RNA found in ribosomes is called ribosomal RNA (rRNA). During polypeptide synthesis, rRNA pro- vides the site where polypeptides are assembled. In addition to rRNA, there are two other major classes of RNA in cells. Transfer RNA (tRNA) molecules both transport the amino acids to the ribosome for use in building the polypep- tides and position each amino acid at the correct place on the elongating polypeptide chain (figure 15.4). Human cells contain about 45 different kinds of tRNA molecules. Mes- senger RNA (mRNA) molecules are long strands of RNA that are transcribed from DNA and that travel to the ribo- somes to direct precisely which amino acids are assembled into polypeptides. 15.1 The Central Dogma traces the flow of gene-encoded information. Small subunit Large subunit Large ribosomal subunit E site P site A site mRNA binding site Small ribosomal subunit EPA FIGURE 15.2 A ribosome is composed of two subunits. The smaller subunit fits into a depression on the surface of the larger one. The A, P, and E sites on the ribosome, discussed later in this chapter, play key roles in protein synthesis. FIGURE 15.3 Ribosomes are very complex machines. The complete atomic structure of a bacterial large ribosomal subunit has been determined at 2.4 ? resolution. The RNA of the subunit is shown in gray and the proteins in gold. The subunit’s RNA is twisted into irregular shapes that fit together like a three-dimensional jigsaw puzzle. Proteins are abundant everywhere on its surface except where peptide bonds form and where it contacts the small subunit. The proteins stabilize the structure by interacting with adjacent RNA strands, often with folded extensions that reach into the subunit’s interior. Transcription: An Overview The first step of the Central Dogma is the transfer of infor- mation from DNA to RNA, which occurs when an mRNA copy of the gene is produced. Like all classes of RNA, mRNA is formed on a DNA template. Because the DNA sequence in the gene is transcribed into an RNA sequence, this stage is called transcription. Transcription is initiated when the enzyme RNA polymerase binds to a particular binding site called a promoter located at the beginning of a gene. Starting there, the RNA polymerase moves along the strand into the gene. As it encounters each DNA nucleotide, it adds the corresponding complementary RNA nucleotide to a growing mRNA strand. Thus, guanine (G), cytosine (C), thymine (T), and adenine (A) in the DNA would signal the addition of C, G, A, and uracil (U), respectively, to the mRNA. When the RNA polymerase arrives at a transcriptional “stop” signal at the opposite end of the gene, it disengages from the DNA and releases the newly assembled RNA chain. This chain is a complementary transcript of the gene from which it was copied. Translation: An Overview The second step of the Central Dogma is the transfer of information from RNA to protein, which occurs when the information contained in the mRNA transcript is used to direct the sequence of amino acids during the synthesis of polypeptides by ribosomes. This process is called translation because the nucleotide sequence of the mRNA transcript is translated into an amino acid se- quence in the polypeptide. Translation begins when an rRNA molecule within the ribosome recognizes and binds to a “start” sequence on the mRNA. The ribosome then moves along the mRNA molecule, three nucleotides at a time. Each group of three nucleotides is a codeword that specifies which amino acid will be added to the growing polypeptide chain. The ribosome continues in this fashion until it encounters a translational “stop” sig- nal; then it disengages from the mRNA and releases the completed polypeptide. The two steps of the Central Dogma, taken together, are a concise summary of the events involved in the expres- sion of an active gene. Biologists refer to this process as gene expression. The information encoded in genes is expressed in two phases: transcription, in which an RNA polymerase enzyme assembles an mRNA molecule whose nucleotide sequence is complementary to the DNA nucleotide sequence of the gene; and translation, in which a ribosome assembles a polypeptide, whose amino acid sequence is specified by the nucleotide sequence in the mRNA. Chapter 15 Genes and How They Work 301 OH Amino acid attaches here Anticodon Anticodon (a) (b) 5H11541 5H11541 3H11541 3H11541 FIGURE 15.4 The structure of tRNA. (a) In the two-dimensional schematic, the three loops of tRNA are unfolded. Two of the loops bind to the ribosome during polypeptide synthesis, and the third loop contains the anticodon sequence, which is complementary to a three-base sequence on messenger RNA. Amino acids attach to the free, single-stranded —OH end. (b) In the three-dimensional structure, the loops of tRNA are folded. DNA Transcription Translation Protein mRNA FIGURE 15.5 The Central Dogma of gene expression. DNA is transcribed to make mRNA, which is translated to make a protein. The Genetic Code The essential question of gene expression is, “How does the order of nucleotides in a DNA molecule encode the in- formation that specifies the order of amino acids in a polypeptide?” The answer came in 1961, through an exper- iment led by Francis Crick. That experiment was so elegant and the result so critical to understanding the genetic code that we will describe it in detail. Proving Code Words Have Only Three Letters Crick and his colleagues reasoned that the genetic code most likely consisted of a series of blocks of information called codons, each corresponding to an amino acid in the encoded protein. They further hypothesized that the infor- mation within one codon was probably a sequence of three nucleotides specifying a particular amino acid. They ar- rived at the number three, because a two-nucleotide codon would not yield enough combinations to code for the 20 different amino acids that commonly occur in proteins. With four DNA nucleotides (G, C, T, and A), only 4 2 , or 16, different pairs of nucleotides could be formed. How- ever, these same nucleotides can be arranged in 4 3 , or 64, different combinations of three, more than enough to code for the 20 amino acids. In theory, the codons in a gene could lie immediately adjacent to each other, forming a continuous sequence of transcribed nucleotides. Alternatively, the sequence could be punctuated with untranscribed nucleotides between the codons, like the spaces that separate the words in this sen- tence. It was important to determine which method cells employ because these two ways of transcribing DNA imply different translating processes. To choose between these alternative mechanisms, Crick and his colleagues used a chemical to delete one, two, or three nucleotides from a viral DNA molecule and then asked whether a gene downstream of the deletions was transcribed correctly. When they made a single deletion or two deletions near each other, the reading frame of the genetic message shifted, and the downstream gene was transcribed as nonsense. However, when they made three deletions, the correct reading frame was restored, and the sequences downstream were transcribed correctly. They obtained the same results when they made additions to the DNA consisting of one, two, or three nucleotides. As shown in figure 15.6, these results could not have been ob- tained if the codons were punctuated by untranscribed nu- cleotides. Thus, Crick and his colleagues concluded that the genetic code is read in increments consisting of three nucleotides (in other words, it is a triplet code) and that reading occurs continuously without punctuation between the three-nucleotide units. Breaking the Genetic Code Within a year of Crick’s experiment, other researchers suc- ceeded in determining the amino acids specified by particular three-nucleotide units. Marshall Nirenberg discovered in 1961 that adding the synthetic mRNA molecule polyU (an RNA molecule consisting of a string of uracil nucleotides) to cell-free systems resulted in the production of the polypep- tide polyphenylalanine (a string of phenylalanine amino acids). Therefore, one of the three-nucleotide sequences specifying phenylalanine is UUU. In 1964, Nirenberg and Philip Leder developed a powerful triplet binding assay in which a specific triplet was tested to see which radioactive amino acid (complexed to tRNA) it would bind. Some 47 of the 64 possible triplets gave unambiguous results. Har Gob- ind Khorana decoded the remaining 17 triplets by construct- ing artificial mRNA molecules of defined sequence and ex- amining what polypeptides they directed. In these ways, all 64 possible three-nucleotide sequences were tested, and the full genetic code was determined (table 15.1). 302 Part V Molecular Genetics 15.2 Genes encode information in three-nucleotide code words. (Nonsense) (Nonsense) Hypothesis A : unpunctuated Delete 1 base Delete T WHYDIDTHEREDBATEATTHEFATRAT? WHYODIDOTHEOREDOBATOEATOTHEOFATORAT? WHY DID HER EDB ATE ATT HEF ATR AT? (Sense) Hypothesis A : unpunctuated Delete 3 bases Delete T,R,and A WHYDIDTHEREDBATEATTHEFATRAT? WHY DID HEE DBT EAT THE FAT RAT? (Nonsense) Hypothesis B : punctuated Delete T WHY DID HEO EDO ATO ATO HEO ATO AT? O O R B E T F R WHYODIDOTHEOREDOBATOEATOTHEOFATORAT? (Nonsense) Hypothesis B : punctuated Delete T,R,and A WHY DID HEO DOB OEA OTH OFA ORA? O O E T T E T T FIGURE 15.6 Using frame-shift alterations of DNA to determine if the genetic code is punctuated. The hypothetical genetic message presented here is “Why did the red bat eat the fat rat?” Under hypothesis B, which proposes that the message is punctuated, the three-letter words are separated by nucleotides that are not read (indicated by the letter “O”). The Code Is Practically Universal The genetic code is the same in almost all organisms. For example, the codon AGA specifies the amino acid arginine in bacteria, in humans, and in all other organisms whose genetic code has been studied. The universality of the ge- netic code is among the strongest evidence that all living things share a common evolutionary heritage. Because the code is universal, genes transcribed from one organism can be translated in another; the mRNA is fully able to dictate a functionally active protein. Similarly, genes can be trans- ferred from one organism to another and be successfully transcribed and translated in their new host. This univer- sality of gene expression is central to many of the advances of genetic engineering. Many commercial products such as the insulin used to treat diabetes are now manufactured by placing human genes into bacteria, which then serve as tiny factories to turn out prodigious quantities of insulin. But Not Quite In 1979, investigators began to determine the complete nucleotide sequences of the mitochondrial genomes in humans, cattle, and mice. It came as something of a shock when these investigators learned that the genetic code used by these mammalian mitochondria was not quite the same as the “universal code” that has become so familiar to biologists. In the mitochondrial genomes, what should have been a “stop” codon, UGA, was instead read as the amino acid tryptophan; AUA was read as methionine rather than isoleucine; and AGA and AGG were read as “stop” rather than arginine. Furthermore, minor differ- ences from the universal code have also been found in the genomes of chloroplasts and ciliates (certain types of protists). Thus, it appears that the genetic code is not quite uni- versal. Some time ago, presumably after they began their endosymbiotic existence, mitochondria and chloroplasts began to read the code differently, particularly the portion of the code associated with “stop” signals. Within genes that encode proteins, the nucleotide sequence of DNA is read in blocks of three consecutive nucleotides, without punctuation between the blocks. Each block, or codon, codes for one amino acid. Chapter 15 Genes and How They Work 303 Table 15.1 The Genetic Code Second Letter First Third Letter U C A G Letter U C A G Phenylalanine Leucine Leucine Isoleucine Methionine; Start Valine Serine Proline Threonine Alanine Tyrosine Stop Stop Histidine Glutamine Asparagine Lysine Aspartate Glutamate Cysteine Stop Tryptophan Arginine Serine Arginine Glycine U C A G U C A G U C A G U C A G A codon consists of three nucleotides read in the sequence shown. For example, ACU codes for threonine. The first letter, A, is in the First Letter column; the second letter, C, is in the Second Letter column; and the third letter, U, is in the Third Letter column. Each of the mRNA codons is recognized by a corresponding anticodon sequence on a tRNA molecule. Some tRNA molecules recognize more than one codon in mRNA, but they always code for the same amino acid. In fact, most amino acids are specified by more than one codon. For example, threonine is specified by four codons, which differ only in the third nucleotide (ACU, ACC, ACA, and ACG). UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG UGU UGC UGA UGG CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Transcription The first step in gene expression is the production of an RNA copy of the DNA sequence encoding the gene, a process called transcription. To understand the mecha- nism behind the transcription process, it is useful to focus first on RNA polymerase, the remarkable enzyme responsi- ble for carrying it out (figure 15.7). RNA Polymerase RNA polymerase is best understood in bacteria. Bacterial RNA polymerase is very large and complex, consisting of five subunits: two α subunits bind regulatory proteins, a β′ subunit binds the DNA template, a β subunit binds RNA nucleoside subunits, and a σ subunit recognizes the promoter and initiates synthesis. Only one of the two strands of DNA, called the template strand, is tran- scribed. The RNA transcript’s sequence is complemen- tary to the template strand. The strand of DNA that is not transcribed is called the coding strand. It has the same sequence as the RNA transcript, except T takes the place of U. The coding strand is also known as the sense (+) strand, and the template strand as the antisense (–) strand. In both bacteria and eukaryotes, the polymerase adds ri- bonucleotides to the growing 3′ end of an RNA chain. No primer is needed, and synthesis proceeds in the 5′→3′ di- rection. Bacteria contain only one RNA polymerase en- zyme, while eukaryotes have three different RNA poly- merases: RNA polymerase I synthesizes rRNA in the nucleolus; RNA polymerase II synthesizes mRNA; and RNA polymerase III synthesizes tRNA. Promoter Transcription starts at RNA polymerase binding sites called promoters on the DNA template strand. A pro- moter is a short sequence that is not itself transcribed by the polymerase that binds to it. Striking similarities are evi- dent in the sequences of different promoters. For example, two six-base sequences are common to many bacterial pro- moters, a TTGACA sequence called the –35 sequence, lo- cated 35 nucleotides upstream of the position where tran- scription actually starts, and a TATAAT sequence called the –10 sequence, located 10 nucleotides upstream of the start site. In eukaryotic DNA, the sequence TATAAA, called the TATA box, is located at –25 and is very similar to the prokaryotic –10 sequence but is farther from the start site. Promoters differ widely in efficiency. Strong promoters cause frequent initiations of transcription, as often as every 2 seconds in some bacteria. Weak promoters may tran- scribe only once every 10 minutes. Most strong promoters have unaltered –35 and –10 sequences, while weak promot- ers often have substitutions within these sites. Initiation The binding of RNA polymerase to the promoter is the first step in gene transcription. In bacteria, a subunit of RNA polymerase called σ (sigma) recognizes the –10 se- quence in the promoter and binds RNA polymerase there. Importantly, this subunit can detect the –10 sequence with- out unwinding the DNA double helix. In eukaryotes, the –25 sequence plays a similar role in initiating transcription, as it is the binding site for a key protein factor. Other eu- karyotic factors then bind one after another, assembling a large and complicated transcription complex. The eu- karyotic transcription complex is described in detail in the following chapter. Once bound to the promoter, the RNA polymerase be- gins to unwind the DNA helix. Measurements indicate that bacterial RNA polymerase unwinds a segment approxi- mately 17 base-pairs long, nearly two turns of the DNA double helix. This sets the stage for the assembly of the RNA chain. Elongation The transcription of the RNA chain usually starts with ATP or GTP. One of these forms the 5′ end of the chain, which grows in the 5′→3′ direction as ribonucleotides are added. Unlike DNA synthesis, a primer is not required. The region containing the RNA polymerase, DNA, and growing RNA transcript is called the transcription bubble because it contains a locally unwound “bubble” of DNA (figure 15.8). Within the bubble, the first 12 bases of the 304 Part V Molecular Genetics 15.3 Genes are first transcribed, then translated. FIGURE 15.7 RNA polymerase. In this electron micrograph, the dark circles are RNA polymerase molecules bound to several promoter sites on bacterial virus DNA. newly synthesized RNA strand temporarily form a helix with the template DNA strand. Corresponding to not quite one turn of the helix, this stabilizes the positioning of the 3′ end of the RNA so it can interact with an incoming ribonu- cleotide. The RNA-DNA hybrid helix rotates each time a nucleotide is added so that the 3′ end of the RNA stays at the catalytic site. The transcription bubble moves down the DNA at a constant rate, about 50 nucleotides per second, leaving the growing RNA strand protruding from the bubble. After the transcription bubble passes, the now transcribed DNA is rewound as it leaves the bubble. Unlike DNA polymerase, RNA polymerase has no proofreading capability. Transcription thus produces many more copying errors than replication. These mistakes, however, are not transmitted to progeny. Most genes are transcribed many times, so a few faulty copies are not harmful. Termination At the end of a gene are “stop” sequences that cause the formation of phosphodiester bonds to cease, the RNA- DNA hybrid within the transcription bubble to dissociate, the RNA polymerase to release the DNA, and the DNA within the transcription bubble to rewind. The simplest stop signal is a series of GC base-pairs followed by a series of AT base-pairs. The RNA transcript of this stop region forms a GC hairpin (figure 15.9), followed by four or more U ribonucleotides. How does this structure terminate tran- scription? The hairpin causes the RNA polymerase to pause immediately after the polymerase has synthesized it, placing the polymerase directly over the run of four uracils. The pairing of U with DNA’s A is the weakest of the four hybrid base-pairs and is not strong enough to hold the hy- brid strands together during the long pause. Instead, the RNA strand dissociates from the DNA within the tran- scription bubble, and transcription stops. A variety of pro- tein factors aid hairpin loops in terminating transcription of particular genes. Posttranscriptional Modifications In eukaryotes, every mRNA transcript must travel a long journey out from the nucleus into the cytoplasm before it can be translated. Eukaryotic mRNA transcripts are modi- fied in several ways to aid this journey: 5′ caps. Transcripts usually begin with A or G, and, in eukaryotes, the terminal phosphate of the 5′ A or G is removed, and then a very unusual 5′-5′ linkage forms with GTP. Called a 5′ cap, this structure protects the 5′ end of the RNA template from nucleases and phos- phatases during its long journey through the cytoplasm. Without these caps, RNA transcripts are rapidly de- graded. 3′ poly-A tails. The 3′ end of eukaryotic transcript is cleaved off at a specific site, often containing the se- quence AAUAAA. A special poly-A polymerase enzyme then adds about 250 A ribonucleotides to the 3′ end of the transcript. Called a 3′ poly-A tail, this long string of As protects the transcript from degradation by nucleases. It also appears to make the transcript a better template for protein synthesis. Transcription is carried out by the enzyme RNA polymerase, aided in eukaryotes by many other proteins. Chapter 15 Genes and How They Work 305 FIGURE 15.8 Model of a transcription bubble. The DNA duplex unwinds as it enters the RNA polymerase complex and rewinds as it leaves. One of the strands of DNA functions as a template, and nucleotide building blocks are assembled into RNA from this template. Template strand Rewinding mRNA RNA-DNA hybrid helix RNA polymerase Unwinding Coding strand DNA 5H11541 5H11541 3H11541 3H11541 5H11541 3H11541 C C C C C C C C C C C C G G G G G G G G G G G G A A A A A A A A A A A A A A A T T T T T T T T T T T T U U U C C A U G C C G C G G C C G U U U OH3H11032 5H11032 G U G U C G C FIGURE 15.9 A GC hairpin. This structure stops gene transcription. Translation In prokaryotes, translation begins when the initial portion of an mRNA molecule binds to an rRNA molecule in a ri- bosome. The mRNA lies on the ribosome in such a way that only one of its codons is exposed at the polypeptide- making site at any time. A tRNA molecule possessing the complementary three-nucleotide sequence, or anticodon, binds to the exposed codon on the mRNA. Because this tRNA molecule carries a particular amino acid, that amino acid and no other is added to the polypep- tide in that position. As the mRNA molecule moves through the ribosome, successive codons on the mRNA are exposed, and a series of tRNA molecules bind one after an- other to the exposed codons. Each of these tRNA mole- cules carries an attached amino acid, which it adds to the end of the growing polypeptide chain (figure 15.10). There are about 45 different kinds of tRNA molecules. Why are there 45 and not 64 tRNAs (one for each codon)? Because the third base-pair of a tRNA anticodon allows some “wobble,” some tRNAs recognize more than one codon. How do particular amino acids become associated with particular tRNA molecules? The key translation step, which pairs the three-nucleotide sequences with appropri- ate amino acids, is carried out by a remarkable set of en- zymes called activating enzymes. Activating Enzymes Particular tRNA molecules become attached to specific amino acids through the action of activating enzymes called aminoacyl-tRNA synthetases, one of which exists for each of the 20 common amino acids (figure 15.11). Therefore, these enzymes must correspond to specific an- ticodon sequences on a tRNA molecule as well as particu- lar amino acids. Some activating enzymes correspond to only one anticodon and thus only one tRNA molecule. Others recognize two, three, four, or six different tRNA molecules, each with a different anticodon but coding for the same amino acid (see table 15.1). If one considers the nucleotide sequence of mRNA a coded message, then the 20 activating enzymes are responsible for decoding that message. “Start” and “Stop” Signals There is no tRNA with an anticodon complementary to three of the 64 codons: UAA, UAG, and UGA. These codons, called nonsense codons, serve as “stop” signals in the mRNA message, marking the end of a polypeptide. The “start” signal that marks the beginning of a polypep- tide within an mRNA message is the codon AUG, which also encodes the amino acid methionine. The ribosome will usually use the first AUG that it encounters in the mRNA to signal the start of translation. Initiation In prokaryotes, polypeptide synthesis begins with the for- mation of an initiation complex. First, a tRNA molecule carrying a chemically modified methionine called N- formylmethionine (tRNA fMet ) binds to the small ribosomal subunit. Proteins called initiation factors position the tRNA fMet on the ribosomal surface at the P site (for pep- tidyl), where peptide bonds will form. Nearby, two other sites will form: the A site (for aminoacyl), where successive amino acid-bearing tRNAs will bind, and the E site (for exit), where empty tRNAs will exit the ribosome (figure 15.12). This initiation complex, guided by another initia- tion factor, then binds to the anticodon AUG on the mRNA. Proper positioning of the mRNA is critical because it determines the reading frame—that is, which groups of three nucleotides will be read as codons. Moreover, the complex must bind to the beginning of the mRNA mole- cule, so that all of the transcribed gene will be translated. In bacteria, the beginning of each mRNA molecule is marked by a leader sequence complementary to one of the rRNA molecules on the ribosome. This complementarity ensures that the mRNA is read from the beginning. Bacte- ria often include several genes within a single mRNA tran- script (polycistronic mRNA), while each eukaryotic gene is transcribed on a separate mRNA (monocistronic mRNA). 306 Part V Molecular Genetics Ribosomes RNA polymerase DNA Polyribosome mRNA FIGURE 15.10 Translation in action. Bacteria have no nucleus and hence no membrane barrier between the DNA and the cytoplasm. In this electron micrograph of genes being transcribed in the bacterium Escherichia coli, you can see every stage of the process. The arrows point to RNA polymerase enzymes. From each mRNA molecule dangling from the DNA, a series of ribosomes is assembling polypeptides. These clumps of ribosomes are sometimes called “polyribosomes.” Initiation in eukaryotes is similar, although it differs in two important ways. First, in eukaryotes, the initiating amino acid is methionine rather than N-formylmethionine. Second, the initiation complex is far more complicated than in bacteria, containing nine or more protein factors, many consisting of several subunits. Eukaryotic initiation complexes are discussed in detail in the following chapter. Elongation After the initiation complex has formed, the large ribosome subunit binds, exposing the mRNA codon adjacent to the initiating AUG codon, and so positioning it for interaction with another amino acid-bearing tRNA molecule. When a tRNA molecule with the appropriate anticodon appears, proteins called elongation factors assist in binding it to the exposed mRNA codon at the A site. When the second tRNA binds to the ribosome, it places its amino acid di- rectly adjacent to the initial methionine, which is still at- tached to its tRNA molecule, which in turn is still bound to the ribosome. The two amino acids undergo a chemical re- action, catalyzed by peptidyl transferase, which releases the initial methionine from its tRNA and attaches it instead by a peptide bond to the second amino acid. Chapter 15 Genes and How They Work 307 Activating enzyme Anticodon tRNA Trp Tryptophan attached to tRNA Trp tRNA Trp binds to UGG codon of mRNA Trp Trp Trp mRNA ACC A C C UGG CO = OH OH CO = H 2 O O CO = O FIGURE 15.11 Activating enzymes “read” the genetic code. Each kind of activating enzyme recognizes and binds to a specific amino acid, such as tryptophan; it also recognizes and binds to the tRNA molecules with anticodons specifying that amino acid, such as ACC for tryptophan. In this way, activating enzymes link the tRNA molecules to specific amino acids. fMet fMet fMet fMet tRNA fMet Leader sequence mRNA Small ribosomal subunit (containing ribosomal RNA) Initiation factor Initiation factor Initiation complex mRNA Large ribosomal subunit E site P site A site 5H11541 3H11541 U U A C A G U U A C U A C U A C A G U A G U A G FIGURE 15.12 Formation of the initiation complex. In prokaryotes, proteins called initiation factors play key roles in positioning the small ribosomal subunit and the N-formylmethionine, or tRNA fMet , molecule at the beginning of the mRNA. When the tRNA fMet is positioned over the first AUG codon of the mRNA, the large ribosomal subunit binds, forming the P, A, and E sites where successive tRNA molecules bind to the ribosomes, and polypeptide synthesis begins. Translocation In a process called translocation (figure 15.13), the ribo- some now moves (translocates) three more nucleotides along the mRNA molecule in the 5′ → 3′ direction, guided by other elongation factors. This movement relocates the initial tRNA to the E site and ejects it from the ribosome, repositions the growing polypeptide chain (at this point containing two amino acids) to the P site, and exposes the next codon on the mRNA at the A site. When a tRNA molecule recognizing that codon appears, it binds to the codon at the A site, placing its amino acid adjacent to the growing chain. The chain then transfers to the new amino acid, and the entire process is repeated. Termination Elongation continues in this fashion until a chain-terminating nonsense codon is exposed (for example, UAA in figure 15.14). Nonsense codons do not bind to tRNA, but they are recognized by release factors, proteins that release the newly made polypeptide from the ribosome. The first step in protein synthesis is the formation of an initiation complex. Each step of the ribosome’s progress exposes a codon, to which a tRNA molecule with the complementary anticodon binds. The amino acid carried by each tRNA molecule is added to the end of the growing polypeptide chain. 308 Part V Molecular Genetics Elongation factor Leu Leu Leu Leu tRNA fMet fMet fMet fMet P site E site A site mRNA 5H11541 5H11541 5H11541 5H115413H11541 3H11541 3H11541 3H11541 U UA A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U UG G G U U A A A A C C C A U U G G G FIGURE 15.13 Translocation. The initiating tRNA fMet in prokaryotes (tRNA fMet in eukaryotes) occupies the P site, and a tRNA molecule with an anticodon complementary to the exposed mRNA codon binds at the A site. fMet is transferred to the incoming amino acid (Leu), as the ribosome moves three nucleotides to the right along the mRNA. The empty tRNA fMet moves to the E site to exit the ribosome, the growing polypeptide chain moves to the P site, and the A site is again exposed and ready to bind the next amino acid–laden tRNA. Val Val Ser Ser Ala Ala Trp Trp Release factor P site E site A site mRNA Polypeptide chain released tRNA Large ribosomal subunit Small ribosomal subunit A C C A AA CC U UGG A AA CC U UGG 5H11541 5H11541 3H11541 3H11541 tRNA FIGURE 15.14 Termination of protein synthesis. There is no tRNA with an anticodon complementary to any of the three termination signal codons, such as the UAA nonsense codon illustrated here. When a ribosome encounters a termination codon, it therefore stops translocating. A specific release factor facilitates the release of the polypeptide chain by breaking the covalent bond that links the polypeptide to the P-site tRNA. The Discovery of Introns While the mechanisms of protein synthesis are similar in bacteria and eukaryotes, they are not identical. One differ- ence is of particular importance. Unlike bacterial genes, most eukaryotic genes are larger than they need to be to produce the polypeptides they code for. Such genes contain long sequences of nucleotides, known as introns, that do not code for any portion of the polypeptide specified by the gene. Introns are inserted between exons, much shorter se- quences in the gene that do code for portions of the polypeptide. In bacteria, virtually every nucleotide within a bacterial gene transcript is part of an amino acid–specifying codon. Scientists assumed for many years that this was true of all organisms. In the late 1970s, however, biologists were amazed to discover that many of the characteristics of prokaryotic gene expression did not apply to eukaryotes. In particular, they found that eukaryotic proteins are encoded by RNA segments that are excised from several locations along what is called the primary RNA transcript (or pri- mary transcript) and then spliced together to form the mRNA that is eventually translated in the cytoplasm. The experiment that revealed this unexpected mode of gene ex- pression consisted of several steps: 1. The mRNA transcribed from a particular gene was isolated and purified. For example, ovalbumin mRNA could be obtained fairly easily from unfertilized eggs. 2. Molecules of DNA complementary to the isolated mRNA were synthesized with the enzyme reverse transcriptase. These DNA molecules, which are called “copy” DNA (cDNA), had the same nucleotide sequence as the template strand of the gene that pro- duced the mRNA. 3. With genetic engineering techniques (chapter 19), the portion of the nuclear DNA containing the gene that produced the mRNA was isolated. This proce- dure is referred to as cloning the gene in question. 4. Single-stranded forms of the cDNA and the nuclear DNA were mixed and allowed to pair with each other (to hybridize). When the researchers examined the resulting hybrid DNA molecules with an electron microscope, they found that the DNA did not appear as a single duplex. Instead, they observed unpaired loops. In the case of the ovalbu- min gene, they discovered seven loops, corresponding to sites where the nuclear DNA contained long nucleotide sequences not present in the cDNA. The conclusion was inescapable: nucleotide sequences must have been re- moved from the gene transcript before it appeared as cy- toplasmic mRNA. These removed sequences are introns, and the remaining sequences are exons (figure 15.15). Because introns are excised from the RNA transcript be- fore it is translated into protein, they do not affect the structure of the protein encoded by the gene in which they occur. Chapter 15 Genes and How They Work 309 15.4 Eukaryotic gene transcripts are spliced. (c) (a) DNA Primary RNA transcript Mature mRNA transcript 5H11032 cap Intron Exon mRNA DNA 1 2 3 4 5 6 7 Exon (coding region) Intron (noncoding region) 123 4 567 Transcription Introns are cut out and coding regions are spliced together 3H11032 poly-A tail (b) FIGURE 15.15 The eukaryotic gene that codes for ovalbumin in eggs contains introns. (a) The ovalbumin gene and its primary RNA transcript contain seven segments not present in the mRNA the ribosomes use to direct protein synthesis. Enzymes cut these segments (introns) out and splice together the remaining segments (exons). (b) The seven loops are the seven introns represented in the schematic drawing (c) of the mature mRNA transcript hybridized to DNA. RNA Splicing When a gene is transcribed, the primary RNA transcript (that is, the gene copy as it is made by RNA polymerase, be- fore any modification occurs) contains sequences comple- mentary to the entire gene, including introns as well as exons. However, in a process called RNA processing, or splicing, the intron sequences are cut out of the primary transcript before it is used in polypeptide synthesis; there- fore, those sequences are not translated. The remaining se- quences, which correspond to the exons, are spliced to- gether to form the final, “processed” mRNA molecule that is translated. In a typical human gene, the introns can be 10 to 30 times larger than the exons. For example, even though only 432 nucleotides are required to encode the 144 amino acids of hemoglobin, there are actually 1356 nucleotides in the primary mRNA transcript of the hemoglobin gene. Fig- ure 15.16 summarizes eukaryotic protein synthesis. Much of a eukaryotic gene is not translated. Noncoding segments scattered throughout the gene are removed from the primary transcript before the mRNA is translated. 310 Part V Molecular Genetics DNA Nucleus Primary RNA transcript RNA polymerase 5H11541 5H11541 5H11541 5H11541 5H11541 3H11541 3H11541 3H11541 3H11541 3H11541 Nuclear membrane Small ribosomal subunit Large ribosomal subunit Cap Cytoplasm mRNA Nuclear pore Poly-A tail Ribosome Codon Anticodon tRNA Amino acids Cytoplasm tRNA A site P site E site Completed polypeptide chain mRNA Growing peptide chain In the cell nucleus, RNA polymerase transcribes RNA from DNA. mRNA is transported out of the nucleus. In the cytoplasm, ribosomal subunits bind to the mRNA. tRNA molecules become attached to specific amino acids with the help of activating enzymes. Amino acids are brought to the ribosome in the order directed by the mRNA. tRNAs bring their amino acids in at the A site on the ribosome. Peptide bonds form between amino acids at the P site, and tRNAs exit the ribosome from the E site. The polypeptide chain grows until the protein is completed. 5H11541 3H11541 Primary RNA transcript Introns Exons mRNA Introns are excised from the RNA transcript, and the remaining exons are spliced together, producing mRNA. 12 3 5 4 6 Poly-A tail Cap FIGURE 15.16 An overview of gene expression in eukaryotes. Differences between Bacterial and Eukaryotic Gene Expression 1. Most eukaryotic genes possess introns. With the ex- ception of a few genes in the Archaebacteria, prokary- otic genes lack introns (figure 15.17). 2. Individual bacterial mRNA molecules often contain transcripts of several genes. By placing genes with re- lated functions on the same mRNA, bacteria coordi- nate the regulation of those functions. Eukaryotic mRNA molecules rarely contain transcripts of more than one gene. Regulation of eukaryotic gene expres- sion is achieved in other ways. 3. Because eukaryotes possess a nucleus, their mRNA molecules must be completely formed and must pass across the nuclear membrane before they are trans- lated. Bacteria, which lack nuclei, often begin transla- tion of an mRNA molecule before its transcription is completed. 4. In bacteria, translation begins at an AUG codon pre- ceded by a special nucleotide sequence. In eukaryotic cells, mRNA molecules are modified at the 5′ leading end after transcription, adding a 5′ cap, a methylated guanosine triphosphate. The cap initiates translation by binding the mRNA, usually at the first AUG, to the small ribosomal subunit. 5. Eukaryotic mRNA molecules are modified before they are translated: introns are cut out, and the re- maining exons are spliced together; a 5′ cap is added; and a 3′ poly-A tail consisting of some 200 adenine (A) nucleotides is added. These modifica- tions can delay the destruction of the mRNA by cel- lular enzymes. 6. The ribosomes of eukaryotes are a little larger than those of bacteria. Gene expression is broadly similar in bacteria and eukaryotes, although it differs in some details. Chapter 15 Genes and How They Work 311 Bacterial chromosome mRNA Protein Cell wall Cell membrane Translation Transcription Chromosome Nuclear pore Nuclear envelope mRNA Intron DNA Primary RNA transcript Protein Plasma membrane Translation Transcription Processing 5H11032 3H11032 Cap Poly-A tail FIGURE 15.17 Gene information is processed differently in prokaryotes and eukaryotes. (a) Bacterial genes are transcribed into mRNA, which is translated immediately. Hence, the sequence of DNA nucleotides corresponds exactly to the sequence of amino acids in the encoded polypeptide. (b) Eukaryotic genes are typically different, containing long stretches of nucleotides called introns that do not correspond to amino acids within the encoded polypeptide. Introns are removed from the primary RNA transcript of the gene and a 5′ cap and 3′ poly-A tail are added before the mRNA directs the synthesis of the polypeptide. (a) (b) 312 Part V Molecular Genetics Chapter 15 Summary Questions Media Resources 15.1 The Central Dogma traces the flow of gene-encoded information. ? There are three principal kinds of RNA: messenger RNA (mRNA), transcripts of genes used to direct the assembly of amino acids into proteins; ribosomal RNA (rRNA), which combines with proteins to make up the ribosomes that carry out the assembly process; and transfer RNA (tRNA), molecules that transport the amino acids to the ribosome for assembly into proteins. 1. What are the three major classes of RNA? What is the function of each type? 2. What is the function of RNA polymerase in transcription? What determines where RNA polymerase begins and ends its function? ? The sequence of nucleotides in DNA encodes the sequence of amino acids in proteins. The mRNA transcribed from the DNA is read by ribosomes in increments of three nucleotides called codons. 3. How did Crick and his colleagues determine how many nucleotides are used to specify each amino acid? What is an anticodon? 15.2 Genes encode information in three-nucleotide code words. ? During transcription, the enzyme RNA polymerase manufactures mRNA molecules with nucleotide sequences complementary to particular segments of the DNA. ? During translation, the mRNA sequences direct the assembly of amino acids into proteins on cytoplasmic ribosomes. ? The information in a gene and in an mRNA molecule is read in three-nucleotide blocks called codons. ? On the ribosome, the mRNA molecule is positioned so that only one of its codons is exposed at any time. ? This exposure permits a tRNA molecule with the complementary base sequence (anticodon) to bind to it. ? Attached to the other end of the tRNA is an amino acid, which is added to the end of the growing polypeptide chain. 4. During protein synthesis, what mechanism ensures that only one amino acid is added to the growing polypeptide at a time? What mechanism ensures the correct amino acid is added at each position in the polypeptide? 5. How does an mRNA molecule specify where the polypeptide it encodes should begin? How does it specify where the polypeptide should end? 6. What roles do elongation factors play in translation? 15.3 Genes are first transcribed, then translated. ? Most eukaryotic genes contain noncoding sequences (introns) interspersed randomly between coding sequences (exons). ? The portions of an mRNA molecule corresponding to the introns are removed from the primary RNA transcript before the remainder is translated. 7. What is an intron? What is an exon? How is each involved in the mRNA molecule that is ultimately translated? 15.4 Eukaryotic gene transcripts are spliced. ? Experiment: Jacob/Meselson/ Brenner-Discovery of Messenger RNA (mRNA) ? Gene Activity ? Transcription ? Translation ? Polyribosomes ? Transcription ? Translation ? Experiment: Chapeville-Proving the tRNA Hypothesis ? Experiment: Nirenberg/Khorana- Breaking the Genetic Code ? Experiment: The Genetic Code is Read in Three Bases at a Time ? Experiment: Chambon-Discovery of Introns http://www.mhhe.com/raven6e http://www.biocourse.com 313 16 Control of Gene Expression Concept Outline 16.1 Gene expression is controlled by regulating transcription. An Overview of Transcriptional Control. In bacteria transcription is regulated by controlling access of RNA polymerase to the promoter in a flexible and reversible way; eukaryotes by contrast regulate many of their genes by turning them on and off in a more permanent fashion. 16.2 Regulatory proteins read DNA without unwinding it. How to Read a Helix without Unwinding It. Regulatory proteins slide special segments called DNA- binding motifs along the major groove of the DNA helix, reading the sides of the bases. Four Important DNA-Binding Motifs. DNA-binding proteins contain structural motifs such as the helix-turn- helix which fit into the major groove of the DNA helix. 16.3 Bacteria limit transcription by blocking RNA polymerase. Controlling Transcription Initiation. Repressor proteins inhibit RNA polymerase’s access to the promoter, while activators facilitate its binding. 16.4 Transcriptional control in eukaryotes operates at a distance. Designing a Complex Gene Control System. Eukaryotic genes use a complex collection of transcription factors and enhancers to aid the polymerase in transcription. The Effect of Chromosome Structure on Gene Regulation. The tight packaging of eukaryotic DNA into nucleosomes does not interfere with gene expression. Posttranscriptional Control in Eukaryotes. Gene expression can be controlled at a variety of levels after transcription. I n an orchestra, all of the instruments do not play all the time; if they did, all they would produce is noise. In- stead, a musical score determines which instruments in the orchestra play when. Similarly, all of the genes in an organ- ism are not expressed at the same time, each gene produc- ing the protein it encodes full tilt. Instead, different genes are expressed at different times, with a genetic score writ- ten in regulatory regions of the DNA determining which genes are active when (figure 16.1). FIGURE 16.1 Chromosome puffs. In this chromosome of the fly Drosophila melanogaster, individual active genes can be visualized as “puffs” on the chromosomes. The RNA being transcribed from the DNA template has been radioactively labeled, and the dark specks indicate its position on the chromosome. the maintenance of a constant internal environment—is considered by many to be the hallmark of multicellular or- ganisms. Although cells in such organisms still respond to signals in their immediate environment (such as growth factors and hormones) by altering gene expression, in doing so they participate in regulating the body as a whole. In multicellular organisms with relatively constant internal environments, the primary function of gene con- trol in a cell is not to respond to that cell’s immediate en- vironment, but rather to participate in regulating the body as a whole. Some of these changes in gene expression compensate for changes in the physiological condition of the body. Others mediate the decisions that produce the body, en- suring that the right genes are expressed in the right cells at the right time during development. The growth and development of multicellular organisms entail a long se- ries of biochemical reactions, each catalyzed by a specific enzyme. Once a particular developmental change has oc- curred, these enzymes cease to be active, lest they disrupt the events that must follow. To produce these enzymes, genes are transcribed in a carefully prescribed order, each for a specified period of time. In fact, many genes are ac- tivated only once, producing irreversible effects. In many animals, for example, stem cells develop into differenti- ated tissues like skin cells or red blood cells, following a fixed genetic program that often leads to programmed cell death. The one-time expression of the genes that guide this program is fundamentally different from the reversible metabolic adjustments bacterial cells make to the environment. In all multicellular organisms, changes in gene expression within particular cells serve the needs of the whole organism, rather than the survival of indi- vidual cells. Posttranscriptional Control Gene expression can be regulated at many levels. By far the most common form of regulation in both bacteria and eukaryotes is transcriptional control, that is, control of the transcription of particular genes by RNA polymerase. Other less common forms of control occur after transcrip- tion, influencing the mRNA that is produced from the genes or the activity of the proteins encoded by the mRNA. These controls, collectively referred to as post- transcriptional controls, will be discussed briefly later in this chapter. Gene expression is controlled at the transcriptional and posttranscriptional levels. Transcriptional control, more common, is effected by the binding of proteins to regulatory sequences within the DNA. 314 Part V Molecular Genetics An Overview of Transcriptional Control Control of gene expression is essential to all organisms. In bacteria, it allows the cell to take advantage of chang- ing environmental conditions. In multicellular organisms, it is critical for directing development and maintaining homeostasis. Regulating Promoter Access One way to control transcription is to regulate the initia- tion of transcription. In order for a gene to be tran- scribed, RNA polymerase must have access to the DNA helix and must be capable of binding to the gene’s pro- moter, a specific sequence of nucleotides at one end of the gene that tells the polymerase where to begin tran- scribing. How is the initiation of transcription regulated? Protein-binding nucleotide sequences on the DNA regu- late the initiation of transcription by modulating the abil- ity of RNA polymerase to bind to the promoter. These protein-binding sites are usually only 10 to 15 nucleotides in length (even a large regulatory protein has a “foot- print,” or binding area, of only about 20 nucleotides). Hundreds of these regulatory sequences have been char- acterized, and each provides a binding site for a specific protein able to recognize the sequence. Binding the pro- tein to the regulatory sequence either blocks transcription by getting in the way of RNA polymerase, or stimulates transcription by facilitating the binding of RNA poly- merase to the promoter. Transcriptional Control in Prokaryotes Control of gene expression is accomplished very differently in bacteria than in the cells of complex multicellular organ- isms. Bacterial cells have been shaped by evolution to grow and divide as rapidly as possible, enabling them to exploit transient resources. In bacteria, the primary function of gene control is to adjust the cell’s activities to its immediate environment. Changes in gene expression alter which en- zymes are present in the cell in response to the quantity and type of available nutrients and the amount of oxygen present. Almost all of these changes are fully reversible, al- lowing the cell to adjust its enzyme levels up or down as the environment changes. Transcriptional Control in Eukaryotes The cells of multicellular organisms, on the other hand, have been shaped by evolution to be protected from transient changes in their immediate environment. Most of them ex- perience fairly constant conditions. Indeed, homeostasis— 16.1 Gene expression is controlled by regulating transcription. How to Read a Helix without Unwinding It It is the ability of certain proteins to bind to specific DNA regulatory sequences that provides the basic tool of gene regulation, the key ability that makes transcriptional con- trol possible. To understand how cells control gene expres- sion, it is first necessary to gain a clear picture of this mole- cular recognition process. Looking into the Major Groove Molecular biologists used to think that the DNA helix had to unwind before proteins could distinguish one DNA se- quence from another; only in this way, they reasoned, could regulatory proteins gain access to the hydrogen bonds between base-pairs. We now know it is unnecessary for the helix to unwind because proteins can bind to its outside surface, where the edges of the base-pairs are ex- posed. Careful inspection of a DNA molecule reveals two helical grooves winding round the molecule, one deeper than the other. Within the deeper groove, called the major groove, the nucleotides’ hydrophobic methyl groups, hy- drogen atoms, and hydrogen bond donors and acceptors protrude. The pattern created by these chemical groups is unique for each of the four possible base-pair arrange- ments, providing a ready way for a protein nestled in the groove to read the sequence of bases (figure 16.2). DNA-Binding Motifs Protein-DNA recognition is an area of active research; so far, the structures of over 30 regulatory proteins have been analyzed. Although each protein is unique in its fine details, the part of the protein that actually binds to the DNA is much less variable. Almost all of these proteins employ one of a small set of structural, or DNA-binding, motifs, par- ticular bends of the protein chain that permit it to interlock with the major groove of the DNA helix. Regulatory proteins identify specific sequences on the DNA double helix, without unwinding it, by inserting DNA-binding motifs into the major groove of the double helix where the edges of the bases protrude. Chapter 16 Control of Gene Expression 315 16.2 Regulatory proteins read DNA without unwinding it. N G H H H N N NH O H H HN N N C OH N M in or groov e M ajo r groo ve N A H H N N NH Sugar Phosphate O H CH 3 H H N N T O N M in or groov e M ajo r groo ve Key: = Hydrogen bond donors = Hydrogen bond acceptors = Hydrophobic methyl group = Hydrogen atoms unable to form hydrogen bonds FIGURE 16.2 Reading the major groove of DNA. Looking down into the major groove of a DNA helix, we can see the edges of the bases protruding into the groove. Each of the four possible base-pair arrangements (two are shown here) extends a unique set of chemical groups into the groove, indicated in this diagram by differently colored balls. A regulatory protein can identify the base-pair arrangement by this characteristic signature. Four Important DNA-Binding Motifs The Helix-Turn-Helix Motif The most common DNA-binding motif is the helix-turn- helix, constructed from two α-helical segments of the pro- tein linked by a short nonhelical segment, the “turn” (fig- ure 16.3). The first DNA-binding motif recognized, the helix-turn-helix motif has since been identified in hundreds of DNA-binding proteins. A close look at the structure of a helix-turn-helix motif reveals how proteins containing such motifs are able to in- teract with the major groove of DNA. Interactions between the helical segments of the motif hold them at roughly right angles to each other. When this motif is pressed against DNA, one of the helical segments (called the recognition helix) fits snugly in the major groove of the DNA molecule, while the other butts up against the outside of the DNA molecule, helping to ensure the proper positioning of the recognition helix. Most DNA regulatory sequences recog- nized by helix-turn-helix motifs occur in symmetrical pairs. Such sequences are bound by proteins containing two helix- turn-helix motifs separated by 3.4 nm, the distance required for one turn of the DNA helix (figure 16.4). Having two protein/DNA-binding sites doubles the zone of contact be- tween protein and DNA and so greatly strengthens the bond that forms between them. 316 Part V Molecular Genetics Recognition helix FIGURE 16.3 The helix-turn-helix motif. One helical region, called the recognition helix, actually fits into the major groove of DNA. There it contacts the edges of base-pairs, enabling it to recognize specific sequences of DNA bases. CAP fragment 3.4 nm Tryptophan repressor Lambda (H9261) repressor fragment 3.4 nm 3.4 nm FIGURE 16.4 How the helix-turn-helix binding motif works. The three regulatory proteins illustrated here all bind to DNA using a pair of helix- turn-helix binding motifs. In each case, the two copies of the motif (red) are separated by 3.4 nm, precisely the spacing of one turn of the DNA helix. This allows the regulatory proteins to slip into two adjacent portions of the major groove in DNA, providing a strong attachment. The Homeodomain Motif A special class of helix-turn-helix motifs plays a critical role in development in a wide variety of eukaryotic organisms, including humans. These motifs were discovered when re- searchers began to characterize a set of homeotic mutations in Drosophila (mutations that alter how the parts of the body are assembled). They found that the mutant genes en- coded regulatory proteins whose normal function was to initiate key stages of development by binding to develop- mental switch-point genes. More than 50 of these regula- tory proteins have been analyzed, and they all contain a nearly identical sequence of 60 amino acids, the homeo- domain (figure 16.5b). The center of the homeodomain is occupied by a helix-turn-helix motif that binds to the DNA. Surrounding this motif within the homeodomain is a region that always presents the motif to the DNA in the same way. The Zinc Finger Motif A different kind of DNA-binding motif uses one or more zinc atoms to coordinate its binding to DNA. Called zinc fingers (figure 16.5c), these motifs exist in several forms. In one form, a zinc atom links an α-helical segment to a β sheet segment so that the helical segment fits into the major groove of DNA. This sort of motif often occurs in clusters, the β sheets spacing the helical segments so that each helix contacts the major groove. The more zinc fin- gers in the cluster, the stronger the protein binds to the DNA. In other forms of the zinc finger motif, the β sheet’s place is taken by another helical segment. The Leucine Zipper Motif In yet another DNA-binding motif, two different protein subunits cooperate to create a single DNA-binding site. This motif is created where a region on one of the subunits containing several hydrophobic amino acids (usually leucines) interacts with a similar region on the other sub- unit. This interaction holds the two subunits together at those regions, while the rest of the subunits are separated. Called a leucine zipper, this structure has the shape of a “Y,” with the two arms of the Y being helical regions that fit into the major groove of DNA (figure 16.5d). Because the two subunits can contribute quite different helical re- gions to the motif, leucine zippers allow for great flexibility in controlling gene expression. Regulatory proteins bind to the edges of base-pairs exposed in the major groove of DNA. Most contain structural motifs such as the helix-turn-helix, homeodomain, zinc finger, or leucine zipper. Chapter 16 Control of Gene Expression 317 (a) Helix-turn-helix motif (b) Homeodomain (c) Zinc finger Zn Zn (d) Leucine zipper FIGURE 16.5 Major DNA-binding motifs. Controlling Transcription Initiation How do organisms use regulatory DNA sequences and the proteins that bind them to control when genes are tran- scribed? The same basic controls are used in bacteria and eukaryotes, but eukaryotes employ several additional ele- ments that reflect their more elaborate chromosomal struc- ture. We will begin by discussing the relatively simple con- trols found in bacteria. Repressors Are OFF Switches A typical bacterium possesses genes encoding several thou- sand proteins, but only some are transcribed at any one time; the others are held in reserve until needed. When the cell encounters a potential food source, for example, it be- gins to manufacture the enzymes necessary to metabolize that food. Perhaps the best-understood example of this type of transcriptional control is the regulation of tryptophan-producing genes (trp genes), which was investi- gated in the pioneering work of Charles Yanofsky and his students at Stanford University. Operons. The bacterium Escherichia coli uses proteins en- coded by a cluster of five genes to manufacture the amino acid tryptophan. All five genes are transcribed together as a unit called an operon, producing a single, long piece of mRNA. RNA polymerase binds to a promoter located at the beginning of the first gene, and then proceeds down the DNA, transcribing the genes one after another. Regu- latory proteins shut off transcription by binding to an oper- ator site immediately in front of the promoter and often overlapping it. When tryptophan is present in the medium surround- ing the bacterium, the cell shuts off transcription of the trp genes by means of a tryptophan repressor, a helix- turn-helix regulatory protein that binds to the operator site located within the trp promoter (figure 16.6). Binding of the repressor to the operator prevents RNA polymerase from binding to the promoter. The key to the functioning of this control mechanism is that the tryptophan repressor cannot bind to DNA unless it has first bound to two mol- ecules of tryptophan. The binding of tryptophan to the repressor alters the orientation of a pair of helix-turn- helix motifs in the repressor, causing their recognition helices to fit into adjacent major grooves of the DNA (figure 16.7). Thus, the bacterial cell’s synthesis of tryptophan de- pends upon the absence of tryptophan in the environment. When the environment lacks tryptophan, there is nothing to activate the repressor, so the repressor cannot prevent 318 Part V Molecular Genetics 16.3 Bacteria limit transcription by blocking RNA polymerase. Tryptophan Promoter Start of transcription Operator Tryptophan present Tryptophan absent mRNA synthesis RNA polymerase RNA polymerase cannot bind Inactive repressor Active repressor Genes are ON Genes are OFF Tryptophan is synthesized Tryptophan is not synthesized FIGURE 16.6 How the trp operon is controlled. The tryptophan repressor cannot bind the operator (which is located within the promoter) unless tryptophan first binds to the repressor. Therefore, in the absence of tryptophan, the promoter is free to function and RNA polymerase transcribes the operon. In the presence of tryptophan, the tryptophan-repressor complex binds tightly to the operator, preventing RNA polymerase from initiating transcription. RNA polymerase from binding to the trp promoter. The trp genes are transcribed, and the cell proceeds to manufac- ture tryptophan from other molecules. On the other hand, when tryptophan is present in the environment, it binds to the repressor, which is then able to bind to the trp pro- moter. This blocks transcription of the trp genes, and the cell’s synthesis of tryptophan halts. Activators Are ON Switches Not all regulatory switches shut genes off—some turn them on. In these instances, bacterial promoters are delib- erately constructed to be poor binding sites for RNA poly- merase, and the genes these promoters govern are thus rarely transcribed—unless something happens to improve the promoter’s ability to bind RNA polymerase. This can happen if a regulatory protein called a transcriptional ac- tivator binds to the DNA nearby. By contacting the poly- merase protein itself, the activator protein helps hold the polymerase against the DNA promoter site so that tran- scription can begin. A well-understood transcriptional activator is the catabolite activator protein (CAP) of E. coli, which initiates the transcription of genes that allow E. coli to use other molecules as food when glucose is not present. Falling lev- els of glucose lead to higher intracellular levels of the sig- naling molecule, cyclic AMP (cAMP), which binds to the CAP protein. When cAMP binds to it, the CAP protein changes shape, enabling its helix-turn-helix motif to bind to the DNA near any of several promoters. Consequently, those promoters are activated and their genes can be tran- scribed (figure 16.8). Chapter 16 Control of Gene Expression 319 Tryptophan 3.4 nm FIGURE 16.7 How the tryptophan repressor works. The binding of tryptophan to the repressor increases the distance between the two recognition helices in the repressor, allowing the repressor to fit snugly into two adjacent portions of the major groove in DNA. CAP cAMP FIGURE 16.8 How CAP works. Binding of the catabolite activator protein (CAP) to DNA causes the DNA to bend around it. This increases the activity of RNA polymerase. Combinations of Switches By combining ON and OFF switches, bacteria can create sophisticated transcrip- tional control systems. A particularly well- studied example is the lac operon of E. coli (figure 16.9). This operon is responsi- ble for producing three proteins that im- port the disaccharide lactose into the cell and break it down into two monosaccha- rides: glucose and galactose. The Activator Switch. The lac operon possesses two regulatory sites. One is a CAP site located adjacent to the lac pro- moter. It ensures that the lac genes are not transcribed effectively when ample amounts of glucose are already present. In the absence of glucose, a high level of cAMP builds up in the cell. Consequently, cAMP is available to bind to CAP and allow it to change shape, bind to the DNA, and activate the lac promoter (figure 16.10). In the presence of glucose, cAMP levels are low, CAP is unable to bind to the DNA, and the lac promoter is not activated. The Repressor Switch. Whether the lac genes are actu- ally transcribed in the absence of glucose is determined by the second regulatory site, the operator, which is located adjacent to the promoter. A protein called the lac repressor is capable of binding to the operator, but only when lactose is absent. Because the operator and the promoter are close together, the repressor covers part of the promoter when it binds to the operator, preventing RNA polymerase from proceeding and so blocking transcription of the lac genes. These genes are then said to be “repressed” (figure 16.11). As a result, the cell does not transcribe genes whose prod- ucts it has no use for. However, when lactose is present, a lactose isomer binds to the repressor, twisting its binding motif away from the major groove of the DNA. This pre- vents the repressor from binding to the operator and so al- lows RNA polymerase to bind to the promoter and tran- scribe the lac genes. Transcription of the lac operon is said to have been “induced” by lactose. This two-switch control mechanism thus causes the cell to produce lactose-utilizing proteins whenever lactose is present but glucose is not, enabling it to make a metabolic decision to produce only what the cell needs, conserving its resources (figure 16.12). Bacteria regulate gene expression transcriptionally through the use of repressor and activator “switches,” such as the trp repressor and the CAP activator. The transcription of some clusters of genes, such as the lac operon, is regulated by both repressors and activators. 320 Part V Molecular Genetics Promoter for I gene Gene for repressor protein Regulatory region Coding region CAP binding site Gene for permease Operator Promoter for lac operon Gene for H9252-galactosidase Gene for transacetylase P I CAP O Z Y A P lac I lac control system FIGURE 16.9 The lac region of the Escherichia coli chromosome. The lac operon consists of a promoter, an operator, and three genes that code for proteins required for the metabolism of lactose. In addition, there is a binding site for the catabolite activator protein (CAP), which affects whether or not RNA polymerase will bind to the promoter. Gene I codes for a repressor protein, which will bind to the operator and block transcription of the lac genes. The genes Z, Y, and A encode the two enzymes and the permease involved in the metabolism of lactose. RNA polymerase RNA polymerase cAMP CAP CAP CAP CAP Promoter for lac operon P lac P lac (a) Glucose low, promoter activated (b) Glucose high, promoter not activated Promoter for lac operon O O CAP binding site FIGURE 16.10 How the CAP site works. The CAP molecule can attach to the CAP binding site only when the molecule is bound to cAMP. (a) When glucose levels are low, cAMP is abundant and binds to CAP. The cAMP-CAP complex binds to the CAP site, bends in the DNA, and gives RNA polymerase access to the promoter. (b) When glucose levels are high, cAMP is scarce, and CAP is unable to activate the promoter. Chapter 16 Control of Gene Expression 321 RNA polymerase Repressor Promoter for lac operon P lac O DNA helix (a) RNA polymerase cannot transcribe lac genes Repressor CAP CAP CAP CAP Promoter Promoter Operator Operator Lactose (inducer) cAMP cAMP P lac P lac RNA polymerase RNA polymerase O O Y Y A A I I Z Z (b) lac operon is "repressed" (c) lac operon is "induced" FIGURE 16.11 How the lac repressor works. (a) The lac repressor. Because the repressor fills the major groove of the DNA helix, RNA polymerase cannot fully attach to the promoter, and transcription is blocked. (b) The lac operon is shut down (“repressed”) when the repressor protein is bound to the operator site. Because promoter and operator sites overlap, RNA polymerase and the repressor cannot functionally bind at the same time, any more than two people can sit in the same chair at once. (c) The lac operon is transcribed (“induced”) when CAP is bound and when lactose binding to the repressor changes its shape so that it can no longer sit on the operator site and block RNA polymerase activity. mRNA synthesis CAP binding site RNA-polymerase binding site (promoter) Operator lacZ gene Operon OFF because CAP is not bound Operon OFF both because lac repressor is bound and CAP is not Operon OFF because lac repressor is bound Operon ON because CAP is bound and lac repressor is not RNA polymerase Repressor RNA polymerase CAP CAP Gluc ose Lac t ose + + + + FIGURE 16.12 Two regulatory proteins control the lac operon. Together, the lac repressor and CAP provide a very sensitive response to the cell’s need to utilize lactose-metabolizing enzymes. 322 Part V Molecular Genetics Designing a Complex Gene Control System As we have seen, combinations of ON and OFF control switches allow bacteria to regulate the transcription of par- ticular genes in response to the immediate metabolic de- mands of their environment. All of these switches work by interacting directly with RNA polymerase, either blocking or enhancing its binding to specific promoters. There is a limit to the complexity of this sort of regulation, however, because only a small number of switches can be squeezed into and around one promoter. In a eukaryotic organism that undergoes a complex development, many genes must interact with one another, requiring many more interacting elements than can fit around a single promoter (table 16.1). In eukaryotes, this physical limitation is overcome by having distant sites on the chromosome exert control over the transcription of a gene (figure 16.13). In this way, many regulatory sequences scattered around the chromosomes can influence a particular gene’s transcription. This “control-at-a-distance” mechanism includes two features: a set of proteins that help bind RNA polymerase to the pro- moter, and modular regulatory proteins that bind to distant sites. These two features produce a truly flexible control system. 16.4 Transcriptional control in eukaryotes operates at a distance. Base pairs GCCAATGC TATA -60 bp -25 bp-80 bp-100 bp Thymidine kinase promoter Thymidine kinase gene FIGURE 16.13 A eukaryotic promoter. This promoter for the gene encoding the enzyme thymidine kinase contains the TATA box that the initiation factor binds to, as well as three other DNA sequences that direct the binding of other elements of the transcription complex. Table 16.1 Some Gene Regulatory Proteins and the DNA Sequences They Recognize Regulatory Regulatory Proteins Proteins of Species DNA Sequence Recognized* of Species DNA Sequence Recognized* ESCHERICHIA COLI lac repressor CAP H9261 repressor YEAST GAL4 MAT H92512 GCN4 AATTGTGAGCGGATAACAATT TTAACACTCGCCTATTGTTAA TGTGAGTTAGCTCACT ACACTCAATCGAGTGA TATCACCGCCAGAGGTA ATAGTGGCGGTCTCCAT CGGAGGACTGTCCTCCG GCCTCCTGACAGGAGGC CATGTAATT GTACATTAA ATGACTCAT TACTGAGTA AACGGGTTAA TTGCCCAATT GGGATTAGA CCCTAATCT GGGCGG CCCGCC ATGCAAAT TACGTTTA TGATAG ACTATC *Each regulatory protein is able to recognize a family of closely related DNA sequences; only one member of each family is listed here. DROSOPHILA MELANOGASTER Krüppel bicoid HUMAN Spl Oct-1 GATA-1 Eukaryotic Transcription Factors For RNA polymerase to successfully bind to a eukaryotic promoter and initiate transcription, a set of proteins called transcription factors must first assemble on the promoter, forming a complex that guides and stabilizes the binding of the polymerase (figure 16.14). The assem- bly process begins some 25 nucleotides upstream from the transcription start site, where a transcription factor com- posed of many subunits binds to a short TATA sequence (discussed in chapter 15). Other transcription factors then bind, eventually forming a full transcription factor com- plex able to capture RNA polymerase. In many instances, the transcription factor complex then phosphorylates the bound polymerase, disengaging it from the complex so that it is free to begin transcription. The binding of several different transcription factors provides numerous points where control over transcription may be exerted. Anything that reduces the availability of a particular factor (for example, by regulating the promoter that governs the expression and synthesis of that factor) or limits its ease of assembly into the transcription factor complex will inhibit transcription. Chapter 16 Control of Gene Expression 323 Repressor Silencer Enhancer Enhancer Enhancer Activator Activator Activator DNA RNA polymerase TATA- binding protein Core promoter A B F E H 250 110 40 30 30 150 60 80 Activators These regulatory proteins bind to DNA at distant sites known as enhancers. When DNA folds so that the enhancer is brought into proximity with the transcription complex, the activator proteins interact with the complex to increase the rate of transcription. Repressors These regulatory proteins bind to "silencer" sites on the DNA, preventing the binding of activators to nearby enhancers and so slowing transcription. Basal factors These transcription factors, in response to coactivators, position RNA polymerase at the start of a protein-coding sequence, and then release the polymerase to transcribe the mRNA. Coactivators These transcription factors transmit signals from activator proteins to the basal factors. TAT A bo x Codi ng re gion FIGURE 16.14 The structure of a human transcription complex. The transcription complex that positions RNA polymerase at the beginning of a human gene consists of four kinds of proteins. Basal factors (the green shapes at bottom of complex with letter names) are transcription factors that are essential for transcription but cannot by themselves increase or decrease its rate. They include the TATA-binding protein, the first of the basal factors to bind to the core promoter sequence. Coactivators (the tan shapes that form the bulk of the transcription complex, named according to their molecular weights) are transcription factors that link the basal factors with regulatory proteins called activators (the red shapes). The activators bind to enhancer sequences at other locations on the DNA. The interaction of individual basal factors with particular activator proteins is necessary for proper positioning of the polymerase, and the rate of transcription is regulated by the availability of these activators. When a second kind of regulatory protein called a repressor (the purple shape) binds to a so-called “silencer” sequence located adjacent to or overlapping an enhancer sequence, the corresponding activator that would normally have bound that enhancer is no longer able to do so. The activator is thus unavailable to interact with the transcription complex and initiate transcription. Enhancers A key advance in the evolution of eukaryotic gene tran- scription was the advent of regulatory proteins composed of two distinct modules, or domains. The DNA-binding domain physically attaches the protein to the DNA at a specific site, using one of the structural motifs discussed earlier, while the regulatory domain interacts with other regulatory proteins. The great advantage of this modular design is that it un- couples regulation from DNA binding, allowing a regula- tory protein to bind to a specific DNA sequence at one site on a chromosome and exert its regulation over a promoter at another site, which may be thousands of nucleotides away. The distant sites where these regulatory proteins bind are called enhancers. Although enhancers also occur in exceptional instances in bacteria (figure 16.15), they are the rule rather than the exception in eukaryotes. How can regulatory proteins affect a promoter when they bind to the DNA at enhancer sites located far from the promoter? Apparently the DNA loops around so that the enhancer is positioned near the promoter. This brings the regulatory domain of the protein attached to the en- hancer into direct contact with the transcription factor complex attached to the promoter (figure 16.16). The enhancer mode of transcriptional control that has evolved in eukaryotes adds a great deal of flexibility to the control process. The positioning of regulatory sites at a distance permits a large number of different regulatory sequences scattered about the DNA to influence a partic- ular gene. Transcription factors and enhancers confer great flexibility on the control of gene expression in eukaryotes. 324 Part V Molecular Genetics NtrC (Activator) RNA polymerase Promoter Bacterial RNA polymerase is loosely bound to the promoter. The activator (NtrC) binds at the enhancer. ADP DNA loops around so that the activator comes into contact with the RNA polymerase. The activator triggers RNA polymerase activation, and transcription begins. DNA unloops. mRNA synthesis ATP 20 nm Enhancer FIGURE 16.15 An enhancer in action. When the bacterial activator NtrC binds to an enhancer, it causes the DNA to loop over to a distant site where RNA polymerase is bound, activating transcription. While such enhancers are rare in bacteria, they are common in eukaryotes. Activator Enhancer sequence Transcription factor RNA polymerase Promoter Coding region of gene mRNA synthesis FIGURE 16.16 How enhancers work. The enhancer site is located far away from the gene being regulated. Binding of an activator (red) to the enhancer allows the activator to interact with the transcription factors (green) associated with RNA polymerase, activating transcription. The Effect of Chromosome Structure on Gene Regulation The way DNA is packaged into chromosomes can have a profound effect on gene expression. As we saw in chapter 11, the DNA of eukaryotes is packaged in a highly compact form that enables it to fit into the cell nucleus. DNA is wrapped tightly around histone proteins to form nucleo- somes (figure 16.17) and then the strand of nucleosomes is twisted into 30-nm filaments. Promoter Blocking by Nucleosomes Intensive study of eukaryotic chromosomes has shown that histones positioned over promoters block the assem- bly of transcription factor complexes. Therefore, tran- scription factors appear unable to bind to a promoter packaged in a nucleosome. In this way, nucleosomes may prevent continuous transcription initiation. On the other hand, nucleosomes do not inhibit activators and RNA polymerase. The regulatory domains of activators at- tached to enhancers apparently are able to displace the histones that block a promoter. In fact, this displacement of histones and the binding of activator to promoter are required for the assembly of the transcription factor com- plex. Once transcription has begun, RNA polymerase seems to push the histones aside as it traverses the nucle- osome. DNA Methylation Chemical methylation of the DNA was once thought to play a major role in gene regulation in vertebrate cells. The addition of a methyl group to cytosine creates 5-methylcytosine but has no effect on base-pairing with guanine (figure 16.18), just as the addition of a methyl group to uracil produces thymine without affecting base- pairing with adenine. Many inactive mammalian genes are methylated, and it was tempting to conclude that methylation caused the inactivation. However, methyla- tion is now viewed as having a less direct role, blocking accidental transcription of “turned-off” genes. Verte- brate cells apparently possess a protein that binds to clus- ters of 5-methylcytosine, preventing transcriptional acti- vators from gaining access to the DNA. DNA methylation in vertebrates thus ensures that once a gene is turned off, it stays off. Transcriptional control of gene expression occurs in eukaryotes despite the tight packaging of DNA into nucleosomes. Chapter 16 Control of Gene Expression 325 (a) Core complex of histones DNA Exterior histone (b) FIGURE 16.17 Nucleosomes. (a) In the electron micrograph, the individual nucleosomes have diameters of about 10 nm. (b) In the diagram of a nucleosome, the DNA double helix is wound around a core complex of eight histones; one additional histone binds to the outside of the nucleosome, exterior to the DNA. H C Cytosine 5-methylcytosine MethylationC N CH H CH 1 6 5 2 4 O NH 2 NH 2 N H C C N C CH 3 C O N 3 FIGURE 16.18 DNA methylation. Cytosine is methylated, creating 5-methylcytosine. Because the methyl group is positioned to the side, it does not interfere with the hydrogen bonds of a GC base- pair. Posttranscriptional Control in Eukaryotes Thus far we have discussed gene regulation entirely in terms of transcription initiation, that is, when and how often RNA polymerase starts “reading” a particular gene. Most gene regulation appears to occur at this point. How- ever, there are many other points after transcription where gene expression could be regulated in principle, and all of them serve as control points for at least some eukaryotic genes. In general, these posttranscriptional control processes involve the recognition of specific sequences on the primary RNA transcript by regulatory proteins or other RNA molecules. Processing of the Primary Transcript As we learned in chapter 15, most eukaryotic genes have a patchwork structure, being composed of numerous short coding sequences (exons) embedded within long stretches of noncoding sequences (introns). The initial mRNA mole- cule copied from a gene by RNA polymerase, the primary transcript, is a faithful copy of the entire gene, including introns as well as exons. Before the primary transcript is translated, the introns, which comprise on average 90% of the transcript, are removed in a process called RNA pro- cessing, or RNA splicing. Particles called small nuclear ri- bonucleoproteins, or snRNPs (more informally, snurps), are thought to play a role in RNA splicing. These particles re- side in the nucleus of a cell and are composed of proteins and a special type of RNA called small nuclear RNA, or snRNA. One kind of snRNP contains snRNA that can bind to the 5′ end of an intron by forming base-pairs with com- plementary sequences on the intron. When multiple snRNPs combine to form a larger complex called a spliceosome, the intron loops out and is excised (figure 16.19). RNA splicing provides a potential point where the ex- pression of a gene can be controlled, because exons can be 326 Part V Molecular Genetics snRNPs ExonExon Intron snRNA Spliceosome Exon Exon Excised intron snRNA forms base-pairs with 5H11032 end of intron. Spliceosome and looped intron form. Exons are spliced; spliceosome disassembles. Mature mRNA 5H11032 end of intron is cut and attached near 3H11032 end of intron, forming a lariat. The 3H11032 end of the intron is then cut. 5H11032 5H11032 5H11032 5H11032 3H11032 3H11032 3H11032 3H11032 FIGURE 16.19 How spliceosomes process RNA. Particles called snRNPs contain snRNA that interacts with the 5′ end of an intron. Several snRNPs come together and form a spliceosome. As the intron forms a loop, the 5′ end is cut and linked to a site near the 3′ end of the intron. The intron forms a lariat that is excised, and the exons are spliced together. The spliceosome then disassembles and releases the mature mRNA. spliced together in different ways, allowing a variety of dif- ferent polypeptides to be assembled from the same gene! Alternative splicing is common in insects and vertebrates, with two or three different proteins produced from one gene. In many cases, gene expression is regulated by chang- ing which splicing event occurs during different stages of development or in different tissues. An excellent example of alternative splicing in action is found in two different human organs, the thyroid and the hypothalamus. The thyroid gland (see chapter 56) is re- sponsible for producing hormones that control processes such as metabolic rate. The hypothalamus, located in the brain, collects information from the body (for example, salt balance) and releases hormones that in turn regulate the re- lease of hormones from other glands, such as the pituitary gland (see chapter 56). The two organs produce two dis- tinct hormones, calcitonin and CGRP (calcitonin gene- related peptide) as part of their function. Calcitonin is re- sponsible for controlling the amount of calcium we take up from our food and the balance of calcium in tissues like bone and teeth. CGRP is involved in a number of neural and endocrine functions. Although these two hormones are used for very different physiological purposes, the hor- mones are made using the same transcript (figure 16.20). The appearance of one product versus another is deter- mined by tissue-specific factors that regulate the processing of the primary transcript. This ability offers another pow- erful way to control the expression of gene products, rang- ing from proteins with subtle differences to totally unre- lated proteins. Transport of the Processed Transcript Out of the Nucleus Processed mRNA transcripts exit the nucleus through the nuclear pores described in chapter 5. The passage of a tran- script across the nuclear membrane is an active process that requires that the transcript be recognized by receptors lin- ing the interior of the pores. Specific portions of the tran- script, such as the poly-A tail, appear to play a role in this recognition. The transcript cannot move through a pore as long as any of the splicing enzymes remain associated with the transcript, ensuring that partially processed transcripts are not exported into the cytoplasm. There is little hard evidence that gene expression is reg- ulated at this point, although it could be. On average, about 10% of transcribed genes are exon sequences, but only about 5% of the total mRNA produced as primary tran- script ever reaches the cytoplasm. This suggests that about half of the exon primary transcripts never leave the nucleus, but it is not clear whether the disappearance of this mRNA is selective. Selecting Which mRNAs Are Translated The translation of a processed mRNA transcript by the ri- bosomes in the cytoplasm involves a complex of proteins called translation factors. In at least some cases, gene ex- pression is regulated by modification of one or more of these factors. In other instances, translation repressor proteins shut down translation by binding to the begin- ning of the transcript, so that it cannot attach to the ribo- some. In humans, the production of ferritin (an iron- storing protein) is normally shut off by a translation repressor protein called aconitase. Aconitase binds to a 30- nucleotide sequence at the beginning of the ferritin mRNA, forming a stable loop to which ribosomes cannot bind. When the cell encounters iron, the binding of iron to aconitase causes the aconitase to dissociate from the ferritin mRNA, freeing the mRNA to be translated and increasing ferritin production 100-fold. Chapter 16 Control of Gene Expression 327 Mature mRNA Splicing pathway 2 (thyroid) Splicing pathway 1 (hypothalamus) CGRP peptide CGRP CGRP D C B A B C D Calcitonin Calcitonin B C D Primary RNA transcript Mature mRNA Calcitonin peptide FIGURE 16.20 Alternative splicing products. The same transcript made from one gene can be spliced differently to give rise to two very distinct protein products, calcitonin and CGRP. Selectively Degrading mRNA Transcripts Another aspect that affects gene expression is the stability of mRNA transcripts in the cell cytoplasm (figure 16.21). Unlike bacterial mRNA transcripts, which typically have a half-life of about 3 minutes, eukaryotic mRNA transcripts are very stable. For example, β-globin gene transcripts have a half-life of over 10 hours, an eternity in the fast-moving metabolic life of a cell. The transcripts encoding regulatory proteins and growth factors, however, are usually much less stable, with half-lives of less than 1 hour. What makes these particular transcripts so unstable? In many cases, they contain specific sequences near their 3′ ends that make them attractive targets for enzymes that degrade mRNA. A sequence of A and U nucleotides near the 3′ poly-A tail of a transcript promotes removal of the tail, which destabilizes the mRNA. Histone transcripts, for example, have a half- life of about 1 hour in cells that are actively synthesizing DNA; at other times during the cell cycle, the poly-A tail is lost and the transcripts are degraded within minutes. Other mRNA transcripts contain sequences near their 3′ ends that are recognition sites for endonucleases, which causes these transcripts to be digested quickly. The short half-lives of the mRNA transcripts of many regulatory genes are critical to the function of those genes, as they enable the levels of regulatory proteins in the cell to be altered rapidly. An Example of a Complex Gene Control System Sunlight is an important gene-controlling signal for plants, from germination to seed formation. Plants must regulate their genes according to the presence of sunlight, the qual- ity of the light source, the time of day, and many other en- vironmental signals. The combination of these responses culminate in the way the genes are regulated, such as the genes cab (a chlorophyll-binding photosynthetic protein) and rbcS (a subunit of a carbon-fixing enzyme). For in- stance, photosynthesis-related genes tend to express early in the day, to carry out photosynthesis, and begin to shut down later in the day. Expression levels may also be regu- lated according to lighting conditions, such as cloudy days versus sunny days. When darkness arrives, the transcripts must be degraded in preparation for the next day. This is an example of how complex a gene control system can be, and scientists are just beginning to understand parts of such a complicated system. Although less common than transcriptional control, posttranscriptional control of gene expression occurs in eukaryotes via RNA splicing, translation repression, and selective degradation of mRNA transcripts. 328 Part V Molecular Genetics operon A cluster of functionally related genes transcribed into a single mRNA mol- ecule. A common mode of gene regulation in prokaryotes, it is rare in eukaryotes other than fungi. promoter A site upstream from a gene to which RNA polymerase attaches to initiate transcription. repressor A protein that regulates tran- scription by binding to the operator and so preventing RNA polymerase from initiating transcription from the promoter. RNA polymerase The enzyme that tran- scribes DNA into RNA. transcription The RNA polymerase- catalyzed assembly of an RNA molecule complementary to a strand of DNA. translation The assembly of a polypep- tide on the ribosomes, using mRNA to di- rect the sequence of amino acids. exon A segment of eukaryotic DNA that is both transcribed into mRNA and trans- lated into protein. Exons are typically scat- tered within much longer stretches of non- translated intron sequences. intron A segment of eukaryotic DNA that is transcribed into mRNA but removed be- fore translation. nonsense codon A codon (UAA, UAG, or UGA) for which there is no tRNA with a complementary andicodon; a chain- terminating codon often called a “stop” codon. operator A site of negative gene regula- tion; a sequence of nucleotides near or within the promoter that is recognized by a repressor. Binding of the repressor to the operator prevents the functional binding of RNA polymerase to the promoter and so blocks transcription. activator A regulatory protein that pro- motes gene transcription by binding to DNA sequences upstream of a promoter. Activator binding stimulates RNA poly- merase activity. anticodon The three-nucleotide sequence on one end of a tRNA molecule that is complementary to and base-pairs with an amino acid–specifying codon in mRNA. codon The basic unit of the genetic code; a sequence of three adjacent nucleotides in DNA or mRNA that codes for one amino acid or for polypeptide termination. A Vocabulary of Gene Expression Chapter 16 Control of Gene Expression 329 Amino acid Completed polypeptide Cytoplasm tRNA Ribosome moves toward 3H11541 end Ribosome Nuclear membrane Nuclear pore Small ribosomal subunit Cap Large ribosomal subunit mRNA mRNA 5H11541 5H11541 5H11541 5H11541 5H11541 3H11541 3H11541 3H11541 3H11541 3H11541 3H11541 Poly-A tail Exons Introns RNA polymerase DNA Cap Poly-A tail Exon splicing. Gene expression can be controlled by altering the rate of splicing in eukaryotes. Post-translational modification. Phosphorylation or other chemical modifications can alter the activity of a protein after it is produced. 6. Protein synthesis. Many proteins take part in the translation process, and regulation of the availability of any of them alters the rate of gene expression by speeding or slowing protein synthesis. 5. Initiation of transcription. Most control of gene expression is achieved by regulating the frequency of transcription initiation. 1. 2. Destruction of the transcript. Many enzymes degrade mRNA, and gene expression can be regulated by modulating the degree to which the transcript is protected. 4. Passage through the nuclear membrane. Gene expression can be regulated by controlling access to or efficiency of transport channels. 3. Primary RNA transcript PO 4 PO 4 FIGURE 16.21 Six levels where gene expression can be controlled in eukaryotes. 330 Part V Molecular Genetics Chapter 16 Summary Questions Media Resources 16.1 Gene expression is controlled by regulating transcription. ? Regulatory sequences are short stretches of DNA that function in transcriptional control but are not transcribed themselves. ? Regulatory proteins recognize and bind to specific regulatory sequences on the DNA. 1. How do regulatory proteins identify specific nucleotide sequences without unwinding the DNA? ? Regulatory proteins possess structural motifs that allow them to fit snugly into the major groove of DNA, where the sides of the base-pairs are exposed. ? Common structural motifs include the helix-turn- helix, homeodomain, zinc finger, and leucine zipper. 2. What is a helix-turn-helix motif? What sort of developmental events are homeodomain motifs involved in? 16.2 Regulatory proteins read DNA without unwinding it. ? Many genes are transcriptionally regulated through repressors, proteins that bind to the DNA at or near the promoter and thereby inhibit transcription of the gene. ? Genes may also be transcriptionally regulated through activators, proteins that bind to the DNA and thereby stimulate the binding of RNA polymerase to the promoter. ? Transcription is often controlled by a combination of repressors and activators. 3. Describe the mechanism by which the transcription of trp genes is regulated in Escherichia coli when tryptophan is present in the environment. 4. Describe the mechanism by which the transcription of lac genes is regulated in E. coli when glucose is absent but lactose is present in the environment. 16.3 Bacteria limit transcription by blocking RNA polymerase. ? In eukaryotes, RNA polymerase cannot bind to the promoter unless aided by a family of transcription factors. ? Anything that interferes with the activity of the transcription factors can block or alter gene expression. ? Eukaryotic DNA is packaged tightly in nucleosomes within chromosomes. This packaging appears to provide some inhibition of transcription, although regulatory proteins and RNA polymerase can still activate specific genes even when they are so packaged. ? Gene expression can also be regulated at the posttranscriptional level, through RNA splicing, translation repressor proteins, and the selective degradation of mRNA transcripts. 5. How do transcription factors promote transcription in eukaryotic cells? How do the enhancers of eukaryotic cells differ from most regulatory sites on bacterial DNA? 6. What role does the methylation of DNA likely play in transcriptional control? 7. How does the primary RNA transcript of a eukaryotic gene differ from the mRNA transcript of that gene as it is translated in the cytoplasm? 8. How can a eukaryotic cell control the translation of mRNA transcripts after they have been transported from the nucleus to the cytoplasm? 16.4 Transcriptional control in eukaryotes operates at a distance. http://www.mhhe.com/raven6e http://www.biocourse.com ? Exploration: Gene regulation ? Student Research: Heat Shock Proteins ? Art Activity: The lac operon ? Regulation of E.coli lac operon ? Regulation of E.coli trp operon ? Gene Regulation ? Exploration: Reading DNA 331 17 Cellular Mechanisms of Development Concept Outline 17.1 Development is a regulated process. Overview of Development. Studies of cellular mechanisms have focused on mice, fruit flies, nematodes, and flowering plants. Vertebrate Development. Vertebrates develop in a highly orchestrated fashion. Insect Development. Insect development is highly specialized, many key events occurring in a fused mass of cells. Plant Development. Unlike animal development, which is buffered from the environment, plant development is sensitive to environmental influences. 17.2 Multicellular organisms employ the same basic mechanisms of development. Cell Movement and Induction. Animal cells move by extending protein cables that they use to pull themselves past surrounding cells. Transcription within cells is influenced by signal molecules from other cells. Determination. Cells become reversibly committed to particular developmental paths. Pattern Formation. Diffusion of chemical inducers governs pattern formation in fly embryos. Expression of Homeotic Genes. Master genes determine the form body segments will take. Programmed Cell Death. Some genes, when activated, kill their cells. 17.3 Four model developmental systems have been extensively researched. The Mouse. Mus musculus. The Fruit Fly. Drosophila melanogaster. The Nematode. Caenorhabditis elegans. The Flowering Plant. Arabidopsis thaliana. 17.4 Aging can be considered a developmental process. Theories of Aging. While there are many ideas about why cells age, no one theory of aging is widely accepted. I n the previous chapter, we explored gene expression from the perspective of an individual cell, examining the diverse mechanisms that may be employed by a cell to control the transcription of particular genes. Now we will broaden our perspective and look at the unique challenge posed by the development of a cell into a multicellular or- ganism (figure 17.1). In the course of this developmental journey, a pattern of decisions about transcription are made that cause particular lines of cells to proceed along different paths, spinning an incredibly complex web of cause and effect. Yet, for all its complexity, this develop- mental program works with impressive precision. In this chapter, we will explore the mechanisms used by multicel- lular organisms to control their development and achieve this precision. FIGURE 17.1 A collection of future fish undergo embryonic development. Inside a transparent fish egg, a single cell becomes millions of cells that form eyes, fins, gills, and other body parts. 332 Part V Molecular Genetics Overview of Development Organisms in all three multicellular kingdoms—fungi, plants, and animals—realize cell specialization by orches- trating gene expression. That is, different cells express dif- ferent genes at different times. To understand develop- ment, we need to focus on how cells determine which genes to activate, and when. Among the fungi, the specialized cells are largely lim- ited to reproductive cells. In basidiomycetes and as- comycetes (the so-called higher fungi), certain cells pro- duce hormones that influence other cells, but the basic design of all fungi is quite simple. For most of its life, a fungus has a two-dimensional body, consisting of long fila- ments of cells that are only imperfectly separated from each other. Fungal maturation is primarily a process of growth rather than specialization. Development is far more complex in plants, where the adult individuals contain a variety of specialized cells or- ganized into tissues and organs. A hallmark of plant de- velopment is flexibility; as a plant develops, the precise array of tissues it achieves is greatly influenced by its environment. In animals, development is complex and rigidly con- trolled, producing a bewildering array of specialized cell types through mechanisms that are much less sensitive to the environment. The subject of intensive study, animal de- velopment has in the last decades become relatively well understood. Here we will focus our attention on four developmental systems which researchers have studied intensively: (1) an animal with a very complexly arranged body, a mammal; (2) a less complex animal with an intricate developmental cycle, an insect; (3) a very simple animal, a nematode; and (4) a flowering plant (figure 17.2). To begin our investigation of development, we will first examine the overall process of development in three quite different organisms, so we can sort through differ- ences in the gross process to uncover basic similarities in underlying mechanisms. We will start by describing the overall process in vertebrates, because it is the best un- derstood among the animals. Then we will examine the very different developmental process carried out by in- sects, in which genetics has allowed us to gain detailed knowledge of many aspects of the process. Finally we will look at development in a third very different organism, a flowering plant. Almost all multicellular organisms undergo development. The process has been well studied in animals, especially in mammals, insects, nematodes, and flowering plants. 17.1 Development is a regulated process. Mammal Insect Nematode Flowering plant FIGURE 17.2 Four developmental systems. Researchers studying the cellular mechanisms of development have focused on these four organisms. Vertebrate Development Vertebrate development is a dynamic process in which cells divide rapidly and move over each other as they first estab- lish the basic geometry of the body (figure 17.3). At differ- ent sites, particular cells then proceed to form the body’s organs, and then the body grows to a size and shape that will allow it to survive after birth. The entire process, de- scribed more fully in chapter 60, is traditionally divided into phases. As in mitosis, however, the boundaries be- tween phases are somewhat artificial, and the phases, in fact, grade into one another. Cleavage Vertebrates begin development as a single fertilized egg, the zygote. Within an hour after fertilization, the zygote begins to divide rapidly into a larger and larger number of smaller and smaller cells called blastomeres, until a solid ball of cells is produced (figure 17.4). This initial period of cell division, termed cleavage, is not accompanied by any increase in the overall size of the embryo; rather, the con- tents of the zygote are simply partitioned into the daughter cells. The two ends of the zygote are traditionally referred to as the animal and vegetal poles. In general, the blas- tomeres of the animal pole will go on to form the external tissues of the body, while those of the vegetal pole will form the internal tissues. The initial top-bottom (dorsal- ventral) orientation of the embryo is determined at fertil- ization by the location where the sperm nucleus enters the egg, a point that corresponds roughly to the future belly. After about 12 divisions, the burst of cleavage divisions slows, and transcription of key genes begins within the embryo cells. Chapter 17 Cellular Mechanisms of Development 333 FIGURE 17.3 The miracle of development. This nine-week-old human fetus started out as a single cell: a fertilized egg, or zygote. The zygote’s daughter cells have been repeatedly dividing and specializing to produce the distinguishable features of a fetus. (a) (b) (c) (d) FIGURE 17.4 Cleavage divisions producing a frog embryo. (a) The initial divisions are, in this case, on the side of the embryo facing you, producing (b) a cluster of cells on this side of the embryo, which soon expands to become a (c) compact mass of cells. (d) This mass eventually invaginates into the interior of the embryo, forming a gastrula, then a neurula. 334 Part V Molecular Genetics Blastomeres (a) Cleavage (b) Blastula formation (c) Gastrulation (d) Neurulation (e) Cell migration (f) Organogenesis Mesoderm Endoderm Neural plate Neural groove Notochord Ectoderm Neural crest Neural tube Notochord Midgut Spinal cord Spinal cord Mesoderm Endoderm Endoderm Ectoderm Ectoderm Mesoderm Brain Stomach Heart Liver Intestine Muscle somites Mammalian blastocyst FIGURE 17.5 The path of vertebrate development. An illustration of the major events in the development of Mus musculus, the house mouse. (a) Cleavage. (b) Formation of blastula. (c) Gastrulation. (d) Neurulation. (e) Cell migration. ( f ) Organogenesis. (g) Growth. liver, and most of the other internal organs. The cells that remain on the exterior are ectoderm, and their derivatives include the skin on the outside of the body and the ner- vous system. The cells that break away from the invagi- nating cells and invade the space between the gut and the exterior wall are mesoderm; they eventually form the no- tochord, bones, blood vessels, connective tissues, and muscles. Neurulation Soon after gastrulation is complete, a broad zone of ecto- derm begins to thicken on the dorsal surface of the embryo, an event triggered by the presence of the notochord be- neath it. The thickening is produced by the elongation of certain ectodermal cells. Those cells then assume a wedge shape by contracting bundles of actin filaments at one end. This change in shape causes the neural tissue to roll up into a tube, which eventually pinches off from the rest of the ec- toderm and gives rise to the brain and spinal cord. This tube is called the neural tube, and the process by which it forms is termed neurulation (figure 17.5d). Cell Migration During the next stage of vertebrate development, a variety of cells migrate to form distant tissues, following specific paths through the embryo to particular locations (figure 17.5e). These migrating cells include those of the neural crest, which pinch off from the neural tube and form a number of structures, including some of the body’s sense organs; cells that migrate from central blocks of muscle tissue called somites and form the skeletal muscles of the body; and the precursors of blood cells and gametes. When a migrating cell reaches its destination, receptor proteins on its surface interact with proteins on the sur- faces of cells in the destination tissue, triggering changes in the cytoskeleton of the migrating cell that cause it to cease moving. Organogenesis and Growth At the end of this wave of cell migration and colonization, the basic vertebrate body plan has been established, al- though the embryo is only a few millimeters long and has only about 10 5 cells. Over the course of subsequent devel- opment, tissues will develop into organs (figure 17.5f ), and the embryo will grow to be a hundred times larger, with a million times as many cells (figure 17.5g). Vertebrates develop in a highly orchestrated fashion. The zygote divides rapidly, forming a hollow ball of cells that then pushes inward, forming the main axis of an embryo that goes on to develop tissues, and after a process of cell migration, organs. Chapter 17 Cellular Mechanisms of Development 335 (g) Growth Formation of the Blastula The outermost blastomeres (figure 17.5a) in the ball of cells produced during cleavage are joined to one another by tight junctions, which, as you may recall from chapter 7, are belts of protein that encircle a cell and weld it firmly to its neighbors. These tight junctions create a seal that iso- lates the interior of the cell mass from the surrounding medium. At about the 16-cell stage, the cells in the interior of the mass begin to pump Na + from their cytoplasm into the spaces between cells. The resulting osmotic gradient causes water to be drawn into the center of the cell mass, enlarging the intercellular spaces. Eventually, the spaces coalesce to form a single large cavity within the cell mass. The resulting hollow ball of cells is called a blastula, or blastocyst in mammals (figure 17.5b). Gastrulation Some cells of the blastula then push inward, forming a gastrula that is invaginated. Cells move by using exten- sions called lamellipodia to crawl over neighboring cells, which respond by forming lamellipodia of their own. Soon a sheet of cells contracts on itself and shoves inward, starting the invagination. Called gastrulation (figure 17.5c), this process creates the main axis of the vertebrate body, converting the blastula into a bilaterally symmetri- cal embryo with a central gut. From this point on, the embryo has three germ layers whose organization fore- shadows the future organization of the adult body. The cells that invaginate and form the tube of the primitive gut are endoderm; they give rise to the stomach, lungs, Insect Development Like all animals, insects develop through an orchestrated series of cell changes, but the path of development is quite differ- ent from that of a vertebrate. Many in- sects produce two different kinds of bod- ies during their development, the first a tubular eating machine called a larva, and the second a flying machine with legs and wings. The passage from one body form to the other is called meta- morphosis and involves a radical shift in development. Here we will describe de- velopment in the fruit fly Drosophila (fig- ure 17.6), which is the subject of much genetic research. Maternal Genes The development of an insect like Drosophila begins before fertilization, with the construction of the egg. Spe- cialized nurse cells that help the egg to grow move some of their own mRNA into the end of the egg nearest them (figure 17.7a). As a result, mRNAs pro- duced by maternal genes are positioned in particular loca- tions in the egg, so that after repeated divisions subdivide the fertilized egg, different daughter cells will contain dif- ferent maternal products. Thus, the action of maternal (rather than zygotic) genes determines the initial course of development. Syncytial Blastoderm After fertilization, 12 rounds of nuclear division without cytokinesis produce about 6000 nuclei, all within a single cytoplasm. All of the nuclei within this syncytial blasto- derm (figure 17.7b) can freely communicate with one an- other, but nuclei located in different sectors of the egg ex- perience different maternal products. The nuclei then space themselves evenly along the surface of the blasto- derm, and membranes grow between them. Folding of the embryo and primary tissue development soon follow, in a process fundamentally similar to that seen in vertebrate de- velopment. The tubular body that results within a day of fertilization is a larva. Larval Instars The larva begins to feed immediately, and as it does so, it grows. Its chitinous exoskeleton cannot stretch much, how- ever, and within a day it sheds the exoskeleton. Before the new exoskeleton has had a chance to harden, the larva ex- pands in size. A total of three larval stages, or instars, are produced over a period of four days (figure 17.7c). Imaginal Discs During embryonic growth, about a dozen groups of cells called imaginal discs are set aside in the body of the larva (figure 17.7d). Imaginal discs play no role in the life of the larva, but are committed to form key parts of the adult fly’s body. Metamorphosis After the last larval stage, a hard outer shell forms, and the larva is transformed into a pupa (figure 17.7e). Within the pupa, the larval cells break down and release their nutrients, which are used in the growth and devel- opment of the various imaginal discs (eye discs, wing discs, leg discs, and so on). The imaginal discs then asso- ciate with one another, assembling themselves into the body of the adult fly (figure 17.7f ). The metamorphosis of a Drosophila larva into a pupa and then into adult fly takes about four days, after which the pupal shell splits and the fly emerges. Drosophila development proceeds through two discrete phases, the first a larval phase that gathers food, then an adult phase that is capable of flight and reproduction. 336 Part V Molecular Genetics FIGURE 17.6 The fruit fly, Drosophila melanogaster. A dorsal view of Drosophila, one of the most intensively studied animals in development. Chapter 17 Cellular Mechanisms of Development 337 Movement of maternal mRNA (a) Egg (b) Syncytial blastoderm Syncytial blastoderm (c) Larval instars (d) Imaginal discs (e) Metamorphosis (f) Adult Nurse cells Imaginal discs Oocyte Instars Larva Pupa Nuclei line up along surface and membranes grow between them Chitinous exoskeleton FIGURE 17.7 The path of insect development. An illustration of the major events in the development of Drosophila melanogaster. (a) Egg. (b) Syncytial blastoderm. (c) Larval instars. (d) Imaginal discs. (e) Metamorphosis. ( f ) Adult. Plant Development At the most basic level, the developmental paths of plants and animals share many key elements. However, the mech- anisms used to achieve body form are quite different. While animal cells follow an orchestrated series of move- ments during development, plant cells are encased within stiff cellulose walls, and, therefore, cannot move. Each cell in a plant is fixed into position when it is created. Instead of using cell migration, plants develop by building their bod- ies outward, creating new parts from special groups of self- renewing cells called meristems. As meristem cells contin- ually divide, they produce cells that can differentiate into the tissues of the plant. Another major difference between animals and plants is that most animals are mobile and can move away from unfavorable circumstances, while plants are anchored in position and must simply endure whatever environment they experience. Plants compensate for this restriction by relaxing the rules of development to accommodate local circumstances. Instead of creating a body in which every part is specified to have a fixed size and location, a plant assembles its body from a few types of modules, such as leaves, roots, branch nodes, and flowers. Each module has a rigidly controlled structure and organization, but how the modules are utilized is quite flexible. As a plant develops, it simply adds more modules, with the environ- ment having a major influence on the type, number, size, and location of what is added. In this way the plant is able to adjust the path of its development to local circumstances. Early Cell Division The first division of the fertilized egg in a flowering plant is off-center, so that one of the daughter cells is small, with dense cytoplasm (figure 17.8a). That cell, the future em- bryo, begins to divide repeatedly, forming a ball of cells. The other daughter cell also divides repeatedly, forming an elongated structure called a suspensor, which links the embryo to the nutrient tissue of the seed. The suspensor also provides a route for nutrients to reach the developing embryo. Just as the animal embryo acquires its initial axis as a cell mass formed during cleavage divisions, so the plant embryo forms its root-shoot axis at this time. Cells near the suspensor are destined to form a root, while those at the other end of the axis ultimately become a shoot. Tissue Formation Three basic tissues differentiate while the plant embryo is still a ball of cells (figure 17.8b), analogous to the formation of the three germ layers in animal embryos, although in plants, no cell movements are involved. The outermost cells in a plant embryo become epidermal cells. The bulk of the embryonic interior consists of ground tissue cells that eventually function in food and water storage. Lastly, cells at the core of the embryo are destined to form the fu- ture vascular tissue. Seed Formation Soon after the three basic tissues form, a flowering plant embryo develops one or two seed leaves called cotyle- dons. At this point, development is arrested, and the em- bryo is now either surrounded by nutritive tissue or has amassed stored food in its cotyledons (figure 17.8c). The resulting package, known as a seed, is resistant to drought and other unfavorable conditions; in its dormant state, it is a vehicle for dispersing the embryo to distant sites and al- lows a plant embryo to survive in environments that might kill a mature plant. Germination A seed germinates in response to changes in its environ- ment brought about by water, temperature, or other fac- tors. The embryo within the seed resumes development and grows rapidly, its roots extending downward and its leaf-bearing shoots extending upward (figure 17.8d). Meristematic Development Plants development exhibits its great flexibility during the assembly of the modules that make up a plant body. Apical meristems at the root and shoot tips generate the large numbers of cells needed to form leaves, flowers, and all other components of the mature plant (figure 17.8e). At the same time, meristems ensheathing the stems and roots produce the wood and other tissues that allow growth in circumference. A variety of hormones produced by plant tissues influence meristem activity and, thus, the develop- ment of the plant body. Plant hormones (see chapter 41) are the tools that allow plant development to adjust to the environment. Morphogenesis The form of a plant body is largely determined by con- trolled changes in cell shape as they expand osmotically after they form (see figure 17.8e). Plant growth-regulating hormones and other factors influence the orientation of bundles of microtubules on the interior of the plasma membrane. These microtubules seem to guide cellulose de- position as the cell wall forms around the outside of a new cell. The orientation of the cellulose fibers, in turn, deter- mines how the cell will elongate as it increases in volume, and so determines the cell’s final shape. In a developing plant, leaves, flowers, and branches are added to the growing body in ways that are strongly influenced by the environment. 338 Part V Molecular Genetics Chapter 17 Cellular Mechanisms of Development 339 (a) Early cell division (b) Tissue formation (c) Seed formation (d) Germination (e) Meristematic development and morphogenesis Embryo Embryo Epidermal cells Ground tissue cells Vascular tissue cells Apical meristem Cotyledons Suspensor Apical meristem Cotyledons Seed wall FIGURE 17.8 The path of plant development. An illustration of the developmental stages of Arabidopsis thaliana. (a) Early cell division. (b) Tissue formation. (c) Seed formation. (d) Germination. (e) Meristematic development and morphogenesis. Despite the many differences in the three developmental paths we have just discussed, it is becoming increasingly clear that most multicellular organisms develop according to molecular mechanisms that are fundamentally very simi- lar. This observation suggests that these mechanisms evolved very early in the history of multicellular life. Here, we will focus on six mechanisms that seem to be of particu- lar importance in the development of a wide variety of or- ganisms. We will consider them in roughly the order in which they first become important during development. Cell Movement and Induction Cell Movement Cells migrate during many stages in animal development, sometimes traveling great distances before reaching the site where they are destined to develop. By the time vertebrate development is complete, most tissues contain cells that originated from quite different parts of the early embryo. One way cells move is by pulling themselves along using cell adhesion molecules, such as the cadherin proteins you read about in chapter 7. Cadherins span the plasma mem- brane, protruding into the cytoplasm and extending out from the cell surface. The cytoplasmic portion of the mole- cule is attached to actin or intermediate filaments of the cy- toskeleton, while the extracellular portion has five 100- amino acid segments linked end-to-end; three or more of these segments have Ca ++ binding sites that play a critical role in the attachment of the cadherin to other cells. Over a dozen different cadherins have been discovered to date. Each type of cadherin attaches to others of its own type at its terminal segments, forming a two-cadherin link between the cytoskeletons of adjacent cells. As a cell migrates to a different tissue, the nature of the cadherin it expresses changes, and if cells expressing two different cadherins are mixed, they quickly sort themselves out, aggregating into two separate masses. This is how the different imaginal discs of a Drosophila larva assemble into an adult. Other calcium- independent cell adhesion molecules, such as the neural cell adhesion molecules (N-CAMs) expressed by migrating nerve cells, reinforce the associations made by cadherins, but cadherins play the major role in holding aggregating cells together. In some tissues, such as connective tissue, much of the volume of the tissue is taken up by the spaces between cells. These spaces are not vacant, however. Rather, they are filled with a network of molecules secreted by surrounding cells, principally, a matrix of long polysaccharide chains co- valently linked to proteins (proteoglycans), within which are embedded strands of fibrous protein (collagen, elastin, and fibronectin). Migrating cells traverse this matrix by binding to it with cell surface proteins called integrins, which was also described in chapter 7. Integrins are at- tached to actin filaments of the cytoskeleton and protrude out from the cell surface in pairs, like two hands. The “hands” grasp a specific component of the matrix such as collagen or fibronectin, thus linking the cytoskeleton to the fibers of the matrix. In addition to providing an anchor, this binding can initiate changes within the cell, alter the growth of the cytoskeleton, and change the way in which the cell secretes materials into the matrix. Thus, cell migration is largely a matter of changing pat- terns of cell adhesion. As a migrating cell travels, it contin- ually extends projections that probe the nature of its envi- ronment. Tugged this way and that by different tentative attachments, the cell literally feels its way toward its ulti- mate target site. 340 Part V Molecular Genetics 17.2 Multicellular organisms employ the same basic mechanisms of development. Ectoderm Neural cavity Wall of forebrain Optic cup Optic stalk Optic nerve Retina Lens Cornea Lens invagination FIGURE 17.9 Development of the vertebrate eye proceeds by induction. The eye develops as an extension of the forebrain called the optic stalk that grows out until it contacts the ectoderm. This contact induces the formation of a lens from the ectoderm. Induction In Drosophila the initial cells created by cleavage divisions contain different developmental signals (called determi- nants) from the egg, setting individual cells off on different developmental paths. This pattern of development is called mosaic development. In mammals, by contrast, all of the blastomeres receive equivalent sets of determinants; body form is determined by cell-cell interactions, a pattern called regulative development. We can demonstrate the importance of cell-cell inter- actions in development by separating the cells of an early blastula and allowing them to develop independently. Under these conditions, animal pole blastomeres develop features of ectoderm and vegetal pole blastomeres de- velop features of endoderm, but none of the cells ever de- velop features characteristic of mesoderm. However, if animal pole and vegetal pole cells are placed next to each other, some of the animal pole cells will develop as meso- derm. The interaction between the two cell types triggers a switch in the developmental path of the cells! When a cell switches from one path to another as a result of in- teraction with an adjacent cell, induction has taken place (figure 17.9). How do cells induce developmental changes in neigh- boring cells? Apparently, the inducing cells secrete proteins that act as intercellular signals. Signal molecules, which we discussed in detail in chapter 7, are capable of producing abrupt changes in the patterns of gene transcription. In some cases, particular groups of cells called organiz- ers produce diffusible signal molecules that convey posi- tional information to other cells. Organizers can have a profound influence on the development of surrounding tis- sues (see chapter 60). Working as signal beacons, they in- form surrounding cells of their distance from the organizer. The closer a particular cell is to an organizer, the higher the concentration of the signal molecule, or morphogen, it experiences (figure 17.10). Although only a few mor- phogens have been isolated, they are thought to be part of a widespread mechanism for determining relative position during development. A single morphogen can have different effects, depend- ing upon how far away from the organizer the affected cell is located. Thus, low levels of the morphogen activin will cause cells of the animal pole of an early Xenopus em- bryo to develop into epidermis, while slightly higher lev- els will induce the cells to develop into muscles, and levels a little higher than that will induce them to form noto- chord (figure 17.11). Cells migrate by extending probes to neighboring cells which they use to pull themselves along. Interactions between cells strongly influence the developmental paths they take. Signal molecules from an inducing cell alter patterns of transcription in cells which come in contact with it. Chapter 17 Cellular Mechanisms of Development 341 Organizer cells secreting morphogen Decreasing morphogen concentration gradient Distance from secretion site Concentration of morphogen Organ A Organ B Organ C Embryo FIGURE 17.10 An organizer creates a morphogen gradient. As a morphogen diffuses from the organizer site, it becomes less concentrated. Different concentrations of the morphogen stimulate the development of different organs. Develops into notochord Animal pole Vegetal pole Develops into muscle Secretion of morphogen Develops into epidermis FIGURE 17.11 Fate of cells in an early Xenopus embryo. The fates of the individual cells are determined by the concentration of morphogen washing over them. Determination The mammalian egg is symmetrical in its contents as well as its shape, so that all of the cells of an early blastoderm are equivalent up to the eight-cell stage. The cells are said to be totipotent, meaning that they are potentially capable of expressing all of the genes of their genome. If they are separated from one another, any one of them can produce a completely normal individual. Indeed, just this sort of pro- cedure has been used to produce sets of four or eight iden- tical offspring in the commercial breeding of particularly valuable lines of cattle. The reverse process works, too; if cells from two different eight-cell-stage embryos are com- bined, a single normal individual results. Such an individual is called a chimera, because it contains cells from different genetic lines (figure 17.12). Mammalian cells start to become different after the eight-cell stage as a result of cell-cell interactions like those we just discussed. At this point, the pathway that will influ- ence the future developmental fate of the cells is deter- mined. The commitment of a particular cell to a specialized developmental path is called determination. A cell in the prospective brain region of an amphibian embryo at the early gastrula stage has not yet been determined; if trans- planted elsewhere in the embryo, it will develop like its new neighbors (see chapter 60). By the late gastrula stage, however, determination has taken place, and the cell will develop as neural tissue no matter where it is transplanted. Determination must be carefully distinguished from differ- entiation, which is the cell specialization that occurs at the end of the developmental path. Cells may become deter- mined to give rise to particular tissues long before they ac- tually differentiate into those tissues. The cells of a Drosophila eye imaginal disc, for example, are fully deter- mined to produce an eye, but they remain totally undiffer- entiated during most of the course of larval development. The Mechanism of Determination What is the molecular mechanism of determination? The gene regulatory proteins discussed in detail in chapter 16 are the tools used by cells to initiate developmental changes. When genes encoding these proteins are acti- vated, one of their effects is to reinforce their own activa- tion. This makes the developmental switch deterministic, initiating a chain of events that leads down a particular de- velopmental pathway. Cells in which a set of regulatory genes have been activated may not actually undergo differ- entiation until some time later, when other factors interact with the regulatory protein and cause it to activate still other genes. Nevertheless, once the initial “switch” is thrown, the cell is fully committed to its future develop- mental path. Often, before a cell becomes fully committed to a partic- ular developmental path, it first becomes partially commit- ted, acquiring positional labels that reflect its location in the embryo. These labels can have a great influence on how the pattern of the body subsequently develops. In a chicken embryo, if tissue at the base of the leg bud (which would nor- mally give rise to the thigh) is transplanted to the tip of the identical-looking wing bud (which would normally give rise to the wing tip), that tissue will develop into a toe rather than a thigh! The tissue has already been determined as leg but is not yet committed to being a particu- lar part of the leg. Therefore, it can be influenced by the posi- tional signaling at the tip of the wing bud to form a tip (in this case a tip of leg). 342 Part V Molecular Genetics Homozygous white mouse embryo is removed from mother at eight-cell stage. Homozygous black mouse embryo is removed from mother at eight-cell stage. Protease enzymes are used to remove zona pellucida from each embryo. Incubated together at body temperature, the two embryos fuse. The 16-cell embryo continues development in vitro as a single embryo to blastocyst stage. The fusion blastocyst is transfered to a pseudopregnant foster mother. The chimeric baby mouse that develops in the foster mother has four parents (none of them is the foster mother). FIGURE 17.12 Constructing a chimeric mouse. Cells from two eight-cell individuals fuse to form a single individual. Is Determination Irreversible? Until very recently, biologists thought determination was irreversible. Exper- iments carried out in the 1950s and 1960s by John Gurdon and others made what seemed a convincing case: using very fine pipettes (hollow glass tubes) to suck the nucleus out of a frog or toad egg, these researchers replaced the egg nucleus with a nucleus sucked out of a body cell taken from another individual (see figure 14.3). If the transplanted nucleus was obtained from an advanced embryo, the egg went on to develop into a tadpole, but died before becoming an adult. Nuclear transplant experiments were attempted without success by many investigators, until finally, in 1984, Steen Willadsen, a Danish em- bryologist working in Texas, suc- ceeded in cloning a sheep using the nucleus from a cell of an early embryo. The key to his success was in picking a cell very early in development. This exciting result was soon replicated by others in a host of other organisms, including pigs and monkeys. Only early embryo cells seemed to work, however. Researchers became convinced, after many attempts to transfer older nuclei, that animal cells become irreversibly committed after the first few cell divisions of the devel- oping embryo. We now know this conclusion to have been unwarranted. The key ad- vance unraveling this puzzle was made in Scotland by geneticists Keith Campbell and Ian Wilmut, who rea- soned that perhaps the egg and the donated nucleus needed to be at the same stage in the cell cycle. They removed mammary cells from the udder of a six-year-old sheep. The origin of these cells gave the clone its name, “Dolly,” after the country singer Dolly Parton. The cells were grown in tissue culture; then, in preparation for cloning, the re- searchers substantially reduced for five days the concentra- tion of serum nutrients on which the sheep mammary cells were subsisting. Starving the cells caused them to pause at the beginning of the cell cycle. In parallel preparation, eggs obtained from a ewe were enucleated (figure 17.13). Mammary cells and egg cells were then surgically com- bined in January of 1996, inserting the mammary cells in- side the covering around the egg cell. The researchers then applied a brief electrical shock. This caused the plasma membranes surrounding the two cells to become leaky, so that the nucleus of the mammary cell passed into the egg cell—a neat trick. The shock also kick-started the cell cycle, causing the cell to begin to divide. After six days, in 30 of 277 tries, the dividing embryo reached the hollow-ball “blastula” stage, and 29 of these were transplanted into surrogate mother sheep. A little over five months later, on July 5, 1996, one sheep gave birth to a lamb, Dolly, the first clone generated from a fully differentiated animal cell. Dolly established beyond all dispute that determination is reversible, that with the right techniques the fate of a fully differentiated cell can be altered. The commitment of particular cells to certain developmental fates is fully reversible. Chapter 17 Cellular Mechanisms of Development 343 Mammary cell is extracted and grown in nutrient-deficient media that arrests cell cycle Nucleus containing source DNA Mammary cell is inserted inside covering of egg cell Egg cell is extracted and nucleus removed from egg cell with a micropipette Electric shock opens cell membranes and triggers cell division Embryo begins to develop in vitro Blastula stage embryo Embryo is implanted into surrogate mother After a five-month pregnancy, a lamb genetically identical to the sheep the mammary cell was extracted from is born FIGURE 17.13 Proof that determination is reversible. This experiment by Campbell and Wilmut was the first successful cloning of an adult animal. Pattern Formation All animals seem to use positional information to deter- mine the basic pattern of body compartments and, thus, the overall architecture of the adult body. How is positional in- formation encoded in labels and read by cells? To answer this question, let us consider how positional labels are used in pattern formation in Drosophila. The Nobel Prize in Physiology or Medicine was awarded in 1995 for the un- raveling of this puzzle. As we noted previously, a Drosophila egg acquires an ini- tial asymmetry long before fertilization as a result of mater- nal mRNA molecules that are deposited in one end of the egg by nurse cells. Part of this maternal mRNA, from a gene called bicoid, remains near its point of entry, marking what will become the embryo’s front end. Fertilization causes this mRNA to be translated into bicoid protein, which diffuses throughout the syncytial blastoderm, form- ing a morphogen gradient. Mothers unable to make bicoid protein produce embryos without a head or thorax (in ef- fect, these embryos are two-tailed, or bicaudal—hence the name “bicoid”). Bicoid protein establishes the anterior (front) end of the embryo. If bicoid protein is injected into the anterior end of mutant embryos unable to make it, the 344 Part V Molecular Genetics H T A Establishing polarity of the embryo: Fertilization of the egg triggers the production of bicoid protein from maternal RNA in the egg. The bicoid protein diffuses through the egg, forming a gradient. This gradient determines the polarity of the embryo, with the head and thorax developing in the zone of high concentration (yellow through red). Setting the stage for segmentation: About 2 1 /2 hours after fertilization, bicoid protein turns on a series of brief signals from so-called gap genes. The gap proteins act to divide the embryo into large blocks. In this photo, fluorescent dyes in antibodies that bind to the gap proteins Krüppel (red) and hunchback (green) make the blocks visible; the region of overlap is yellow. Laying down the fundamental regions: About 1 /2 hour later, the gap genes switch on a so-called “pair- rule” gene called hairy. Hairy produces a series of boundaries within each block, dividing the embryo into seven fundamental regions. Forming the segments: The final stage of segmentation occurs when a “segment- polarity” gene called engrailed divides each of the seven regions into halves, producing 14 narrow compartments. Each compartment corresponds to one segment of the future body. There are three head segments (H, top left), three thoracic segments (T, lower left), and eight abdominal segments (A, from bottom left to upper right). FIGURE 17.14 Body organization in an early Drosophila embryo. In these images by 1995 Nobel laureate, Christiane Nüsslein-Volhard, and Sean Carroll, we watch a Drosophila egg pass through the early stages of development, in which the basic segmentation pattern of the embryo is established. embryos will develop normally. If it is injected into the op- posite (posterior) end of normal embryos, a head and tho- rax will develop at that end. Bicoid protein exerts this profound effect on the organi- zation of the embryo by activating genes that encode the first mRNAs to be transcribed after fertilization. Within the first two hours, before cellularization of the syncytial blastoderm, a group of six genes called the gap genes be- gins to be transcribed. These genes map out the coarsest subdivision of the embryo (figure 17.14). One of them is a gene called hunchback (because an embryo without hunch- back lacks a thorax and so, takes on a hunched shape). Al- though hunchback mRNA is distributed throughout the em- bryo, its translation is controlled by the protein product of another maternal mRNA called nanos (named after the Greek word for “dwarf,” as mutants without nanos genes lack abdominal segments and hence, are small). The nanos protein binds to hunchback mRNA, preventing it from being translated. The only place in the embryo where there is too little nanos protein to block translation of hunchback mRNA is the far anterior end. Consequently, hunchback protein is made primarily at the anterior end of the em- bryo. As it diffuses back toward the posterior end, it sets up a second morphogen gradient responsible for establishing the thoracic and abdominal segments. Other gap genes act in more posterior regions of the embryo. They, in turn, activate 11 or more pair-rule genes. (When mutated, each of these genes alters every other body segment.) One of the pair-rule genes, named hairy, produces seven bands of protein, which look like stripes when visualized with fluorescent markers. These bands establish boundaries that divide the embryo into seven zones. Finally, a group of 16 or more segment po- larity genes subdivide these zones. The engrailed gene, for example, divides each of the seven zones established by hairy into anterior and posterior compartments. The 14 compartments that result correspond to the three head seg- ments, three thoracic segments, and eight abdominal seg- ments of the embryo. Thus, within three hours after fertilization, a highly or- chestrated cascade of segmentation gene activity produces the fly embryo’s basic body plan. The activation of these and other developmentally important genes (figure 17.15) depends upon the free diffusion of morphogens that is pos- sible within a syncytial blastoderm. In mammalian embryos with cell partitions, other mechanisms must operate. In Drosophila diffusion of chemical inducers produces the embryo’s basic body plan, a cascade of genes dividing it into 14 compartments. Chapter 17 Cellular Mechanisms of Development 345 (a) (d) (e)(b) (c) (f) FIGURE 17.15 A gene controlling organ formation in Drosophila. Called tinman, this gene is responsible for the formation of gut musculature and the heart. The dye shows expression of the tinman in five-hour (a) and seventeen- hour (b) Drosophila embryos. The gut musculature then appears along the edges of normal embryos (c) but is not present in embryos in which the gene has been mutated (d). The heart tissue develops along the center of normal embryos (e) but is missing in tinman mutant embryos (f ). Expression of Homeotic Genes After pattern formation has successfully established the number of body segments in Drosophila, a series of homeotic genes act as master switches to determine the forms these segments will assume. Homeotic genes code for proteins that function as transcription factors. Each homeotic gene activates a particular module of the genetic program, initiating the production of specific body parts within each of the 14 compartments. Homeotic Mutations Mutations in homeotic genes lead to the appearance of per- fectly normal body parts in unusual places. Mutations in bithorax (figure 17.16), for example, cause a fly to grow an extra pair of wings, as if it had a double thoracic segment, and mutations in Antennapedia cause legs to grow out of the head in place of antennae! In the early 1950s, geneticist Edward Lewis discovered that several homeotic genes, in- cluding bithorax, map together on the third chromosome of Drosophila, in a tight cluster called the bithorax complex. 346 Part V Molecular Genetics FIGURE 17.16 Mutations in homeotic genes. Three separate mutations in the bithorax gene caused this fruit fly to develop an extra thoracic segment, with accompanying wings. Compare this photograph with that of the normal fruit fly in figure 17.6. Mutations in these genes all affect body parts of the tho- racic and abdominal segments, and Lewis concluded that the genes of the bithorax complex control the development of body parts in the rear half of the thorax and all of the ab- domen. Most interestingly, the order of the genes in the bithorax complex mirrors the order of the body parts they control, as if the genes are activated serially! Genes at the beginning of the cluster switch on development of the tho- rax, those in the middle control the anterior part of the ab- domen, and those at the end affect the tip of the abdomen. A second cluster of homeotic genes, the Antennapedia complex, was discovered in 1980 by Thomas Kaufmann. The Antennapedia complex governs the anterior end of the fly, and the order of genes in it also corresponds to the order of segments they control (figure 17.17). The Homeobox Drosophila homeotic genes typically contain the home- obox, a sequence of 180 nucleotides that codes for a 60- amino acid DNA-binding peptide domain called the home- odomain (figure 17.18). As we saw in chapter 16, proteins that contain the homeodomain function as transcription factors, ensuring that developmentally related genes are transcribed at the appropriate time. Segmentation genes such as bicoid and engrailed also contain the homeobox se- quence. Clearly, the homeobox distinguishes those portions of the genome devoted to pattern formation. Chapter 17 Cellular Mechanisms of Development 347 FIGURE 17.17 Drosophila homeotic genes. Called the homeotic gene complex, or HOM complex, the genes are grouped into two clusters, the Antennapedia complex (anterior) and the bithorax complex (posterior). Dfd abd-Babd-A pb lab Scr Antp Ubx Drosophila HOM genes Drosophila embryo ThoraxHead Abdomen Variable region Hinge region Homeodomain COOH H 2 N Helices 1 2 4 3 FIGURE 17.18 Homeodomain protein. This protein plays an important regulatory role when it binds to DNA and regulates expression of specific genes. The variable region of the protein determines the specific activity of the protein. Also included in this protein is a small hinge region and the homeodomain, a 60-amino-acid sequence common to all proteins of this type. The homeodomain region of the protein is coded for by the homeobox region of genes and is composed of four α helices. One of the helices recognizes and binds to a specific DNA sequence in target genes. Evolution of Homeobox Genes Since their initial discovery in Drosophila, homeotic genes have also been found in mice and humans, which are separated from insects by over 600 million years of evolution. Their presence in mammals and insects indicates that homeotic genes governing the positioning of body parts must have arisen very early in the evolu- tionary history of animals. Similar genes also appear to operate in flowering plants. Gene probes made using the homeobox sequence of Drosophila have been used to identify very similar sequences in a wide variety of other organisms, including frogs, mice, humans, cows, chickens, bee- tles, and even earthworms. Mice and hu- mans have four clusters of homeobox- containing genes, called Hox genes in mice. Just as in flies, the homeotic genes of mammals appear to be lined up in the same order as the segments they control (figure 17.19). Thus, the ordered nature of homeotic gene clusters is highly con- served in evolution (figure 17.20). There is a total of 38 Hox genes in the four homeotic clusters of a mouse, and we are only beginning to understand how they interact. Homeotic genes encode transcription factors that activate blocks of genes specifying particular body parts. 348 Part V Molecular Genetics Fruit fly Fruit fly embryo Mouse embryo Mouse HOM fly chromosome Mouse chromosomes Hox 1 Hox 2 Hox 3 Hox 4 pblab Dfd Scr Antp abd-Babd-A Ubx FIGURE 17.19 A comparison of homeotic gene clusters in the fruit fly Drosophila melanogaster and the mouse Mus musculus. Similar genes, the Drosophila HOM genes and the mouse Hox genes, control the development of front and back parts of the body. These genes are located on a single chromosome in the fly, and on four separate chromosomes in mammals. The genes are color-coded to match the parts of the body in which they are expressed. FIGURE 17.20 The remarkably conserved homeobox series. By inserting a mouse homeobox- containing gene into a fruit fly, a mutant fly (right) can be manufactured with a leg (arrow) growing from where its antenna would be in a normal fly (left). Programmed Cell Death Not every cell that is produced during development is des- tined to survive. For example, the cells between your fin- gers and toes die; if they did not, you would have paddles rather than digits. Vertebrate embryos produce a very large number of neurons, ensuring that there are enough neu- rons to make all of the necessary synaptic connections, but over half of these neurons never make connections and die in an orderly way as the nervous system develops. Unlike accidental cell deaths due to injury, these cell deaths are planned for and indeed required for proper development. Cells that die due to injury typically swell and burst, releas- ing their contents into the extracellular fluid. This form of cell death is called necrosis. In contrast, cells programmed to die shrivel and shrink in a process called apoptosis (from the Greek word meaning shedding of leaves in au- tumn), and their remains are taken up by surrounding cells. Gene Control of Apoptosis This sort of developmentally regulated cell suicide occurs when a “death program” is activated. All animal cells ap- pear to possess such programs. In the nematode worm, for example, the same 131 cells always die during development in a predictable and reproducible pattern of apoptosis. Three genes govern this process. Two (ced-3 and ced-4) constitute the death program itself; if either is mutant, those 131 cells do not die, and go on instead to form ner- vous and other tissue. The third gene (ced-9) represses the death program encoded by the other two (figure 17.21a). The same sorts of apoptosis programs occur in human cells: the bax gene encodes the cell death program, and an- other, an oncogene called bcl-2, represses it (figure 17.21b). The mechanism of apoptosis appears to have been highly conserved during the course of animal evolution. The protein made by bcl-2 is 25% identical in amino acid se- quence to that made by ced-9. If a copy of the human bcl-2 gene is transferred into a nematode with a defective ced-9 gene, bcl-2 suppresses the cell death program of ced-3 and ced-4! How does bax kill a cell? The bax protein seems to in- duce apoptosis by binding to the permeability pore of the cell’s mitochondria, increasing its permeability and in doing so triggering cell death. How does bcl-2 prevent cell death? One suggestion is that it prevents damage from free radicals, highly reactive fragments of atoms that can dam- age cells severely. Proteins or other molecules that destroy free radicals are called antioxidants. Antioxidants are al- most as effective as bcl-2 in blocking apoptosis. Animal development involves programmed cell death (apoptosis), in which particular genes, when activated, kill their cells. Chapter 17 Cellular Mechanisms of Development 349 ced-3 protein ced-4 protein ced-3 protein ced-4 protein Nematode Human + + ced-3 ced-4 ced-9 ced-3 ced-4 ced-9 Death program No death program Death program No death program bax bax protein bax protein bcl-2 bax bcl-2 FIGURE 17.21 Programmed cell death. Apoptosis, or programmed cell death, is necessary for normal development of all animals. (a) In the developing nematode, for example, two genes, ced-3 and ced-4, code for proteins that cause the programmed cell death of 131 specific cells. In the other cells of the developing nematode, the product of a third gene, ced-9, represses the death program encoded by ced-3 and ced-4. (b) In developing humans, the product of a gene called bax causes a cell death program in some cells and is blocked by the bcl-2 gene in other cells. (a) (b) The Mouse Some of the most elegant investiga- tions of the cellular mechanisms of development are being done with mammals, particularly the mouse Mus musculus. Mice have a battery of homeotic genes, the Hox genes (fig- ure 17.22), which seem to be closely related to the homeotic genes of Drosophila. Very interestingly, not only do the same genes occur, but they also seem to operate in the same order! Clearly, the homeotic gene system has been highly con- served during the course of animal evolution. What lends great power to this developmental model system is the ability to create chimeric mice con- taining cells from two different ge- netic lines. Mammalian embryos are unusual among vertebrates in that they arise from symmetrical eggs; there are no chemical gradients, and during the initial cleavage divisions, all of the daughter cells are identical. Up to the eight-cell stage, any one of the cells, if isolated, will form a normal adult. Moreover, two differ- ent eight-cell-stage embryos can be fused to form a single embryo that will go on to form a normal adult. The resulting adult is a chimera, containing cells from both embryos. In a very real sense, these chimeric mice each have four parents! The Hox genes control body part development in mice. 350 Part V Molecular Genetics 17.3 Four model developmental systems have been extensively researched. Mouse chromosomes Hox 4 Hox 3 Hox 2 Hox 1 FIGURE 17.22 Studying development in the mouse. Chapter 17 Cellular Mechanisms of Development 351 Mouse embryo Adult mouse Drosophila egg bicoid Krüppel knirps hunchback even-skipped fushi-tarazu engrailed The Fruit Fly The tiny fruit fly Drosophila melanogaster has been a favorite of geneticists for over 90 years and is now playing a key role in our growing understanding of the cellular mecha- nisms of development. Over the last 10 years, researchers have pieced together a fairly complete picture of how genes expressed early in fruit fly development determine the pat- tern of the adult body (figure 17.23). The major parts of the adult body are determined as patches of tissue called imaginal discs that float within the body of the larva; dur- ing the pupal stage, these discs grow, develop, and associate to form the adult body. The adult Drosophila body is divided into 17 segments, some bearing jointed appendages such as wings or legs. These segments are established during very early develop- ment, before the many nuclei of the blastoderm are fully separated from one another. Chemical gradients, estab- lished within the egg by material from the mother, create a polarity that directs embryonic development. Reacting to this gradient, a series of segmentation genes progressively subdivide the embryo, first into four broad stripes, and then into 7, 14, and finally 17 segments. Within each segment, the development of key body parts is under the control of homeotic genes that determine where the body part will form. As we have seen, there are two clusters of homeotic genes, one called Antennapedia that governs the front (anterior) end of the body, and an- other called bithorax that governs the rear (posterior) end. The organization of genes within each cluster corresponds nicely with the order of the segments they affect. A very similar set of homeotic genes governs body architecture in mice and humans. A series of segmentation genes divides a Drosophila embryo into parts; Antennapedia genes control anterior development, and bithorax genes control the development of the posterior. FIGURE 17.23 Studying development in the fruit fly. Drosophila embryo Adult fly Lip Lip Larva with imaginal discs Mouthparts Mouthparts Prothorax Antenna Eye Leg (3) Wing Rudimentary wing Genital Antp ftz Tuba 84B Scr Dfd tRNA:lys5:84AB ama bcd lab Zen Zen2 Bithorax complex (Posterior) Antennapedia complex (Anterior) 3R chromosome abd-Babd-AUbx AntpScrDfdpblab 354 Part V Molecular Genetics Cuticle Gonad Nervous system Pharynx Cuticle-making cells The Nematode One of the most powerful models of animal development is the tiny nematode Caenorhabditis elegans. Only about 1 mm long, it consists of 959 somatic cells and has about the same amount of DNA as Drosophila. The entire genome has been mapped as a series of overlapping fragments, and a serious effort is underway to determine the complete DNA se- quence of the genome. Because C. elegans is transparent, individual cells can be followed as they divide. By observing them, researchers have learned how each of the cells that make up the adult worm is derived from the fertilized egg. As shown on this lineage map (figure 17.24), the egg divides into two, and then its daughter cells continue to divide. Each horizontal line on the map represents one round of cell division. The length of each vertical line represents the time between cell divisions, and the end of each vertical line represents one fully differentiated cell. In figure 17.24, the major organs of the worm are color-coded to match the colors of the corre- sponding groups of cells on the lineage map. Some of these differentiated cells, such as some of the cells that generate the worm’s external cuticle, are “born” after only 8 rounds of cell division; other cuticle cells require as many as 14 rounds. The cells that make up the worm’s pharynx, or feeding organ, are born after 9 to 11 rounds of division, while cells in the gonads require up to 17 divisions. Exactly 302 nerve cells are destined for the worm’s ner- vous system. Exactly 131 cells are programmed to die, mostly within minutes of their birth. The fate of each cell is the same in every C. elegans individual, except for the cells that will become eggs and sperm. The nematode develops 959 somatic cells from a single fertilized egg in a carefully orchestrated series of cell divisions which have been carefully mapped by researchers. FIGURE 17.24 Studying development in the nematode. Chapter 17 Cellular Mechanisms of Development 355 Vulva Intestine Sperm Nervous system Pharynx Vulva Egg Intestine Gonad Egg and sperm line The Flowering Plant Scientists are only beginning to unravel the molecular biol- ogy of plant development, largely through intensive recent study of a small weedy relative of the mustard plant, the wall cress Arabidopsis thaliana. Easy to grow and cross, and with a short generation time, Arabidopsis makes an ideal model for investigating plant development. It is able to self-fertilize, like Mendel’s pea plants, making genetic analysis convenient. Arabidopsis can be grown indoors in test tubes, a single plant producing thousands of offspring after only two months. Its genome is approximately the same size as those of the nematode Caenorhabditis elegans and the fruit fly Drosophila melanogaster. An ordered library of Arabidopsis gene clones was made available to researchers in 1997, and the full genome sequence was completed in 1999. Pattern Formation Much of the current work investigating Arabidopsis devel- opment has centered on obtaining and studying muta- tions that alter the plant’s development. Many different sorts of mutations have been identified. Some of the most interesting of them alter the basic architecture of the em- bryo, the pattern of tissues laid down as the embryo first forms. Mutations in over 50 different genes that alter pattern formation in Arabidopsis embryos are now known, affecting every stage of development. While work in this area is still very preliminary, it appears that the mecha- nisms that establish patterns in the early Arabidopsis em- bryo are broadly similar to those known to function in animal development. Organ Formation Importantly, the subsequent development of organs in Arabidopsis also seems to parallel organ development in animals, and a similar set of regulatory genes control de- velopment in Arabidopsis, Drosophila, and mice. Arabidopsis flowers, for example, are modified leaves formed as four whorls in a specific order, and homeotic mutations have been identified that convert one part of the pattern to another, just as they do in the body segments of a fly (figure 17.25). Scientists are only beginning to understand the molecular biology of plant development. In broad outline, it appears quite similar to the development in animals. The genes that determine pattern formation and organ development, for example, operate in the same way in plants and animals. 356 Part V Molecular Genetics Mutation: class B genes not functioning Floral meristem Homeotic mutant flower Whorl 1 sepal (A) Whorl 2 petal (A and B) Class A genes expressed in meristem Class B genes expressed in meristem Class C genes expressed in meristem Whorl 3 stamen (B and C) Whorl 4 carpel (C) FIGURE 17.25 Studying development in a flowering plant. Chapter 17 Cellular Mechanisms of Development 357 Normal flower Shoot apical meristem Stamen Carpel Petal Sepal Root apical meristem Cotyledon (seed leaf) Theories of Aging All humans die. The oldest documented person, Jeanne Louise Calment of Arles, France, reached the age of 122 years before her death in 1997. The “safest” age is around puberty. As you can see in figure 17.26, 10- to 15-year-olds have the lowest risk of dying. The death rate begins to in- crease rapidly after puberty; the rate of mortality then be- gins to increase as an exponential function of increasing age. Plotted on a log scale as in figure 17.26 (in a so-called Gompertz plot), the mortality rate increases as a straight line from about 15 to 90 years, doubling about every eight years (the “Gompertz number”). By the time we reach 100, age has taken such a toll that the risk of dying reaches 50% per year. A wide variety of theories have been advanced to explain why humans and other animals age. No one theory has gained general acceptance, but the following four are being intensively investigated: Accumulated Mutation Hypothesis The oldest general theory of aging is that cells accumulate mutations as they age, leading eventually to lethal damage. Careful studies have shown that somatic mutations do in- deed accumulate during aging. As cells age, for example, they tend to accumulate the modified base 8-hydroxygua- nine, in which an —OH group is added to the base gua- nine. There is little direct evidence, however, that these mutations cause aging. No acceleration in aging occurred among survivors of Hiroshima and Nagasaki despite their enormous added mutation load, arguing against any gen- eral relationship between mutation and aging. Telomere Depletion Hypothesis In a seminal experiment carried out in 1961, Leonard Hayflick demonstrated that fibroblast cells growing in tis- sue culture will divide only a certain number of times (fig- ure 17.27). After about 50 population doublings, cell divi- sion stops, the cell cycle blocked just before DNA replication. If a cell sample is taken after 20 doublings and frozen, when thawed it resumes growth for 30 more dou- blings, then stops. An explanation of the “Hayflick limit” was suggested in 1986 when Howard Cooke first glimpsed an extra length of DNA at the ends of chromosomes. These telomeric regions, repeats of the sequence TTAGGG, were found to be substantially shorter in older somatic tissue, and Cooke speculated that a 100 base-pair portion of the telomere cap was lost by a chromosome during each cycle of DNA replication. Eventually, after some 50 replication cycles, the protective telomeric cap would be used up, and the cell line would then enter senescence, no longer able to proliferate. Cancer cells appear to avoid telomeric shortening. Research reported in 1998 has confirmed Cooke’s hy- pothesis, providing direct evidence for a causal relation be- tween telomeric shortening and cell senescence. Using ge- netic engineering, researchers transferred into human primary cell cultures a gene that leads to expression of telomerase, an enzyme that builds TTAGGG telomeric caps. The result was unequivocal. New telomeric caps were added to the chromosomes of the cells, and the cells with the artificially elongated telomeres did not senesce at the Hayflick limit, continuing to divide in a healthy and vigor- ous manner for more than 20 additional generations. Wear-and-Tear Hypothesis Numerous theories of aging focus in one way or another on the general idea that cells wear out over time, accumulating damage until they are no longer able to function. Loosely dubbed the “wear-and-tear” hypothesis, this idea implies that there is no inherent designed-in limit to aging, just a statistical one—over time, disruption, wear, and damage eventually erode a cell’s ability to function properly. 358 Part V Molecular Genetics 17.4 Aging can be considered a developmental process. Age (years) Deaths per 1000 men per year 0.5 1.0 2 5 10 20 50 100 200 500 1000 0.3 0 1020304050607080 India, 1900 Sweden, 1949 United States, 1900 United States, 1940 United States, 1950 Mexico, 1940 FIGURE 17.26 Gompertz curves. While human populations may differ 25-fold in their mortality rates before puberty, the slopes of their Gompertz curves are about the same in later years. There is considerable evidence that aging cells do accu- mulate damage. Some of the most interesting evidence concerns free radicals, fragments of molecules or atoms that contain an unpaired electron. Free radicals are very re- active chemically and can be quite destructive in a cell. Free radicals are produced as natural by-products of oxidative metabolism, but most are mopped up by special enzymes that function to sweep the cell interior free of their de- structive effects. One of the most damaging free radical reactions that oc- curs in cells causes glucose to become linked to proteins, a nonenzymatic process called glycation. Two of the most commonly glycated proteins are collagen and elastin, key components of the connective tissues in our joints. Gly- cated collagen and elastin are not replaced, and individual molecules may be as old as the individual. Glycation of collagen, elastin, and a diverse collection of other proteins within the cell produces a complex mixture of glucose-linked proteins called advanced glycosylation end products (AGEs). AGEs can cross-link to one another, reducing the flexibility of connective tissues in the joints and producing many of the other characteristic symptoms of aging. Gene Clock Hypothesis There is very little doubt that at least some aspects of aging are under the direct control of genes. Just as genes regulate the body’s development, so they appear to regulate its rate of aging. Mutations in these genes can produce premature aging in the young. In the very rare recessive Hutchinson- Gilford syndrome, growth, sexual maturation, and skeletal development are retarded; atherosclerosis and strokes usu- ally lead to death by age 12 years. Only some 20 cases have ever been described. The similar Werner’s syndrome is not as rare, affect- ing some 10 people per million worldwide. The syn- drome is named after Otto Werner, who in Germany in 1904 reported a family affected by premature aging and said a genetic component was at work. Werner’s syn- drome makes its appearance in adolescence, usually pro- ducing death before age 50 of heart attack or one of a va- riety of rare connective tissue cancers. The gene responsible for Werner’s syndrome was identified in 1996. Located on the short arm of chromosome 8, it seems to affect a helicase enzyme involved in the repair of DNA. The gene, which codes for a 1432-amino-acid protein, has been fully sequenced, and four mutant alle- les identified. Helicase enzymes are needed to unwind the DNA double helix whenever DNA has to be repli- cated, repaired, or transcribed. The high incidence of certain cancers among Werner’s syndrome patients leads investigators to speculate that the mutant helicase may fail to activate critical tumor suppressor genes. The po- tential role of helicases in aging is the subject of heated research. Research on aging in other animals strongly supports the hypothesis that genes regulate the rate of aging. Partic- ularly impressive results have been obtained in the nema- tode Caenorhabditis elegans, where genes discovered in 1996 seem to affect an intrinsic genetic clock. A combination of mutations can increase the worm’s lifespan fivefold, the largest increase in lifespan seen in any organism! Mutations in the clock gene clk-1 cause individual cells to divide more slowly, and the animal spends more time in each phase of its life cycle. Mutations in two other clock genes, clk-2 and clk-3, have similar effects. Nematodes with mutations in two of the clock genes lived three to four times longer than normal. It seems that slowing life down in nematodes ex- tends it. Perhaps, as the “wear-and-tear” theory suggests, aging results from damage to cells and their DNA by highly reactive oxidative by-products of metabolism. Living more slowly, destructive by-products may be produced less frequently, accumulate more slowly, and their damage be repaired more efficiently. Similar genes have been reported in yeasts, and attempts are now underway to isolate and clone these genes. Among the many theories advanced to explain aging, many involve the progressive accumulation of damage to DNA. When genes affecting aging have been isolated, they affect DNA repair processes. Chapter 17 Cellular Mechanisms of Development 359 Relative growth rate Diploid fibroblasts Cancer cells III II I 12345 Months 6 7 8 9 10 11 12 Transfers to new plates 10 20 30 40 50 FIGURE 17.27 Hayflick’s experiment. Fibroblast cells stop growing after about 50 doublings. Growth is rapid in phases I and II, but slows in phase III, as the culture becomes senescent, until the final doubling. Cancer cells, by contrast, do not “age.” 360 Part V Molecular Genetics Chapter 17 Summary Summary Questions Media Resources 17.1 Development is a regulated process. ? Vertebrate development is initiated by a rapid cleavage of the fertilized egg into a hollow ball of cells, the blastula. Cell movements then form primary germ layers and organize the structure of the embryo. ? Cells determined in the insect embryo are carried within the body of larvae as imaginal discs, which are assembled into the adult body during pupation. ? Plant meristems continuously produce new tissues, which then differentiate into body parts. This differentiation is significantly influenced by the environment. 1. What is cleavage? How does the type of cleavage influence subsequent embryonic development? 2. What is a blastula? How does it form and what does it turn into? 3. What is a gastrula? Where are the germ layers in a gastrula? 4. What is neurulation? How and when does it occur? ? Cell movement in animal development is carried out by altering a cell’s complement of surface adhesion molecules, which it uses to pull itself over other cells. ? A key to animal development is the ability of cells to alter the developmental paths of adjacent cells, a process called induction. Induction is achieved by diffusible chemicals called morphogens. ? Determination of a cell’s ultimate developmental fate often involves the addition to it of positional labels that reflect its location in the embryo. ? The location of structures within body segments is dictated by a spatially organized assembly of homeotic genes, first discovered in Drosophila but now known to occur in all animals. ? Many cells are genetically programmed to die, usually soon after they are formed during development, in a process called apoptosis. 5. What role do cadherins and integrins play in cell movement? 6. What is the difference between mosaic development and regulative development? 7. How do organizers and morphogens participate in induction? 8. How is determination distinguished from differentiation? 9. What role does maternal mRNA play in the development of a Drosophila embryo? 10. What are homeotic genes and what do they do? 17.2 Multicellular organisms employ the same basic mechanisms of development. ? The four most intensively studied model systems of development are the mouse Mus musculus, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and the flowering plant Arabidopsis thaliana. 11. What are the major differences between vertebrate, insect, and plant developmental pathways? What are the similarities? 17.3 Four model developmental systems have been extensively researched. ? Aging is not well understood, although not for want of theories, most of which involve progressive damage to DNA. 12. Cancer cell cultures never seem to grow old, dividing ceaselessly. What can you deduce about the state of their telomerase gene? 17.4 Aging can be considered a developmental process. www.mhhe.com www.biocourse.com ? Introduction to Development ? Vertebrate Limb Formation ? Induction ? Pattern Formation 361 18 Altering the Genetic Message Concept Outline 18.1 Mutations are changes in the genetic message. Mutations Are Rare But Important. Changes in genes provide the raw material for evolution. Kinds of Mutation. Some mutations alter genes themselves, others alter the positions of genes. Point Mutations. Radiation damage or chemical modification can change one or a few nucleotides. Changes in Gene Position. Chromosomal rearrangement and insertional inactivation reflect changes in gene position. 18.2 Cancer results from mutation of growth- regulating genes. What Is Cancer? Cancer is a growth disorder of cells. Kinds of Cancer. Cancer occurs in almost all tissues, but more in some than others. Some Tumors Are Caused by Chemicals. Chemicals that mutate DNA cause cancer. Other Tumors Result from Viral Infection. Viruses carrying growth-regulating genes can cause cancer. Cancer and the Cell Cycle. Cancer results from mutation of genes regulating cell proliferation Smoking and Cancer. Smoking causes lung cancer. Curing Cancer. New approaches offer promise of a cure. 18.3 Recombination alters gene location. An Overview of Recombination. Recombination is produced by gene transfer and by reciprocal recombination. Gene Transfer. Many genes move within small circles of DNA called plasmids. Plasmids can move between bacterial cells and carry bacterial genes. Some gene sequences move from one location to another on a chromosome. Reciprocal Recombination. Reciprocal recombination can alter genes in several ways. Trinucleotide Repeats. Increases in the number of repeated triplets can produce gene disorders. 18.4 Genomes are continually evolving. Classes of Eukaryotic DNA. Unequal crossing over expands eukaryotic genomes. I n general, the genetic message can be altered in two broad ways: mutation and recombination. A change in the content of the genetic message—the base sequence of one or more genes—is referred to as a mutation. Some mu- tations alter the identity of a particular nucleotide, while others remove or add nucleotides to a gene. A change in the position of a portion of the genetic message is referred to as recombination. Some recombination events move a gene to a different chromosome; others alter the location of only part of a gene. In this chapter, we will first consider gene mutation, using cancer as a focus for our inquiry (fig- ure 18.1). Then we will turn to recombination, focusing on how it has affected the organization of the eukaryotic genome. FIGURE 18.1 Cancer. A scanning electron micrograph of deadly cancer cells (8000×). Evolution can be viewed as the selection of particular combinations of alleles from a pool of alternatives. The rate of evolution is ultimately limited by the rate at which these alternatives are generated. Genetic change through mutation and recombination provides the raw material for evolution. Genetic changes in somatic cells do not pass on to off- spring, and so have less evolutionary consequence than germ-line change. However, changes in the genes of so- matic cells can have an important immediate impact, par- ticularly if the gene affects development or is involved with regulation of cell proliferation. Rare changes in genes, called mutations, can have significant effects on the individual when they occur in somatic tissue, but are only inherited if they occur in germ-line tissue. Inherited changes provide the raw material for evolution. 362 Part V Molecular Genetics Mutations Are Rare But Important The cells of eukaryotes contain an enor- mous amount of DNA. If the DNA in all of the cells of an adult human were lined up end-to-end, it would stretch nearly 100 bil- lion kilometers—60 times the distance from Earth to Jupiter! The DNA in any multicel- lular organism is the final result of a long series of replications, starting with the DNA of a single cell, the fertilized egg. Or- ganisms have evolved many different mech- anisms to avoid errors during DNA replica- tion and to preserve the DNA from damage. Some of these mechanisms “proof- read” the replicated DNA strands for accu- racy and correct any mistakes. The proof- reading is not perfect, however. If it were, no variation in the nucleotide sequences of genes would be generated. Mistakes Happen In fact, cells do make mistakes during repli- cation, and damage to the genetic message also occurs, causing mutation (figure 18.2). However, change is rare. Typically, a par- ticular gene is altered in only one of a mil- lion gametes. If changes were common, the genetic instructions encoded in DNA would soon degrade into meaningless gib- berish. Limited as it might seem, the steady trickle of change that does occur is the very stuff of evo- lution. Every difference in the genetic messages that specify different organisms arose as the result of genetic change. The Importance of Genetic Change All evolution begins with alterations in the genetic mes- sage: mutation creates new alleles, gene transfer and trans- position alter gene location, reciprocal recombination shuf- fles and sorts these changes, and chromosomal rearrangement alters the organization of entire chromo- somes. Some changes in germ-line tissue produce alter- ations that enable an organism to leave more offspring, and those changes tend to be preserved as the genetic endow- ment of future generations. Other changes reduce the abil- ity of an organism to leave offspring. Those changes tend to be lost, as the organisms that carry them contribute fewer members to future generations. 18.1 Mutations are changes in the genetic message. FIGURE 18.2 Mutation. Normal fruit flies have one pair of wings extending from the thorax. This fly is a mutant because of changes in bithorax, a gene regulating a critical stage of development; it possesses two thoracic segments and thus two sets of wings. Kinds of Mutation Because mutations can occur randomly anywhere in a cell’s DNA, mutations can be detrimental, just as making a ran- dom change in a computer program or a musical score usu- ally worsens performance. The consequences of a detri- mental mutation may be minor or catastrophic, depending on the function of the altered gene. Mutations in Germ-Line Tissues The effect of a mutation depends critically on the identity of the cell in which the mutation occurs. During the em- bryonic development of all multicellular organisms, there comes a point when cells destined to form gametes (germ- line cells) are segregated from those that will form the other cells of the body (somatic cells). Only when a muta- tion occurs within a germ-line cell is it passed to subse- quent generations as part of the hereditary endowment of the gametes derived from that cell. Mutations in Somatic Tissues Mutations in germ-line tissue are of enormous biological importance because they provide the raw material from which natural selection produces evolutionary change. Change can occur only if there are new, different allele combinations available to replace the old. Mutation pro- duces new alleles, and recombination puts the alleles to- gether in different combinations. In animals, it is the oc- currence of these two processes in germ-line tissue that is important to evolution, as mutations in somatic cells (so- matic mutations) are not passed from one generation to the next. However, a somatic mutation may have drastic ef- fects on the individual organism in which it occurs, as it is passed on to all of the cells that are descended from the original mutant cell. Thus, if a mutant lung cell divides, all cells derived from it will carry the mutation. Somatic muta- tions of lung cells are, as we shall see, the principal cause of lung cancer in humans. Point Mutations One category of mutational changes affects the message it- self, producing alterations in the sequence of DNA nu- cleotides (table 18.1 summarizes the sources and types of mutations). If alterations involve only one or a few base- pairs in the coding sequence, they are called point muta- tions. While some point mutations arise due to sponta- neous pairing errors that occur during DNA replication, others result from damage to the DNA caused by muta- gens, usually radiation or chemicals. The latter class of mutations is of particular practical importance because modern industrial societies often release many chemical mutagens into the environment. Changes in Gene Position Another category of mutations affects the way the genetic message is organized. In both bacteria and eukaryotes, indi- vidual genes may move from one place in the genome to another by transposition. When a particular gene moves to a different location, its expression or the expression of neighboring genes may be altered. In addition, large seg- ments of chromosomes in eukaryotes may change their rel- ative locations or undergo duplication. Such chromosomal rearrangements often have drastic effects on the expres- sion of the genetic message. Point mutations are changes in the hereditary message of an organism. They may result from spontaneous errors during DNA replication or from damage to the DNA due to radiation or chemicals. Chapter 18 Altering the Genetic Message 363 Table 18.1 Types of Mutation Mutation Example result NO MUTATION Normal B protein is produced by the B gene. POINT MUTATION Base substitution B protein is inactive because changed amino acid disrupts function. Insertion B protein is inactive because inserted material disrupts proper shape. Deletion B protein is inactive because portion of protein is missing. CHANGES IN GENE POSITION Transposition B gene or B protein may be regulated differently because of change in gene position. Chromosomal rearrangement B gene may be inactivated or regulated differently in its new location on chromosome. Substitution of one or a few bases Addition of one or a few bases ABC AC A C ACB AC Loss of one or a few bases A C B B Point Mutations Physical Damage to DNA Ionizing Radiation. High-energy forms of radiation, such as X rays and gamma rays, are highly mutagenic. When such radiation reaches a cell, it is absorbed by the atoms it encounters, imparting energy to the electrons in their outer shells. These energized electrons are ejected from the atoms, leaving behind free radicals, ionized atoms with unpaired electrons. Free radicals react violently with other mol- ecules, including DNA. When a free radical breaks both phosphodiester bonds of a DNA helix, causing a double-strand break, the cell’s usual mutational repair enzymes cannot fix the damage. The two frag- ments created by the break must be aligned while the phos- phodiester bonds between them form again. Bacteria have no mechanism to achieve this alignment, and double-strand breaks are lethal to their descendants. In eukaryotes, which almost all possess multiple copies of their chromosomes, the synaptonemal complex assembled in meiosis is used to pair the fragmented chromosome with its homologue. In fact, it is speculated that meiosis may have evolved initially as a mechanism to repair double-strand breaks in DNA (see chapter 12). Ultraviolet Radiation. Ultraviolet (UV) radiation, the component of sunlight that tans (and burns), contains much less energy than ionizing radiation. It does not induce atoms to eject electrons, and thus it does not produce free radicals. The only molecules capable of absorbing UV radiation are certain organic ring compounds, whose outer-shell elec- trons become reactive when they absorb UV energy. DNA strongly absorbs UV radiation in the pyrimidine bases, thymine and cytosine. If one of the nucleotides on either side of the absorbing pyrimidine is also a pyrimidine, a double covalent bond forms between them. The resulting cross-link between adjacent pyrimidines is called a pyrimi- dine dimer (figure 18.3). In most cases, cellular UV repair systems either cleave the bonds that link the adjacent pyrimidines or excise the entire pyrimidine dimer from the strand and fill in the gap, using the other strand as a tem- plate (figure 18.4). In those rare instances in which a pyrimidine dimer goes unrepaired, DNA polymerase may fail to replicate the portion of the strand that includes the dimer, skipping ahead and leaving the problem area to be filled in later. This filling-in process is often error-prone, however, and it may create mutational changes in the base sequence of the gap region. Some unrepaired pyrimidine dimers block DNA replication altogether, which is lethal to the cell. Sunlight can wreak havoc on the cells of the skin be- cause its UV light causes mutations. Indeed, a strong and direct association exists between exposure to bright sun- light, UV-induced DNA damage, and skin cancer. A deep tan is not healthy! A rare hereditary disorder among hu- mans called xeroderma pigmentosum causes these prob- lems after a lesser exposure to UV. Individuals with this disorder develop extensive skin tumors after exposure to sunlight because they lack a mechanism for repairing the DNA damage UV radiation causes. Because of the many different proteins involved in excision and repair of pyrimi- dine dimers, mutations in as many as eight different genes cause the disease. 364 Part V Molecular Genetics T T T T T T A A Thymine dimer Ultraviolet light Kink FIGURE 18.3 Making a pyrimidine dimer. When two pyrimidines, such as two thymines, are adjacent to each other in a DNA strand, the absorption of UV radiation can cause covalent bonds to form between them—creating a pyrimidine dimer. The dimer introduces a “kink” into the double helix that prevents replication of the duplex by DNA polymerase. T T C A T A A C A G T T C A T A A C A G G T A G T C 1 G T A G T C 2 C A T A A C A G G T A T T G T C 4 C A T A A C A G G T A T C 3 T FIGURE 18.4 Repair of a pyrimidine dimer. Some pyrimidine dimers are repaired by excising the dimer, as well as a short run of nucleotides on either side of it, and then filling in the gap using the other strand as a template. Chemical Modification of DNA Many mutations result from direct chemical modification of the DNA. The chemicals that act on DNA fall into three classes: (1) chemicals that resemble DNA nu- cleotides but pair incorrectly when they are incorporated into DNA (figure 18.5). Some of the new AIDS chemotherapeutic drugs are analogues of nitrogenous bases that are inserted into the viral or infected cell DNA. This DNA cannot be properly transcribed, so viral growth slows; (2) chemicals that remove the amino group from adenine or cytosine, causing them to mispair; and (3) chemicals that add hydrocarbon groups to nucleotide bases, also causing them to mispair. This last group in- cludes many particularly potent mutagens commonly used in laboratories, as well as compounds sometimes released into the environment, such as mustard gas. Spontaneous Mutations Many point mutations occur spontaneously, without ex- posure to radiation or mutagenic chemicals. Sometimes nucleotide bases spontaneously shift to alternative confor- mations, or isomers, which form different kinds of hydro- gen bonds than the normal conformations. During repli- cation, DNA polymerase pairs a different nucleotide with the isomer than it would have otherwise selected. Unre- paired spontaneous errors occur in fewer than one in a billion nucleotides per generation, but they are still an important source of mutation. Sequences sometimes misalign when homologous chromosomes pair, causing a portion of one strand to loop out. These misalignments, called slipped mispair- ing, are usually only transitory, and the chromosomes quickly revert to the normal arrangement (figure 18.6). If the error-correcting system of the cell encounters a slipped mispairing before it reverts, however, the system will attempt to “correct” it, usually by excising the loop. This may result in a deletion of several hundred nu- cleotides from one of the chromosomes. Many of these deletions start or end in the middle of a codon, thereby shifting the reading frame by one or two bases. These so- called frame-shift mutations cause the gene to be read in the wrong three-base groupings, distorting the genetic message, just as the deletion of the letter F from the sen- tence, THE FAT CAT ATE THE RAT shifts the read- ing frame of the sentence, producing the meaningless message, THE ATC ATA TET HER AT. Some chemi- cals specifically promote deletions and frame-shift muta- tions by stabilizing the loops produced during slipped mispairing, thus increasing the time the loops are vulner- able to excision. Chapter 18 Altering the Genetic Message 365 H Cytosine N H O NH 2 N H Thymine N CH 3 H O O N H 5-Bromouracil N BrH O O N FIGURE 18.5 Chemicals that resemble DNA bases can cause mutations. For example, DNA polymerase cannot distinguish between thymine and 5-bromouracil, which are similar in shape. Once incorporated into a DNA molecule, however, 5-bromouracil tends to rearrange to a form that resembles cytosine and pairs with guanine. When this happens, what was originally an A-T base-pair becomes a G- C base-pair. Resumption of correct pairing Correct pairing Slipped mispairing Excision of loop ResultResult FIGURE 18.6 Slipped mispairing. Slipped mispairing occurs when a sequence is present in more than one copy on a chromosome and the copies on homologous chromosomes pair out of register, like a shirt buttoned wrong. The loop this mistake produces is sometimes excised by the cell’s repair enzymes, producing a short deletion and often altering the reading frame. Any chemical that stabilizes the loop increases the chance it will be excised. The major sources of physical damage to DNA are ionizing radiation, which breaks the DNA strands; ultraviolet radiation, which creates nucleotide cross- links whose removal often leads to errors in base selection; and chemicals that modify DNA bases and alter their base-pairing behavior. Unrepaired spontaneous errors in DNA replication occur rarely. Changes in Gene Position Chromosome location is an important factor in determin- ing whether genes are transcribed. Some genes cannot be transcribed if they are adjacent to a tightly coiled region of the chromosome, even though the same gene can be tran- scribed normally in any other location. Transcription of many chromosomal regions appears to be regulated in this manner; the binding of specific proteins regulates the de- gree of coiling in local regions of the chromosome, deter- mining the accessibility RNA polymerase has to genes lo- cated within those regions. Chromosomal Rearrangements Chromosomes undergo several different kinds of gross physical alterations that have significant effects on the loca- tions of their genes. The two most important are translo- cations, in which a segment of one chromosome becomes part of another chromosome, and inversions, in which the orientation of a portion of a chromosome is reversed. Translocations often have significant effects on gene ex- pression. Inversions, on the other hand, usually do not alter gene expression, but they are nonetheless important. Re- combination within a region that is inverted on one homo- logue but not the other (figure 18.7) leads to serious prob- lems: none of the gametes that contain chromatids produced following such a crossover event will have a com- plete set of genes. Other chromosomal alterations change the number of gene copies an individual possesses. Particular genes or seg- ments of chromosomes may be deleted or duplicated, whole chromosomes may be lost or gained (aneuploidy), and entire sets of chromosomes may be added (polyploidy). Most deletions are harmful because they halve the number of gene copies within a diploid genome and thus seriously af- fect the level of transcription. Duplications cause gene im- balance and are also usually harmful. Insertional Inactivation Many small segments of DNA are capable of moving from one location to another in the genome, using an en- zyme to cut and paste themselves into new genetic neigh- borhoods. We call these mobile bits of DNA transpos- able elements, or transposons. Transposons select their new locations at random, and are as likely to enter one segment of a chromosome as another. Inevitably, some transposons end up inserted into genes, and this almost always inactivates the gene. The encoded protein now has a large meaningless chunk inserted within it, disrupt- ing its structure. This form of mutation, called inser- tional inactivation, is common in nature. Indeed, it seems to be one of the most significant causes of muta- tion. The original white-eye mutant of Drosophila discov- ered by Morgan (see chapter 13) is the result of a trans- position event, a transposon nested within a gene encoding a pigment-producing enzyme. As you might expect, a variety of human gene disorders are the result of transposition. The human transposon called Alu, for example, is responsible for an X-linked he- mophilia, inserting into clotting factor IX and placing a premature stop codon there. It also causes inherited high levels of cholesterol (hypercholesterolemia), Alu elements inserting into the gene encoding the low density lipopro- tein (LDL) receptor. In one very interesting case, a Drosophila transposon called Mariner proves responsible for a rare human neurological disorder called Charcot-Marie- Tooth disease, in which the muscles and nerves of the legs and feet gradually wither away. The Mariner transposon is inserted into a key gene called CMT on chromosome 17, creating a weak site where the chromosome can break. No one knows how the Drosophila transposon got into the human genome. Many mutations result from changes in gene location or from insertional inactivation. 366 Part V Molecular Genetics c f g h i b d e a E F G H I B D C A 1 c f g h i b d e a E F G H I B D C A Inverted segment 2 c f g h i b d e a F G H I B C A E D 3 c f g h i b e F H I B C A 4 G c f g h i b d e a F G H I B C A E D 5 d a D E FIGURE 18.7 The consequence of inversion. (1) When a segment of a chromosome is inverted, (2) it can pair in meiosis only by forming an internal loop. (3) Any crossing over that occurs within the inverted segment during meiosis will result in nonviable gametes; some genes are lost from each chromosome, while others are duplicated (4 and 5). For clarity, only two strands are shown, although crossing over occurs in the four-strand stage. The pairing that occurs between inverted segments is sometimes visible under the microscope as a characteristic loop (inset). What Is Cancer? Cancer is a growth disorder of cells. It starts when an ap- parently normal cell begins to grow in an uncontrolled and invasive way (figure 18.8). The result is a cluster of cells, called a tumor, that constantly expands in size. Cells that leave the tumor and spread throughout the body, forming new tumors at distant sites, are called metastases (figure 18.9). Cancer is perhaps the most pernicious disease. Of the children born in 1999, one-third will contract cancer at some time during their lives; one-fourth of the male chil- dren and one-third of the female children will someday die of cancer. Most of us have had family or friends affected by the disease. In 1997, 560,000 Americans died of cancer. Not surprisingly, researchers are expending a great deal of effort to learn the cause of this disease. Scientists have made a great deal of progress in the last 20 years using molecular biological techniques, and the rough outlines of understanding are now emerging. We now know that can- cer is a gene disorder of somatic tissue, in which damaged genes fail to properly control cell proliferation. The cell di- vision cycle is regulated by a sophisticated group of pro- teins described in chapter 11. Cancer results from the mu- tation of the genes encoding these proteins. Cancer can be caused by chemicals that mutate DNA or in some instances by viruses that circumvent the cell’s nor- mal proliferation controls. Whatever the immediate cause, however, all cancers are characterized by unrestrained growth and division. Cell division never stops in a cancer- ous line of cells. Cancer cells are virtually immortal—until the body in which they reside dies. Cancer is unrestrained cell proliferation caused by damage to genes regulating the cell division cycle. Chapter 18 Altering the Genetic Message 367 18.2 Cancer results from mutation of growth-regulating genes. FIGURE 18.8 Lung cancer cells (530×). These cells are from a tumor located in the alveolus (air sac) of a lung. FIGURE 18.9 Portrait of a cancer. This ball of cells is a carcinoma (cancer tumor) developing from epithelial cells that line the interior surface of a human lung. As the mass of cells grows, it invades surrounding tissues, eventually penetrating lymphatic and blood vessels, both plentiful within the lung. These vessels carry metastatic cancer cells throughout the body, where they lodge and grow, forming new masses of cancerous tissue. Carcinoma of the lung Connective tissue Lymphatic vessel Smooth muscle Metastatic cells Blood vessel Blood vessel Kinds of Cancer Cancer can occur in almost any tissue, so a bewildering number of different cancers occur. Tumors arising from cells in connective tissue, bone, or muscle are known as sarcomas, while those that originate in epithelial tissue such as skin are called carcinomas. In the United States, the three deadliest human cancers are lung cancer, cancer of the colon and rectum, and breast cancer (table 18.2). Lung cancer, re- sponsible for the most cancer deaths, is largely preventable; most cases re- sult from smoking cigarettes. Col- orectal cancers appear to be fostered by the high-meat diets so favored in the United States. The cause of breast cancer is still a mystery, although in 1994 and 1995 researchers isolated two genes responsible for hereditary susceptibility to breast cancer, BRCA1 and BRCA2 (Breast Cancer genes #1 and #2 located on human chromo- somes 17 and 13); their discovery of- fers hope that researchers will soon be able to unravel the fundamental mechanism leading to hereditary breast cancer, about one-third of all breast cancers. The association of particular chemicals with cancer, particularly chemicals that are potent mutagens, led re- searchers early on to the suspicion that cancer might be caused, at least in part, by chemicals, the so-called chem- ical carcinogenesis theory. Agents thought to cause cancer are called carcinogens. A simple and effective way to test if a chemical is mutagenic is the Ames test (figure 18.10), named for its developer, Bruce Ames. The test uses a strain of Salmonella bacteria that has a defec- tive histidine-synthesizing gene. Because these bacteria cannot make histidine, they cannot grow on media without it. Only a back-mutation that restores the ability to manu- facture histidine will permit growth. Thus the number of colonies of these bacteria that grow on histidine-free medium is a measure of the frequency of back-mutation. A majority of chemicals that cause back-mutations in this test are carcinogenic, and vice versa. To increase the sen- sitivity of the test, the strains of bacteria are altered to disable their DNA repair machinery. The search for the cause of cancer has focused in part on chemical carcino- gens and other environmental factors, including ionizing radiation such as X rays (figure 18.11). Cancers occur in all tissues, but are more common in some than others. 368 Part V Molecular Genetics Table 18.2 Incidence of Cancer in the United States in 1999 Type of Cancer New Cases Deaths % of Cancer Deaths Lung 171,600 158,900 28 Colon and rectum 129,400 56,600 10 Leukemia/lymphoma 94,200 49,100 9 Breast 176,300 43,700 8 Prostate 179,300 37,000 7 Pancreas 28,600 28,600 5 Ovary 25,200 14,500 3 Stomach 21,900 13,500 2 Liver 14,500 13,600 2 Nervous system/eye 19,000 13,300 2 Bladder 54,200 12,100 2 Oral cavity 29,800 8,100 2 Kidney 30,000 11,900 2 Cervix/uterus 50,200 11,200 2 Malignant melanoma 44,200 7,300 1 Sarcoma (connective tissue) 10,400 5,800 1 All other cancers 143,000 77,900 14 In the United States in 1999 there were 1,221,800 reported cases of new cancers and 563,100 cancer deaths, indicating that roughly half the people who develop cancer die from it. Source: Data from the American Cancer Society, Inc., 1999. Suspected carcinogen Histidine- dependent bacteria Rat liver extract Mix Pour into petri dish and incubate on histidine-lacking medium Count the number of bacterial colonies that grow FIGURE 18.10 The Ames test. This test is uses a strain of Salmonella bacteria that requires histidine in the growth medium due to a mutated gene. If a suspected carcinogen is mutagenic, it can reverse this mutation. Rat liver extract is added because it contains enzymes that can convert carcinogens into mutagens. The mutagenicity of the carcinogen can be quantified by counting the number of bacterial colonies that grow on a medium lacking histidine. Chapter 18 Altering the Genetic Message 369 Nigeria Japan Colombia Chile Hungary Poland Puerto Rico Finland Yugoslavia Jamaica Norway Israel Sweden Netherlands UK Denmark Canada USA New Zealand West Germany Iceland East Germany Romania 0 10 20 30 40 50 Meat consumption (grams per person per day) Cancer of large intestine annual incidence (per 100,000 population) 0 40 80 120 160 200 240 280 320 0 20 40 60 80 100 120 Manufactured cigarettes per adult in 1950 Lung cancer at ages 35 – 44 in the early 1970s (per 100,000 population) 500 1000 1500 2000 2500 3000 Spain Germany Australia France Sweden Finland Switzerland Denmark Holland Greece New Zealand Austria Norway USA Ireland UK Canada Italy Belgium Japan Portugal USA — never smoked Above U.S. average Highest cancer rates (a) POLLUTION (b) DIET (c) SMOKING FIGURE 18.11 Potential cancer-causing agents. (a) The incidence of cancer per 1000 people is not uniform throughout the United States. The incidence is higher in cities and in the Mississippi Delta, suggesting that pollution and pesticide runoff may contribute to the development of cancer. (b) One of the deadliest cancers in the United States, cancer of the large intestine, is uncommon in many other countries. Its incidence appears to be related to the amount of meat a person consumes: a high-meat diet slows the passage of food through the intestine, prolonging exposure of the intestinal wall to digestive waste. (c) The biggest killer among cancers is lung cancer, and the most deadly environmental agent producing lung cancer is cigarette smoke. The incidence of lung cancer among men 35 to 44 years of age in various countries strongly correlates with the cigarette consumption in that country 20 years earlier. Some Tumors Are Caused by Chemicals Early Ideas The chemical carcinogenesis theory was first advanced over 200 years ago in 1761 by Dr. John Hill, an English physi- cian, who noted unusual tumors of the nose in heavy snuff users and suggested tobacco had produced these cancers. In 1775, a London surgeon, Sir Percivall Pott, made a similar observation, noting that men who had been chimney sweeps exhibited frequent cancer of the scrotum, and sug- gesting that soot and tars might be responsible. British sweeps washed themselves infrequently and always seemed covered with soot. Chimney sweeps on the continent, who washed daily, had much less of this scrotal cancer. These and many other observations led to the hypothesis that cancer results from the action of chemicals on the body. Demonstrating That Chemicals Can Cause Cancer It was over a century before this hypothesis was directly tested. In 1915, Japanese doctor Katsusaburo Yamagiwa ap- plied extracts of coal tar to the skin of 137 rabbits every 2 or 3 days for 3 months. Then he waited to see what would happen. After a year, cancers appeared at the site of applica- tion in seven of the rabbits. Yamagiwa had induced cancer with the coal tar, the first direct demonstration of chemical carcinogenesis. In the decades that followed, this approach demonstrated that many chemicals were capable of causing cancer. Importantly, most of them were potent mutagens. Because these were lab studies, many people did not ac- cept that the results applied to real people. Do tars in fact in- duce cancer in humans? In 1949, the American physician Ernst Winder and the British epidemiologist Richard Doll independently reported that lung cancer showed a strong link to the smoking of cigarettes, which introduces tars into the lungs. Winder interviewed 684 lung cancer patients and 600 normal controls, asking whether each had ever smoked. Cancer rates were 40 times higher in heavy smokers than in nonsmokers. Doll’s study was even more convincing. He in- terviewed a large number of British physicians, noting which ones smoked, then waited to see which would develop lung cancer. Many did. Overwhelmingly, those who did were smokers. From these studies, it seemed likely as long as 50 years ago that tars and other chemicals in cigarette smoke in- duce cancer in the lungs of persistent smokers. While this suggestion was (and is) resisted by the tobacco industry, the evidence that has accumulated since these pioneering studies makes a clear case, and there is no longer any real doubt. Chemicals in cigarette smoke cause cancer. Carcinogens Are Common In ongoing investigations over the last 50 years, many hundreds of synthetic chemicals have been shown capable of causing cancer in laboratory animals. Among them are trichloroethylene, asbestos, benzene, vinyl chloride, arsenic, arylamide, and a host of complex petroleum products with chemical structures resembling chicken wire. People in the workplace encounter chemicals daily (table 18.3). In addition to identifying potentially dangerous sub- stances, what have the studies of potential carcinogens told us about the nature of cancer? What do these cancer- causing chemicals have in common? They are all mutagens, each capable of inducing changes in DNA. Chemicals that produce mutations in DNA are often potent carcinogens. Tars in cigarette smoke, for example, are the direct cause of most lung cancers. 370 Part V Molecular Genetics Table 18.3 Chemical Carcinogens in the Workplace Workers at Risk Chemical Cancer for Exposure COMMON EXPOSURE Benzene Myelogenous Painters; dye users; leukemia furniture finishers Diesel exhaust Lung Railroad and bus-garage workers; truckers; miners Mineral oils Skin Metal machinists Pesticides Lung Sprayers Cigarette tar Lung Smokers UNCOMMON EXPOSURE Asbestos Mesothelioma, Brake-lining, lung insulation workers Synthetic mineral Lung Wall and pipe fibers insulation and duct wrapping users Hair dyes Bladder Hairdressers and barbers Paint Lung Painters Polychlorinated Liver, skin Users of hydraulic biphenyls fluids and lubricants, inks, adhesives, insecticides Soot Skin Chimney sweeps; bricklayers; firefighters; heating-unit service workers RARE EXPOSURE Arsenic Lung, skin Insecticide/herbicide sprayers; tanners; oil refiners Formaldehyde Nose Wood product, paper, textiles, and metal product workers Other Tumors Result from Viral Infection Chemical mutagens are not the only carcinogens, however. Some tumors seem almost certainly to result from viral in- fection. Viruses can be isolated from certain tumors, and these viruses cause virus-containing tumors to develop in other individuals. About 15% of human cancers are associ- ated with viruses. A Virus That Causes Cancer In 1911, American medical researcher Peyton Rous re- ported that a virus, subsequently named Rous avian sar- coma virus (RSV), was associated with chicken sarcomas. He found that RSV could infect and initiate cancer in chicken fibroblast (connective tissue) cells growing in cul- ture; from those cancerous cells, more viruses could be iso- lated. Rous was awarded the 1966 Nobel Prize in Physiol- ogy or Medicine for this discovery. RSV proved to be a kind of RNA virus called a retrovirus. When retroviruses infect a cell, they make a DNA copy of their RNA genome and insert that copy into the host cell’s DNA. How RSV Causes Cancer How does RSV initiate cancer? When RSV was compared to a closely related virus, RAV-O, which is unable to trans- form normal chicken cells into cancerous cells, the two viruses proved to be identical except for one gene that was present in RSV but absent from RAV-O. That gene was called the src gene, short for sarcoma. How do viral genes cause cancer? An essential clue came in 1970, when temperature-sensitive RSV mutants were isolated. These mutants would transform tissue culture cells into cancer cells at 35°C, but not at 41°C. Tempera- ture sensitivity of this kind is almost always associated with proteins. It seemed likely, therefore, that the src gene was actively transcribed by the cell, rather than serving as a recognition site for some sort of regulatory protein. This was an exciting result, suggesting that the protein specified by this cancer-causing gene, or oncogene, could be iso- lated and its properties studied. The src protein was first isolated in 1977 by J. Michael Bishop and Harold Varmus, who won the Nobel Prize for their efforts. It turned out to be an enzyme of moderate size that phosphorylates (adds a phosphate group to) the ty- rosine amino acids of proteins. Such enzymes, called tyro- sine kinases, are quite common in animal cells. One exam- ple is an enzyme that also serves as a plasma membrane receptor for epidermal growth factor, a protein that sig- nals the initiation of cell division. This finding raised the exciting possibility that RSV may cause cancer by introduc- ing into cells an active form of a normally quiescent growth-promoting enzyme. Later experiments showed this is indeed the case. Origin of the src Gene Does the src gene actually integrate into the host cell’s chromosome along with the rest of the RSV genome? One way to answer this question is to prepare a radioactive ver- sion of the gene, allow it to bind to complementary se- quences on the chicken chromosomes, and examine where the chromosomes become radioactive. The result of this experiment is that radioactive src DNA does in fact bind to the site where RSV DNA is inserted into the chicken genome—but it also binds to a second site where there is no part of the RSV genome! The explanation for the second binding site is that the src gene is not exclusively a viral gene. It is also a growth- promoting gene that evolved in and occurs normally in chickens. This normal chicken gene is the second site where src binds to chicken DNA. Somehow, an ancestor of RSV picked up a copy of the normal chicken gene in some past infection. Now part of the virus, the gene is tran- scribed under the control of viral promoters rather than under the regulatory system of the chicken genome (figure 18.12). Studies of RSV reveal that cancer results from the inappropriate activity of growth-promoting genes that are less active or completely inactive in normal cells. Chapter 18 Altering the Genetic Message 371 Tyrosine kinase gene of chicken chromosome with 6 introns Retrovirus genome without oncogene (RAV-0) Envelope proteins Genome of Rous avian sarcoma virus (RSV) RNA transcript Reverse transcriptase DNA copy 123 4 5 6 gag src pol env gag pol env src FIGURE 18.12 How a chicken gene got into the RSV genome. RSV contains only a few genes: gag and env, which encode the viral protein coat and envelope proteins, and pol, which encodes reverse transcriptase. It also contains the src gene that causes sarcomas, which the RAV-O virus lacks. RSV originally obtained its src gene from chickens, where a copy of the gene occurs normally and is controlled by the chicken’s regulatory genes. Cancer and the Cell Cycle An important technique used to study tumors is called transfection. In this procedure, the nuclear DNA from tumor cells is isolated and cleaved into random fragments. Each fragment is then tested individually for its ability to induce cancer in the cells that assimilate it. Using transfection, researchers have discovered that most human tumors appear to result from the mutation of genes that regulate the cell cycle. Sometimes the mutation of only one or two gene is all that is needed to transform normally dividing cells into cancerous cells in tissue culture (table 18.4). Point Mutations Can Lead to Cancer The difference between a normal gene encoding a protein that regulates the cell cycle and a cancer-inducing version can be a single point mutation in the DNA. In one case of ras-induced bladder cancer, for example, a single DNA base change from guanine to thymine converts a glycine in the normal ras protein into a valine in the cancer-caus- ing version. Several other ras-induced human carcinomas have been shown to also involve single nucleotide substi- tutions. Telomerase and Cancer Telomeres are short sequences of nucleotides repeated thousands of times on the ends of chromosomes. Because DNA polymerase is unable to copy chromosomes all the way to the tip (there is no place for the primer necessary to copy the last Okazaki fragment), telomeric segments are lost every time a cell divides. In healthy cells a tumor suppressor inhibits production of a special enzyme called telomerase that adds the lost telomere material back to the tip. Without this enzyme, a cell’s chromosomes lose material from their telomeres with each replication. Every time a chromosome is copied as the cell prepares to divide, more of the tip is lost. After some 30 divisions, so much is lost that copying is no longer pos- sible. Cells in the tissues of an adult human have typically undergone 25 or more divisions. Cancer can’t get very far with only the 5 remaining cell divisions. Were cancer to start, it would grind to a halt after only a few divisions for lack of telomere. Thus, we see that the cell’s inhibition of telomerase in somatic cells is a very effective natural brake on the cancer process. Any mutation that destroys the telomerase in- hibitor releases that brake, making cancer possible. Thus, when researchers looked for telomerase in human ovarian tumor cells, they found it. These cells contained muta- tions that had inactivated the cell control that blocks the transcription of the telomerase gene. Telomerase pro- duced in these cells reversed normal telomere shortening, allowing the cells to proliferate and gain the immortality of cancer cells. Mutations in Proto-Oncogenes: Accelerating the Cell Cycle Most cancers are the direct result of mutations in growth- regulating genes. There are two general classes of cancer- inducing mutations: mutations of proto-oncogenes and mutations of tumor-suppressor genes. Genes known as proto-oncogenes encode proteins that stimulate cell division. Mutations that overactivate these stimulatory proteins cause the cells that contain them to proliferate excessively. Mutated proto-oncogenes become cancer-causing genes called oncogenes (Greek onco-, “tumor”) (figure 18.13). Often the induction of these cancers involves changes in the activity of intracel- lular signalling molecules associated with receptors on the surface of the plasma membrane. In a normal cell, the signalling pathways activated by these receptors trigger passage of the G 1 checkpoint of cell proliferation (see fig- ure 11.17). The mutated alleles of these oncogenes are genetically dominant. Among the most widely studied are myc and ras. Expression of myc stimulates the production of cyclins and cyclin-dependent protein kinases (Cdks), key elements in regulating the checkpoints of cell division. 372 Part V Molecular Genetics Growth-factor receptors: PDGF receptor erbB Growth-factors: PDGF Cytoplasmic steroid-type growth-factor receptors: RET Cytoplasmic serine/threonine-specific protein kinases: raf Membrane/cytoskeleton- protein kinases: src Nuclear proteins: myc bcl MDM Cytoplasmic tyrosine- specific protein kinases: N-ras G proteins: K-ras FIGURE 18.13 The main classes of oncogenes. Before they are altered by mutation to their cancer-causing condition, oncogenes are called proto-oncogenes (that is, genes able to become oncogenes). Illustrated here are the principal classes of proto-oncogenes, with some typical representatives indicated. The ras gene product is involved in the cellular response to a variety of growth factors such as EGF, an intercellular signal that normally initiates cell proliferation. When EGF binds to a specific receptor protein on the plasma mem- brane of epithelial cells, the portion of the receptor that protrudes into the cytoplasm stimulates the ras protein to bind to GTP. The ras protein/GTP complex in turn re- cruits and activates a protein called Raf to the inner surface of the plasma membrane, which in turn activates cytoplas- mic kinases and so triggers an intracellular signaling system (see chapter 7). The final step in the pathway is the activa- tion of transcription factors that trigger cell proliferation. Cancer-causing mutations in ras greatly reduce the amount of EGF necessary to initiate cell proliferation. Chapter 18 Altering the Genetic Message 373 Table 18.4 Some Genes Implicated in Human Cancers Gene Product Cancer ONCOGENES Genes Encoding Growth Factors or Their Receptors erb-B Receptor for epidermal growth factor Glioblastoma (a brain cancer); breast cancer erb-B2 A growth factor receptor (gene also called neu) Breast cancer; ovarian cancer; salivary gland cancer PDGF Platelet-derived growth factor Glioma (a brain cancer) RET A growth factor receptor Thyroid cancer Genes Encoding Cytoplasmic Relays in Intracellular Signaling Pathways K-ras Protein kinase Lung cancer; colon cancer; ovarian cancer; pancreatic cancer N-ras Protein kinase Leukemias Genes Encoding Transcription Factors That Activate Transcription of Growth-Promoting Genes c-myc Transcription factor Lung cancer; breast cancer; stomach cancer; leukemias L-myc Transcription factor Lung cancer N-myc Transcription factor Neuroblastoma (a nerve cell cancer) Genes Encoding Other Kinds of Proteins bcl-2 Protein that blocks cell suicide Follicular B cell lymphoma bcl-1 Cyclin D1, which stimulates the cell Breast cancer; head and neck cancers cycle clock (gene also called PRAD1) MDM2 Protein antagonist of p53 tumor-supressor protein Wide variety of sarcomas (connective tissue cancers) TUMOR-SUPRESSOR GENES Genes Encoding Cytoplasmic Proteins APC Step in a signaling pathway Colon cancer; stomach cancer DPC4 A relay in signaling pathway that inhibits cell division Pancreatic cancer NF-1 Inhibitor of ras, a protein that stimulates cell division Neurofibroma; myeloid leukemia NF-2 Inhibitor of ras Meningioma (brain cancer); schwannoma (cancer of cells supporting peripheral nerves) Genes Encoding Nuclear Proteins MTS1 p16 protein, which slows the cell cycle clock A wide range of cancers p53 p53 protein, which halts cell division at the G 1 checkpoint A wide range of cancers Rb Rb protein, which acts as a master brake of the cell cycle Retinoblastoma; breast cancer; bone cancer; bladder cancer Genes Encoding Proteins of Unknown Cellular Locations BRCA1 ? Breast cancer; ovarian cancer BRCA2 ? Breast cancer VHL ? Renal cell cancer Mutations in Tumor-Suppressor Genes: Inactivating the Cell’s Inhibitors of Proliferation If the first class of cancer-inducing mutations “steps on the accelerator” of cell division, the second class of cancer- inducing mutations “removes the brakes.” Cell division is normally turned off in healthy cells by proteins that pre- vent cyclins from binding to Cdks. The genes that encode these proteins are called tumor-suppressor genes. Their mutant alleles are genetically recessive. Among the most widely studied tumor-suppressor genes are Rb, p16, p21, and p53. The unphosphorylated product of the Rb gene ties up transcription factor E2F, which transcribes several genes required for passage through the G 1 checkpoint into S phase of the cell cycle (figure 18.14). The proteins encoded by p16 and p21 re- inforce the tumor-suppressing role of the Rb protein, preventing its phosphorylation by binding to the appro- priate Cdk/cyclin complex and inhibiting its kinase activ- ity. The p53 protein senses the integrity of the DNA and is activated if the DNA is damaged (figure 18.15). It ap- pears to act by inducing the transcription of p21, which binds to cyclins and Cdk and prevents them from inter- acting. One of the reasons repeated smoking leads inex- orably to lung cancer is that it induces p53 mutations. In- deed, almost half of all cancers involve mutations of the p53 gene. 374 Part V Molecular Genetics Rb Retinoblastoma protein p16 Tumor suppressor Cell division No cell division x Rb Cyclins Cdk Growth blocked at G 1 Cell nucleus E2F E2F E2F Rb Rb ATP P Mitosis initiated Mitosis inhibited Cell nucleus p16 binds to Cdk, preventing phosphorylation of Rb p16 Cdk Growth blocked at G 1 E2F E2F Rb Rb p16 Cyclins FIGURE 18.14 How the tumor-suppressor genes Rb and p16 interact to block cell division. The retinoblastoma protein (Rb) binds to the transcription factor (E2F) that activates genes in the nucleus, preventing this factor from initiating mitosis. The G 1 checkpoint is passed when Cdk interacts with cyclins to phosphorylate Rb, releasing E2F. The p16 tumor-suppressor protein reinforces Rb’s inhibitory action by binding to Cdk so that Cdk is not available to phosphorylate Rb. 1. Halts cell cycle at G 1 checkpoint 2. Activates DNA repair system Cdk Damage to DNA p53 Initiates transcription of repair enzymes Initiates transcription of p21 DNA repair p21 Cyclins p21 Blocks cell cycle at G 1 checkpoint Prevents DNA replication FIGURE 18.15 The role of tumor-suppressor p53 in regulating the cell cycle. The p53 protein works at the G 1 checkpoint to check for DNA damage. If the DNA is damaged, p53 activates the DNA repair system and stops the cell cycle at the G 1 checkpoint (before DNA replication). This allows time for the damage to be repaired. p53 stops the cell cycle by inducing the transcription of p21. The p21 protein then binds to cyclins and prevents them from complexing with Cdk. Cancer-Causing Mutations Accumulate over Time Cells control proliferation at several checkpoints, and all of these controls must be inactivated for cancer to be ini- tiated. Therefore, the induction of most cancers involves the mutation of multiple genes; four is a typical number (figure 18.16). In many of the tissue culture cell lines used to study cancer, most of the controls are already inacti- vated, so that mutations in only one or a few genes trans- form the line into cancerous growth. The need to inacti- vate several regulatory genes almost certainly explains why most cancers occur in people over 40 years old (fig- ure 18.17); in older persons, there has been more time for individual cells to accumulate multiple mutations. It is now clear that mutations, including those in potentially cancer-causing genes, do accumulate over time. Using the polymerase chain reaction (PCR), researchers in 1994 searched for a certain cancer-associated gene mutation in the blood cells of 63 cancer-free people. They found that the mutation occurred 13 times more often in people over 60 years old than in people under 20. Cancer is a disease in which the controls that normally restrict cell proliferation do not operate. In some cases, cancerous growth is initiated by the inappropriate activation of proteins that regulate the cell cycle; in other cases, it is initiated by the inactivation of proteins that normally suppress cell division. Chapter 18 Altering the Genetic Message 375 MUTATED GENE Tumor suppressor Normal epithelium Hyperproliferative epithelium Early benign polyp Intermediate benign polyp Late benign polyp Carcinoma Metastasis APC OncogeneK-ras Tumor suppressor DCC Tumor suppressor p53 Other mutations Loss of APC Mutation of K-ras and DCC Mutation of p53 FIGURE 18.16 The progression of mutations that commonly lead to colorectal cancer. The fatal metastasis is the last of six serial changes that the epithelial cells lining the rectum undergo. One of these changes is brought about by mutation of a proto-oncogene, and three of them involve mutations that inactivate tumor-suppressor genes. 0 10 20 30 40 50 60 70 80 0 25 50 75 100 200 300 400 500 Age at death (years) Annual death rate 150 250 350 450 FIGURE 18.17 The annual death rate from cancer climbs with age. The rate of cancer deaths increases steeply after age 40 and even more steeply after age 60, suggesting that several independent mutations must accumulate to give rise to cancer. Smoking and Cancer How can we prevent cancer? The most obvious strategy is to minimize mutational insult. Anything that decreases ex- posure to mutagens can decrease the incidence of cancer because exposure has the potential to mutate a normal gene into an oncogene. It is no accident that the most reliable tests for the carcinogenicity of a substance are tests that measure the substance’s mutagenicity. The Association between Smoking and Cancer About a third of all cases of cancer in the United States are directly attributable to cigarette smoking. The association between smoking and cancer is particularly striking for lung cancer (figure 18.18). Studies of male smokers show a highly positive correlation between the number of ciga- rettes smoked per day and the incidence of lung cancer (figure 18.19). For individuals who smoke two or more packs a day, the risk of contracting lung cancer is at least 40 times greater than it is for nonsmokers, whose risk level ap- proaches zero. Clearly, an effective way to avoid lung can- cer is not to smoke. Other studies have shown a clear rela- tionship between cigarette smoking and reduced life expectancy (figure 18.20). Life insurance companies have calculated that smoking a single cigarette lowers one’s life expectancy by 10.7 minutes (longer than it takes to smoke the cigarette)! Every pack of 20 cigarettes bears an unwrit- ten label: “The price of smoking this pack of cigarettes is 3 1 ?2 hours of your life.” Smoking Introduces Mutagens to the Lungs Over half a million people died of cancer in the United States in 1999; about 28% of them died of lung cancer. About 140,000 persons were diagnosed with lung cancer each year in the 1980s. Around 90% of them died within three years after diagnosis; 96% of them were cigarette smokers. Smoking is a popular pastime. In the United States, 24% of the population smokes, and U.S. smokers consumed over 450 billion cigarettes in 1999. The smoke emitted from these cigarettes contains some 3000 chemical components, including vinyl chloride, benzo[a]pyrenes, and nitroso-nor- nicotine, all potent mutagens. Smoking places these muta- gens into direct contact with the tissues of the lungs. Mutagens in the Lung Cause Cancer Introducing powerful mutagens to the lungs causes consid- erable damage to the genes of the epithelial cells that line the lungs and are directly exposed to the chemicals. Among the genes that are mutated as a result are some whose nor- mal function is to regulate cell proliferation. When these genes are damaged, lung cancer results. 376 Part V Molecular Genetics FIGURE 18.18 Photo of a cancerous human lung. The bottom half of the lung is normal, while a cancerous tumor has completely taken over the top half. The cancer cells will eventually break through into the lymph and blood vessels and spread through the body. Cigarettes smoked per day Incidence of cancer per 100,000 men 10 0 100 200 300 400 500 20 30 40 FIGURE 18.19 Smoking causes cancer. The annual incidence of lung cancer per 100,000 men clearly increases with the number of cigarettes smoked per day. This process has been clearly demonstrated for benzo[a]pyrene (BP), one of the potent mutagens released into cigarette smoke from tars in the tobacco. The epithe- lial cells of the lung absorb BP from tobacco smoke and chemically alter it to a derivative form. This derivative form, benzo[a]pyrene-diolepoxide (BPDE), binds directly to the tumor-suppressor gene p53 and mutates it to an in- active form. The protein encoded by p53 oversees the G 1 cell cycle checkpoint described in chapter 11 and is one of the body’s key mechanisms for preventing uncontrolled cell proliferation. The destruction of p53 in lung epithelial cells greatly hastens the onset of lung cancer—p53 is mutated to an inactive form in over 70% of lung cancers. When exam- ined, the p53 mutations in cancer cells almost all occur at one of three “hot spots.” The key evidence linking smoking and cancer is that when the mutations of p53 caused by BPDE from cigarettes are examined, they occur at the same three specific “hot spots!” The Incidence of Cancer Reflects Smoking Cigarette manufacturers argue that the causal connection between smoking and cancer has not been proved, and that somehow the relationship is coincidental. Look care- fully at the data presented in figure 18.21 and see if you agree. The upper graph, compiled from data on American men, shows the incidence of smoking from 1900 to 1990 and the incidence of lung cancer over the same period. Note that as late as 1920, lung cancer was a rare disease. About 20 years after the incidence of smoking began to increase among men, lung cancer also started to become more common. Now look at the lower graph, which presents data on American women. Because of social mores, significant numbers of American women did not smoke until after World War II, when many social conventions changed. As late as 1963, when lung cancer among males was near cur- rent levels, this disease was still rare in women. In the United States that year, only 6588 women died of lung can- cer. But as more women smoked, more developed lung cancer, again with a lag of about 20 years. American women today have achieved equality with men in the num- bers of cigarettes they smoke, and their lung cancer death rates are today approaching those for men. In 1990, more than 49,000 women died of lung cancer in the United States. The current annual rate of deaths from lung cancer in male and female smokers is 180 per 100,000, or about 2 out of every 1000 smokers each year. The easiest way to avoid cancer is to avoid exposure to mutagens. The single greatest contribution one can make to a longer life is not to smoke. Chapter 18 Altering the Genetic Message 377 40 0 20 40 60 80 100 Age Percentage alive Never smoked regularly 1–14 cigarettes a day 15–24 cigarettes a day 25 or more a day 55 70 85 FIGURE 18.20 Tobacco reduces life expectancy. The world’s longest-running survey of smoking, begun in 1951 in Britain, revealed that by 1994 the death rate for smokers had climbed to three times the rate for nonsmokers among men 35 to 69 years of age. Source: Data from New Scientist, October 15, 1994. 0 1000 2000 3000 4000 5000 0 20 40 60 80 100 0 1000 2000 3000 4000 5000 0 20 40 60 80 100 Cigarettes smoked per capita per year Incidence of lung cancer (per 100,000 per year) 1900 1920 1940 1960 1980 1990 1900 1920 1940 1960 1980 1990 Men Women Lung cancer Lung cancer Smoking Smoking FIGURE 18.21 The incidence of lung cancer in men and women. What do these graphs indicate about the connection between smoking and lung cancer? Curing Cancer Potential cancer therapies are being developed on many fronts (figure 18.22). Some act to prevent the start of can- cer within cells. Others act outside cancer cells, preventing tumors from growing and spreading. Preventing the Start of Cancer Many promising cancer therapies act within potential can- cer cells, focusing on different stages of the cell’s “Shall I divide?” decision-making process. 1. Receiving the Signal to Divide. The first step in the decision process is the reception of a “divide” signal, usu- ally a small protein called a growth factor released from a neighboring cell. The growth factor is received by a pro- tein receptor on the cell surface. Mutations that increase the number of receptors on the cell surface amplify the di- vision signal and so lead to cancer. Over 20% of breast can- cer tumors prove to overproduce a protein called HER2 as- sociated with the receptor for epidermal growth factor. Therapies directed at this stage of the decision process utilize the human immune system to attack cancer cells. Special protein molecules called “monoclonal antibodies,” created by genetic engineering, are the therapeutic agents. These monoclonal antibodies are designed to seek out and stick to HER2. Like waving a red flag, the presence of the monoclonal antibody calls down attack by the immune sys- tem on the HER2 cell. Because breast cancer cells overpro- duce HER2, they are killed preferentially. Genentech’s re- cently approved monoclonal antibody, called “herceptin,” has given promising results in clinical tests. In other tests, the monoclonal antibody C225, directed against epidermal growth factor receptors, has succeeded in curing advanced colon cancer. Clinical trials of C225 have begun. 2. The Relay Switch. The second step in the decision process is the passage of the signal into the cell’s interior, the cytoplasm. This is carried out in normal cells by a pro- tein called Ras that acts as a relay switch. When growth factor binds to a receptor like EGF, the adjacent Ras pro- tein acts like it has been “goosed,” contorting into a new shape. This new shape is chemically active, and initiates a chain of reactions that passes the “divide” signal inward to- ward the nucleus. Mutated forms of the Ras protein behave like a relay switch stuck in the “ON” position, continually instructing the cell to divide when it should not. 30% of all cancers have a mutant form of Ras. Therapies directed at this stage of the decision process take advantage of the fact that normal Ras proteins are in- active when made. Only after it has been modified by the special enzyme farnesyl transferase does Ras protein become able to function as a relay switch. In tests on animals, farne- syl transferase inhibitors induce the regression of tumors and prevent the formation of new ones. 3. Amplifying the Signal. The third step in the decision process is the amplification of the signal within the cyto- plasm. Just as a TV signal needs to be amplified in order to be received at a distance, so a “divide” signal must be am- plified if it is to reach the nucleus at the interior of the cell, a very long journey at a molecular scale. Cells use an inge- nious trick to amplify the signal. Ras, when “ON,” activates an enzyme, a protein kinase. This protein kinase activates other protein kinases that in their turn activate still others. The trick is that once a protein kinase enzyme is activated, it goes to work like a demon, activating hoards of others every second! And each and every one it activates behaves the same way too, activating still more, in a cascade of ever- widening effect. At each stage of the relay, the signal is am- plified a thousand-fold. Mutations stimulating any of the protein kinases can dangerously increase the already ampli- fied signal and lead to cancer. Five percent of all cancers, for example, have a mutant hyperactive form of the protein kinase Src. Therapies directed at this stage of the decision process employ so-called “anti-sense RNA” directed specifically against Src or other cancer-inducing kinase mutations. The idea is that the src gene uses a complementary copy of itself to manufacture the Src protein (the “sense” RNA or mes- senger RNA), and a mirror image complementary copy of the sense RNA (“anti-sense RNA”) will stick to it, gum- ming it up so it can’t be used to make Src protein. The ap- proach appears promising. In tissue culture, anti-sense RNAs inhibit the growth of cancer cells, and some also ap- pear to block the growth of human tumors implanted in laboratory animals. Human clinical trials are underway. 4. Releasing the Brake. The fourth step in the decision process is the removal of the “brake” the cell uses to re- strain cell division. In healthy cells this brake, a tumor sup- pressor protein called Rb, blocks the activity of a transcrip- tion factor protein called E2F. When free, E2F enables the cell to copy its DNA. Normal cell division is triggered to begin when Rb is inhibited, unleashing E2F. Mutations which destroy Rb release E2F from its control completely, leading to ceaseless cell division. Forty percent of all can- cers have a defective form of Rb. Therapies directed at this stage of the decision process are only now being attempted. They focus on drugs able to inhibit E2F, which should halt the growth of tumors aris- ing from inactive Rb. Experiments in mice in which the E2F genes have been destroyed provide a model system to study such drugs, which are being actively investigated. 5. Checking That Everything Is Ready. The fifth step in the decision process is the mechanism used by the cell to en- sure that its DNA is undamaged and ready to divide. This job is carried out in healthy cells by the tumor-suppressor protein p53, which inspects the integrity of the DNA. When it de- tects damaged or foreign DNA, p53 stops cell division and activates the cell’s DNA repair systems. If the damage doesn’t 378 Part V Molecular Genetics get repaired in a reasonable time, p53 pulls the plug, trigger- ing events that kill the cell. In this way, mutations such as those that cause cancer are either repaired or the cells con- taining them eliminated. If p53 is itself destroyed by muta- tion, future damage accumulates unrepaired. Among this damage are mutations that lead to cancer. Fifty percent of all cancers have a disabled p53. Fully 70 to 80% of lung cancers have a mutant inactive p53—the chemical benzo[a]pyrene in cigarette smoke is a potent mutagen of p53. A promising new therapy using adenovirus (responsible for mild colds) is being targeted at cancers with a mutant p53. To grow in a host cell, adenovirus must use the prod- uct of its gene E1B to block the host cell’s p53, thereby en- abling replication of the adenovirus DNA. This means that while mutant adenovirus without E1B cannot grow in healthy cells, the mutants should be able to grow in, and destroy, cancer cells with defective p53. When human colon and lung cancer cells are introduced into mice lack- ing an immune system and allowed to produce substantial tumors, 60% of the tumors simply disappear when treated with E1B-deficient adenovirus, and do not reappear later. Initial clinical trials are less encouraging, as many people possess antibodies to adenovirus. 6. Stepping on the Gas. Cell division starts with replica- tion of the DNA. In healthy cells, another tumor suppressor “keeps the gas tank nearly empty” for the DNA replication process by inhibiting production of an enzyme called telom- erase. Without this enzyme, a cell’s chromosomes lose ma- terial from their tips, called telomeres. Every time a chro- mosome is copied, more tip material is lost. After some thirty divisions, so much is lost that copying is no longer possible. Cells in the tissues of an adult human have typi- cally undergone twenty five or more divisions. Cancer can’t get very far with only the five remaining cell divisions, so inhibiting telomerase is a very effective natural break on the cancer process. It is thought that almost all cancers involve a mutation that destroys the telomerase inhibitor, releasing this break and making cancer possible. It should be possible to block cancer by reapplying this inhibition. Cancer thera- pies that inhibit telomerase are just beginning clinical trials. Preventing the Spread of Cancer 7. Tumor Growth. Once a cell begins cancerous growth, it forms an expanding tumor. As the tumor grows ever- larger, it requires an increasing supply of food and nutri- ents, obtained from the body’s blood supply. To facilitate this necessary grocery shopping, tumors leak out sub- stances into the surrounding tissues that encourage angio- genesis, the formation of small blood vessels. Chemicals that inhibit this process are called angiogenesis inhibitors. In mice, two such angiogenesis inhibitors, angiostatin and endostatin, caused tumors to regress to microscopic size. This very exciting result has proven controversial, but ini- tial human trials seem promising. 8. Metastasis. If cancerous tumors simply continued to grow where they form, many could be surgically removed, and far fewer would prove fatal. Unfortunately, many can- cerous tumors eventually metastasize, individual cancer cells breaking their moorings to the extracellular matrix and spreading to other locations in the body where they ini- tiate formation of secondary tumors. This process involves metal-requiring protease enzymes that cleave the cell-ma- trix linkage, components of the extracellular matrix such as fibronectin that also promote the migration of several non- cancerous cell types, and RhoC, a GTP-hydrolyzing en- zyme that promotes cell migration by providing needed GTP. All of these components offer promising targets for future anti-cancer therapy. Therapies such as those described here are only part of a wave of potential treatments under development and clini- cal trial. The clinical trials will take years to complete, but in the coming decade we can expect cancer to become a curable disease. Understanding of how mutations produce cancer has progressed to the point where promising potential therapies can be tested. Chapter 18 Altering the Genetic Message 379 Cell surface protein Nucleus Cell Amplifying enzyme Extracellular matrix Capillary network Angiogenesis Division occurs Cell migration 1 2 3 4 65 7 8 FIGURE 18.22 New molecular therapies for cancer target eight different stages in the cancer process. (1) On the cell surface, a growth factor signals the cell to divide. (2) Just inside the cell, a protein relay switch passes on the divide signal. (3) In the cytoplasm, enzymes amplify the signal. In the nucleus, (4) a “brake” preventing DNA replication is released, (5) proteins check that the replicated DNA is not damaged, and (6) other proteins rebuild chromosome tips so DNA can replicate. (7) The new tumor promotes angiogenesis, the formation of growth-promoting blood vessels. (8) Some cancer cells break away from the extracellular matrix and invade other parts of the body. An Overview of Recombination Mutation is a change in the content of an organism’s genetic message, but it is not the only source of genetic diversity. Diversity is also generated when existing elements of the genetic message move around within the genome. As an analogy, consider the pages of this book. A point mutation would correspond to a change in one or more of the letters on the pages. For example, “ . . . in one or more of the let- ters of the pages” is a mutation of the previous sentence, in which an “n” is changed to an “f.” A significant alteration is also achieved, however, when we move the position of words, as in “ . . . in one or more of the pages on the let- ters.” The change alters (and destroys) the meaning of the sentence by exchanging the position of the words “letters” and “pages.” This second kind of change, which represents an alteration in the genomic location of a gene or a fragment of a gene, demonstrates genetic recombination. Gene Transfer Viewed broadly, genetic recombination can occur by two mechanisms (table 18.5). In gene transfer, one chromo- some or genome donates a segment to another chromo- some or genome. The transfer of genes from the human immunodeficiency virus (HIV) to a human chromosome is an example of gene transfer. Because gene transfer occurs in both prokaryotes and eukaryotes, it is thought to be the more primitive of the two mechanisms. Reciprocal Recombination Reciprocal recombination is when two chromosomes trade segments. It is exemplified by the crossing over that occurs between homologous chromo- somes during meiosis. Independent as- sortment during meiosis is another form of reciprocal recombination. Dis- cussed in chapters 12 and 13, it is re- sponsible for the 9:3:3:1 ratio of pheno- types in a dihybrid cross and occurs only in eukaryotes. Genetic recombination is a change in the genomic association among genes. It often involves a change in the position of a gene or portion of a gene. Recombination of this sort may result from one-way gene transfer or reciprocal gene exchange. 380 Part V Molecular Genetics Table 18.5 Classes of Genetic Recombination Class Occurrence GENE TRANSFERS Conjugation Occurs predominantly but not exclusively in bacteria and is targeted to specific locations in the genome Transposition Common in both bacteria and eukaryotes; genes move to new genomic locations, apparently at random RECIPROCAL RECOMBINATIONS Crossing over Requires the pairing of homologous chromosomes and may occur anywhere along their length Unequal crossing over The result of crossing over between mismatched segments; leads to gene duplication and deletion Gene conversion Occurs when homologous chromosomes pair and one is “corrected” to resemble the other Independent assortment Haploid cells produced by meiosis contain only one randomly selected member of each pair of homologous chromosomes 18.3 Recombination alters gene location. FIGURE 18.23 A Nobel Prize for discovering gene transfer by transposition. Barbara McClintock receiving her Nobel Prize in 1983. Gene Transfer Genes are not fixed in their locations on chromosomes or the circular DNA mole- cules of bacteria; they can move around. Some genes move because they are part of small, circular, extrachromosomal DNA segments called plasmids. Plasmids enter and leave the main genome at specific places where a nucleotide sequence matches one present on the plasmid. Plasmids occur pri- marily in bacteria, in which the main ge- nomic DNA can interact readily with other DNA fragments. About 5% of the DNA that occurs in a bacterium is plasmid DNA. Some plasmids are very small, containing only one or a few genes, while others are quite complex and contain many genes. Other genes move within transposons, which jump from one genomic position to another at random in both bacteria and eu- karyotes. Gene transfer by plasmid movement was discovered by Joshua Lederberg and Edward Tatum in 1947. Three years later, trans- posons were discovered by Barbara McClin- tock. However, her work implied that the position of genes in a genome need not be constant. Researchers accustomed to viewing genes as fixed entities, like beads on a string, did not readily accept the idea of trans- posons. Therefore, while Lederberg and Tatum were awarded a Nobel Prize for their discovery in 1958, McClintock did not re- ceive the same recognition for hers until 1983 (figure 18.23). Plasmid Creation To understand how plasmids arise, consider a hypotheti- cal stretch of bacterial DNA that contains two copies of the same nucleotide sequence. It is possible for the two copies to base-pair with each other and create a transient “loop,” or double duplex. All cells have recombination enzymes that can cause such double duplexes to undergo a reciprocal exchange, in which they exchange strands. As a result of the exchange, the loop is freed from the rest of the DNA molecule and becomes a plasmid (figure 18.24, steps 1–3). Any genes between the duplicated se- quences (such as gene A in figure 18.24) are transferred to the plasmid. Once a plasmid has been created by reciprocal exchange, DNA polymerase will replicate it if it contains a replication origin, often without the controls that restrict the main genome to one replication per cell division. Consequently, some plasmids may be present in multiple copies, others in just a few copies, in a given cell. Integration A plasmid created by recombination can reenter the main genome the same way it left. Sometimes the region of the plasmid DNA that was involved in the original exchange, called the recognition site, aligns with a matching se- quence on the main genome. If a recombination event oc- curs anywhere in the region of alignment, the plasmid will integrate into the genome (figure 18.24, steps 4–6). Inte- gration can occur wherever any shared sequences exist, so plasmids may be integrated into the main genome at posi- tions other than the one from which they arose. If a plas- mid is integrated at a new position, it transfers its genes to that new position. Transposons and plasmids transfer genes to new locations on chromosomes. Plasmids can arise from and integrate back into a genome wherever DNA sequences in the genome and in the plasmid match. Chapter 18 Altering the Genetic Message 381 4 Integration Plasmid D BH11032 CH11032 C DH11032 B A BH11032 D CH11032 CDH11032 B B 3 1 2 Homologous pairing Bacterial chromosome DH11032 CH11032 C BH11032 DA A Homologous pairing Excision Excision Integration 6 5 FIGURE 18.24 Integration and excision of a plasmid. Because the ends of the two sequences in the bacterial genome are the same (D′, C′, B′, and D, C, B), it is possible for the two ends to pair. Steps 1–3 show the sequence of events if the strands exchange during the pairing. The result is excision of the loop and a free circle of DNA—a plasmid. Steps 4–6 show the sequence when a plasmid integrates itself into a bacterial genome. Gene Transfer by Conjugation One of the startling discoveries Lederberg and Tatum made was that plasmids can pass from one bacterium to an- other. The plasmid they studied was part of the genome of Escherichia coli. It was given the name F for fertility factor because only cells which had that plasmid integrated into their DNA could act as plasmid donors. These cells are called Hfr cells (for “high-frequency recombination”). The F plasmid contains a DNA replication origin and several genes that promote its transfer to other cells. These genes encode protein subunits that assemble on the surface of the bacterial cell, forming a hollow tube called a pilus. When the pilus of one cell (F + ) contacts the surface of another cell that lacks a pilus, and therefore does not con- tain an F plasmid (F – ), the pilus draws the two cells close together so that DNA can be exchanged (figure 18.25). First, the F plasmid binds to a site on the interior of the F + cell just beneath the pilus. Then, by a process called rolling-circle replication, the F plasmid begins to copy its DNA at the binding point. As it is replicated, the single- stranded copy of the plasmid passes into the other cell. There a complementary strand is added, creating a new, stable F plasmid (figure 18.26). In this way, genes are passed from one bacterium to another. This transfer of genes between bacteria is called conjugation. In an Hfr cell, with the F plasmid integrated into the main bacterial genome rather than free in the cytoplasm, the F plasmid can still organize the transfer of genes. In this case, the integrated F region binds beneath the pilus and initiates the replication of the bacterial genome, transfer- ring the newly replicated portion to the recipient cell. Transfer proceeds as if the bacterial genome were simply a part of the F plasmid. By studying this phenomenon, re- searchers have been able to locate the positions of different genes in bacterial genomes (figure 18.27). Gene Transfer by Transposition Like plasmids, transposons (figure 18.28) move from one genomic location to another. After spending many genera- tions in one position, a transposon may abruptly move to a new position in the genome, carrying various genes along with it. Transposons encode an enzyme called trans- posase, that inserts the transposon into the genome (figure 18.29). Because this enzyme usually does not recognize any particular sequence on the genome, transposons appear to move to random destinations. The movement of any given transposon is relatively rare: it may occur perhaps once in 100,000 cell generations. Although low, this rate is still about 10 times as frequent as 382 Part V Molecular Genetics FIGURE 18.25 Contact by a pilus. The pilus of an F + cell connects to an F - cell and draws the two cells close together so that DNA transfer can occur. F + (donor cell) F - (recipient cell) F Plasmid Bacterial chromosome Conjugation bridge FIGURE 18.26 Gene transfer between bacteria. Donor cells (F + ) contain an F plasmid that recipient cells (F – ) lack. The F plasmid replicates itself and transfers the copy across a conjugation bridge. The remaining strand of the plasmid serves as a template to build a replacement. When the single strand enters the recipient cell, it serves as a template to assemble a double-stranded plasmid. When the process is complete, both cells contain a complete copy of the plasmid. the rate at which random mutational changes occur. Fur- thermore, there are many transposons in most cells. Hence, over long periods of time, transposition can have an enor- mous evolutionary impact. One way this impact can be felt is through mutation. The insertion of a transposon into a gene often destroys the gene’s function, resulting in what is termed insertional inactivation. This phenomenon is thought to be the cause of a significant number of the spontaneous mutations ob- served in nature. Transposition can also facilitate gene mobilization, the bringing together in one place of genes that are usu- ally located at different positions in the genome. In bacte- ria, for example, a number of genes encode enzymes that make the bacteria resistant to antibiotics such as peni- cillin, and many of these genes are located on plasmids. The simultaneous exposure of bacteria to multiple antibi- otics, a common medical practice some years ago, favors the persistence of plasmids that have managed to acquire several resistance genes. Transposition can rapidly gener- ate such composite plasmids, called resistance transfer factors (RTFs), by moving antibiotic resistance genes from several plasmids to one. Bacteria possessing RTFs are thus able to survive treatment with a wide variety of antibiotics. RTFs are thought to be responsible for much of the recent difficulty in treating hospital-engendered Staphylococcus aureus infections and the new drug-resistant strains of tuberculosis. Plasmids transfer copies of bacterial genes (and even entire genomes) from one bacterium to another. Transposition is the one-way transfer of genes to a randomly selected location in the genome. The genes move because they are associated with mobile genetic elements called transposons. Chapter 18 Altering the Genetic Message 383 Plasmid Transposon FIGURE 18.28 Transposon. Transposons form characteristic stem-and- loop structures called “lollipops” because their two ends have the same nucleotide sequence as inverted repeats. These ends pair together to form the stem of the lollipop. Transposon Transposase FIGURE 18.29 Transposition. Transposase does not recognize any particular DNA sequence; rather, it selects one at random, moving the transposon to a random location. Some transposons leave a copy of themselves behind when they move. Map of E. coli genome leu azi ton lac gal tyr-cys his ade ser-gly xyl met-B 12 thi Direction of transfer azi 0 min 10 min 20 min 25 min ton Time elapsed from beginning of conjugation until interruption (a) (b) lac gal thr R arg FIGURE 18.27 A conjugation map of the E. coli chromosome. Scientists have been able to break the Escherichia coli conjugation bridges by agitating the cell suspension rapidly in a blender. By agitating at different intervals after the start of conjugation, investigators can locate the positions of various genes along the bacterial genome. (a) The closer the genes are to the origin of replication, the sooner one has to turn on the blender to block their transfer. (b) Map of the E. coli genome developed using this method. Reciprocal Recombination In the second major mechanism for producing genetic re- combination, reciprocal recombination, two homologous chromosomes exchange all or part of themselves during the process of meiosis. Crossing Over As we saw in chapter 12, crossing over occurs in the first prophase of meiosis, when two homologous chromosomes line up side by side within the synaptonemal complex. At this point, the homologues exchange DNA strands at one or more locations. This exchange of strands can produce chromosomes with new combinations of alleles. Imagine, for example, that a giraffe has genes encoding neck length and leg length at two different loci on one of its chromosomes. Imagine further that a recessive mutation occurs at the neck length locus, leading after several rounds of independent assortment to some individuals that are ho- mozygous for a variant “long-neck” allele. Similarly, a re- cessive mutation at the leg length locus leads to homozy- gous “long-leg” individuals. It is very unlikely that these two mutations would arise at the same time in the same individual because the prob- ability of two independent events occurring together is the product of their individual probabilities. If the spon- taneous occurrence of both mutations in a single individ- ual were the only way to produce a giraffe with both a long neck and long legs, it would be extremely unlikely that such an individual would ever occur. Because of re- combination, however, a crossover in the interval be- tween the two genes could in one meiosis produce a chromosome bearing both variant alleles. This ability to reshuffle gene combinations rapidly is what makes re- combination so important to the production of natural variation. Unequal Crossing Over Reciprocal recombination can occur in any region along two homologous chromosomes with sequences similar enough to permit close pairing. Mistakes in pairing occa- sionally happen when several copies of a sequence exist in different locations on a chromosome. In such cases, one copy of a sequence may line up with one of the duplicate copies instead of with its homologous copy. Such misalign- ment causes slipped mispairing, which, as we discussed ear- lier, can lead to small deletions and frame-shift mutations. If a crossover occurs in the pairing region, it will result in unequal crossing over because the two homologues will ex- change segments of unequal length. In unequal crossing over, one chromosome gains extra copies of the multicopy sequences, while the other chro- mosome loses them (figure 18.30). This process can gener- ate a chromosome with hundreds of copies of a particular gene, lined up side by side in tandem array. Because the genomes of most eukaryotes possess mul- tiple copies of transposons scattered throughout the chromosomes, unequal crossing over between copies of transposons located in different positions has had a pro- found influence on gene organization in eukaryotes. As we shall see later, most of the genes of eukaryotes appear to have been duplicated one or more times during their evolution. Gene Conversion Because the two homologues that pair within a synaptone- mal complex are not identical, some nucleotides in one ho- mologue are not complementary to their counterpart in the other homologue with which it is paired. These occasional nonmatching pairs of nucleotides are called mismatch pairs. As you might expect, the cell’s error-correcting machin- ery is able to detect mismatch pairs. If a mismatch is de- tected during meiosis, the enzymes that “proofread” new DNA strands during DNA replication correct it. The mis- matched nucleotide in one of the homologues is excised and replaced with a nucleotide complementary to the one in the other homologue. Its base-pairing partner in the first homologue is then replaced, producing two chromosomes with the same sequence. This error correction causes one of the mismatched sequences to convert into the other, a process called gene conversion. Unequal crossing over is a crossover between chromosomal regions that are similar in nucleotide sequence but are not homologous. Gene conversion is the alteration of one homologue by the cell’s error- detection and repair system to make it resemble the other homologue. 384 Part V Molecular Genetics 16 Gene copies 16 Gene copies 27 Gene copies 5 Gene copies FIGURE 18.30 Unequal crossing over. When a repeated sequence pairs out of register, a crossover within the region will produce one chromosome with fewer gene copies and one with more. Much of the gene duplication that has occurred in eukaryotic evolution may well be the result of unequal crossing over. Trinucleotide Repeats In 1991, a new kind of change in the genetic material was reported, one that involved neither changes in the identity of nucleotides (mutation) nor changes in the position of nucleotide sequences (recombination), but rather an in- crease in the number of copies of repeated trinucleotide se- quences. Called trinucleotide repeats, these changes ap- pear to be the root cause of a surprisingly large number of inherited human disorders. The first examples of disorders resulting from the ex- pansion of trinucleotide repeat sequences were reported in individuals with fragile X syndrome (the most common form of developmental disorder) and spinal muscular atrophy. In both disorders, genes containing runs of repeated nu- cleotide triplets (CGG in fragile X syndrome and CAG in spinal muscular atrophy) exhibit large increases in copy number. In individuals with fragile X syndrome, for exam- ple, the CGG sequence is repeated hundreds of times (fig- ure 18.31), whereas in normal individuals it repeats only about 30 times. Ten additional human genes are now known to have al- leles with expanded trinucleotide repeats (figure 18.32). Many (but not all) of these alleles are GC-rich. A few of the alleles appear benign, but most are associated with herita- ble disorders, including Huntington’s disease, myotonic dystrophy, and a variety of neurological ataxias. In each case, the expansion transmits as a dominant trait. Often the repeats are found within the exons of their genes, but sometimes, as in the case of fragile X syndrome, they are located outside the coding segment. Furthermore, although the repeat number is stably transmitted in normal families, it shows marked instability once it has abnormally ex- panded. Siblings often exhibit unique repeat lengths. As the repeat number increases, disease severity tends to increase in step. In fragile X syndrome, the CGG triplet number first increases from the normal stable range of 5 to 55 times (the most common allele has 29 repeats) to an un- stable number of repeats ranging from 50 to 200, with no detectable effect. In offspring, the number increases markedly, with copy numbers ranging from 200 to 1300, with significant mental retardation (see figure 18.31). Simi- larly, the normal allele for myotonic dystrophy has 5 GTC repeats. Mildly affected individuals have about 50, and se- verely affected individuals have up to 1000. Trinucleotide repeats appear common in human genes, but their function is unknown. Nor do we know the mech- anism behind trinucleotide repeat expansion. It may in- volve unequal crossing over, which can readily produce copy-number expansion, or perhaps some sort of stutter in the DNA polymerase when it encounters a run of triplets. The fact that di- and tetranucleotide repeat expansions are not found seems an important clue. Undoubtedly, further examples of this remarkable class of genetic change will be reported in the future. Considerable research is currently focused on this extremely interesting area. Many human genes contain runs of a trinucleotide sequence. Their function is unknown, but if the copy number expands, hereditary disorders often result. Chapter 18 Altering the Genetic Message 385 Normal allele CGG 5–55 CGG repeats CGGCGG Pre-fragile X allele 50–200 CGG repeats Fragile X allele 200–1300 CGG repeats FIGURE 18.31 CGG repeats in fragile X alleles. The CGG triplet is repeated approximately 30 times in normal alleles. Individuals with pre- fragile X alleles show no detectable signs of the syndrome but do have increased numbers of CGG repeats. In fragile X alleles, the CGG triplet repeats hundreds of times. CGG CAG CTGGAA Fragile X syndrome Fragile site 11B Fragile XE syndrome Spinal and bulbar muscular atrophy Spinocerebellar ataxia type 1 Huntington's disease Dentatorubral-pallidoluysian atrophy Machado-Joseph disease Myotonic dystrophyFriedreich's ataxia Exon 1 Exon 2 Exon 3Intron 1 Intron 2 Repeated trinucleotide Condition FIGURE 18.32 A hypothetical gene showing the locations and types of trinucleotide repeats associated with various human diseases. The CGG repeats of fragile X syndrome, fragile XE syndrome, and fragile site 11B occur in the first exon of their respective genes. GAA repeats characteristic of Friedreich’s ataxia exist in the first intron of its gene. The genes for five different diseases, including Huntington’s disease, have CAG repeats within their second exons. Lastly, the myotonic dystrophy gene contains CTG repeats within the third exon. Classes of Eukaryotic DNA The two main mechanisms of genetic recombination, gene transfer and reciprocal recombination, are directly respon- sible for the architecture of the eukaryotic chromosome. They determine where genes are located and how many copies of each exist. To understand how recombination shapes the genome, it is instructive to compare the effects of recombination in bacteria and eukaryotes. Comparing Bacterial and Eukaryotic DNA Sequences Bacterial genomes are relatively simple, containing genes that almost always occur as single copies. Unequal crossing over between repeated transposition elements in their cir- cular DNA molecules tends to delete material, fostering the maintenance of a minimum genome size (figure 18.33a). For this reason, these genomes are very tightly packed, with few or no noncoding nucleotides. Recall the efficient use of space in the organization of the lac genes described in chapter 16. In eukaryotes, by contrast, the introduction of pairs of homologous chromosomes (presumably because of their importance in repairing breaks in double-stranded DNA) has led to a radically different situation. Unequal crossing over between homologous chromosomes tends to promote the duplication of material rather than its reduction (figure 18.33b). Consequently, eukaryotic genomes have been in a constant state of flux during the course of their evolution. Multiple copies of genes have evolved, some of them subse- quently diverging in sequence to become different genes, which in turn have duplicated and diverged. Six different classes of eukaryotic DNA sequences are commonly recognized, based on the number of copies of each (table 18.6). Transposons Transposons exist in multiple copies scattered about the genome. In Drosophila, for example, more than 30 different transposons are known, most of them present at 20 to 40 different sites throughout the genome. In all, the known transposons of Drosophila account for perhaps 5% of its DNA. Mammalian genomes contain fewer kinds of trans- posons than the genomes of many other organisms, al- though the transposons in mammals are repeated more often. The family of human transposons called ALU ele- ments, for example, typically occurs about 300,000 times in each cell. Transposons are transcribed but appear to play no functional role in the life of the cell. As noted earlier in this chapter, many transposition events carry transposons into the exon portions of genes, disrupting the function of the protein specified by the gene transcript. These inser- tional inactivations are thought to be responsible for many naturally occurring mutations. Tandem Clusters A second class consists of DNA sequences that are repeated many times, one copy following another in tandem array. By transcribing all of the copies in these tandem clusters simultaneously, a cell can rapidly obtain large amounts of the product they encode. For example, the genes encoding rRNA are present in several hundred copies in most eu- karyotic cells. Because these clusters are active sites of rRNA synthesis, they are readily visible in cytological preparations, where they are called nucleolar organizer regions. When transcription of the rRNA gene clusters ceases during cell division, the nucleolus disappears from view under the microscope, but it reappears when tran- scription begins again. The genes present in a tandem cluster are very similar in sequence but not always identical; some may differ by one 386 Part V Molecular Genetics 18.4 Genomes are continually evolving. Unequal crossing over within a bacterial genome deletes material Lost (a) Unequal crossing over between chromosomes adds material to one and subtracts it from the other (b) X X FIGURE 18.33 Unequal crossing over has different consequences in bacteria and eukaryotes. (a) Bacteria have a circular DNA molecule, and a crossover between duplicate regions within the molecule deletes the intervening material. (b) In eukaryotes, with two versions of each chromosome, crossing over adds material to one chromosome; thus, gene amplification occurs in that chromosome. or a few nucleotides. Each gene in the cluster is separated from its neighbors by a short “spacer” sequence that is not transcribed. Unlike the genes, the spacers in a cluster vary considerably in sequence and in length. Multigene Families As we have learned more about the nucleotide sequences of eukaryotic genomes, it has become apparent that many genes exist as parts of multigene families, groups of re- lated but distinctly different genes that often occur to- gether in a cluster. Multigene families differ from tandem clusters in that they contain far fewer genes (from three to several hundred), and those genes differ much more from one another than the genes in tandem clusters. Despite their differences, the genes in a multigene family are clearly related in their sequences, making it likely that they arose from a single ancestral sequence through a series of un- equal crossing over events. For example, studies of the evo- lution of the hemoglobin multigene family indicate that the ancestral globin gene is at least 800 million years old. By the time modern fishes evolved, this ancestral gene had al- ready duplicated, forming the α and β forms. Later, after the evolutionary divergence of amphibians and reptiles, these two globin gene forms moved apart on the chromo- some; the mechanism of this movement is not known, but it may have involved transposition. In mammals, two more waves of duplication occurred to produce the array of 11 globin genes found in the human genome. Three of these genes are silent, encoding nonfunctional proteins. Other genes are expressed only during embryonic (ζ and ε) or fetal (γ) development. Only four (δ, β, α 1 , and α 2 ) encode the polypeptides that make up adult human hemoglobin. Satellite DNA Some short nucleotide sequences are repeated several mil- lion times in eukaryotic genomes. These sequences are col- lectively called satellite DNA and occur outside the main body of DNA. Almost all satellite DNA is either clustered around the centromere or located near the ends of the chromosomes, at the telomeres. These regions of the chro- mosomes remain highly condensed, tightly coiled, and un- transcribed throughout the cell cycle; this suggests that satellite DNA may serve some sort of structural function, such as initiating the pairing of homologous chromosomes in meiosis. About 4% of the human genome consists of satellite DNA. Dispersed Pseudogenes Silent copies of a gene, inactivated by mutation, are called pseudogenes. Such mutations may affect the gene’s pro- moter (see chapter 16), shift the reading frame of the gene, or produce a small deletion. While some pseudogenes occur within a multigene family cluster, others are widely separated. The latter are called dispersed pseudogenes because they are believed to have been dispersed from their original position within a multigene family cluster. No one suspected the existence of dispersed pseudogenes until a few years ago, but they are now thought to be of major evolutionary significance in eukaryotes. Single-Copy Genes Ever since eukaryotes appeared, processes such as unequal crossing over between different copies of transposons have repeatedly caused segments of chromosomes to duplicate, and it appears that no portion of the genome has escaped this phenomenon. The duplication of genes, followed by the conversion of some of the copies into pseudogenes, has probably been the major source of “new” genes during the evolution of eukaryotes. As pseudogenes accumulate muta- tional changes, a fortuitous combination of changes may eventually result in an active gene encoding a protein with different properties. When that new gene first arises, it is a single-copy gene, but in time it, too, will be duplicated. Thus, a single-copy gene is but one stage in the cycle of duplication and divergence that has characterized the evo- lution of the eukaryotic genome. Gene sequences in eukaryotes vary greatly in copy number, some occurring many thousands of times, others only once. Many protein-encoding eukaryotic genes occur in several nonidentical copies, some of them not transcribed. Chapter 18 Altering the Genetic Message 387 Table 18.6 Classes of DNA Sequences Found in Eukaryotes Class Description Transposons Thousands of copies scattered around the genome Tandem clusters Clusters containing hundreds of nearly identical copies of a gene Multigene families Clusters of a few to several hundred copies of related but distinctly different genes Satellite DNA Short sequences present in millions of copies per genome Dispersed pseudogenes Inactive members of a multigene family separated from other members of the family Single-copy genes Genes that exist in only one copy in the genome 388 Part V Molecular Genetics Chapter 18 Summary Questions Media Resources 18.1 Mutations are changes in the genetic message. ? A mutation is any change in the hereditary message. ? Mutations that change one or a few nucleotides are called point mutations. They may arise as a result of damage from ionizing or ultraviolet radiation, chemical mutagens, or errors in pairing during DNA replication. 1. What are pyrimidine dimers? How do they form? How are they repaired? What may happen if they are not repaired? 2. Explain how slipped mispairing can cause deletions and frame-shift mutations. ? Cancer is a disease in which the regulatory controls that normally restrain cell division are disrupted. ? A variety of environmental factors, including ionizing radiation, chemical mutagens, and viruses, have been implicated in causing cancer. ? The best way to avoid getting cancer is to avoid exposure to mutagens, especially those in cigarette smoke. 3. What is transfection? What has it revealed about the genetic basis of cancer? 4. About how many genes can be mutated to cause cancer? Why do most cancers require mutations in multiple genes? 18.2 Cancer results from mutation of growth-regulating genes. ? Recombination is the creation of new gene combinations. It includes changes in the position of genes or fragments of genes as well as the exchange of entire chromosomes during meiosis. ? Genes may be transferred between bacteria when they are included within small circles of DNA called plasmids. ? Transposition is the random movement of genes within transposons to new locations in the genome. It is responsible for many naturally occurring mutations, as the insertion of a transposon into a gene often inactivates the gene. ? Crossing over involves a physical exchange of genetic material between homologous chromosomes during the close pairing that occurs in meiosis. It may produce chromosomes that have different combinations of alleles. 5. What is genetic recombination? What mechanisms produce it? Which of these mechanisms occurs in prokaryotes, and which occurs in eukaryotes? 6. What is a plasmid? What is a transposon? How are plasmids and transposons similar, and how are they different? 7. What are mismatched pairs? How are they corrected? What effect does this correction have on the genetic message? 18.3 Recombination alters gene location. ? Satellite sequences are short sequences of nucleotides repeated millions of times. ? Tandem clusters are genes that occur in thousands of copies grouped together at one or a few sites on a chromosome. These genes encode products that are required by the cell in large amounts. ? Multigene families consist of copies of genes clustered at one site on a chromosome that diverge in sequence more than the genes in a tandem cluster. 8. What kinds of genes exist in multigene families? How are these families thought to have evolved? 9. What are pseudogenes? How might they have been involved in the evolution of single-copy genes? 18.4 Genomes are continually evolving. www.mhhe.com www.biocourse.com ? Mutations ? DNA repair ? Experiment: Luria/Delbrück- Mutations Occur in Random ? Polymerase Chain Reaction ? Student Research: Age and Breast Cancer On Science Articles: ? Understanding Cancer ? Evidence Links Cigarette Smoking to Lung Cancer ? Deadly Cancer is Becoming More Common ? Recombinant DNA/Technology ? Experiments: McClintock/Stern ? Student research: DNA repair in fish 389 19 Gene Technology Concept Outline 19.1 The ability to manipulate DNA has led to a new genetics. Restriction Endonucleases. Enzymes that cleave DNA at specific sites allow DNA segments from different sources to be spliced together. Using Restriction Endonucleases to Manipulate Genes. Fragments produced by cleaving DNA with restriction endonucleases can be spliced into plasmids, which can be used to insert the DNA into host cells. 19.2 Genetic engineering involves easily understood procedures. The Four Stages of a Genetic Engineering Experiment. Gene engineers cut DNA into fragments that they splice into vectors that carry the fragments into cells. Working with Gene Clones. Gene technology is used in a variety of procedures involving DNA manipulation. 19.3 Biotechnology is producing a scientific revolution. DNA Sequence Technology. The complete nucleotide sequence of the genomes of many organisms are now known. The unique DNA of every individual can be used to identify sperm, blood, or other tissues. Biochips. Biochips are squares of glass etched with DNA strands and can be used for genetic screening. Medical Applications. Many drugs and vaccines are now produced with gene technology. Agricultural Applications. Gene engineers have developed crops resistant to pesticides and pests, as well as commercially superior animals. Cloning. Recent experiments show it is possible to clone agricultural animals, a result with many implications for both agriculture and society. Stem Cells. Both embryonic stem cells and tissue- specific stem cells can potentially be used to repair or replace damaged tissue. Ethics and Regulation. Genetic engineering raises important questions about danger and privacy. O ver the past decades, the development of new and powerful techniques for studying and manipulating DNA has revolutionized genetics (figure 19.1). These tech- niques have allowed biologists to intervene directly in the genetic fate of organisms for the first time. In this chapter, we will explore these technologies and consider how they apply to specific problems of great practical importance. Few areas of biology will have as great an impact on our fu- ture lives. FIGURE 19.1 A famous plasmid. The circular molecule in this electron micrograph is pSC101, the first plasmid used successfully to clone a vertebrate gene. Its name comes from the fact that it was the one-hundred-and-first plasmid isolated by Stanley Cohen. quences of nucleotides in DNA. These enzymes are the basic tools of genetic engineering. Discovery of Restriction Endonucleases Scientific discoveries often have their origins in seemingly unimportant observations that receive little attention by re- searchers before their general significance is appreciated. In the case of genetic engineering, the original observation was that bacteria use enzymes to defend themselves against viruses. Most organisms eventually evolve means of defending themselves from predators and parasites, and bacteria are no exception. Among the natural enemies of bacteria are bacteriophages, viruses that infect bacteria and multiply within them. At some point, they cause the bacterial cells to burst, releasing thousands more viruses. Through natural selection, some types of bacteria have acquired powerful weapons against these viruses: they contain enzymes called restriction endonucleases that fragment the viral DNA as soon as it enters the bacterial cell. Many restriction en- donucleases recognize specific nucleotide sequences in a DNA strand, bind to the DNA at those sequences, and cleave the DNA at a particular place within the recognition sequence. Why don’t restriction endonucleases cleave the bacter- ial cells’ own DNA as well as that of the viruses? The an- swer to this question is that bacteria modify their own DNA, using other enzymes known as methylases to add methyl (—CH 3 ) groups to some of the nucleotides in the bacterial DNA. When nucleotides within a restriction en- donuclease’s recognition sequence have been methylated, the endonuclease cannot bind to that sequence. Conse- quently, the bacterial DNA is protected from being de- graded at that site. Viral DNA, on the other hand, has not been methylated and therefore is not protected from enzy- matic cleavage. How Restriction Endonucleases Cut DNA The sequences recognized by restriction endonucleases are typically four to six nucleotides long, and they are often palindromes. This means the nucleotides at one end of the recognition sequence are complementary to those at the other end, so that the two strands of the DNA duplex have the same nucleotide sequence running in opposite direc- tions for the length of the recognition sequence. Two im- portant consequences arise from this arrangement of nucleotides. 390 Part V Molecular Genetics Restriction Endonucleases In 1980, geneticists used the relatively new technique of gene splicing, which we will describe in this chapter, to introduce the human gene that encodes interferon into a bacterial cell’s genome. Interferon is a rare blood pro- tein that increases human resistance to viral infection, and medical scientists have been interested in its possible usefulness in cancer therapy. This possibility was diffi- cult to investigate before 1980, however, because purifi- cation of the large amounts of interferon required for clinical testing would have been prohibitively expensive, given interferon’s scarcity in the blood. An inexpensive way to produce interferon was needed, and introducing the gene responsible for its production into a bacterial cell made that possible. The cell that had acquired the human interferon gene proceeded to produce interferon at a rapid rate, and to grow and divide. Soon there were millions of interferon-producing bacteria in the culture, all of them descendants of the cell that had originally re- ceived the human interferon gene. The Advent of Genetic Engineering This procedure of producing a line of genetically identical cells from a single altered cell, called cloning, made every cell in the culture a miniature factory for producing inter- feron. The human insulin gene has also been cloned in bac- teria, and now large amounts of insulin, a hormone essen- tial for treating some forms of diabetes, can be manufactured at relatively little expense. Beyond these clin- ical applications, cloning and related molecular techniques are used to obtain basic information about how genes are put together and regulated. The interferon experiment and others like it marked the beginning of a new genetics, ge- netic engineering. The essence of genetic engineering is the ability to cut DNA into recognizable pieces and rearrange those pieces in different ways. In the interferon experiment, a piece of DNA carrying the interferon gene was inserted into a plas- mid, which then carried the gene into a bacterial cell. Most other genetic engineering approaches have used the same general strategy, bringing the gene of interest into the tar- get cell by first incorporating it into a plasmid or an infec- tive virus. To make these experiments work, one must be able to cut the source DNA (human DNA in the interferon experiment, for example) and the plasmid DNA in such a way that the desired fragment of source DNA can be spliced permanently into the plasmid. This cutting is per- formed by enzymes that recognize and cleave specific se- 19.1 The ability to manipulate DNA has led to a new genetics. First, because the same recognition sequence occurs on both strands of the DNA duplex, the restriction endonucle- ase can bind to and cleave both strands, effectively cutting the DNA in half. This ability to cut across both strands is almost certainly the reason that restric- tion endonucleases have evolved to rec- ognize nucleotide sequences with twofold rotational symmetry. Second, because the bond cleaved by a restriction endonuclease is typically not positioned in the center of the recognition sequence to which it binds, and because the DNA strands are an- tiparallel, the cut sites for the two strands of a duplex are offset from each other (figure 19.2). After cleavage, each DNA fragment has a single-stranded end a few nucleotides long. The single- stranded ends of the two fragments are complementary to each other. Why Restriction Endonucleases Are So Useful There are hundreds of bacterial restric- tion endonucleases, and each one has a specific recognition sequence. By chance, a particular endonuclease’s recognition sequence is likely to occur somewhere in any given sample of DNA; the shorter the sequence, the more often it will arise by chance within a sample. Therefore, a given restriction endonuclease can probably cut DNA from any source into fragments. Each fragment will have complementary single-stranded ends characteristic of that endonuclease. Because of their complementarity, these single-stranded ends can pair with each other (conse- quently, they are sometimes called “sticky ends”). Once their ends have paired, two fragments can then be joined together with the aid of the en- zyme DNA ligase, which re-forms the phosphodiester bonds of DNA. What makes restriction endonucleases so valuable for genetic engineering is the fact that any two frag- ments produced by the same restriction endonuclease can be joined together. Fragments of elephant and ostrich DNA cleaved by the same endonuclease can be joined to one an- other as readily as two bacterial DNA fragments. Genetic engineering involves manipulating specific genes by cutting and rearranging DNA. A restriction endonuclease cleaves DNA at a specific site, generating in most cases two fragments with short single-stranded ends. Because these ends are complementary to each other, any pair of fragments produced by the same endonuclease, from any DNA source, can be joined together. Chapter 19 Gene Technology 391 GAATTC CTTAAG GAATTC AATTC AATTC AATTC GAATTC G G G G G AA TTC G CTTAAG CTT AA G CTTAA CTTAA CTTAAG DNA ligase joins the strands. DNA from another source cut with the same restriction endonuclease is added. Restriction endonuclease cleaves the DNA. DNA duplex Sticky ends (complementary single-stranded DNA tails) Restriction sites Recombinant DNA molecule FIGURE 19.2 Many restriction endonucleases produce DNA fragments with “sticky ends.” The restriction endonuclease EcoRI always cleaves the sequence GAATTC between G and A. Because the same sequence occurs on both strands, both are cut. However, the two sequences run in opposite directions on the two strands. As a result, single-stranded tails are produced that are complementary to each other, or “sticky.” Using Restriction Endonucleases to Manipulate Genes A chimera is a mythical creature with the head of a lion, body of a goat, and tail of a serpent. Although no such creatures ex- isted in nature, biologists have made chimeras of a more modest kind through genetic engineering. Constructing pSC101 One of the first chimeras was manufac- tured from a bacterial plasmid called a resistance transfer factor by American geneticists Stanley Cohen and Herbert Boyer in 1973. Cohen and Boyer used a restriction endonuclease called EcoRI, which is obtained from Escherichia coli, to cut the plasmid into fragments. One fragment, 9000 nucleotides in length, contained both the origin of replication necessary for replicating the plasmid and a gene that conferred resistance to the antibiotic tetracycline (tet r ). Because both ends of this fragment were cut by the same restriction endonuclease, they could be ligated to form a circle, a smaller plasmid Cohen dubbed pSC101 (figure 19.3). Using pSC101 to Make Recombinant DNA Cohen and Boyer also used EcoRI to cleave DNA that coded for rRNA that they had isolated from an adult am- phibian, the African clawed frog, Xenopus laevis. They then mixed the fragments of Xenopus DNA with pSC101 plasmids that had been “reopened” by EcoRI and allowed bacterial cells to take up DNA from the mixture. Some of the bacterial cells immediately became resistant to tetra- cycline, indicating that they had incorporated the pSC101 plasmid with its antibiotic-resistance gene. Furthermore, some of these pSC101-containing bacteria also began to produce frog ribosomal RNA! Cohen and Boyer con- cluded that the frog rRNA gene must have been inserted into the pSC101 plasmids in those bacteria. In other words, the two ends of the pSC101 plasmid, produced by cleavage with EcoRI, had joined to the two ends of a frog DNA fragment that contained the rRNA gene, also cleaved with EcoRI. The pSC101 plasmid containing the frog rRNA gene is a true chimera, an entirely new genome that never existed in nature and never would have evolved by natural means. It is a form of recombinant DNA—that is, DNA created in the laboratory by joining together pieces of different genomes to form a novel combination. Other Vectors The introduction of foreign DNA fragments into host cells has become common in molecular genetics. The genome that carries the foreign DNA into the host cell is called a vector. Plasmids, with names like pUC18 can be induced to make hundreds of copies of themselves and thus of the foreign genes they contain. Much larger pieces of DNA can be introduced using YAKs (yeast artificial chromosomes) as a vector instead of a plasmid. Not all vectors have bacterial targets. Animal viruses such as the human cold virus aden- ovirus, for example, are serving as vectors to carry genes into monkey and human cells, and animal genes have even been introduced into plant cells. One of the first recombinant genomes produced by genetic engineering was a bacterial plasmid into which an amphibian ribosomal RNA gene was inserted. Viruses can also be used as vectors to insert foreign DNA into host cells and create recombinant genomes. 392 Part V Molecular Genetics Amphibian DNA Endonuclease EcoRI rRNA gene Recombinant plasmid Plasmid pSC101 tet r gene Cleaved plasmid is combined with amphibian fragment. Cleave plasmid pSC101 with EcoRI. Cleave amphibian DNA with restriction endonuclease EcoRI. FIGURE 19.3 One of the first genetic engineering experiments. This diagram illustrates how Cohen and Boyer inserted an amphibian gene encoding rRNA into pSC101. The plasmid contains a single site cleaved by the restriction endonuclease EcoRI; it also contains tet r , a gene which confers resistance to the antibiotic tetracycline. The rRNA- encoding gene was inserted into pSC101 by cleaving the amphibian DNA and the plasmid with EcoRI and allowing the complementary sequences to pair. Examples of Gene Manipulation SUPER SALMON! Canadian fisheries scientists have inserted recombinant growth hor- mone genes into developing salmon embryos, creating the first trans- genic salmon. Not only do these transgenic fish have shortened pro- duction cycles, they are, on an average, 11 times heavier than nontransgenic salmon! The implications for the fisheries industry and for worldwide food production are obvious. WILT-PROOF FLOWERS Ethylene, the plant hormone that causes fruit to ripen, also causes flowers to wilt. Researchers at Purdue have found the gene that makes flower petals respond to ethylene by wilting and replaced it with a gene insensitive to ethylene. The transgenic carnations they produced lasted for 3 weeks after cutting, while normal carnations last only 3 days. HERMAN THE WONDER BULL GenPharm, a California biotechnology company, engineered Herman, a bull that possesses the gene for human lactoferrin (HLF). HLF con- fers antibacterial and iron transport properties to humans. Many of Herman’s female offspring now produce milk containing HLF, and GenPharm intends to build a herd of transgenic cows for the large- scale commercial production of HLF. Chapter 19 Gene Technology 393 WEEVIL-PROOF PEAS Not only has gene tech- nology afforded agricul- ture viral and pest con- trol in the field, it has also provided a pest control technique for the storage bin. A team of U.S. and Australian sci- entists have engineered a gene that is expressed only in the seed of the pea plant. The enzyme inhibitor encoded by this gene inhibits feeding by weevils, one of the most notorious pests affecting stored crops. The world- wide ramifications are significant as up to 40% of stored grains are lost to pests. 394 Part V Molecular Genetics The Four Stages of a Genetic Engineering Experiment Like the experiment of Cohen and Boyer, most genetic engineering experiments consist of four stages: DNA cleavage, production of recombinant DNA, cloning, and screening. Stage 1: DNA Cleavage A restriction endonuclease is used to cleave the source DNA into fragments. Because the endonuclease’s recog- nition sequence is likely to occur many times within the source DNA, cleavage will produce a large number of different fragments. A different set of fragments will be obtained by employing endonucleases that recognize dif- ferent sequences. The fragments can be separated from one another according to their size by electrophoresis (figure 19.4). Stage 2: Production of Recombinant DNA The fragments of DNA are inserted into plasmids or viral vectors, which have been cleaved with the same restriction endonuclease as the source DNA. 19.2 Genetic engineering involves easily understood procedures. Longer fragments Shorter fragments Mixture of DNA fragments of different sizes in solution placed at the top of "lanes" in the gel Electric current applied, fragments migrate down the gel by size—smaller ones move faster (and therefore go farther) than larger ones Power source Completed gel Gel Glass plates Anode+ Cathode DNA and restriction endonuclease – FIGURE 19.4 Gel electrophoresis. (a) After restriction endonucleases have cleaved the DNA, the fragments are loaded on a gel, and an electric current is applied. The DNA fragments migrate through the gel, with bigger ones moving more slowly. The fragments can be visualized easily, as the migrating bands fluoresce in UV light when stained with ethidium bromide. (b) In the photograph, one band of DNA has been excised from the gel for further analysis and can be seen glowing in the tube the technician holds. (a) (b) Stage 3: Cloning The plasmids or viruses serve as vectors that can intro- duce the DNA fragments into cells—usually, but not al- ways, bacteria (figure 19.5). As each cell reproduces, it forms a clone of cells that all contain the fragment-bearing vector. Each clone is maintained separately, and all of them together constitute a clone library of the original source DNA. Chapter 19 Gene Technology 395 + Animal cell DNA Gene of interest Restriction site lacZH11032 gene Nonfunctional lacZH11032gene amp r gene E. coli Plasmid Stage 1: DNA from two sources is isolated and cleaved with the same restriction endonuclease. Stage 2: The two types of DNA can pair at their sticky ends when mixed together; DNA ligase joins the segments. Stage 3: Plasmids are inserted into bacterial cells by transformation; bacterial cells reproduce and form clones. To stage 4: Clones are screened for gene of interest. Sticky ends Recombinant DNA and plasmids Restriction endonuclease cut sites Clone 1 Clone 2 Clone 3 Part of a clone library FIGURE 19.5 Stages in a genetic engineering experiment. In stage 1, DNA containing the gene of interest (in this case, from an animal cell) and DNA from a plasmid are cleaved with the same restriction endonuclease. The genes amp r and lacZ' are contained within the plasmid and used for screening a clone (stage 4). In stage 2, the two cleaved sources of DNA are mixed together and pair at their sticky ends. In stage 3, the recombinant DNA is inserted into a bacterial cell, which reproduces and forms clones. In stage 4, the bacterial clones will be screened for the gene of interest. Stage 4: Screening The clones containing a specific DNA fragment of interest, often a fragment that includes a particular gene, are identi- fied from the clone library. Let’s examine this stage in more detail, as it is generally the most challenging in any genetic engineering experiment. 4–I: The Preliminary Screening of Clones. Investiga- tors initially try to eliminate from the library any clones that do not contain vectors, as well as clones whose vectors do not contain fragments of the source DNA. The first cat- egory of clones can be eliminated by employing a vector with a gene that confers resistance to a specific antibiotic, such as tetracycline, penicillin, or ampicillin. In figure 19.6a, the gene amp r is incorporated into the plasmid and confers resistance to the antibiotic ampicillin. When the clones are exposed to a medium containing that antibiotic, only clones that contain the vector will be resistant to the antibiotic and able to grow. One way to eliminate clones with vectors that do not have an inserted DNA fragment is to use a vector that, in addition to containing antibiotic resistance genes, contains the lacZ' gene which is required to produce β-galactosidase, an enzyme that enables the cells to metabolize the sugar, X-gal. Metabolism of X-gal results in the formation of a blue reaction product, so any cells whose vectors contain a functional version of this gene will turn blue in the pres- ence of X-gal (figure 19.6b). However, if one uses a restric- tion endonuclease whose recognition sequence lies within the lacZ' gene, the gene will be interrupted when recombi- nants are formed, and the cell will be unable to metabolize X-gal. Therefore, cells with vectors that contain a fragment of source DNA should remain colorless in the presence of X-gal. Any cells that are able to grow in a medium containing the antibiotic but don’t turn blue in the medium with X-gal must have incorporated a vector with a fragment of source DNA. Identifying cells that have a specific fragment of the source DNA is the next step in screening clones. 396 Part V Molecular Genetics Eliminate cells without plasmid Colonies with plasmid Ampicillin in media Identify cells without recombinant DNA Colony with recombinant DNA Cells that did not take up the plasmid are not resistant to ampicillin and do not form colonies on media containing this antibiotic. (a) (b) Bacterial cell that did not take up plasmid amp r gene Gene of interest lacZH11032 gene (nonfunctional) Bacterial cell without recombinant DNA lacZH11032 gene (functional) Cells that did not take up DNA fragments have functional lacZH11032 genes, are able to metabolize X-gal, and turn blue on media that contain X-gal. X-gal in media Fragment of DNA FIGURE 19.6 Stage 4-I: Using antibiotic resistance and X-gal as preliminary screens of restriction fragment clones. Bacteria are transformed with recombinant plasmids that contain a gene (amp r ) that confers resistance to the antibiotic ampicillin and a gene (lacZ') that is required to produce β-galactosidase, the enzyme which enables the cells to metabolize the sugar X-gal. (a) Only those bacteria that have incorporated a plasmid will be resistant to ampicillin and will grow on a medium that contains the antibiotic. (b) Ampicillin-resistant bacteria will be able to metabolize X-gal if their plasmid does not contain a DNA fragment inserted in the lacZ' gene; such bacteria will turn blue when grown on a medium containing X-gal. Bacteria with a plasmid that has a DNA fragment inserted within the lacZ' gene will not be able to metabolize X-gal and, therefore, will remain colorless in the presence of X-gal. 4–II: Finding the Gene of Interest. A clone library may contain anywhere from a few dozen to many thousand indi- vidual fragments of source DNA. Many of those fragments will be identical, so to assemble a complete library of the entire source genome, several hundred thousand clones could be required. A complete Drosophila (fruit fly) library, for example, contains more than 40,000 different clones; a complete human library consisting of fragments 20 kilo- bases long would require close to a million clones. To search such an immense library for a clone that contains a fragment corresponding to a particular gene requires inge- nuity, but many different approaches have been successful. The most general procedure for screening clone li- braries to find a particular gene is hybridization (figure 19.7). In this method, the cloned genes form base-pairs with complementary sequences on another nucleic acid. The complementary nucleic acid is called a probe because it is used to probe for the presence of the gene of interest. At least part of the nucleotide sequence of the gene of in- terest must be known to be able to construct the probe. In this method of screening, bacterial colonies contain- ing an inserted gene are grown on agar. Some cells are transferred to a filter pressed onto the colonies, forming a replica of the plate. The filter is then treated with a solu- tion that denatures the bacterial DNA and that contains a radioactively labeled probe. The probe hybridizes with complementary single-stranded sequences on the bacterial DNA. When the filter is laid over photographic film, areas that contain radioactivity will expose the film (autoradiography). Only colonies which contain the gene of interest hybridize with the radioactive probe and emit radioactivity onto the film. The pattern on the film is then compared to the origi- nal master plate, and the gene-containing colonies may be identified. Genetic engineering generally involves four stages: cleaving the source DNA; making recombinants; cloning copies of the recombinants; and screening the cloned copies for the desired gene. Screening can be achieved by making the desired clones resistant to certain antibiotics and giving them other properties that make them readily identifiable. Chapter 19 Gene Technology 397 Film Filter 1. Colonies of plasmid-containing bacteria, each from a clone from the clone library, are grown on agar. 5. A comparison with the original plate identifies the colony containing the gene. 2. A replica of the plate is made by pressing a filter against the colonies. Some cells from each colony adhere to the filter. 3. The filter is washed with a solution that denatures the DNA and contains the radioactively labeled probe. The probe contains nucleotide sequences complementary to the gene of interest and binds to cells containing the gene. 4. Only those colonies containing the gene will retain the probe and emit radioactivity on film placed over the filter. FIGURE 19.7 Stage 4-II: Using hybridization to identify the gene of interest. (1) Each of the colonies on these bacterial culture plates represents millions of clones descended from a single cell. To test whether a certain gene is present in any particular clone, it is necessary to identify colonies whose cells contain DNA that hybridizes with a probe containing DNA sequences complementary to the gene. (2) Pressing a filter against the master plate causes some cells from each colony to adhere to the filter. (3) The filter is then washed with a solution that denatures the DNA and contains the radioactively labeled probe. (4) Only those colonies that contain DNA that hybridizes with the probe, and thus contain the gene of interest, will expose film in autoradiography. (5) The film is then compared to the master plate to identify the gene-containing colony. Working with Gene Clones Once a gene has been successfully cloned, a variety of pro- cedures are available to characterize it. Getting Enough DNA to Work with: The Polymerase Chain Reaction Once a particular gene is identified within the library of DNA fragments, the final requirement is to make multiple copies of it. One way to do this is to insert the identified fragment into a bacterium; after repeated cell divisions, millions of cells will contain copies of the fragment. A far more direct approach, however, is to use DNA polymerase to copy the gene sequence of interest through the poly- merase chain reaction (PCR; figure 19.8). Kary Mullis developed PCR in 1983 while he was a staff chemist at the Cetus Corporation; in 1993, it won him the Nobel Prize in Chemistry. PCR can amplify specific sequences or add se- quences (such as endonuclease recognition sequences) as primers to cloned DNA. There are three steps in PCR: Step 1: Denaturation. First, an excess of primer (typ- ically a synthetic sequence of 20 to 30 nucleotides) is mixed with the DNA fragment to be amplified. This mixture of primer and fragment is heated to about 98° C. At this temperature, the double-stranded DNA fragment dissociates into single strands. Step 2: Annealing of Primers. Next, the solution is allowed to cool to about 60°C. As it cools, the single strands of DNA reassociate into double strands. How- ever, because of the large excess of primer, each strand of the fragment base-pairs with a complementary primer flanking the region to be amplified, leaving the rest of the fragment single-stranded. Step 3: Primer Extension. Now a very heat-stable type of DNA polymerase, called Taq polymerase (after the thermophilic bacterium Thermus aquaticus, from which Taq is extracted) is added, along with a supply of all four nucleotides. Using the primer, the polymerase copies the rest of the fragment as if it were replicating DNA. When it is done, the primer has been lengthened into a complementary copy of the entire single-stranded fragment. Because both DNA strands are replicated, there are now two copies of the original fragment. Steps 1 to 3 are now repeated, and the two copies be- come four. It is not necessary to add any more polymerase, as the heating step does not harm this particular enzyme. Each heating and cooling cycle, which can be as short as 1 or 2 minutes, doubles the number of DNA molecules. After 20 cycles, a single fragment produces more than one mil- lion (2 20 ) copies! In a few hours, 100 billion copies of the fragment can be manufactured. PCR, now fully automated, has revolutionized many as- pects of science and medicine because it allows the investi- gation of minute samples of DNA. In criminal investiga- tions, “DNA fingerprints” are prepared from the cells in a tiny speck of dried blood or at the base of a single human hair. Physicians can detect genetic defects in very early em- bryos by collecting a few sloughed-off cells and amplifying their DNA. PCR could also be used to examine the DNA of historical figures such as Abraham Lincoln and of now- extinct species, as long as even a minuscule amount of their DNA remains intact. 398 Part V Molecular Genetics Target sequence Primers DNA polymerase Free nucleotides 2 copies 4 copies 8 copies Cycle 3 Cycle 2 Cycle 1 P P P P P P P P P P P 3 Primer extension Annealing of primers PP P PP P P P PP P Heat Heat Heat Cool Cool Cool Denaturation FIGURE 19.8 The polymerase chain reaction. (1) Denaturation. A solution containing primers and the DNA fragment to be amplified is heated so that the DNA dissociates into single strands. (2) Annealing of primers. The solution is cooled, and the primers bind to complementary sequences on the DNA flanking the region to be amplified. (3) Primer extension. DNA polymerase then copies the remainder of each strand, beginning at the primer. Steps 1–3 are then repeated with the replicated strands. This process is repeated many times, each time doubling the number of copies, until enough copies of the DNA fragment exist for analysis. Identifying DNA: Southern Blotting Once a gene has been cloned, it may be used as a probe to identify the same or a similar gene in another sample (fig- ure 19.9). In this procedure, called a Southern blot, DNA from the sample is cleaved into restriction fragments with a restriction endonuclease, and the fragments are spread apart by gel electrophoresis. The double-stranded helix of each DNA fragment is then denatured into single strands by making the pH of the gel basic, and the gel is “blotted” with a sheet of nitrocellulose, transferring some of the DNA strands to the sheet. Next, a probe consisting of puri- fied, single-stranded DNA corresponding to a specific gene (or mRNA transcribed from that gene) is poured over the sheet. Any fragment that has a nucleotide sequence com- plementary to the probe’s sequence will hybridize (base- pair) with the probe. If the probe has been labeled with 32 P, it will be radioactive, and the sheet will show a band of ra- dioactivity where the probe hybridized with the comple- mentary fragment. Chapter 19 Gene Technology 399 1. Electrophoresis is performed, using radioactively labeled markers as a size guide in the first lane. 3. Pattern on gel is copied faithfully, or "blotted", onto the nitrocellulose. 4. Blotted nitocellulose is incubated with radioactively labeled nucleic acids, and then rinsed. 5. Photographic film is laid over the paper and is exposed only in areas that contain radioactivity (autoradiography). Nitrocellulose is examined for radioactive bands, indicating hybridization of the original nucleic acids with the radioactively labeled ones. 2. The gel is covered with a sheet of nitrocellulose and placed in a tray of buffer on top of a sponge. Alkaline chemicals in the buffer denature the DNA into single strands. The buffer wicks its way up through the gel and nitrocellulose into a stack of paper towels placed on top of the nitrocellulose. Test nucleic acids Radioactively labeled markers with specific sizes Electrophoretic gel Nitrocellulose paper now contains nucleic acid "print" Sealed container Size markers Hybridized nucleic acids Film Radioactively labeled nucleic acids Gel Buffer Sponge Stack of paper towels Nitrocellulose paper Gel Electrophoresis FIGURE 19.9 The Southern blot procedure. E. M. Southern developed this procedure in 1975 to enable DNA fragments of interest to be visualized in a complex sample containing many other fragments of similar size. The DNA is separated on a gel, then transferred (“blotted”) onto a solid support medium such as nitrocellulose paper or a nylon membrane. It is then incubated with a radioactive single-strand copy of the gene of interest, which hybridizes to the blot at the location(s) where there is a fragment with a complementary sequence. The positions of radioactive bands on the blot identify the fragments of interest. Distinguishing Differences in DNA: RFLP Analysis Often a researcher wishes not to find a specific gene, but rather to identify a particular individual using a specific gene as a marker. One powerful way to do this is to analyze restriction fragment length polymorphisms, or RFLPs (figure 19.10). Point muta- tions, sequence repetitions, and transposons (see chapter 18) that occur within or between the restric- tion endonuclease recognition sites will alter the length of the DNA frag- ments (restriction fragments) the re- striction endonucleases produce. DNA from different individuals rarely has exactly the same array of restriction sites and distances be- tween sites, so the population is said to be polymorphic (having many forms) for their restriction fragment patterns. By cutting a DNA sample with a particular restriction endonu- clease, separating the fragments ac- cording to length on an elec- trophoretic gel, and then using a radioactive probe to identify the fragments on the gel, one can obtain a pattern of bands often unique for each region of DNA analyzed. These “DNA fingerprints” are used in forensic analysis during criminal investigations. RFLPs are also useful as markers to identify particular groups of people at risk for some genetic disorders. Making an Intron-Free Copy of a Eukaryotic Gene Recall from chapter 15 that eukaryotic genes are encoded in exons separated by numerous nontranslated introns. When the gene is transcribed to produce the primary tran- script, the introns are cut out during RNA processing to produce the mature mRNA transcript. When transferring eukaryotic genes into bacteria, it is desirable to transfer DNA already processed this way, instead of the raw eu- karyotic DNA, because bacteria lack the enzymes to carry out the processing. To do this, genetic engineers first iso- late from the cytoplasm the mature mRNA corresponding to a particular gene. They then use an enzyme called re- verse transcriptase to make a DNA version of the mature mRNA transcript (figure 19.11). The single strand of DNA can then serve as a template for the synthesis of a complementary strand. In this way, one can produce a double-stranded molecule of DNA that contains a gene lacking introns. This molecule is called complementary DNA, or cDNA. 400 Part V Molecular Genetics Restriction endonuclease cutting sites Single base-pair change Sequence duplication (a) Three different DNA duplexes (b) Cut DNA (c) Gel electrophoresis of restriction fragments Larger fragments Smaller fragments – ++ – + – ++ FIGURE 19.10 Restriction fragment length polymorphism (RFLP) analysis. (a) Three samples of DNA differ in their restriction sites due to a single base-pair substitution in one case and a sequence duplication in another case. (b) When the samples are cut with a restriction endonuclease, different numbers and sizes of fragments are produced. (c) Gel electrophoresis separates the fragments, and different banding patterns result. Intron (noncoding region) Exon (coding region) Eukaryotic DNA Primary RNA transcript Transcription Mature mRNA transcript Introns are cut out and coding regions are spliced together mRNA-cDNA hybrid Isolation of mRNA Addition of reverse transcriptase Addition of mRNA- degrading enzymes DNA polymerase Double-stranded cDNA gene without introns FIGURE 19.11 The formation of cDNA. A mature mRNA transcript is isolated from the cytoplasm of a cell. The enzyme reverse transcriptase is then used to make a DNA strand complementary to the processed mRNA. That newly made strand of DNA is the template for the enzyme DNA polymerase, which assembles a complementary DNA strand along it, producing cDNA, a double-stranded DNA version of the intron-free mRNA. Sequencing DNA: The Sanger Method Most DNA sequencing is currently done using the “chain termination” technique developed initially by Frederick Sanger, for which he earned his second Nobel Prize (figure 19.12). (1) A short single-stranded primer is added to the end of a single-stranded DNA fragment of unknown se- quence. The primer provides a 3′ end for DNA poly- merase. (2) The primed fragment is added, along with DNA polymerase and a supply of all four deoxynucleotides (d-nucleotides), to four synthesis tubes. Each contains a different dideoxynucleotide (dd-nucleotide); such nu- cleotides lack both the 2′ and the 3′ —OH groups and are thus chain-terminating. The first tube, for example, con- tains ddATP and stops synthesis whenever ddA is incorpo- rated into DNA instead of dATP. Because of the relatively low concentration of ddATP compared to dATP, ddA will not necessarily be added to the first A site; this tube will contain a series of fragments of different lengths, corre- sponding to the different distances the polymerase traveled from the primer before a ddA was incorporated. (3) These fragments can be separated according to size by elec- trophoresis. (4) A radioactive label (here dATP*) allows the fragments to be visualized on X-ray film, and the newly made sequence can be read directly from the film. Try it. (5) The original fragment has the complementary sequence. Techniques such as Southern blotting and PCR enable investigators to identify specific genes and produce them in large quantities, while RFLP analysis and the Sanger method identify individuals and unknown gene sequences. Chapter 19 Gene Technology 401 1. A primer is added to one end of a single-stranded DNA of unknown sequence. 2. The primed DNA fragment is combined with DNA polymerase and free nucleotides and then is added to four tubes. Each tube contains a different, chain- terminating dideoxynucleotide. 3. DNA polymerase adds nucleotides to the single- stranded DNA. Fragments of different sizes are produced when a dideoxynucleotide is added and terminates synthesis. These fragments are separated by size in gel electrophoresis. 4. The radioactive label (dATP*) allows the gel pattern to be visualized on X-ray film. Each column on the gel corresponds to one of the four nucleotides, and each band in the gel corresponds to a DNA fragment that ends with the nucleotide of the column. The sequence of the newly synthesized DNA can be read from bottom to top. 5. The DNA sequence of interest is complementary to the DNA sequence from the gel. 3H11032 5H11032 AACA AACA T Primer Single-stranded DNA of unknown sequence Reaction products Template TGT GC C CTTTTAG GAAAG TTGT dda dda dda dda TTGT TTGT TTGT dATP* (radioactively labeled) dGTP, dCTP, dTTP DNA polymerase ddATP ddCTP Reaction mixtures Gel electrophoresis X-ray film Sequence of new strand is read Known primer sequence Sequence of original fragment Small fragments Large fragments ddGTP ddTTP A C T A G T G A C T C T A G C T G A T C A C T G A G A T C G T G T T A C A A A CGT FIGURE 19.12 The Sanger dideoxynucleotide sequencing method. DNA Sequence Technology The 1980s saw an explosion of interest in biotechnology, the application of genetic engineering to practical human problems. Let us examine some of the major areas where these techniques have been put to use. Genome Sequencing Genetic engineering techniques are enabling us to learn a great deal more about the human genome. Several clonal libraries of the human genome have been assembled, using large-size restriction fragments. Any cloned gene can now be localized to a specific chromosomal site by using probes to detect in situ hybridization (that is, bind- ing between the probe and a complementary sequence on the chromosome). Genes are now being mapped at an as- tonishing rate: genes that contribute to dyslexia, obesity, and cholesterol-proof blood are some of the important ones that were mapped in 1994 and 1995 alone! With an understanding of where specific genes are located in the human genome and how they work, it is not difficult to imagine a future in which virtually any genetic disease could be treated or perhaps even cured with gene ther- apy. As we mentioned in chapter 13, some success has al- ready been reported in treating patients who have cystic fibrosis with a genetically corrected version of the cystic fibrosis gene. An exciting scientific by-product of the human genome project has been the complete genome sequencing of many microorganisms with smaller genomes, on the order of a few Mb (table 19.1). In general, about half of the genes prove to have a known function; what the other half of the genes are doing is a complete mystery. The first eukaryotic genome to be sequenced in its entirety was that of brewer’s yeast Saccharomyces cerevisiae; many of its approximately 6000 genes have a similar structure to some human genes. The complete sequences of many much larger genomes have recently been completed, including the malarial Plas- modium parasite (30 Mb), the nematode (100 Mb), the plant Arabidopsis (100 Mb) (figure 19.13), the fruit fly Drosophila (120 Mb), and the mouse (300 Mb). The international scientific community has over the last several years mounted a major effort to sequence the entire human genome. Because the human genome contains some 3000 Mb (million nucleotide base-pairs), this task has pre- sented no small challenge. Rapid progress was made possi- ble by the use of so-called shotgun cloning techniques, in which the entire genome is first fragmented, then each of the fragments is sequenced by automated machines, and fi- nally computers use overlaps to order the fragments. All but a small portion of the sequence was completed by the beginning of the year 2000. 402 Part V Molecular Genetics 19.3 Biotechnology is producing a scientific revolution. FIGURE 19.13 Part of the genome sequence of the plant Arabidopsis. Data from an automated DNA-sequencing run shows the nucleotide sequence for a small section of the Arabidopsis genome. Automated DNA sequencing has greatly increased the speed at which genomes can be sequenced. Table 19.1 Genome Sequencing Projects Genome Organism Size (Mb) Description ARCHAEBACTERIA Methanococcus jannaschi 1.7 Extreme thermophile EUBACTERIA Escherichia coli 4.6 Laboratory standard FUNGI Saccharomyces cerevisiae 13 Baker’s yeast PROTIST Plasmodium 30 Malarial parasite PLANT Arabidopsis thaliana 100 Relative of mustard plant ANIMAL Caenorhabditis elegans 100 Nematode Drosophila melanogaster 120 Fruit fly Mus musculus 300 Mouse Homo sapiens 3000 Human DNA Fingerprinting Figure 19.14 shows the DNA fingerprints a prosecuting attorney presented in a rape trial in 1987. They consisted of autoradiographs, parallel bars on X-ray film resembling the line patterns of the universal price code found on gro- ceries. Each bar represents the position of a DNA restric- tion endonuclease fragment produced by techniques simi- lar to those described in figures 19.4 and 19.10. The lane with many bars represents a standardized control. Two different probes were used to identify the restriction frag- ments. A vaginal swab had been taken from the victim within hours of her attack; from it semen was collected and the semen DNA analyzed for its restriction endonu- clease patterns. Compare the restriction endonuclease patterns of the semen to that of the suspect Andrews. You can see that the suspect’s two patterns match that of the rapist (and are not at all like those of the victim). Clearly the semen collected from the rape victim and the blood sample from the sus- pect came from the same person. The suspect was Tom- mie Lee Andrews, and on November 6, 1987, the jury re- turned a verdict of guilty. Andrews became the first person in the United States to be convicted of a crime based on DNA evidence. Since the Andrews verdict, DNA fingerprinting has been admitted as evidence in more than 2000 court cases (figure 19.15). While some probes highlight profiles shared by many people, others are quite rare. Using several probes, identity can be clearly established or ruled out. Just as fingerprinting revolutionized forensic evidence in the early 1900s, so DNA fingerprinting is revolutionizing it today. A hair, a minute speck of blood, a drop of semen can all serve as sources of DNA to damn or clear a suspect. As the man who an- alyzed Andrews’ DNA says: “It’s like leaving your name, address, and social security num- ber at the scene of the crime. It’s that pre- cise.” Of course, laboratory analyses of DNA samples must be carried out properly— sloppy procedures could lead to a wrongful conviction. After widely publicized instances of questionable lab procedures, national standards are being developed. The genomes of several organisms have been completely sequenced. When DNA is digested with restriction endonucleases, distinctive profiles on electrophoresis gels can be used to identify the individual that was the source of the tissue. Chapter 19 Gene Technology 403 Victim Rapist’s semen Suspect’s blood Victim Rapist’s semen Suspect’s blood FIGURE 19.14 Two of the DNA profiles that led to the conviction of Tommie Lee Andrews for rape in 1987. The two DNA probes seen here were used to characterize DNA isolated from the victim, the semen left by the rapist, and the suspect. The dark channels are multiband controls. There is a clear match between the suspect’s DNA and the DNA of the rapist’s semen in these. FIGURE 19.15 The DNA profiles of O. J. Simpson and blood samples from the murder scene of his former wife from his highly publicized and controversial murder trial in 1995. Biochips A biochip, also called a gene microarray, is a square of glass smaller than a postage stamp, covered with millions of strands of DNA like blades of grass. Biochips were in- vented nine years ago by gene scientist Stephen Fodor. In a flash of insight, he saw that photolithography, the process used to etch semiconductor circuits into silicon, could also be used to assemble particular DNA molecules on a chip— a biochip. Think of the chip surface as a field of assembly sites, much as a TV screen is a field of colored dots. Just as a scanning beam moves over each individual TV dot instruct- ing it to be red, green, or blue (the three components of color), so a scanning beam moves over each biochip spot, commanding the addition there of a base to a growing strand of DNA. A computer, by varying the wavelength of the scanning beam, determines which of four possible nu- cleotides is added to the growing DNA strand anchored to each spot. When the entire chip has been scanned, each DNA strand has been lengthened one nucleotide unit. The computer repeats the process, layer by layer, until each DNA strand is an entire gene or gene fragment. One biochip made in this way contains hundreds of thousands of specific gene sequences. How could you use such a biochip to delve into a per- son’s genes? All you would have to do is to obtain a little of the person’s DNA, say from a blood sample or even a bit of hair. Flush fluid containing the DNA over the biochip sur- face. Every place that the DNA has a gene matching one of the biochip strands, it will stick to it in a way the computer can detect. Now here is where it gets interesting. The mad rush to sequence the human genome is over. The gene re- search firm Celera has recently announced it has essen- tially completed the sequence, with over 90% of genes done. Already the researchers are busily comparing their consensus “reference sequence” to the DNA of individual people, and noting any differences they detect. Called single nucleotide polymorphisms, or SNPs (pronounced “snips”), these spot differences in the identity of particu- lar nucleotides collectively record every way in which a particular individual differs from the reference sequence. Some SNPs cause diseases like cystic fibrosis or sickle cell anemia. Others may give you red hair or elevated cholesterol in your blood. As the human genome project charges toward completion, its researchers are excitedly assembling a huge database of SNPs. Research indicates that SNPs can be expected to occur at a frequency of about one per thousand nucleotides, scattered about ran- domly over the chromosomes. Each of us thus differs from the standard "type sequence" in several thousand nucleotide SNPs. Everything genetic about you that is diferent from a stranger you meet is caused by a few thousand SNPs; otherwise you and that stranger are identical. How Biochips Can Be Used to Screen for Cancer One of the biggest decisions facing an oncologist (cancer doctor) treating a tumor is to select the proper treatment. Most cancer cells look alike, although the tumors may in fact be caused by quite different forms of cancer. If the on- cologist could clearly identify the cancer, very targeted therapies might be possible. Unable to tell the difference for sure, however, oncologists take no chances. Tumors are treated with therapy that attacks all cancers, usually with severe side effects. This year Boston researchers Todd Golub and Eric Lander took a vital step towards treating cancer, using new DNA technology to sniff out the differences between dif- ferent forms of a deadly cancer of the immune system. Golub and Lander worked with biochips. The way to tell the difference between two kinds of can- cer is to compare the mutations that led to the cancer in the first place. Biologists call such gene changes mutations. The mutations that cause many lung cancers are caused by a tobacco-induced alteration of a single DNA nucleotide in one gene. Such spot differences between the version of a gene one person has and another person has, or a cancer patient has, are examples of SNPs. Golub and Lander obtained bone marrow cells from pa- tients with two types of leukemia (cancer of white blood cells), and exposed DNA from each to biochips containing all known human genes, 6817 in all (figure 19.16). Using high-speed computer programs, Golub and Lander exam- ined each of the 6817 positions on the chip. The two forms of leukemia each showed gene changes from normal, but, importantly, the changes were different in each case! Each had their own characteristic SNP. Biochips thus may offer a quick and reliable way to iden- tify any type of cancer. Just look and see what SNP is present. The Use of Gene Chips Will Soon Be Widespread Biochip technology is likely to dominate medicine in the coming millennium, a prospect both exciting and scary. Re- searchers have announced plans to compile a database of hundreds of thousands of SNPs over the next two years. Screening SNPs and comparing them to known SNP data- bases will soon allow doctors to screen each of us for copies of genes leading to genetic diseases. Many genetic diseases are associated with SNPs, including cystic fibrosis and muscular dystrophy. Biochips Raise Critical Issues of Personal Privacy The scary part is SNPs on chips. Researchers plan to have identified some 300,000 different SNPs by 2001, all of which could reside on a single biochip. When your DNA is flushed over a SNP biochip, the sequences that light up 404 Part V Molecular Genetics will instantly reveal your SNP profile. The genetic charac- teristics that make you you, genes that might affect your health, your behavior, your future potential—all are there to be read by anyone clever enough to interpret the profile. To what extent are you your genes? Scientists fight about this question, and no one really knows the answer. It is clear that much of what each of us is like is strongly affected by our genetic makeup. Researchers have proven beyond any real dispute that intelligence and major personality traits like aggressiveness and inquisitiveness are about 80% herita- ble (that is, 80% of the variation in these traits reflects varia- tion in genes). Your SNP profile will reflect all of this variation, a table of contents of your chromosomes, a molecular window to who you are. When millions of such SNP profiles have been gathered over the coming years, computers will be able to identify other individuals with profiles like yours, and, by examining health records, standard personality tests, and the like, correlate parts of your profile with particular traits. Even behavioral characteristics involving many genes, which until now have been thought too complex to ever analyze, cannot resist a determined assault by a computer comparing SNP profiles. A biochip is a discrete collection of gene fragments on a stamp-sized chip that can be used to screen for the presence of particular gene variants. Biochips allow rapid screening of gene profiles, a tool that promises to have a revolutionary impact on medicine and society. Chapter 19 Gene Technology 405 1. DNA is obtained from the bone marrow cells of patients with two types of leukemia. 3. High speed computer programs examine the biochips and identify any SNPs, or single nucleotide polymorphisms. 4. The SNP profiles from each type of leukemia patient are examined. Leukemia 1 exhibits a different SNP than leukemia 2. Thus, the two types of leukemia are associated with two different gene changes. 2. The DNA is exposed to biochips containing all known human genes. Leukemia patient # 1 Leukemia patient # 2 Bone marrow cells Bone marrow cells DNA DNA Biochip Leukemia 1 SNP profile Leukemia 2 SNP profile FIGURE 19.16 Biochips can help in identifying precise forms of cancer. Medical Applications Pharmaceuticals The first and perhaps most obvious commercial applica- tion of genetic engineering was the introduction of genes that encode clinically important proteins into bacteria. Because bacterial cells can be grown cheaply in bulk (fer- mented in giant vats, like the yeasts that make beer), bac- teria that incorporate recombinant genes can synthesize large amounts of the proteins those genes specify. This method has been used to produce several forms of human insulin and interferon, as well as other commercially valuable proteins such as growth hormone (figure 19.17) and erythropoietin, which stimulates red blood cell production. Among the medically important proteins now manufac- tured by these approaches are atrial peptides, small pro- teins that may provide a new way to treat high blood pres- sure and kidney failure. Another is tissue plasminogen activator, a human protein synthesized in minute amounts that causes blood clots to dissolve and may be effective in preventing and treating heart attacks and strokes. A problem with this general approach has been the diffi- culty of separating the desired protein from the others the bacteria make. The purification of proteins from such com- plex mixtures is both time-consuming and expensive, but it is still easier than isolating the proteins from the tissues of animals (for example, insulin from hog pancreases), which is how such proteins used to be obtained. Recently, how- ever, researchers have succeeded in producing RNA tran- scripts of cloned genes; they can then use the transcripts to produce only these proteins in a test tube containing the transcribed RNA, ribosomes, cofactors, amino acids, tRNA, and ATP. Gene Therapy In 1990, researchers first attempted to combat genetic de- fects by the transfer of human genes. When a hereditary disorder is the result of a single defective gene, an obvious way to cure the disorder is to add a working copy of the gene. This approach is being used in an attempt to combat cystic fibrosis, and it offers potential for treating muscular dystrophy and a variety of other disorders (table 19.2). One of the first successful attempts was the transfer of a gene encoding the enzyme adenosine deaminase into the bone marrow of two girls suffering from a rare blood disorder caused by the lack of this enzyme. However, while many clinical trials are underway, no others have yet proven suc- cessful. This extremely promising approach will require a lot of additional effort. 406 Part V Molecular Genetics FIGURE 19.17 Genetically engineered human growth hormone. These two mice are genetically identical, but the large one has one extra gene: the gene encoding human growth hormone. The gene was added to the mouse’s genome by genetic engineers and is now a stable part of the mouse’s genetic endowment. Table 19.2 Diseases Being Treated in Clinical Trials of Gene Therapy Disease Cancer (melanoma, renal cell, ovarian, neuroblastoma, brain, head and neck, lung, liver, breast, colon, prostate, mesothelioma, leukemia, lymphoma, multiple myeloma) SCID (severe combined immunodeficiency) Cystic fibrosis Gaucher’s disease Familial hypercholesterolemia Hemophilia Purine nucleoside phosphorylase deficiency Alpha-1 antitrypsin deficiency Fanconi’s anemia Hunter’s syndrome Chronic granulomatous disease Rheumatoid arthritis Peripheral vascular disease AIDS Piggyback Vaccines Another area of potential significance involves the use of genetic engineering to produce subunit vaccines against viruses such as those that cause herpes and hepatitis. Genes encoding part of the protein-polysaccharide coat of the herpes simplex virus or hepatitis B virus are spliced into a fragment of the vaccinia (cowpox) virus genome (figure 19.18). The vaccinia virus, which British physician Edward Jenner used almost 200 years ago in his pioneering vaccina- tions against smallpox, is now used as a vector to carry the herpes or hepatitis viral coat gene into cultured mammalian cells. These cells produce many copies of the recombinant virus, which has the outside coat of a herpes or hepatitis virus. When this recombinant virus is injected into a mouse or rabbit, the immune system of the infected animal pro- duces antibodies directed against the coat of the recombi- nant virus. It therefore develops an immunity to herpes or hepatitis virus. Vaccines produced in this way are harmless because the vaccinia virus is benign and only a small frag- ment of the DNA from the disease-causing virus is intro- duced via the recombinant virus. The great attraction of this approach is that it does not depend upon the nature of the viral disease. In the future, similar recombinant viruses may be injected into humans to confer resistance to a wide variety of viral diseases. In 1995, the first clinical trials began of a novel new kind of DNA vaccine, one that depends not on antibodies but rather on the second arm of the body’s immune defense, the so-called cellular immune response, in which blood cells known as killer T cells attack infected cells. The in- fected cells are attacked and destroyed when they stick fragments of foreign proteins onto their outer surfaces that the T cells detect (the discovery by Peter Doherty and Rolf Zinkernagel that infected cells do so led to their receiving the Nobel Prize in Physiology or Medicine in 1996). The first DNA vaccines spliced an influenza virus gene encod- ing an internal nucleoprotein into a plasmid, which was then injected into mice. The mice developed strong cellular immune responses to influenza. New and controversial, the approach offers great promise. Genetic engineering has produced commercially valuable proteins, gene therapies, and, possibly, new and powerful vaccines. Chapter 19 Gene Technology 407 Human immune response Gene specifying herpes simplex surface protein Harmless vaccinia (cowpox) virus 1. DNA is extracted. 2. Herpes simplex gene is isolated. 3. Vaccinia DNA is extracted and cleaved. 4. Fragment containing surface gene combines with cleaved vaccinia DNA. 5. Harmless engineered virus (the vaccine) with surface like herpes simplex is injected into the human body. 6. Antibodies directed against herpes simplex viral coat are made. Herpes simplex virus FIGURE 19.18 Strategy for constructing a subunit vaccine for herpes simplex. Agricultural Applications Another major area of genetic engineering activity is ma- nipulation of the genes of key crop plants. In plants the pri- mary experimental difficulty has been identifying a suitable vector for introducing recombinant DNA. Plant cells do not possess the many plasmids that bacteria do, so the choice of potential vectors is limited. The most successful results thus far have been obtained with the Ti (tumor- inducing) plasmid of the plant bacterium Agrobacterium tumefaciens, which infects broadleaf plants such as tomato, tobacco, and soybean. Part of the Ti plasmid integrates into the plant DNA, and researchers have succeeded in at- taching other genes to this portion of the plasmid (figure 19.19). The characteristics of a number of plants have been altered using this technique, which should be valuable in improving crops and forests. Among the features scientists would like to affect are resistance to disease, frost, and other forms of stress; nutritional balance and protein con- tent; and herbicide resistance. Unfortunately, Agrobac- terium generally does not infect cereals such as corn, rice, and wheat, but alternative methods can be used to intro- duce new genes into them. A recent advance in genetically manipulated fruit is Cal- gene’s “Flavr Savr” tomato, which has been approved for sale by the USDA. The tomato has been engineered to in- hibit genes that cause cells to produce ethylene. In toma- toes and other plants, ethylene acts as a hormone to speed fruit ripening. In Flavr Savr tomatoes, inhibition of ethyl- ene production delays ripening. The result is a tomato that can stay on the vine longer and that resists overripening and rotting during transport to market. Herbicide Resistance Recently, broadleaf plants have been genetically engineered to be resistant to glyphosate, the active ingredient in Roundup, a powerful, biodegradable herbicide that kills most actively growing plants (figure 19.20). Glyphosate works by inhibiting an enzyme called EPSP synthetase, which plants require to produce aromatic amino acids. Hu- mans do not make aromatic amino acids; they get them from their diet, so they are unaffected by glyphosate. To make glyphosate-resistant plants, agricultural scientists used a Ti plasmid to insert extra copies of the EPSP syn- thetase genes into plants. These engineered plants produce 20 times the normal level of EPSP synthetase, enabling them to synthesize proteins and grow despite glyphosate’s suppression of the enzyme. In later experiments, a bacterial form of the EPSP synthetase gene that differs from the 408 Part V Molecular Genetics Plant genetic engineering Agrobacterium Gene of interest Plasmid 1. Plasmid is removed and cut open with restriction endonuclease. 2. Gene is isolated from the chromosome of another organism. 3. New gene is inserted into plasmid. 4. Plasmid is put back into Agrobacterium. 5. When mixed with plant cells, Agrobacterium duplicates the plasmid. 6. The bacterium transfers the new gene into a chromosome of the plant cell. 7. The plant cell divides, and each daughter cell receives the new gene, giving the whole plant a new trait. FIGURE 19.19 The Ti plasmid. This Agrobacterium tumefaciens plasmid is used in plant genetic engineering. plant form by a single nucleotide was introduced into plants via Ti plasmids; the bacterial enzyme in these plants is not inhibited by glyphosate. These advances are of great interest to farmers because a crop resistant to Roundup would never have to be weeded if the field were simply treated with the herbicide. Because Roundup is a broad-spectrum herbicide, farmers would no longer need to employ a variety of different herbicides, most of which kill only a few kinds of weeds. Furthermore, glyphosate breaks down readily in the environment, unlike many other herbicides commonly used in agriculture. A plasmid is actively being sought for the introduction of the EPSP synthetase gene into cereal plants, making them also glyphosate-resistant. Nitrogen Fixation A long-range goal of agricultural genetic engineering is to introduce the genes that allow soybeans and other legume plants to “fix” nitrogen into key crop plants. These so-called nif genes are found in certain symbiotic root-colonizing bacteria. Living in the root nodules of legumes, these bacte- ria break the powerful triple bond of atmospheric nitrogen gas, converting N 2 into NH 3 (ammonia). The plants then use the ammonia to make amino acids and other nitrogen- containing molecules. Other plants lack these bacteria and cannot fix nitrogen, so they must obtain their nitrogen from the soil. Farmland where these crops are grown soon be- comes depleted of nitrogen, unless nitrogenous fertilizers are applied. Worldwide, farmers applied over 60 million metric tons of such fertilizers in 1987, an expensive under- taking. Farming costs would be much lower if major crops like wheat and corn could be engineered to carry out bio- logical nitrogen fixation. However, introducing the nitrogen-fixing genes from bacteria into plants has proved difficult because these genes do not seem to function prop- erly in eukaryotic cells. Researchers are actively experiment- ing with other species of nitrogen-fixing bacteria whose genes might function better in plant cells. Insect Resistance Many commercially important plants are attacked by in- sects, and the traditional defense against such attacks is to apply insecticides. Over 40% of the chemical insecticides used today are targeted against boll weevils, bollworms, and other insects that eat cotton plants. Genetic engineers are now attempting to produce plants that are resistant to in- sect pests, removing the need to use many externally ap- plied insecticides. The approach is to insert into crop plants genes encod- ing proteins that are harmful to the insects that feed on the plants but harmless to other organisms. One such insectici- dal protein has been identified in Bacillus thuringiensis, a soil bacterium. When the tomato hornworm caterpillar ingests this protein, enzymes in the caterpillar’s stomach convert it into an insect-specific toxin, causing paralysis and death. Because these enzymes are not found in other animals, the protein is harmless to them. Using the Ti plasmid, scien- tists have transferred the gene encoding this protein into tomato and tobacco plants. They have found that these transgenic plants are indeed protected from attack by the insects that would normally feed on them. In 1995, the EPA approved altered forms of potato, cotton, and corn. The genetically altered potato can kill the Colorado potato beetle, a common pest. The altered cotton is resistant to cotton bollworm, budworm, and pink bollworm. The corn has been altered to resist the European corn borer and other mothlike insects. Monsanto scientists screening natural compounds ex- tracted from plant and soil samples have recently isolated a new insect-killing compound from a fungus, the enzyme cholesterol oxidase. Apparently, the enzyme disrupts mem- branes in the insect gut. The fungus gene, called the Boll- gard gene after its discoverer, has been successfully inserted into a variety of crops. It kills a wide range of insects, in- cluding the cotton boll weevil and the Colorado potato beetle, both serious agricultural pests. Field tests began in 1996. Some insect pests attack plant roots, and B. thuringiensis is being employed to counter that threat as well. This bac- terium does not normally colonize plant roots, so biologists have introduced the B. thuringiensis insecticidal protein gene into root-colonizing bacteria, especially strains of Pseudomonas. Field testing of this promising procedure has been approved by the Environmental Protection Agency. Chapter 19 Gene Technology 409 FIGURE 19.20 Genetically engineered herbicide resistance. All four of these petunia plants were exposed to equal doses of the herbicide Roundup. The two on top were genetically engineered to be resistant to glyphosate, the active ingredient of Roundup, while the two on the bottom were not. The Real Promise of Plant Genetic Engineering In the last decade the cultivation of genetically modified crops of corn, cotton, and soybeans has become com- monplace in the United States—in 1999, over half of the 72 million acres planted with soybeans in the United States were planted with seeds genetically modified to be herbicide resistant, with the result that less tillage has been needed, and as a consequence soil erosion has been greatly lessened. These benefits, while significant, have been largely confined to farmers, making their cultivation of crops cheaper and more efficient. The food that the public gets is the same, it just costs less to get it to the table. Like the first act of a play, these developments have served mainly to set the stage for the real action, which is only now beginning to happen. The real promise of plant genetic engineering is to produce genetically modified plants with desirable traits that directly benefit the con- sumer. One recent advance, nutritionally improved rice, gives us a hint of what is to come. In developing countries large numbers of people live on simple diets that are poor sources of vitamins and minerals (what botanists called "micronutrients"). Worldwide, the two major micronutri- ent deficiencies are iron, which affects 1.4 billion women, 24% of the world population, and vitamin A, affecting 40 million children, 7% of the world population. The defi- ciencies are especially severe in developing countries where the major staple food is rice. In recent research, Swiss bio- engineer Ingo Potrykus and his team at the Institute of Plant Sciences, Zurich, have gone a long way towards solv- ing this problem. Supported by the Rockefeller Founda- tion and with results to be made free to developing coun- tries, the work is a model of what plant genetic engineering can achieve. To solve the problem of dietary iron deficiency among rice eaters, Potrykus first asked why rice is such a poor source of dietary iron. The problem, and the answer, proved to have three parts: 1. Too little iron. The proteins of rice endosperm have unusually low amounts of iron. To solve this prob- lem, a ferritin gene was transferred into rice from beans (figure 19.21). Ferritin is a protein with an ex- traordinarily high iron content, and so greatly in- creased the iron content of the rice. 2. Inhibition of iron absorption by the intestine. Rice con- tains an unusually high concentration of a chemical called phytate, which inhibits iron reabsorption in the intestine—it stops your body from taking up the iron in the rice. To solve this problem, a gene encoding an enzyme that destroys phytate was transferred into rice from a fungus. 3. Too little sulfur for efficient iron absorption. Sulfur is required for iron uptake, and rice has very little of it. To solve this problem, a gene encoding a particularly sulfur-rich metallothionin protein was transferred into rice from wild rice. To solve the problem of vitamin A deficiency, the same approach was taken. First, the problem was identified. It turns out rice only goes part way toward making beta- carotene (provitamin A); there are no enzymes in rice to catalyze the last four steps. To solve the problem, genes en- coding these four enzymes were added to rice from a famil- iar flower, the daffodil. Potrykus's development of transgenic rice to combat dietary deficiencies involved no subtle tricks, just straightforward bioengineering and the will to get the job done. The transgenic rice he has developed will directly improve the lives of millions of people. His work is rep- 410 Part V Molecular Genetics Daffodil Ferritin gene is transferred into rice from beans. Phytase gene is transferred into rice from a fungus. Metallothionin gene is transferred into rice from wild rice. Enzymes for beta-carotene synthesis are transferred into rice from daffodils. Fe Pt S Rice chromosome A 1 A 2 A 3 A 4 Ferritin protein increases iron content of rice. Phytate, which inhibits iron reabsorption, is destroyed by the phytase enzyme. Metallothionin protein supplies extra sulfur to increase iron uptake. Beta-carotene, a precursor to vitamin A, is synthesized. Beans Aspergillus fungus Wild rice FIGURE 19.21 Transgenic rice. Developed by Swiss bioengineer Ingo Potrykus, transgenic rice offers the promise of improving the diets of people in rice-consuming developing countries, where iron and vitamin A deficiencies are a serious problem. resentative of the very real promise of genetic engineer- ing to help meet the challenges of the coming new millennium. The list of gene modifications that directly aid con- sumers will only grow. In Holland, Dutch bioengineers an- nounced last month that they are genetically engineering plants to act as vaccine-producing factories! To petunias they have added a gene for a vaccine against dog par- vovirus, hiding the gene within the petunia genes that di- rect nectar production. The drug is produced in the nec- tar, collected by bees, and extracted from the honey. It is hard to believe this isn't science fiction. Clearly, the real promise of plant genetic engineering lies ahead, and not very far. Farm Animals The gene encoding the growth hormone somatotropin was one of the first to be cloned successfully. In 1994, Monsanto received federal approval to make its recombi- nant bovine somatotropin (BST) commercially available, and dairy farmers worldwide began to add the hormone as a supplement to their cows’ diets, increasing the ani- mals’ milk production (figure 19.22). Genetically engi- neered somatotropin is also being tested to see if it in- creases the muscle weight of cattle and pigs, and as a treatment for human disorders in which the pituitary gland fails to make adequate levels of somatotropin, pro- ducing dwarfism. BST ingested in milk or meat has no effect on humans, because it is a protein and is digested in the stomach. Nevertheless, BST has met with some public resistance, due primarily to generalized fears of gene technology. Some people mistrust milk produced through genetic engineering, even though the milk itself is identical to other milk. Problems concerning public perception are not uncommon as gene technology makes an even greater impact on our lives. Transgenic animals engineered to have specific desirable genes are becoming increasingly available to breeders. Now, instead of selectively breeding for several generations to produce a racehorse or a stud bull with desirable quali- ties, the process can be shortened by simply engineering such an animal right at the start. Gene technology is revolutionizing agriculture, increasing yields and resistance to pests, and producing animals with desirable traits. Chapter 19 Gene Technology 411 Bovine somatotropin production Escherichia coli Gene of interest Cow DNA Plasmid 1. Plasmid is removed and cut open with restriction endonuclease. 2. Cow somatotropin gene is isolated from cow cell. 3. Somatotropin gene is inserted into bacterial plasmid. 4. Plasmid is reintroduced into bacterium. 5. Bacteria producing bovine somatotropin are grown in fermentation tanks. 6. Somatotropin is removed from bacteria and purified. 7. Bovine somatotropin is administered to cow to enhance milk production. FIGURE 19.22 The production of bovine somatotropin (BST) through genetic engineering. Although BST is functional, harmless, and sanctioned by the FDA, much controversy exists over whether it is actually desirable. Cloning The difficulty in using transgenic animals to improve live- stock is in getting enough of them. Breeding produces off- spring only slowly, and recombination acts to undo the painstaking work of the genetic engineer. Ideally, one would like to “Xerox” many exact genetic copies of the transgenic strain—but until 1997 it was commonly ac- cepted that adult animals can’t be cloned. Now the holy grail of agricultural genetic engineers seems within reach. In 1997, scientists announced the first successful cloning of differentiated vertebrate tissue, a lamb grown from a cell taken from an adult sheep. This startling result promises to revolutionize agricultural science. Spemann’s “Fantastical Experiment” The idea of cloning animals was first suggested in 1938 by German embryologist Hans Spemann (called the “father of modern embryology”), who proposed what he called a “fantastical experiment”: remove the nucleus from an egg cell, and put in its place a nucleus from another cell. It was 14 years before technology advanced far enough for anyone to take up Spemann’s challenge. In 1952, two American scientists, Robert Briggs and T. J. King, used very fine pipettes to suck the nucleus from a frog egg (frog eggs are unusually large, making the experiment feasible) and transfer a nucleus sucked from a body cell of an adult frog into its place. The experiment did not work when done this way, but partial success was achieved 18 years later by the British developmental biologist John Gurdon, who in 1970 inserted nuclei from advanced frog embryos rather than adult tissue. The frog eggs developed into tad- poles, but died before becoming adults. The Path to Success For 14 years, nuclear transplant experiments were at- tempted without success. Technology continued to advance however, until finally in 1984, Steen Willadsen, a Danish embryologist working in Texas, succeeded in cloning a sheep using a nucleus from a cell of an early embryo. This exciting result was soon replicated by others in a host of other organisms, including cattle, pigs, and monkeys. Only early embryo cells seemed to work, however. Re- searchers became convinced that animal embryo cells be- come irreversibly “committed” after the first few cell divi- sions. After that, nuclei from differentiated animal cells cannot be used to clone entire organisms. We now know this conclusion to have been unwar- ranted. The key advance for unraveling this puzzle was made in Scotland by geneticist Keith Campbell, a specialist in studying the cell cycle of agricultural animals. By the early 1990s, knowledge of how the cell cycle is controlled, advanced by cancer research, had led to an understanding that cells don’t divide until conditions are appropriate. Just as a washing machine checks that the water has completely emptied before initiating the spin cycle, so the cell checks that everything needed is on hand before initiating cell di- vision. Campbell reasoned: “Maybe the egg and the do- nated nucleus need to be at the same stage in the cell cycle.” This proved to be a key insight. In 1994 researcher Neil First, and in 1995 Campbell himself working with repro- ductive biologist Ian Wilmut, succeeded in cloning farm animals from advanced embryos by first starving the cells, so that they paused at the beginning of the cell cycle at the G 1 checkpoint. Two starved cells are thus synchronized at the same point in the cell cycle. 412 Part V Molecular Genetics Nucleus containing source DNA Mammary cell is extracted and grown in nutrient- deficient solution that arrests the cell cycle. Egg cell is extracted. Nucleus is removed from egg cell with a micropipette. Mammary cell is inserted inside covering of egg cell. Electric shock opens cell membranes and triggers cell division. Preparation Cell fusion Cell division FIGURE 19.23 Wilmut’s animal cloning experiment. Wilmut combined a nucleus from a mammary cell and an egg cell (with its nucleus removed) to successfully clone a sheep. Wilmut’s Lamb Wilmut then set out to attempt the key breakthrough, the experiment that had eluded researchers since Spemann proposed it 59 years before: to transfer the nucleus from an adult differentiated cell into an enucleated egg, and allow the resulting embryo to grow and develop in a surrogate mother, hopefully producing a healthy animal. Wilmut removed mammary cells from the udder of a six-year-old sheep (figure 19.23). The origin of these cells, gave the clone its name, “Dolly” after the country singer Dolly Parton. The cells were grown in tissue culture, and some frozen so that in the future it would be possible with genetic fingerprinting to prove that a clone was indeed ge- netically identical with the six-year-old sheep. In preparation for cloning, Wilmut’s team reduced for five days the concentration of serum on which the sheep mammary cells were subsisting. In parallel preparation, eggs obtained from a ewe were enucleated, the nucleus of each egg carefully removed with a micropipette. Mammary cells and egg cells were then surgically com- bined in January of 1996, the mammary cells inserted in- side the covering around the egg cell. Wilmut then applied a brief electrical shock. A neat trick, this causes the plasma membranes surrounding the two cells to become leaky, so that the contents of the mammary cell passes into the egg cell. The shock also kick-starts the cell cycle, causing the cell to begin to divide. After six days, in 30 of 277 tries, the dividing embryo reached the hollow-ball “blastula” stage, and 29 of these were transplanted into surrogate mother sheep. A little over five months later, on July 5, 1997, one sheep gave birth to a lamb. This lamb, “Dolly,” was the first successful clone generated from a differentiated animal cell. The Future of Cloning Wilmut’s successful cloning of fully differentiated sheep cells is a milestone event in gene technology. Even though his procedure proved inefficient (only one of 277 trials suc- ceeded), it established the point beyond all doubt that cloning of adult animal cells can be done. In the following four years researchers succeeded in greatly improving the efficiency of cloning. Seizing upon the key idea in Wilmut’s experiment, to clone a resting-stage cell, they have returned to the nuclear transplant procedure pio- neered by Briggs and King. It works well. Many different mammals have been successfully cloned including mice, pigs, and cattle. Transgenic cloning can be expected to have a major im- pact on medicine as well as agriculture. Animals with human genes can be used to produce rare hormones. For example, sheep that have recently been genetically engi- neered to secrete a protein called alpha-1 antitrypsin (help- ful in relieving the symptoms of cystic fibrosis) into their milk may be cloned, greatly cheapening the production of this expensive drug. It is impossible not to speculate on the possibility of cloning a human. There is no reason to believe such an ex- periment would not work, but many reasons to question whether it should be done. Because much of Western thought is based on the concept of human individuality, we can expect the possibility of human cloning to engender considerable controversy. Recent experiments have demonstrated the possibility of cloning differentiated mammalian tissue, opening the door for the first time to practical transgenic cloning of farm animals. Chapter 19 Gene Technology 413 Embryo Embryo is implanted into surrogate mother. Embryo begins to develop in vitro. After a five-month pregancy, a lamb genetically identical to the sheep from which the mammary cell was extracted is born. Development Implantation Birth of clone Growth to adulthood Stem Cells Since the isolation of embryonic stem cells in 1998, labs all over the world have been exploring the possibility of using stem cells to restore damaged or lost tissue. Exciting results are now starting to come in. What is a stem cell? At the dawn of a human life, a sperm fertilizes an egg to create a single cell destined to be- come a child. As development commences, that cell begins to divide, producing a small ball of a few dozen cells. At this very early point, each of these cells is identical. We call these cells embryonic stem cells. Each one of them is capable by itself of developing into a healthy individual. In cattle breeding, for example, these cells are frequently separated by the breeder and used to produce multiple clones of valu- able offspring. The exciting promise of these embryonic stem cells is that, because they can develop into any tissue, they may give us the ability to restore damaged heart or spine tissue (figure 19.24). Experiments have already been tried suc- cessfully in mice. Heart muscle cells have been grown from mouse embryonic stem cells and successfully integrated with the heart tissue of a living mouse. This suggests that the damaged heart muscle of heart attack victims might be reparable with stem cells, and that injured spinal cords might be repairable. These very promising experiments are being pursued aggressively. They are, however, quite con- troversial, as embryonic stem cells are typically isolated from tissue of discarded or aborted embryos, raising serious ethical issues. Tissue-Specific Stem Cells New results promise a neat way around the ethical maze presented by stem cells derived from embryos. Go back for a moment to what we were saying about how a human child develops. What happens next to the embryonic stem cells? They start to take different developmental paths. Some become destined to form nerve tissue and, after this decision is taken, cannot ever produce any other kind of cell. They are then called nerve stem cells. Others become specialized to produce blood, still others muscle. Each major tissue is represented by its own kind of tissue-specific stem cell. Now here’s the key point: as development pro- ceeds, these tissue-specific stem cells persist. Even in adults. So why not use these adult cells, rather than embry- onic stem cells? Transplanted Tissue-Specific Stem Cells Cure MS in Mice In pathfinding 1999 laboratory experiments by Dr. Evan Snyder of Harvard Medical School, tissue-specific stem cells were able to restore lost brain tissue. He and his co- workers injected neural stem cells (immediate descendants of embryonic stem cells able to become any kind of neural cell) into the brains of newborn mice with a disease resem- bling multiple sclerosis (MS). These mice lacked the cells that maintain the layers of myelin insulation around signal- conducting nerves. The injected stem cells migrated all over the brain, and were able to convert themselves into the missing type of cell. The new cells then proceeded to repair the ravages of the disease by replacing the lost insu- lation of signal-conducting nerve cells. Many of the treated mice fully recovered. In mice at least, tissue-specific stem cells offer a treatment for MS. The approach seems very straightforward, and should apply to humans. Indeed, blood stem cells are already rou- tinely used in humans to replenish the bone marrow of can- cer patients after marrow-destroying therapy. The problem 414 Part V Molecular Genetics Once sperm cell and egg cell have joined, cell cleavage produces a blastocyst. The inner cell mass of the blastocyst develops into the human embryo. Biologists have cultured embryonic stem cells from both the inner cell mass and embryonic germ cells, which escape early differentiation. Egg Sperm Blastocyst Embryo Embryonic stem-cell culture Inner cell mass FIGURE 19.24 Using embryonic stem cells to restore damaged tissue. Embyronic stem cells can develop into any body tissue. Methods for growing the tissue and using it to repair damaged tissue in adults, such as the brain cells of multiple sclerosis patients, heart muscle, and spinal nerves, are being developed. with extending the approach to other kinds of tissue- specific stem cells is that it has not always been easy to find the kind of tissue-specific stem cell you want. Transplanted Stem Cells Reverse Juvenile Diabetes in Mice Very promising experiments carried out in 2000 by Dr. Ammon Peck and a team of researchers at the University of Florida concern a particularly vexing problem, that of type 1 or juvenile diabetes. A person with juvenile diabetes lacks insulin-producing pancreas cells, because their im- mune system has mistakenly turned against them and de- stroyed them. They are no longer able to produce enough insulin to control their blood sugar levels and must take in- sulin daily. Adding back new insulin-producing cells called islet cells has been tried many times, but doesn’t work well. Immune cells continue to destroy them. Peck and his team reasoned, why not add instead the stem cells that produce islet cells? They would be able to produce a continuous supply of new islet cells, replacing those lost to immune attack. Because there would always be cells to make insulin, the diabetes would be cured. No one knew just what such a stem cell looked like, but the researchers knew they come from the epithelial cells that line the pancreas ducts. Surely some must still lurk there unseen. So the research team took a bunch of these epithelial cells from mice and grew them in tissue culture until they had lots of them. Were the stem cells they sought present in the cell cul- ture they had prepared? Yes. In laboratory dishes the cell culture produced insulin in response to sugar, indicating islet cells had developed in the growing culture, islet cells that must have been produced from stem cells. Now on to juvenile diabetes. The scientists injected their cell culture into the pancreas of mice specially bred to develop juvenile diabetes. Unable to manufacture their own insulin because they had no islet cells, these diabetic mice could not survive without daily insulin. What happened? The diabetes was reversed! The mice no longer required insulin. Impatient to see in more detail what had happened, the researchers sacrificed the mice and examined the cells of their pancreas. The mice appeared to have perfectly normal islet cells. One might have wished the researchers waited a little longer before terminating the experiment. It is not clear whether the cure was transitory or long term. Still, there is no escaping the conclusion that injection of a culture of adult stem cells cured their juvenile diabetes. While certainly encouraging, a mouse is not a human, and there is no guarantee the approach will work in hu- mans. But there is every reason to believe it might. The ex- periment is being repeated now with humans. People suf- fering from juvenile diabetes are being treated with human pancreatic duct cells obtained from people who have died and donated their organs for research. No ethical issues arise from using cells of adult organ donors, and initial re- sults look promising. Transplanted stem cells may allow us to replace damaged or lost tissue, offering cures for many disorders that cannot now be treated. Current work focuses on tissue-specific stem cells, which do not present the ethical problems that embryonic stem cells do. Chapter 19 Gene Technology 415 For use in therapy, the embryonic stem cells are genetically engineered to match the patient's immune system: the stem cells' self-recognition genes are replaced with the patient's self-recognition genes. The stem cells are grown to produce whatever type of tissue is needed by the patient. The tissue cells are injected into the patient where needed. Once in place, the tissue cells respond to local chemical signals, adding to or replacing damaged cells. Embryonic stem cell Patient Tissue cells Patient's self-recognition genes Ethics and Regulation The advantages afforded by genetic engineering are revolu- tionizing our lives. But what are the disadvantages, the po- tential costs and dangers of genetic engineering? Many people, including influential activists and members of the scientific community, have expressed concern that genetic engineers are “playing God” by tampering with genetic material. For instance, what would happen if one frag- mented the DNA of a cancer cell, and then incorporated the fragments at random into vectors that were propagated within bacterial cells? Might there not be a danger that some of the resulting bacteria would transmit an infective form of cancer? Could genetically engineered products ad- ministered to plants or animals turn out to be dangerous for consumers after several generations? What kind of un- foreseen impact on the ecosystem might “improved” crops have? Is it ethical to create “genetically superior” organ- isms, including humans? How Do We Measure the Potential Risks of Genetically Modified Crops? While the promise of genetic engineering is very much in evidence, this same genetic engineering has this summer been the cause of outright war between researchers and protesters in England. In June 1999, British protesters at- tacked an experimental plot of genetically modified (GM) sugar beets; the following August they destroyed a test field of GM canola (used for cooking oil and animal feed). The contrast could not be more marked between American ac- ceptance of genetically modified crops on the one hand, and European distrust of genetically modified foods, on the other. The intense feelings generated by this dispute point to the need to understand how we measure the risks asso- ciated with the genetic engineering of plants. Two sets of risks need to be considered. The first stems from eating genetically modified foods, the other concerns potential ecological effects. Is Eating Genetically Modified Food Dangerous? Pro- testers worry that genetically modified food may have been rendered somehow dangerous. To sort this out, it is useful to bear in mind that bioengineers modify crops in two quite different ways. One class of gene modification makes the crop easier to grow; a second class of modification is in- tended to improve the food itself. The introduction of Roundup-resistant soybeans to Eu- rope is an example of the first class of modification. This modification has been very popular with farmers in the United States, who planted half their crop with these soy- beans in 1999. They like GM soybeans because the beans can be raised without intense cultivation (weeds are killed with Roundup herbicide instead), which both saves money and lessens soil erosion. But is the soybean that results nu- tritionally different? No. The gene that confers Roundup resistance in soybeans does so by protecting the plant's ability to manufacture so-called "aromatic" amino acids. In unprotected weeds, by contrast, Roundup blocks this man- ufacturing process, killing the weed. Because humans don't make any aromatic amino acids anyway (we get them in our diets), Roundup doesn't hurt us. The GM soybean we eat is nutritionally the same as an "organic" one, just cheaper to produce. In the second class of modification, where a gene is added to improve the nutritional character of some food, the food will be nutritionally different. In each of these in- stances, it is necessary to examine the possibility that con- sumers may prove allergic to the product of the intro- duced gene. In one instance, for example, addition of a methionine-enhancing gene from Brazil nut into soybeans (which are deficient in this amino acid) was discontinued when six of eight individuals allergic to Brazil nuts pro- duced antibodies to the GM soybeans, suggesting the pos- sibility of a reverse reaction. Instead, methionine levels in GM crops are being increased with genes from sunflowers. Screening for allergy problems is now routine. On both scores, then, the risk of bioengineering to the food supply seems to be very slight. GM foods to date seem completely safe. Are GM Crops Harmful to the Environment? What are we to make of the much-publicized report that Monarch butterflies might be killed by eating pollen blow- ing out of fields planted with GM corn? First, it should come as no surprise. The GM corn (so-called Bt corn) was engineered to contain an insect-killing toxin (harmless to people) in order to combat corn borer pests. Of course it will kill any butterflies or other insects in the immediate vicinity of the field. However, focus on the fact that the GM corn fields do not need to be sprayed with pesticide to control the corn borer. An estimated $9 billion in damage is caused annually by the application of pesticides in the United States, and billions of insects and other animals, in- cluding an estimated 67 million birds, are killed each year. This pesticide-induced murder of wildlife is far more dam- aging ecologically than any possible effects of GM crops on butterflies. Will pests become resistant to the GM toxin? Not nearly as fast as they now become resistant to the far higher levels of chemical pesticide we spray on crops. How about the possibility that introduced genes will pass from GM crops to their wild or weedy relatives? This sort of gene flow happens naturally all the time, and so this is a legitimate question. But so what if genes for resistance to Roundup herbicide spread from cultivated sugar beets to wild populations of sugar beets in Europe? Why would that be a problem? Besides, there is almost never a potential rel- ative around to receive the modified gene from the GM crop. There are no wild relatives of soybeans in Europe, for example. Thus, there can be no gene escape from GM soy- beans in Europe, any more than genes can flow from you to other kinds of animals. 416 Part V Molecular Genetics On either score, then, the risk of bioengineering to the environment seems to be very slight. Indeed, in some cases it lessens the serious environmental damage produced by cultivation and agricultural pesticides. Should We Label Genetically Modified Foods? While there seems little tangible risk in the genetic modifi- cation of crops, public assurance that these risks are being carefully assessed is important. Few issues manage to raise the temperature of discussions about plant genetic engi- neering more than labeling of genetically modified (GM) crops. Agricultural producers have argued that there are no demonstrable risks, so that a GM label can only have the function of scaring off wary consumers. Consumer advo- cates respond that consumers have every right to make that decision, and to the information necessary to make it. In considering this matter, it is important to separate two quite different issues, the need for a label, and the right of the public to have one. Every serious scientific investi- gation of the risks of GM foods has concluded that they are safe—indeed, in the case of soybeans and many other crops modified to improve cultivation, the foods themselves are not altered in any detectable way, and no nutritional test could distinguish them from "organic" varieties. So there seems to be little if any health need for a GM label for ge- netically engineered foods. The right of the public to know what it is eating is a very different issue. There is widespread fear of genetic manip- ulation in Europe, because it is unfamiliar. People there don't trust their regulatory agencies as we do here, because their agencies have a poor track record of protecting them. When they look at genetically modified foods, they are haunted by past experiences of regulatory ineptitude. In England they remember British regulators' failure to pro- tect consumers from meat infected with mad cow disease. It does no good whatsoever to tell a fearful European that there is no evidence to warrant fear, no trace of data supporting danger from GM crops. A European consumer will simply respond that the harm is not yet evident, that we don't know enough to see the danger lurking around the corner. "Slow down," the European consumers say. "Give research a chance to look around all the corners. Lets be sure." No one can argue against caution, but it is difficult to imagine what else researchers can look into— safety has been explored very thoroughly. The fear re- mains, though, for the simple reason that no amount of in- formation can remove it. Like a child scared of a monster under the bed, looking under the bed again doesn't help— the monster still might be there next time. And that means we are going to have to have GM labels, for people have every right to be informed about something they fear. What should these labels be like? A label that only says "GM FOOD" simply acts as a brand—like a POISON label, it shouts a warning to the public of lurking danger. Why not instead have a GM label that provides informa- tion to the consumer, that tells the consumer what regula- tors know about that product? (For Bt corn): The production of this food was made more efficient by the addition of genes that made plants resistant to pests so that less pesticides were required to grow the crop. (For Roundup-ready soybeans): Genes have been added to this crop to render it resistant to herbicides—this re- duces soil erosion by lessening the need for weed- removing cultivation. (For high beta-carotene rice): Genes have been added to this food to enhance its beta-carotene content and so combat vitamin A deficiency. GM food labels that in each instance actually tell con- sumers what has been done to the gene-modified crop would go a long way toward hastening public acceptance of gene technology in the kitchen. Genetic engineering affords great opportunities for progress in medicine and food production, although many are concerned about possible risks. On balance, the risks appear slight, and the potential benefits substantial. Chapter 19 Gene Technology 417 CALVIN AND HOBBES ?1995 Watterson. Dist. by Universal Press Syndicate. Reprinted with permission. All rights reserved. 418 Part V Molecular Genetics Chapter 19 Summary Questions Media Resources 19.1 The ability to manipulate DNA has led to a new genetics. ? Genetic engineering involves the isolation of specific genes and their transfer to new genomes. ? An important component of genetic engineering technology is a special class of enzymes called restriction endonucleases, which cleave DNA molecules into fragments. ? The first such recombinant DNA was made by Cohen and Boyer in 1973, when they inserted a frog ribosomal RNA gene into a bacterial plasmid. 1. Why do the ends of the DNA fragments created by restriction endonucleases enable fragments from different genomes to be spliced together? ? Genetic engineering experiments consist of four stages: isolation of DNA, production of recombinant DNA, cloning, and screening for the gene(s) of interest. ? Preliminary screening can be accomplished by making the desired clones resistant to an antibiotic; hybridization can then be employed to identify the gene of interest. ? Gene technologies, including PCR, Southern blotting, RFLP analysis, and the Sanger method, enable researchers to isolate genes and produce them in large quantities. 2. Describe the procedure used to eliminate clones that have not incorporated a vector in a genetic engineering experiment. 3. What is used as a probe in a Southern blot? With what does the probe hybridize? How are the regions of hybridization visualized? 19.2 Genetic engineering involves easily understood procedures. ? Extensive research on the human genome has yielded important information about the location of genes, such as those that may be involved in dyslexia, obesity, and resistance to high blood cholesterol levels. ? Gene splicing holds great promise as a clinical tool, particularly in the prevention of disease with bioengineered vaccines. ? A major focus of genetic engineering activity has been agriculture, where genes conferring resistance to herbicides or insect pests have been incorporated into crop plants. ? Recent experiments open the way for cloning of genetically altered animals and suggest that human cloning is feasible. ? The impact of genetic engineering has skyrocketed over the past decade, providing many useful innovations for society; its moral and ethical aspects still provide a topic for heated debates. 4. What is the primary vector used to introduce genes into plant cells? What types of plants are generally infected by this vector? Describe three examples of how this vector has been used for genetic engineering, and explain the agricultural significance of each example. 5. How is the genetic engineering of bovine somatotropin (BST) used to increase milk production in the dairy industry? What effect would BST in milk have on persons who drink it? 19.3 Biotechnology is producing a scientific revolution. www.mhhe.com www.biocourse.com ? Experiment: Cohen/Boyer/Berg- The first Genetically Engineered Organism ? Student Research: Homeobox Genes in the Medicinal Leech ? Polymerase Chain Reaction ? Recombinant ? On Science Article: How Genetic Engineering is Done ? Exploration: DNA from Real Court Cases On Science Articles: ? The Real Promise of Plant Genetic Engineering ? Should We Label Genetically Modified Foods? ? Measuring Risks of Genetically Modified Crops ? The Search for the Natural Relatives of Cassava ? Renouncing the Terminator ? Frankenstein Grass is Poised to Invade my Back Yard ? The Road to Dolly ? Should a Clone Have Rights? ? Who Should Own the Secrets of Your Genes? 419 Catching evolution in action A hundred years ago Charles Darwin’s theory of evolution by natural selection was taught as the foundation of biology in public schools throughout the United States. Then something happened. In the 1920s, conservative religious groups began to argue against the teaching of evolution in our nation's schools. Darwinism, they said, contradicted the revealed word of God in the Bible and thus was a direct attack on their religious beliefs. Many of you will have read about the 1925 Scopes "monkey trial" or seen the move about it, Inherit the Wind. In the backwash of this contro- versy, evolution for the first time in this century disap- peared from the schools. Textbook publishers and local school boards, in a wish to avoid the dispute, simply chose not to teach evolution. By 1959, 100 years after Darwin's book, a famous American geneticist cried in anguish, "A hundred years without Darwin is enough!" What he meant was that the theory of evolution by natural selection has be- come the central operating concept of the science of biol- ogy, organic evolution being one of the most solidly vali- dated facts of science. How could we continue to hide this truth from our children, crippling their understanding of science? In the 1970s, Darwin reappeared in our nation's schools, part of the wave of concern about science that followed Sputnik. Not for long, however. Cries from creationists for equal time in the classroom soon had evolution out of our classrooms again. Only in recent years, amid considerable uproar, have states like California succeeded in reforming their school curriculums, focusing on evolution as the cen- tral principle of biology. In other states, teaching Darwin remains controversial. While Darwin’s proposal that evolution occurs as the result of natural selection remains controversial in many local school boards, it is accepted by practically every biol- ogist who has examined it seriously. In this section, we will review the evidence supporting Darwin’s theory. Evolu- tionary biology is unlike most other fields of biology in which hypotheses are tested directly with experimental methods. To study evolution, we need to investigate what happened in the past, sometimes many millions of years ago. In this way, evolutionary biology is similar to astron- omy and history, relying on observation and deduction rather than experiment and induction to examine ideas about past events. Nonetheless, evolutionary biology is not entirely an ob- servational science. Darwin was right about many things, but one area in which he was mistaken concerns the pace at which evolution occurs. Darwin thought that evolution occurred at a very slow, almost imperceptible, pace. How- ever, in recent years many case studies of natural popula- tions have demonstrated that in some circumstances evolu- tionary change can occur rapidly. In these instances, it is possible to establish experimental studies to directly test evolutionary hypotheses. Although laboratory studies on fruit flies and other organisms have been common for more than 50 years, it has only been in recent years that scientists have started conducting experimental studies of evolution in nature. To conduct experimental tests of evolution, it is first nec- essary to identify a population in nature upon which strong selection might be operating (see above). Then, by manipu- lating the strength of the selection, an investigator can pre- dict what outcome selection might produce, then look and see the actual effect on the population. Part VI Evolution The evolution of protective coloration in guppies. In pools below waterfalls where predation is high, guppies are drab colored. In the absence of the highly predatory pike cichlid, guppies in pools above waterfalls are much more colorful and attractive to females. The evolution of these differences can be experimentally tested.